casein kinase 1 delta phosphorylates tau and disrupts its binding

Casein Kinase 1 Delta Phosphorylates Tau and Disrupts Its Binding to Microtubules

Guibin Li‡, Haishan Yin§, and Jeff Kuret‡║

From the ‡Center for Molecular Neurobiology; §Ohio State Biochemistry Program, and

║Department of Molecular and Cellular Biochemistry, Ohio State University College of

Medicine and Public Health, Columbus, Ohio 43210

To whom correspondence should be addressed: Jeff Kuret, Ph.D. Center for Neurobiotechnology 1060 Carmack Rd. Columbus, OH 43210 Phone (614) 688-5899 Fax: (614) 292-5379 Email: [email protected] Running title: Tau Phosphorylation by CK1 in situ Keywords: Tau protein, Alzheimer’s disease, microtubules, Tubulin, protein phosphorylation, protein kinase, Casein kinase 1

1

by guest on April 4, 2018

http://ww

w.jbc.org/

Dow

nloaded from

mailto:[email protected]

http://www.jbc.org/

Abstract

Tau hyperphosphorylation precedes neuritic lesion formation in Alzheimer’s disease, suggesting

it participates in the tau fibrillization reaction pathway. Candidate tau protein kinases include

members of the casein kinase 1 (CK1) family of phosphotransferases, which are highly over-

expressed in Alzheimer’s disease brain and colocalize with neuritic and granulovacuolar lesions.

Here we characterized the contribution of one CK1 isoform, Ckiδ, to the phosphorylation of tau

at residues S202/T205 and S396/S404 in human embryonic kidney-293 cells using immunodetection

and fluorescence microscopy. Treatment of cells with membrane permeable CK1 inhibitor 3-

[(2,3,6-trimethoxyphenyl)methylidenyl]-indolin-2-one (IC261) lowered occupancy of S396/S404

phosphorylation sites by >70% at saturation, suggesting that endogenous CK1 was the major

source of basal phosphorylation activity at these sites. Overexpression of Ckiδ increased CK1

enzyme activity and further raised tau phosphorylation at residues S202/T205 and S396/S404 in situ.

Inhibitor IC261 reversed tau hyperphosphorylation induced by Ckiδ overexpression. Co-

immunoprecipitation assays showed direct association of tau and Ckiδ in situ, consistent with tau

being a Ckiδ substrate. Ckiδ overexpression also produced a decrease in the fraction of bulk tau

bound to detergent-insoluble microtubules. These results suggest that Ckiδ phosphorylates tau at

sites that modulate tau/microtubule binding, and that the expression pattern of Ckiδ in

Alzheimer’s disease is consistent with it playing an important role in tau aggregation.

2


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Introduction

AD1 is a progressive neurodegenerative disease characterized in part by the appearance of

neurofibrillary tangles (NFTs), neuritic plaques, and neuropil threads (1). Each manifestation of

neuritic pathology is comprised of tau protein aggregated into filaments. Because the spatial

distribution of tau fibrillization appears stereotypically, correlates with neuronal cell loss, and

parallels cognitive decline, it is a useful marker of and may contribute to degeneration in AD and

other dementias.

Tau fibrillization is accompanied by extensive phosphorylation on over twenty-five distinct

sites (2,3), some of which function to modulate the ability of tau to bind and stabilize

microtubules (4,5). Candidate enzymes for catalyzing the hyperphosphorylation of tau protein in

disease include members of the CK1 family of protein kinases, which in mammals consist of at

least seven isoforms derived from distinct genes including Ckiα, β, γ1, γ2, γ3, δ and ε (6-10).

Each isoform shares a highly conserved N-terminal catalytic domain (11) with diverse C-

terminal domains of variable lengths. CK1 family members phosphorylate cytoskeletal proteins

such as spectrin, troponin, myosin, ankyrin, tau, and α-synuclein (12-17), but also non-

cytoskeletal proteins such as SV40 T antigen (18), p53 (14,19) and β-catenin (20).

Phosphorylation of these substrates is thought to modulate diverse physiological functions such

as vesicular trafficking, DNA repair, cell cycle progression, and cytokinesis (21).

CK1 levels appear to be regulated within the cell. For example, Ckiδ levels are elevated in

both AD brain (22,23) and the spinal cords of a murine model of amyotropic lateral sclerosis

(24). Moreover, isoforms Ckiα and Ckiδ associate with the neurofibrillary lesions of AD

(25,26), the pathological hallmarks in AD and other tauopathic neurofibrillary degenerations

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

diseases. These observations led to the hypothesis that CK1 enzymes regulate tau

phosphorylation in vivo, and that their upregulation in level or activity contributes to tau

hyperphosphorylation in disease (22).

Here we test this hypothesis by examining the ability of one CK1 isoform, Ckiδ, to

phosphorylate tau under basal and overexpression conditions in situ. The data suggests that CK1

activity makes a major contribution to basal levels of tau phosphorylation, and that Ckiδ can

modulate microtubule stability by direct interaction with tau protein.

4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Experimental Procedures

Materials. Polyclonal antibody against the C-terminus of p35 (C-19) was purchased from Santa

Cruz Biotechnology (Santa Cruz, CA), whereas monoclonal antibodies AT8, Tau5, PHF1, and

128A were obtained from Endogen (Woburn, MA), Dr. L.I. Binder, Northwestern University

Medical School, Dr. Peter Davies, Einstein College of Medicine, and ICOS Corp. (Bothell, WA),

respectively. Monoclonal anti-α-tubulin antibody (27), taxol, and protease inhibitors (1x

complete contained: 1 mM 4-(2-aminoethyl)-bezenesulfonylfluoride, 0.8 µM aprotinin, 40 µM

bestatin, 20 µM leupeptin, 15 µM pepstatin A, 14 µM L-transepoxysuccinyl-leucylamido-[4-

guanidino]butane, and 26 µM N-acetyl-leu-leu-norleu-al) were obtained from Sigma/Aldrich

Chemicals (St. Louis, MO). HEK-293 cells were purchased from ATCC (Manassas, VA),

TransFastTM Transfection Reagent from Promega (Madison, WI), inhibitor IC261 from

CalBiochem (San Diego, CA), and purified bovine brain tubulin from Cytoskeleton (Denver,

CO).

Recombinant Proteins. Recombinant htau40 containing a His6 tag was expressed and purified

as described (28). Poly-His free recombinant htau40 was prepared the same way, except that E.

coli expression was from vector pET-14b (EMD Biosciences, San Diego, CA), and protein

isolated from IMAC was digested 20 h at 4°C with thrombin prior to repetition of IMAC and gel

filtration chromatography.

Human brain Ckiδ cDNA served as template for PCR amplification of C-terminal truncated

Ckiδ (Ckiδ-∆317. The sense primer (5’-ACGGATCCCATATGGAGCTGAGAGTC)

incorporated an NdeI site at the start codon, whereas the downstream primer (5’-

CTCGAGTTAGTGTCTCCAGCCGCTC) contained a TTA stop codon downstream of the

5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

codon for His317 followed by an XhoI site. The amplified PCR product was subcloned directly

into TOPO2.1 (Invitrogen, Carlsbad, CA) and sequenced in both directions for errors. The Ckiδ-

∆317-TOPO2.1 cDNA was digested with NdeI and XhoI, the approximate 0.9 kb Ckiδ-∆317

fragment was gel purified and subcloned into E. coli expression vector PT7C (28). Recombinant

Ckiδ-∆317 was purified by IMAC and gel filtration chromatography as described previously for

tau protein (28).

