brg may 2014
DESCRIPTION
Volume 4 / Issue 5TRANSCRIPT
OPENING DAY
HanginG
BasketS
springproduce
VEGGIE
StartS
MeaT CheesE
& EggS
sATURDAYMAY 3RD........................8AM - 1:30 PM
beavertonfarmersmarket.com
FREE Community Paper, Take One! Volume 4 | Issue 5 | May 2014
www.BeavertonResourceGuide.com
• What’s the Beaverton Police doing in Bangladesh? Find out on page 2
• What’s a Cascara? It’s Beaverton’s native plant of the month! See page 15
• Have you eaten at La Hacienda Real? We have! See our review on page 19
• Is your child creative? Submit a poem & drawing for our Kids Corner. See page 32
• Veggie Hunt Contest! Win a $25 gift certificate to Black Bear Diner! See page 32
• Wh t’ th B t P li d i i BB l d h??Wh t’ th B t P li d i i B l Fi d t 2
What's Happening this Month in Beaverton?
Cover Art
Farmers Market(See pages 26-27)
Hi
There!
2 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Co
nte
nts
Chief's MessageChief's Message
BEAVERTON, OREGON, USAAverage rainfall: 36.3 inches per year
City size: 18.7 square miles
Coordinates: N 45º 29.14 / W 122º 47.84 (latitude / longitude)
Elevation above sea level:• Low: 131.7 feet above sea level
(at the Progress Ridge Rock Quarry / Murray-Scholls Transit Center area)
• Average: 189 feet above sea level
• High: 698.2 feet (just north of Hwy. 26 and Camelot Ctr)
First Settled: 1847 by Augustus Fanno
Location: Seven miles west of Portland, Oregon
Median family income: $71,303 (2009)
Population: 91,205
MAYOR & CITY COUNCILMayor: Denny Doyle Council: Catherine Arnold, Betty Bode, Ian King, Marc San Soucie, Mark Fagin
MEETINGS Tuesdays, 6:30pm City Council meetings are held in the Forrest C. Soth Council Chambers in City Hall and open to the public. For the most up to date agenda and materials call 503-526-2222 or visit: www.beavertonoregon.gov.
USEFUL NUMBERSBeaverton Recycling ........................................503-526-2665Beaverton School District ................................503-591-8000 Chamber of Commerce ................................... 503-644-0123 City Hall ............................................................503-526-2222 City of Beaverton (Water) ................................503-526-2257 Hazardous Waste Disposal (Metro) ................ 503-797-1700 Oregon DMV ....................................................503-299-9999 Oregon Ecycle ..................................................888-532-9253 NW Natural (Gas) ............................................. 503-226-4211 PGE (Electricity) ...............................................800-743-5000 Police (Non-Emergency) .................................503-526-2260 Waste Management (Trash) ............................800-808-5901
BRG HistoryThe Beaverton Resource Guide (BRG) is a free monthly community paper written, edited and published in Beaverton, by Beaverton residents and for the businesses and people of Beaverton, Oregon, USA. Cedar House Media published the first edition in April of 2011 featuring local businesses, community news, and the Farmers Market. That first issue was 16 pages. Today, the paper is 32 pages and sponsored by a diverse cross section of public and private community organizations.
BRG GoalsBeaverton has so many positive attributes and many go unnoticed. The BRG is our way of giving back to the community by highlighting what makes our city a great place to live, work and shop. With a focus on small, local businesses, we’d like to encourage our neighbors to first visit nearby stores and give them a chance before moving on to businesses outside our community.
BRG AdvertisingWith our unique layout, colorful design and exclusive community content, our readers are beyond loyal. Not only do they want to know "What's Happening in Beaverton This Month" but they also agree with our philosophy of: "Shop Local - Give Local - Stay Local."
As a business in the Beaverton area, your ad will be seen by those who are most willing to go out of their way to keep their dollars close to home. These shoppers, your potential new customers, also happen to be our best readers! In addition, we don’t print massive quantities and mail them out to uninterested parties. Our papers are located in convenient and high traffic locations ready to be picked up by those who love Beaverton. With low rates, targeted distribution and a willingness to provide more value than what you pay for, you'll find that we're just as interested in stretching your advertising dollar as you are!
Publisher / Executive Editor Cory Burden
Content Editor / Advertising Michael Wong
Graphic Design Audrey Moran
Cartoonist Ralph Scheeler
WritersContact
"The Beaverton Resource Guide is a vibrant snapshot of the Beaverton Community."
Marie Prins, Washington County Visitors Association
Chief Geoff SpauldingMark TwainFox 12 StaffTVFR StaffCity Staff
Oregon Zoo StaffAnn KoppyMark Hyde
Ginger RapportGreg MattieBob Strong
Brigid FitzpatrickSpencer RubinJolene Guptill
Larry FergusonHailee Meacham
Laila MottaghiStevie Freeman Montes
Katie WilsonJim BrooksBill Evans
Karen BadiGinger RapportCelia Lambert
Dan HortchKristie cox
Beverlee RyanChelsea Ploof
Last Month’s Cover ArtBy Ralph Scheeler
Questions or comments? Email us:
4575 SW Tucker Ave. Beaverton, OR 97005
503.641.3320
“Yes ma’am, new to the farmers
market i AM... specializing in
fruit fLavored bark chips,
100% Organic!“
Over the past few months, the Beaverton Police
Department has part-nered with the Portland Police Bureau in their Bangladesh Community Police Partnership Program. Thanks to funding from the United States Department of Justice International Criminal Investigative Training Assistance Program, the program is
Bangladesh each year to enhance the United States’ ability to build positive, enduring relationships with developing nations that improve long-term internal secu-rity and enhance goodwill. Police
and citizens community policing
strategies, assist them with imple-mentation, provide hands-on
instruction, modeling and mentoring to the cities of
Rajshahi and Sardah.
their responsibilities of policing in a democratic society, how to utilize citizens as an element of police effectiveness,
investigative techniques and strategies, supervi-
sory and leadership and human rights. To date, the
Beaverton Police Department
currently in-country and another
This has been a very rewarding and eye opening experience for our department and one that the
teaching others.
Welcome! (Chief’s Message) .......................................................................... 2
Shop Beaverton (Local Businesses) ..........................................................3-13
Our Town (Community News) ..............................................................14-25
Just for Fun (What’s Happening This Month in Beaverton?) ...............................26-32
Cedar Hills Crossing 3
Advertising Bulletin Board 4-6, 8, 21
Announcements 5-6
Maps 8-10
Business Directory 7-13
Thrive! Beaverton Business 14
Sustainable Beaverton 15
KPTV Channel 12 16
Beaverton History 17
Local Eats & Treats 18-19
Cruisin’ Beaverton 20-21
Automotive/Traffic Q&A 20-21
TVF&R 21
THPRD 22
Senior News 23
Oregon Zoo 24
Teen Thinking 25
Beaverton Farmers Market 26-27
City Library 29
Happy Hour Listings 29
Washington Country Event Calendar 30
Theatre & Movies 30-31
Beaverton Kid’s Corner 32
May “Easter Egg” Hunt Contest 32
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 3Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
C e d a r H i l l s C r o s s i n g
Massage, Waxing & Facialswww.handandstone.com
503-626-8200Mall Information
3205 SW Cedar Hills Blvd 503-643-6563
www.cedarhillscrossing.com
Vegg
ie G
rill
T-M
obile
Past
ini P
asta
ria
McGrath’sFish House
Bask
inRo
bbin
s
Bankof the West
US
Bank
SW
Wal
ker
Rd
SW
Jenkin
s Rd
SW
Hal
l Blv
d
SW H
ocken
Rd
SW Cedar Hills Crossing Blvd
State Farm
Labor Max
Thai Imports
Vogue Nails
Cedar Hills Salon
Mr. Formal
Subway
Bugatti’s
McMenamin’sPub
Entr
ance
Entrance
Entrance
13475 SW Millikan Way
Catalyst
Chiropractic
Hair MTanRepublic
Virgina GarciaMedical Center
Roxy’sIslandGrill
MOD Pizza VerizonZoomCare(Coming Soon)
OnP
oint
(Com
ing
Soon
)
Fire
hous
e Su
bs
Life
Way
PaneraBread
ULTA
PacS
un
Star
buck
s --
Mac
Sto
re --
Veriz
on --
---Fa
mou
sFo
otw
ear
NEW Stores & Restaurants Coming Soon!