Cell Culture, Transfection, and Treatment. cDNAs encoding the longest human tau isoform

(htau40), human Ckiδ, or p25 (an activator of Cdk5) were cloned into the mammalian CMV

expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA). HEK-293 cells, which were

maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% bovine

serum, 100 U/ml penicillin G, 250 ng/ml amphotericin B, and 100 µg/ml streptomycin (37°C

with 5% CO2), were transiently transfected with these plasmids (5 µg per 60 mm dish) using

TransFastTM reagent according to the manufacturer’s instructions.

To generate a cell line stably expressing human htau40 (stable tau cells), 5 µg of tau-

pcDNA3.1 plasmid was linearized with BglII and transfected into HEK-293 cells. Forty h after

transfection, cells were cultured in selective medium containing 500 µg/ml G418.

To assay CK1 inhibitor IC261, tau stable cells treated with different IC261 concentrations

were harvested after 30, 60, 120, 240, and 480 min of incubation. IC261 was stored as a 50 mM

stock solution in DMSO and diluted to a working stock of 1 mM in H2O before treatment.

To assess toxicity of various treatments, cells were stained with DNA-specific fluorochrome

Hoechst 33258 (Molecular Probes, Eugene, OR) and examined under fluorescence for chromatin

condensation (29). Cells with uniformly distributed chromatin were scored as "viable."

Immunoprecipitation. Cells were harvested and disrupted in Lysis Buffer [20 mM Tris-HCl

6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

pH 7.4, 140 mM NaCl, 1 mM PMSF, 1 mM Na3NO4, 10 mM NaF, 0.5% (v/v) Nonidet-40, 1

mM EDTA, and 1x complete protease inhibitors], and cell debris was removed by centrifugation

(10 min x 10,000g) at 4oC. Protein concentrations were determined using the Coomassie blue

binding method with bovine serum albumin as standard (30). For immunoprecipitation

experiments, extracts (500 µg) were incubated with 2 µg of each monoclonal antibody examined

(anti-Ckiδ, 128A; anti-tau, Tau5; anti-p25) for 2 h at 4oC. Protein G-agarose beads [60 µl of

25% (w/v) slurry] were then added to the samples and incubation continued for 1 h at 4oC. The

resultant immunocomplexes were collected by centrifugation, washed three times with Lysis

Buffer, and subjected to immunoblot or in vitro protein kinase assays as described below.

Immunoblot Analysis. Aliquots of cell lysates (20 - 40 µg) or immunocomplexes derived from

immunoprecipitation experiments were boiled in SDS-PAGE Loading Buffer (1x buffer

contained 48 mM Tris-HCl, pH 6.8, 7.5% glycerol, 1.8% SDS, and 3.8% 2-mercaptoethanol),

separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes. After 1 h in

Blocking Buffer (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, pH 8.0, 0.1% Tween-20, 5% nonfat

milk), membranes were incubated with primary antibody for 2 h at room temperature followed

by 1 h with secondary antibody (horseradish peroxidase-conjugated anti-rabbit or anti-mouse

IgG). Immunoreactivity was detected by enhanced chemiluminescence, collected on x-ray film,

and finally quantified on a BioRad GS-800 calibrated laser densitometer.

In Vitro Protein Kinase Assay. Purified protein kinase (Ckiδ-∆317) or immunocomplexes

derived from immunoprecipitation experiments were incubated with 2 µg of htau40 in 20 µl of

Kinase Buffer (50 mM Tris, 200 µM ATP, and 1 mM DTT) at 37°C for up to 4 h. When

necessary, reactions were supplemented with 1.25 µCi [γ-32P]ATP. All reactions were stopped

by addition of 10 µl of 4x SDS-PAGE Loading Buffer. Following SDS-PAGE, gels were

7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

subjected to immunoblot analysis as described above or stained and dried for autoradiography

using a Molecular Imager FX Pro Plus multi-imager system (BioRad).

RNA Interference. Sequence specific post-transcriptional silencing of selected genes was

initiated by transfection of HEK-293 cells with double stranded RNA oligonucleotides

(synthesized by Dharmacon, Lafayette, CO). Ckiδ/ε isoforms were silenced with RNA duplexes

consisting of oligonucleotides 5’-CUGGGGAAGAAGGGCCdTdT and 5’-

GGUUGCCCUUCCCCAGdTdT (31). RNA duplexes targeting luciferase, a non-mammalian

protein found in fireflies, were used to control for nonspecific effects of siRNA transfection.

These oligonucleotides, termed GL2, consisted of sense (5’-CGU

ACGCGGAAUACUUCGAdTdT) and antisense (5’-UCGAAGUAUUCCGCGUACGdTdT)

components (32). GL2 or Ckiδ/ε siRNA duplexes (5 µg) were transfected into stable tau cells

using TransFastTM reagents for 48 h. Levels of Ckiδ, tau, and phospho-tau were then quantified

by immunoblot analysis performed on cell lysates (30 µg protein) as described above.

Microtubule-Binding Assay. To assay the ability of tau to bind microtubules in situ, HEK-293

cells transfected with pcDNA3.1/tau or Ckiδ/tau for 24 h were harvested in 500 µl Microtubule-

Stabilizing Buffer (80 mM PIPES, pH 6.8, 1 mM GTP, 1 mM MgCl2, 1 mM EGTA, 0.5% Triton

X-100, 30% glycerol, and 1x complete protease inhibitors) in the presence of 10 µM taxol at

37°C. After cell debris was removed by centrifugation (10,000g for 10 min) at 37°C,

supernatant fractions were collected and centrifuged again at 100,000g for 1 h at 35°C (5). The

resultant pellets (P1) were washed twice with and resuspended (500 µl) in Microtubule-

Stabilizing Buffer, sonicated for 10 s, and then subjected along with 100,000g supernatants (S1)

to SDS-PAGE and immunoblot analysis as described above.

To assay the ability of tau to bind microtubules in vitro, tubulin (1 mg/ml) was first

8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

assembled in Microtubule Assembly Buffer (80 mM PIPES, pH 6.8, 1 mM MgCl2, 1 mM EGTA,

1 mM GTP) containing 10 µM taxol for 30 min at 30°C. Resultant microtubules were then

incubated (37°C for 30 min) with supernatants (S1; 500 µg) from the in situ microtubule binding

assays described above, and then harvested by centrifugation (100,000g for 1 h at 25°C). Pellet

fractions (P2) were resuspended in Microtubule-Assembly Buffer so that their final volumes

equaled those of supernatant fractions (S2). Equal amounts of supernatant (S2) and pellet (P2)

fractions were then analyzed by SDS-PAGE and the distribution of tau protein examined by

immunoblot analysis using monoclonal antibody Tau5.

Cell Extraction and Immunoflorescence Staining. Wild-type HEK-293 cells were cultured on

coverslips for 24 h and transfected with Ckiδ/tau or PcDNA3.1/tau for 24 h as described above.