Visit These Stores
INSIDEthe Mall!
A Lil'Sumpin' Sumpin'
AT&T Wireless
Beaverton Ballroom
BedCo
BG Pizza
Claire’s Boutique
Cold Stone Creamery
Game Trader
GNC
HairMasters
L&L Hawaiian BBQ
Merle Norman
MLY Jewelry
Peachwave (Frozen Yogurt)
Powell’s Books
Substunce
Sunflower Beauty
Teaser’s Top Shop
Thai Noodle Etc.
Top Shopping USA
Visionworks
Weight Watchers
971-238-4409
503-924-1819
503-274-9040
503-430-7277
971-238-4409
503-644-9142
503-352-3880
503-641-5511
503-626-8484
503-644-1835
503-726-0770
503-469-0884
971-238-4659
503-746-7729
503-228-4651
971-238-4460
503-644-9190
503-526-8970
503-941-9112
Coming Soon!
503-646-7995
800-651-6000
1-800-FANDANGO + 984#call Fandango today for movie listings. www.fandango.com
Opening Soon
ZoomCare
OnPoint Credit Union
Top Shopping USA
Now Open
Firehouse Subs
Verizon (New Location)
MOD Pizza
Events
Children’s Safety FairSaturday, May 3rd, 11am-1pmActivities include children hel-met inspections, children helmet replacements (if needed), bike safety course, basic bike safe-ty checks and adjustments, face painting! All free while supplies last! Bring your bike and helmet with you! Generously presented by NW Bicycle Safety Fair, Bea-verton Police, The Sports Author-ity. Meet us inside the Mall.
Mother’s Day FREE Gift with Purchase
Friday & Saturday, May 9 & 10, 12pm-6pmFREE Mother’s Day Gift with Pur-chase - a FREE Manicure! Simply present $75 in same day sales receipts from any combination of Cedar Hills Crossing stores/restaurants to the Gift Booth INSIDE the mall to receive your FREE Mother’s Day Gift, a certif-icate for a free manicure! While supplies last!
Sports Card ShowSaturday, May 10th, 10am-4pmThe Twin Oaks Sports Card Show will be held throughout the inte-rior mall on Saturday, May 10th, 10am-4pm. Stop by the check out the large inventory of sports cards and memorabilia.
Radio Disney EventSaturday, May 17th, 11:30am-1pmIt’s a Disney Junior Party! Come dressed as your favorite Disney Junior Character and join Radio Disney for games, music, danc-ing, prizes and a Sherriff Callie Craft Station.
Kid’s Club EventTuesday, May 27th, 5pm-6:30pmJoin us for Kid’s Club! Not a member? That’s ok! Children 12 years of age and younger are always invited to join the fun! To become a member and receive advance notice on event activi-ties, simply sign up on the “Kid’s Club” tab at top of page!
Mon-Sat: 10 - 9, Sun: 11 - 7 www.powells.com
503-228-4651
Children’s Safety Fair11 am - 1 pm • inside the mall
Saturday, May 3
» FREE Children Helmet Fitting Checks
» FREE Children Helmets (if replacement needed)
» FREE Bike Safety Course
» FREE Basic Bike Safety Check & Adjustments
» FREE Face Painting
A special thank you to all of our generous sponsors! NW Bicycle Safety Council, Beaverton Police, The Sports Authority.
3205 SW Cedar Hills Blvd, Beaverton
(while supplies last)
ents
e
Bring your bike and helmet!