To extract soluble proteins, cells were washed with PBS and incubated with Microtubule-

Stabilizing Buffer containing 10 µM taxol for 2 min at room temperature. Cells were washed

once with Microtubule-Stabilizing Buffer without detergent. Both the extracted cells and non-

extracted cells were fixed with methanol. Following the PBS washes, cells were sequentially

incubated with PBS containing 3% BSA for 1 h, Tau5 antibody (1:1000) overnight at 4°C, and

fluorescein-labeled goat anti-mouse IgG secondary antibody (1:1000) for 1 h. Immunostaining

was visualized by fluorescence microscopy (Eclipse 800, Nikon, Japan), captured with a SPOT II

digital camera (Diagnostic Instruments, Inc., Sterling Heights, MI), and processed with

Metamorph imaging software (Universal Imaging Corp., Downingtown, PA).

Analytical Methods. Hyperbolic inhibition curves were fit to the rectangular hyperbola:

xb

axy+

=

where y is immunoreactivity determined at inhibitor concentration x, and constant b corresponds

to x at 50% ymax (i.e., IC50).

9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

10

Probability values were determined by student’s t test for single comparison and one-way

ANOVA with Tukey’s post hoc test for multiple comparisons. All analyses were performed

using the InStat Software program.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

11

Results

Ckiδ Phosphorylates tau in vitro. To determine whether Ckiδ could directly phosphorylate tau,

a truncated form of the human enzyme (Ckiδ-∆317) was expressed and purified as a His6-fusion

protein and used to phosphorylate tau protein in vitro. Truncated enzyme was used because it

was easily prepared after heterologous expression in E. coli while retaining the protein kinase

activity of full-length protein (33). Incubation of htau40 with purified Ckiδ-∆317 in the presence

of radioactive nucleotide substrate led to detectable phosphate incorporation within 30 min (Fig.

1A). Detection of total tau protein on Western blots using monoclonal antibody Tau5, the

reactivity of which is not phosphorylation dependent (28), revealed a substantial electrophoretic

mobility shift by 4 h incubation (Fig. 1B). These slowly migrating tau species were strongly

labeled by monoclonal antibodies AT8 and PHF1, which selectively bind phospho-tau residues

S202/T205 (34) and S396/S404 (35), respectively. These data show that CK1 isoform Ckiδ could

directly phosphorylate tau protein, and that monoclonal antibodies AT8 and PHF1 could be used

as probes for Ckiδ-mediated phosphorylation reactions.

Ckiδ Phosphorylates tau in situ. To determine whether Ckiδ could modulate tau

phosphorylation in situ, HEK-293 cells were transiently transfected with plasmids encoding

htau40 and either Ckiδ, p25 (an activator of Cdk5), or empty pcDNA vector. Transfection times

of 24 h were employed because cells remained viable during this time frame in all studies

reported herein (data not shown). Cdk5 activator p25 was included because of its ability to

activate endogenous Cdk5 in situ (36) and therefore serve as an alternate source of tau

hyperphosphorylation activity. Total tau protein was detected with monoclonal antibody Tau5

whereas phospho-tau was detected with antibodies AT8 and PHF1. All cells transfected with

htau40 constructs contained detectable levels of tau protein (Fig. 2A). When these cells were co-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

12

transfected with empty vector (i.e, in the absence of exogenous protein kinase), a portion of total

tau was PHF1 and AT8 positive, reflecting basal levels of tau phosphorylation. Basal levels of

Ckiδ also were substantial in these cells as demonstrated by Western analysis using monoclonal

antibody 128A. However, cotransfection with DNA constructs encoding Ckiδ significantly

increased the amounts of both Ckiδ and phopho-tau detectable by both the AT8 and PHF1

antibodies (Fig. 1A). These data recapitulate the pattern seen in vitro (Fig. 1A) and suggest that

Ckiδ overexpression significantly increased tau phosphorylation in situ (Fig. 2B). Expression of

p25 also induced a large increase tau phosphorylation, primarily owing to the absence of

endogenous p25 in non-transfected cells (Fig. 2B).

To confirm that the increased levels of Ckiδ observed upon overexpression were

accompanied by increases in phosphotransferase activity, Ckiδ was immunoprecipitated and

subjected to in vitro kinase assays using htau40 and [γ-32P]ATP as substrates 24 h after transient

transfection with Ckiδ/tau or pcDNA3.1/tau constructs. Radioactive assay reaction products

were separated by SDS-PAGE, stained with Coomassie blue, and visualized on a

phosphoimager. Although CK1 activity was found in both the Ckiδ/tau overexpressing and

pcDNA3.1/tau control cells (Fig. 3A), quantitation of the data showed that Ckiδ overexpression

led to ~2-fold increases in recoverable phosphotransferase activity (Fig. 3B). These data

confirmed that Ckiδ overexpression lead to increased Ckiδ activity within HEK-293 cells, but

also showed that significant levels of Ckiδ activity were present under basal conditions.

Ckiδ and tau Directly Interact in situ. The Ckiδ-mediated tau phosphorylation observed in

HEK-293 cells could be direct or arise from an indirect protein phosphorylation cascade. To

distinguish these alternatives, tau and Ckiδ were separately immunoprecipitated from stable tau

cells and subjected to Western analysis using monoclonal antibodies 128A or Tau5. Results


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

13

showed that tau and Ckiδ coimmunoprecipitated in both experimental paradigms (Fig. 4C and

D). These data suggest that tau associates with Ckiδ in situ, and therefore potentially serves as a

direct substrate for Ckiδ-mediated phosphorylation reactions.

To determine the region of Ckiδ involved in binding tau protein, htau40 (non His6-tagged)

was incubated with or without truncation mutant Ckiδ-∆317 in vitro and immunoprecipitated

with antibody 128A. Subsequent Western analysis with antibodies 128A and Tau5 confirmed

direct association between truncated Ckiδ and htau40 (Fig. 4B). These data suggest that at least

a portion of the amino acid sequences mediating direct binding of Ckiδ to tau protein are located

in the protein kinase catalytic domain.

CK1 Inhibitor IC261 Reverses Tau Hyperphosphorylation Induced by Ckiδ

Overexpression. IC261 is a small molecule, membrane permeable, ATP-competitive inhibitor

of CK1 isoforms including Ckiδ (14,37). To determine whether inhibitor treatment could

selectively reverse Ckiδ-mediated tau hyperphosphorylation, HEK-293 cells were co-transfected

with Ckiδ/tau, P25/tau, or pcDNA3.1/tau for 24 h, treated with and without IC261 treatment (10

µM for 30 min), and then probed for phospho- and total tau levels with antibodies PHF1, AT8,

and Tau5. The resultant Western blots showed that IC261 inhibited tau phosphorylation induced

by Ckiδ overexpression without affecting expression levels of Ckiδ (Fig. 5A). Inhibition was

selective for CK1, as shown by the failure of IC261 to significantly modulate tau

phosphorylation induced by p25 overexpression (Fig. 5B). These findings are consistent with

the inhibitory selectivity of IC261 determined both in vitro and in situ (37,38), and confirm the

utility of IC261 for inhibition of CK1 activity in culture. Moreover, they suggest that CK1-

mediated tau phosphorylation is opposed by endogenous phosphoprotein phosphatase activity


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14

that can decrease occupancy of phosphorylation sites in response to IC261 over time courses as

short as 30 min.

Endogenous CK1 contribues to basal levels of tau phosphorylation. The above data showed

that basal levels of both Ckiδ and phospho-tau were substantial in HEK-293 cells expressing tau

protein, and were consistent with previous studies showing that phosphorylation sites S396 and

S202 were partially occupied in both stable and transiently transfected 3T3, CHO, and SH-SY5Y

cells (39-41). To assess the contribution of endogenous Ckiδ activity to basal levels of tau

phosphorylation, an HEK-293 cell line stably expressing htau40 was generated and employed in

two experimental approaches. First, the dependence of tau phosphorylation on activity

contributed by all CK1 isoforms was estimated by treating stable tau-HEK-293 cells with

varying concentrations of IC261. In the absence of inhibitor, significant amounts of tau were

detectable in this cell line, with a portion being PHF1 reactive (Fig. 6A). Although addition of

IC261 for 30 min did not change total tau levels (i.e., detectable with antibody Tau5), it did

result in large decreases in levels of phospho-tau detected by antibody PHF1 (Fig. 6A).

Inhibition of tau phosphorylation was dose dependent, with an IC50 of 1.5 ± 0.5 µM and up to

71.9 ± 7.5% of PHF1 reactivity at saturation (Fig. 6B). In vitro, IC261 has been shown to inhibit

purified recombinant Ckiδ with an IC50 of 1.1 ± 0.1 µM and 98.1 ± 3.2% of activity at saturation

(Fig. 6B; data replotted from Fig. 1 of Ref. 37). These data suggest that CK1 activity makes a

major contribution to basal levels of tau phosphorylation in HEK-293 cells.

As a second approach, the specific contribution of CK1 isoforms Ckiδ/ε to basal tau

phosphorylation was assessed by siRNA-mediated downregulation conducted 48 h after

transfection. RNA interference promotes hydrolysis of targeted mRNA in a sequence-specific

reaction (42,43). The levels of total tau, phosphorylated tau and Ckiδ were then detected by


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

15

immunoblot analysis as a negative control, siRNA oligonucleotides selective for luciferase

(GL2) were employed. Compared to GL2 treatment, Ckiδ/ε siRNA lowered Ckiδ levels ~30%

48 h after transfection and decreased phosphorylated tau about 25% as well (Fig. 7B). RNA

interference did not change the expression levels of total tau (Fig. 7A). These data indicate that

either downregulating Ckiδ activity or its protein level decreases tau phosphorylation, and

suggests that Ckiδ/ε contributes at least a portion of the basal CK1 activity detectable in HEK-

293 cells.

Ckiδ-mediated Tau Phosphorylation Disrupts Microtubule Binding. The microtubule-

binding activity of tau protein is modulated by phosphorylation (4,5). To assess the effect of

Ckiδ-induced phosphorylation on tau/tubulin interactions, HEK-293 cells transiently co-

transfected with Ckiδ/tau or pcDNA/tau constructs were examined by fluorescence microscopy

after extraction with detergent in the presence of taxol (a microtubule stabilizing agent). In the

absence of extraction, total tau immunofluorescence in both Ckiδ/tau or pcDNA/tau transfections

were similar, again demonstrating that Ckiδ overexpression did not markedly change tau levels

over the time course of the experiment (Fig. 8A). But in detergent extracted cells, which

retained a detergent-insoluble cytoskeleton, levels of tau immunofluorescence were significantly

lower in the presence of Ckiδ (Ckiδ/tau transfection) than in its absence (pcDNA/tau

transfection). These data suggested that the fraction of detergent-stable (i.e., microtubule-

associated) tau decreased in response to phosphorylation induced by Ckiδ overexpression.

To confirm these findings, HEK-293 cells transiently co-transfected with Ckiδ/tau or

pcDNA/tau for 24 h were detergent extracted, fractionated into soluble (S1) and particulate (P1)

fractions (the latter containing microtubules), and subjected to Western analysis using antibodies

Tau5 and PHF1. Phospho-tau (detected by PHF1) was found exclusively in the soluble fraction,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

16

with greater amounts recovered from cells transfected with Ckiδ/tau than with pcDNA/tau (Fig.

8B). In contrast, significant amounts of total tau (detected by Tau5) were recovered in both

particulate and soluble fractions (Fig. 8B). However, the subcellular distribution of total tau

shifted toward the soluble pool in cells transfected with Ckiδ/tau compared to pcDNA/tau cells

(Fig. 8C).

Together these data suggest that the microtubule-binding activity of tau decreases in response

to Ckiδ-mediated phosphorylation. To test this hypothesis, soluble tau prepared from each of the

cell populations described above (fraction S1) was subjected to in vitro microtubule binding

assays. Results showed that a portion of soluble tau from pcDNA/tau cells retained an ability to

associate with synthetic microtubules (Fig. 8D), consistent with tau overexpression leading to

saturation of endogenous microtubules. In contrast, soluble tau prepared from Ckiδ/tau cells was

almost devoid of microtubule-binding activity (Fig. 8D), despite accumulating to higher levels

than in control extracts (Fig. 8C,D). These data suggest that the accumulation of soluble tau

observed in situ upon Ckiδ-overpression results from phosphorylation of tau protein at sites that

directly modulate microtubule binding.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

17

Discussion

CK1 Isozymes and tau Phosphorylation. Owing to its natively unfolded structure and high

complement of hydroxyamino acids, tau is an efficient substrate for many protein kinases in vitro

(44), including tissue-derived CK1 activity (13,16). Here it was found that CK1 serves as a tau

protein kinase in situ as well. First, studies with selective inhibitor IC261 showed that over 70%

of basal tau phosphorylation at S396/S404 sites in HEK-293 cells stems from CK1 activity.

Supporting this conclusion, the IC50 for IC261 in situ was only slightly higher than the value

determined in vitro with purified Ckiδ. Moreover, the IC261 inhibition isotherm was consistent

with a single class of binding site. Because IC261 inhibits most CK1 isoforms with similar

potency (37), basal levels of tau phosphorylation could potentially result from the activity of

multiple CK1 isoforms. But the decrease in phospho-tau accompanying downregulation of

Ckiδ/ε using RNA interference suggests that these specific isoforms compose at least a portion

of IC261-sensitive tau phosphorylation activity under basal conditions. Indeed, Ckiδ and tau

could be co-immunoprecipitated from stable tau cells containing only basal levels of Ckiδ.

These data demonstrate that tau and Ckiδ directly associate in situ, and are consistent with their

colocalization to microtubules (16).

Second, overexpression of Ckiδ increased tau phosphorylation at sites it phosphorylated in

vitro. Again, IC261 totally reversed the tau hyperphosphorylation induced by Ckiδ

overexpression. However, the recognition sequence mediating the substrate selectivity of Ckiδ is

not understood in the context of tau phosphorylation. On the basis of studies with short peptides,

CK1 isoforms are phosphotropic kinases that recognize the motif S/T(P)XXS/T (45,46).

Nonetheless, priming of substrates with phosphate is not a strict requirement, and motifs


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

18

consisting of acidic residues N- or C-terminal to the phosphorylatable residue also are

phosphorylated by CK1 (20,47,48). Although our in vitro data showing that Ckiδ

phosphorylated recombinant tau at S202/T205 and S396/S404 is consistent with a previous study

showing that tissue-derived CK1 activity phosphorylates tau at T231, S396/S404 (17), the

relationship between these sites and the motifs summarized above is weakly apparent only for

S396/S404. It appears that recognition of full-length tau as substrate differs from that of short

peptides. In any event, phosphorylation of tau at S202/S205 and S396/S404 by Ckiδ does not require

priming by other protein kinases.

Consequences of CK1-mediated tau Phosphorylation. Tau protein binds and stabilizes

microtubules (49). However, this microtubule stabilizing function is regulated by its

phosphorylation state. For example, hyperphosphorylated tau from AD brain binds to

microtubules weakly (50,51), but strong binding can be restored after dephosphorylation (4).

Thus, the stability of the axonal cytoskeleton may be influenced the equilibrium between tau

phosphorylation and dephosphorylation. Phosphorylation sites that mediate this activity include

S199, S202, S231, T205, S396, and S404 (5,52). Ckiδ phosphorylates most of these sites in situ, and as

a result tau/microtubule equilibrium shifts markedly toward free tau in response to Ckiδ

overexpression. Similar shifts have been observed following Cdk5/p25, GSK3β, or PKA

induced phosphorylation of tau (5,36,53-56). Moreover, Cdk5/p39-induced tau phosphorylation

reduces its affinity for microtubules during development in a transgenic mouse model (57).

These data suggest that control of microtubule stability may involve common phosphorylation

sites that are differentially regulated through the action of multiple protein kinases.

Role of tau Phosphorylation in Disease. The pathway through which tau fibrillizes in disease

is not entirely clear but appears to begin with amorphous aggregation of tau protein into non-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

19

fibrillar deposits (58). Phosphorylation can play a major role in this process, by modulating the

equilibrium between microtubule-bound and free populations as discussed above. In vitro,

elevated concentrations of phospho-tau promotes amorphous aggregation (59). In vivo,

amorphous deposits, frequently in conjunction with intracellular membranes, are where the

earliest beta-sheet enriched species are detectable using fluorescent dyes (60). Studies with

synthetic inducers of tau fibrillization have revealed the existence of a partially folded, thioflavin

S-positive intermediate in the reaction pathway, the formation of which appears to be essential

for fibrillization (61). Therefore, the key roles of tau phosphorylation in early stage disease

appear to be modulation of the tau/microtubule equilibrium to raise intracellular concentrations

of free tau, and promotion of amorphous aggregation from which assembly competent

intermediates can form. Consistent with this model, extensive hyperphosphorylation of tau in

COS cells leads to thioflavin-S positive deposits that are not fibrillar in appearance and contain

only modest amounts of tau filaments (40).

CK1 in Disease. The properties of CK1 isoforms are consistent with a role in disease. First, as

shown here, CK1 composes the bulk of basal tau phosphorylation activity in HEK-293 cells, and

phosphorylates tau on sites that modulate tau function. These observations are consistent with

Ckiδ and tau being resident on microtubules (16). Second, CK1 isoforms correlate spatially with

neurofibrillary lesions in both AD (22) and other tauopathies (26), and appear as major

components in preparations of authentic, disease-derived filaments (25). One isoform, Ckiδ, is a

particularly robust marker of granulovacuolar degeneration bodies (22). Thus CK1 is associated

with more than one lesion in AD. Third, the appearance of CK1-positive lesions correlates

temporally with memory decline in longitudinal studies of AD, suggesting that CK1 is as

powerful a marker of AD progression as is tau (62). Finally, levels of at least one CK1 isoform,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20

Ckiδ, are greatly increased in postmortem AD tissue (22). Unlike tau protein, overexpression of

Ckiδ is observable at the mRNA level (23), suggesting that accumulation does not result solely

from sequestration with insoluble proteinaceous inclusions. In situ, Ckiδ expression increases in

response to drug- or γ-irradiation- induced genotoxic stress suggesting DNA damage as a

potential mechanism for the elevated levels seen in AD (19,63). Further study of Ckiδ

expression in AD will be required to clarify this issue.

Despite these properties, CK1 is but one of several protein kinases capable of

phosphorylating tau in situ. GSK3β and Cdk5 also physically associate with tau within cells (64)

and can modulate tau phosphorylation in transgenic animal models (65,66). GSK3β most

prominently catalyzes phosphorylation at S202, S235, S396, S404 (55), whereas Cdk5/p25 has been

shown to phosphorylate tau at T181, S202, T205, T212, T217, S396, and S404 (54,67,68). Thus GSK3β

and Cdk5/p25 potentially join CK1 in modulating tau/microtubule equilibrium (69). Although

the potential interplay among these enzymes is unknown, it is interesting to note that GSK3β

functions primarily as a phosphate-directed protein kinase dependent on priming of substrates by

other protein kinases (70). Because of its strong contribution to basal tau phosphorylation state

and inducibility in response to stress, CK1 could potentially provide priming activity as it does

with β-catenin phosphorylation (71). Yet CK1 also recognizes primed substrates as in the case

of p53 (72), and in this substrate recognition mode could potentially further amplify disease-

associated phosphorylation of sites found tightly clustered around the microtubule repeat region

(2,3).

Finally, we note that CK1 phosphorylates proteins in addition to tau in vivo. In the cases of

p53 (72), β-catenin (73), multidrug transporter Pdr5p (74), Hedgehog signaling effector Cubitus

interruptus (75), and proteins involved in circadian rhythm control (76), CK1-mediated


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

21

phosphorylation modulates protein turnover. This function may be part of the neuronal response

to stress, accounting for both the induction of CK1 in AD and its presence in granulovacuolar

degeneration bodies. Thus CK1-mediated tau phosphorylation may result from an attempt by the

cell to modulate protein turnover in response to cellular distress.

Acknowledgments

The authors thank Dr. Rick Dobrowsky, University of Kansas, for providing the p25-pCDNA

construct, Dr. Peter Davies, Albert Einstein College of Medicine, for providing PHF1 antibody,

and Dr. Lester I. Binder for providing monoclonal antibody Tau5.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

22

References

1. Buee, L., Bussiere, T., Buee-Scherrer, V., Delacourte, A., and Hof, P. R. (2000) Brain

Res. Brain Res. Rev. 33, 95-130

2. Hanger, D. P., Betts, J. C., Loviny, T. L., Blackstock, W. P., and Anderton, B. H. (1998)

J. Neurochem. 71, 2465-2476

3. Morishima-Kawashima, M., Hasegawa, M., Takio, K., Suzuki, M., Yoshida, H.,

Watanabe, A., Titani, K., and Ihara, Y. (1995) Neurobiol. Aging 16, 365-371; discussion

371-380

4. Bramblett, G. T., Goedert, M., Jakes, R., Merrick, S. E., Trojanowski, J. Q., and Lee, V.

M. (1993) Neuron 10, 1089-1099

5. Wagner, U., Utton, M., Gallo, J., and Miller, C. (1996) J. Cell Sci. 109, 1537-1543

6. Fish, K. J., Cegielska, A., Getman, M. E., Landes, G. M., and Virshup, D. M. (1995) J.

Biol. Chem. 270, 14875-14883

7. Graves, P., Haas, D., Hagedorn, C., DePaoli-Roach, A., and Roach, P. (1993) J. Biol.

Chem. 268, 6394-6401

8. Rowles, J., Slaughter, C., Moomaw, C., Hsu, J., and Cobb, M. H. (1991) Proc. Natl.

Acad. Sci. U.S.A. 88, 9548-9552

9. Zhai, L., Graves, P. R., Robinson, L. C., Italiano, M., Culbertson, M. R., Rowles, J.,

Cobb, M. H., DePaoli-Roach, A. A., and Roach, P. J. (1995) J. Biol. Chem. 270, 12717-

12724

10. Kitabayashi, A. N., Kusuda, J., Hirai, M., and Hashimoto, K. (1997) Genomics 46, 133-

137


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23

11. Xu, R. M., Carmel, G., Sweet, R. M., Kuret, J., and Cheng, X. (1995) EMBO J. 14, 1015-

1023

12. Simkowski, K., and Tao, M. (1980) J. Biol. Chem. 255, 6456-6461

13. Singh, T., Grundke-Iqbal, I., and Iqbal, K. (1995) J. Neurochem. 64, 1420-1423

14. Behrend, L., Milne, D. M., Stoter, M., Deppert, W., Campbell, L. E., Meek, D. W., and

Knippschild, U. (2000) Oncogene 19, 5303-5313

15. Okochi, M., Walter, J., Koyama, A., Nakajo, S., Baba, M., Iwatsubo, T., Meijer, L.,

Kahle, P. J., and Haass, C. (2000) J. Biol. Chem. 275, 390-397

16. Behrend, L., Stoter, M., Kurth, M., Rutter, G., Heukeshoven, J., Deppert, W., and

Knippschild, U. (2000) Eur. J. Cell Biol. 79, 240-251

17. Singh, T. J., Zaidi, T., Grundke-Iqbal, I., and Iqbal, K. (1996) Mol. Cell. Biochem. 154,

143-151

18. Cegielska, A., Gietzen, K. F., Rivers, A., and Virshup, D. M. (1998) J. Biol. Chem. 273,

1357-1364

19. Knippschild, U., Milne, D. M., Campbell, L. E., DeMaggio, A. J., Christenson, E.,

Hoekstra, M. F., and Meek, D. W. (1997) Oncogene 15, 1727-1736

20. Marin, O., Bustos, V. H., Cesaro, L., Meggio, F., Pagano, M. A., Antonelli, M., Allende,

C. C., Pinna, L. A., and Allende, J. E. (2003) Proc. Natl. Acad. Sci. U.S.A. 100, 10193-

10200

21. Gross, S., Simerly, C., Schatten, G., and Anderson, R. (1997) J. Cell Sci. 110, 3083-3090

22. Ghoshal, N., Smiley, J. F., DeMaggio, A. J., Hoekstra, M. F., Cochran, E. J., Binder, L.

I., and Kuret, J. (1999) Am. J. Pathol. 155, 1163-1172


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

24

23. Yasojima, K., Kuret, J., DeMaggio, A. J., McGeer, E., and McGeer, P. L. (2000) Brain

Res. 865, 116-120

24. Hu, J. H., Chernoff, K., Pelech, S., and Krieger, C. (2003) J. Neurochem. 85, 422-431

25. Kuret, J., Johnson, G. S., Cha, D., Christenson, E. R., DeMaggio, A. J., and Hoekstra, M.

F. (1997) J. Neurochem. 69, 2506-2515

26. Schwab, C., DeMaggio, A. J., Ghoshal, N., Binder, L. I., Kuret, J., and McGeer, P. L.

(2000) Neurobiol. Aging 21, 503-510

27. Blose, S. H., Meltzer, D. I., and Feramisco, J. R. (1984) J. Cell Biol. 98, 847-858

28. Carmel, G., Mager, E. M., Binder, L. I., and Kuret, J. (1996) J. Biol. Chem. 271, 32789-

32795

29. McGinty, A., Chang, Y. W., Sorokin, A., Bokemeyer, D., and Dunn, M. J. (2000) J. Biol.

Chem. 275, 12095-12101

30. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254

31. Eide, E. J., Vielhaber, E. L., Hinz, W. A., and Virshup, D. M. (2002) J. Biol. Chem. 277,

17248-17254

32. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T.

(2001) Nature 411, 494-498

33. Graves, P. R., and Roach, P. J. (1995) J. Biol. Chem. 270, 21689-21694

34. Goedert, M., Jakes, R., and Vanmechelen, E. (1995) Neurosci. Lett. 189, 167-169

35. Otvos, L., Jr., Feiner, L., Lang, E., Szendrei, G. I., Goedert, M., and Lee, V. M. (1994) J.

Neurosci. Res. 39, 669-673

36. Patrick, G. N., Zukerberg, L., Nikolic, M., de la Monte, S., Dikkes, P., and Tsai, L. H.

(1999) Nature 402, 615-622


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

25

37. Mashhoon, N., DeMaggio, A. J., Tereshko, V., Bergmeier, S. C., Egli, M., Hoekstra, M.

F., and Kuret, J. (2000) J. Biol. Chem. 275, 20052-20060

38. Liu, F., Ma, X.-H., Ule, J., Bibb, J. A., Nishi, A., DeMaggio, A. J., Yan, Z., Nairn, A. C.,

and Greengard, P. (2001) PNAS 98, 11062-11068

39. Hamdane, M., Sambo, A. V., Delobel, P., Begard, S., Violleau, A., Delacourte, A.,

Bertrand, P., Benavides, J., and Buee, L. (2003) J. Biol. Chem. 278, 34026-34034

40. Sato, S., Tatebayashi, Y., Akagi, T., Chui, D. H., Murayama, M., Miyasaka, T., Planel,

E., Tanemura, K., Sun, X., Hashikawa, T., Yoshioka, K., Ishiguro, K., and Takashima, A.

(2002) J. Biol. Chem. 277, 42060-42065

41. Sygowski, L. A., Fieles, A. W., Lo, M. M., Scott, C. W., and Caputo, C. B. (1993) Brain

Res. Mol. Brain Res. 20, 221-228

42. Vickers, T. A., Koo, S., Bennett, C. F., Crooke, S. T., Dean, N. M., and Baker, B. F.

(2003) J. Biol. Chem. 278, 7108-7118

43. Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001) Genes Dev. 15, 188-200

44. Mandelkow, E. M., Biernat, J., Drewes, G., Gustke, N., Trinczek, B., and Mandelkow, E.

(1995) Neurobiol. Aging 16, 355-362; discussion 362-353

45. Flotow, H., Graves, P. R., Wang, A. Q., Fiol, C. J., Roeske, R. W., and Roach, P. J.

(1990) J. Biol. Chem. 265, 14264-14269

46. Flotow, H., and Roach, P. J. (1991) J. Biol. Chem. 266, 3724-3727

47. Marin, O., Meggio, F., and Pinna, L. A. (1994) Biochem. Biophys. Res. Comm. 198, 898-

905

48. Pulgar, V., Marin, O., Meggio, F., Allende, C. C., Allende, J. E., and Pinna, L. A. (1999)

Eur. J. Biochem. 260, 520-526


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

26

49. Goedert, M. (1993) Trends Neurosci. 16, 460-465

50. Busciglio, J., Lorenzo, A., Yeh, J., and Yankner, B. A. (1995) Neuron 14, 879-888

51. Sontag, E., Nunbhakdi-Craig, V., Bloom, G. S., and Mumby, M. C. (1995) J. Cell Biol.

128, 1131-1144

52. Sontag, E., Nunbhakdi-Craig, V., Lee, G., Bloom, G. S., and Mumby, M. C. (1996)

Neuron 17, 1201-1207

53. Wada, Y., Ishiguro, K., Itoh, T. J., Uchida, T., Hotani, H., Saito, T., Kishimoto, T., and

Hisanaga, S. (1998) J. Biochem. (Tokyo) 124, 738-746

54. Evans, D. B., Rank, K. B., Bhattacharya, K., Thomsen, D. R., Gurney, M. E., and

Sharma, S. K. (2000) J. Biol. Chem. 275, 24977-24983

55. Utton, M. A., Vandecandelaere, A., Wagner, U., Reynolds, C. H., Gibb, G. M., Miller, C.

C., Bayley, P. M., and Anderton, B. H. (1997) Biochem. J. 323, 741-747

56. Scott, C., Spreen, R., Herman, J., Chow, F., Davison, M., Young, J., and Caputo, C.

(1993) J. Biol. Chem. 268, 1166-1173

57. Takahashi, S., Saito, T., Hisanaga, S.-i., Pant, H. C., and Kulkarni, A. B. (2003) J. Biol.

Chem. 278, 10506-10515

58. Bancher, C., Brunner, C., Lassmann, H., Budka, H., Jellinger, K., Wiche, G.,

Seitelberger, F., Grundke-Iqbal, I., Iqbal, K., and Wisniewski, H. M. (1989) Brain Res.

477, 90-99

59. Alonso, A. C., Grundke-Iqbal, I., and Iqbal, K. (1996) Nat. Med. 2, 783-787

60. Galvan, M., David, J. P., Delacourte, A., Luna, J., and Mena, R. (2001) J. Alzheimers

Dis. 3, 417-425

61. Chirita, C. N., and Kuret, J. (2004) Biochemistry 43, in press


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

27

62. Ghoshal, N., Garcia-Sierra, F., Wuu, J., Leurgans, S., Bennett, D. A., Berry, R. W., and

Binder, L. I. (2002) Exp. Neurol. 177, 475-493

63. Knippschild, U., Milne, D., Campbell, L., and Meek, D. (1996) Oncogene 13, 1387-1393

64. Sun, W., Qureshi, H. Y., Cafferty, P. W., Sobue, K., Agarwal-Mawal, A., Neufield, K.

D., and Paudel, H. K. (2002) J. Biol. Chem. 277, 11933-11940

65. Lucas, J. J., Hernandez, F., Gomez-Ramos, P., Moran, M. A., Hen, R., and Avila, J.

(2001) EMBO J. 20, 27-39

66. Spittaels, K., Van den Haute, C., Van Dorpe, J., Geerts, H., Mercken, M., Bruynseels, K.,

Lasrado, R., Vandezande, K., Laenen, I., Boon, T., Van Lint, J., Vandenheede, J.,

Moechars, D., Loos, R., and Van Leuven, F. (2000) J. Biol. Chem. 275, 41340-41349

67. Lund, E. T., McKenna, R., Evans, D. B., Sharma, S. K., and Mathews, W. R. (2001) J.

Neurochem. 76, 1221-1232

68. Hashiguchi, M., Sobue, K., and Paudel, H. K. (2000) J. Biol. Chem. 275, 25247-25254

69. Cho, J. H., and Johnson, G. V. (2003) J. Biol. Chem. 278, 187-193

70. Harwood, A. J. (2001) Cell 105, 821-824

71. Amit, S., Hatzubai, A., Birman, Y., Andersen, J. S., Ben-Shushan, E., Mann, M., Ben-

Neriah, Y., and Alkalay, I. (2002) Genes Dev. 16, 1066-1076

72. Sakaguchi, K., Saito, S., Higashimoto, Y., Roy, S., Anderson, C. W., and Appella, E.

(2000) J. Biol. Chem. 275, 9278-9283

73. Gao, Z. H., Seeling, J. M., Hill, V., Yochum, A., and Virshup, D. M. (2002) Proc. Natl.

Acad. Sci. U.S.A. 99, 1182-1187

74. Decottignies, A., Owsianik, G., and Ghislain, M. (1999) J. Biol. Chem. 274, 37139-37146

75. Price, M. A., and Kalderon, D. (2002) Cell 108, 823-835


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

28

76. Kloss, B., Price, J. L., Saez, L., Blau, J., Rothenfluh, A., Wesley, C. S., and Young, M.

W. (1998) Cell 94, 97-107


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29

Footnotes

*This work was supported by National Institutes of Health grant AG14452 (to J.K.)

1The abbreviations used are: AD, Alzheimer's disease; Cdk5, cyclin-dependent kinase 5; CK1,

casein kinase 1; Ckiδ-∆317, C-terminal truncated Ckiδ; DMSO, dimethyl sulfoxide; GSK3β,

glycogen synthase kinase-3β; his6, polyhistidine tag; HEK, human embryonic kidney; IC261, 3-

[(2,3,6-trimethoxyphenyl)methylidenyl]-indolin-2-one; IMAC, immobilized metal affinity

chromatography; siRNA, small interfering RNA.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

30

Figure legends

Fig. 1. Ckiδ phosphorylates tau at S202, T205, S396, and S404 in vitro. Recombinant His6-tagged

htau40 (0.2 mg/ml) was incubated in the presence or absence of Ckiδ-∆317 (50 ng) under

phosphorylating conditions and subjected to SDS-PAGE and Western analysis. A, after 30 min

at 37°C in the presence of [γ-32P]ATP, phospho-tau could be detected by phosphorimaging.

However, total tau as detected by Coomassie blue (CB) staining of SDS gels shows essentially

no band shift. The bottom panel shows Ckiδ-∆317 detected with monoclonal antibody 128A

antibody. B, after 4 h at 37°C, total tau as detected with monoclonal antibody Tau5 shows a

marked band shift. Phospho-tau species were detected by monoclonal antibodies PHF1 and

AT8, suggesting that, at a minimum, Ckiδ-∆317 phosphorylated sites S202, T205, S396, and S404 on

htau40.

Fig. 2. Ckiδ induces tau phosphorylation in situ. HEK-293 cells transiently co-transfected

(24 h) with p25/tau, Ckiδ/tau, and empty pcDNA vector/tau were harvested, lysed, and subjected

to immunoblot analysis using monoclonal antibodies AT8, PHF1, Tau5, 128A, or C-19. A, cells

transfected with empty vector showed measurable basal levels of phospho-tau and Ckiδ but not

of p25. Transfection of cells with Ckiδ or cdk5 activator p25 significantly increased phospho-

tau over basal levels. B, total tau (Tau5 epitope) and phospho-tau (PHF1 epitope) levels were

quantified densitometrically from three individual experiments. When normalized for total tau

content, phospho-tau was found to increase significantly with both p25 and Ckiδ transfection. *,

p < 0.01; **, p < 0.001 when compared to empty vector control.

Fig. 3. In vitro kinase assay. HEK-293 cells transiently transfected (24 h) with Ckiδ/tau or

empty vector/tau were harvested, lysed, and subjected to immunoprecipitation assays using anti-


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31

Ckiδ antibody 128A. Ckiδ immunocomplexes from Ckiδ/tau (lane 1) or from empty vector/tau

(lane 2) were then incubated in vitro with His6-htau40 and [γ-32P]ATP for 30 min and subjected

to SDS-PAGE. A, phospho-tau detected by phosphorimaging shows that transfection with Ckiδ

increased immunoprecipitable Ckiδ activity (32P), which correlated with levels of Ckiδ protein

(128A). Bottom panel shows total tau detected by Coomassie blue staining. B, quantitative data

from three independent experiments presented as mean ± S.E. **, p < 0.001 compared with

empty vector control.

Fig. 4. Ckiδ associates with tau in situ. Lysates (Lys) prepared from stable tau or wild-type

HEK-293 cells were immunoprecipitated with anti-tau (Tau5) or anti-Ckiδ (128A) monoclonal

antibodies as described in Experimental Procedures and subjected to immunoblot analysis using

A, 128A or B, Tau5 as probes. A, both wild-type and stable tau cells contained Ckiδ that could

be immunoprecipitated with 128A. B, in contrast, only stable tau cells contained detectable tau

protein after immunoprecipitation with Tau5. Ckiδ and tau coimmunoprecipitated with either

128A or Tau5 antibodies in stable tau cells, suggesting direct association in situ. C, htau40 (1

µg/ml) without His6 tag incubated (4°C overnight) with or without truncation mutant Ckiδ-∆317

(1 µg/ml) in Lysis Buffer was immunoprecipitated with antibodies Tau5 or 128A and subjected

to immunoblot analysis with anti-tau (Tau5) and anti-Ckiδ (128A) antibodies. Tau and Ckiδ-

∆317 coimmunoprecipitated under these conditions, suggesting direct interaction between tau

and the catalytic domain of Ckiδ in vitro.

Fig. 5. IC261 inhibits tau phosphorylation induced by Ckiδ. HEK-293 cells transiently

transfected (24 h) with tau/p25, tau/Ckiδ, or empty vector/tau were treated with either 10 µM

IC261(IC), or vehicle control (Con) for an additional 30 min. Cell lysates were then prepared


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

32

and subjected to SDS-PAGE (30 µg/lane). A, representative immunoblots using monoclonal

antibodies AT8, PHF1 Tau5, 128A, and C-19 show that IC261 inhibited basal and Ckiδ-induced

tau phosphorylation without modulating the levels of total tau or Ckiδ. In contrast, neither p25

levels nor p25-induced tau phosphorylation was significantly affected by IC261. B, phospho-tau

levels were quantified by densitometry from three independent experiments, normalized to levels

of total tau, and plotted as percent phospho-tau in untreated, empty vector/tau transfected cells.

**, p < 0.01 compared with untreated empty vector/tau transfected cells. ##, p < 0.01 compared

with untreated Ckiδ/tau transfected cells.

Fig. 6. CK1 inhibitor IC261 decreases tau phosphorylation. A, stable tau cells were grown to

80% confluence and then incubated with 0, 1, 3, or 10 µM inhibitor IC261 for 30 min. All

reactions were controlled for DMSO, the vehicle for IC261. Treated cells were harvested, lysed,

and subjected to SDS-PAGE. A, representative immunoblots probed with monoclonal antibodies

PHF1, Tau5, and 128A. IC261-mediated inhibition of phospho-tau levels (i.e, PHF1

immunoreactivity) was concentration dependent. B, phospho-tau levels were quantified by

densitometry, normalized to levels of total tau, and plotted as percent inhibition, where 0%

inhibition corresponds to PHF1 immunoreactivity in the absence of IC261. Each point

represents mean ± S.E. of four independent experiments, whereas the line represents best fit of

the data to a rectangular hyperbola ( ). IC261 inhibited tau phosphorylation (PHF1 epitope)

with an IC50 of 1.5 ± 0.5 µM. This value is very similar to the IC50 determined in vitro for Ckiδ

(1.1 ± 0.1 µM; data from Ref. 37; ).

Fig. 7. siRNA decreases tau phosphorylation. Stable tau cells transfected (48 h) with 5 µg of

siRNA selective for Ckiδ or luciferase (GL2) were harvested, lysed, and subjected to SDS-

PAGE (30 µg/lane). A, representative immunoblots probed with monoclonal antibodies PHF1,


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

33

Tau5, and 128A. Treatment with Ckiδ siRNAs decreased levels of Ckiδ and phospho-tau (PHF1

epitope) but not total tau (Tau5 epitope) relative to GL2 control. B, phospho-tau and Ckiδ levels

were quantified by densitometry and plotted as percent GL2 control. Each bar represents the

mean ± S.E. of 3 independent experiments. *, p < 0.05, compared with GL2 control.

Fig. 8. Ckiδ induced tau phosphorylation decreases tau binding to microtubule. A, HEK-

293 cells transiently transfected (24 h) with either a,c, empty vector/tau or b,d, Ckiδ/tau were

harvested and washed with either a,b, PBS or c,d, Microtubule-Stabilizing Buffer. All cells were

then fixed with methanol and immunostained with monoclonal antibody Tau5. a,b, in the

absence of detergent extraction, no change in tau immunofluorescence was observed with Ckiδ

overexpression, showing that transfection of cells with Ckiδ did not change total tau levels. c,d,

in detergent extracted cells, however, expression of Ckiδ led to decreased tau association with

detergent insoluble cytoskeletons. These data are consistent with a migration of tau from

detergent-insoluble to detergent-soluble fractions of the cell in response to Ckiδ overexpression.

B, HEK-293 cells transfected (24 h) with pcDNA/tau or Ckiδ/tau were harvested, lysed, and

separated into soluble (S1) and pellet (P1) fractions by centrifugation as described in

Experimental Procedures. Total (Tau5 epitope), phospho-tau (PHF1 epitope), and α-tubulin

levels were then detected by immunoblot analysis. In pcDNA/tau cells, tau was found

distributed between soluble and particulate fractions. In Ckiδ/tau, however, tau distribution

shifted toward the soluble pool, consistent with a decrease in microtubule association. C, total

tau levels in particulate and soluble fractions were quantified by densitometry. Each bar

represents the mean ± S.E. of 4 independent experiments (**, p < 0.01 compared with empty

vector/tau control). D, microtubule-binding assays were performed using taxol-stabilized

microtubules prepared in vitro and equal volumes of the soluble, cell-derived fractions (S1)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

34

described above. After centrifugation, the resultant pellet (P2; containing microtubules) and

supernatant (S2) fractions were analyzed for Tubulin by SDS-PAGE (Coomassie blue) and total

tau (Tau5) by immunoblotting. Whereas a portion of soluble tau prepared from cells transfected

with pcDNA/tau was capable of binding microtubules, soluble tau prepared from Ckiδ/tau cells

was almost devoid of microtubule-binding activity.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Guibin Li, Haishan Yin and Jeff KuretCasein kinase 1 delta phosphorylates Tau and disrupts its binding to microtubules

published online February 2, 2004J. Biol. Chem.

10.1074/jbc.M314116200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M314116200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M314116200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/02/02/jbc.M314116200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2004/02/02/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2004/02/02/jbc.M314116200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

casein kinase 1 delta phosphorylates tau and disrupts its binding

Documents