4 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
(1835-1910)
“Under certain circumstances, profanity provides a relief denied even to prayer.”
“Of all the animals, man is the only one that is cruel. He is the only one that inflicts pain for the pleasure of doing it.”
“I’ve had a lot of worries in my life, most of which never happened.”
“Go to heaven for the climate and hell for the company.”
“I do not fear death. I had been dead for billions and billions of years before I was born, and had not suffered the slightest inconvenience from it.”
“The reports of my death are greatly exaggerated.”
Get a bicycle. You will not regret it, if you live.
“Always do right. This will gratify some people and astonish the rest.”
“Life is short, break the rules, forgive quickly, kiss slowly, love truly, laugh uncontrollably, and never regret anything that made you smile. Twenty years from now you will be more disappointed by the things you didn’t do than by the ones you did. So throw off the bowlines. Sail away from the safe harbor. Catch the trade winds in your sails. Explore. Dream. Discover.”
Samuel Langhorne Clemens, better known by his pen name Mark Twain, was an American author and humorist. He wrote The Adventures of Tom Sawyer and its sequel, Adventures of Huckleberry Finn, the latter often called “the Great American Novel.”
We have 1 bedrooms from $715, 2 bedrooms from $965
www.OverlookatMurrayhill.com
Drop on by and you’ll also find:
Please call us at
Heated year-round swimming poolSmoke free community
Assigned parking & more!
Conveniently located near Murrayhill Marketplace
(503)579-9326
Protecting your health and property since 1949!A local family owned & operated business.
Birds Insects & Spiders Rodents
(503) 646-2119GuaranteedPestControl.net Please call for an estimate (CCB #43186).
503-591-9031
1st Appointment Specials!Residential: Stove & refridgerator cleaned for FREE!Commercial: Floors (stripping/waxing/buffing) or carpets for FREE!
Commercial / Residential High Quality Service at Affordable Prices!
503-591-9031Cell: 503-933-6239 / Fax: 503-591-5800
Professional Cleaning Services
Call for a free estimate (Bonded & Insured!)www.craterlakejanitorial.com
Call us for FREE estimates: 503-330-2137
CC
B# 202354
Commercial & Residential Yard Work Cleanup, Bark, Hedges, Trees, Roof, Gutter, Pressure Wash, Retain Walls, French Drain, Fences, Gravel, Ivy/Junk Removal and more!
Shop Beaverton
$299 $399$149
SAVE UP TO 80% OFF RETAIL PRICES!
PortlandMattressOutlet.com503.747.2896
12602 SW Farmington Rd. Beaverton, OR 97005
$149Twin Size
Mattress & Box Set
$299Queen Pillowtop
Mattress & Box Set
$399Queen Size Memory
Foam Mattress, Box & Frame
Located next to the City Library4755 SW Tucker Avenue Beaverton, OR 97005
(503) 644-1814Catholic Book Store
Books/CDs/DVDsChristmas/NativityCrucifixes/RosariesFirst Communion
Holy Water FontsLiturgicalStatuesGifts and more!
Tuesday - Friday: 10am to 5pmSaturday: 10am to 3pm
Sunday and Monday: Closed
Thrift Shop
Consignment Shop
A bargain hunter’s paradise!
The smart, easy way to buy or sell
clothing jewelry housewaresfurniture books CDs
jewelry collectibles china crystalhome furnishings unique accessories
We believe we can make a difference...because we have.
4000 SW 117th Ave.Beaverton, OR 97005
503-526-9300
Hours Mon: Noon - 4pm Tue-Sat: 10am - 4pm
of Greater PortlandWWW.PORTLAND.ASSISTANCELEAGUE.ORG
Retail
KELLY CHRISTIANSEN 503-464-67119248 SW Bvtn Hillsdale Hwy Beaverton, OR 97005
Living Proof Moroccanoil J Beverly Hills
THE CATWALK HAIR STUDIO
“Our goal is to meet or exceed your expectations!”
RAGGEDY ANN’S DUSTBUSTERS
503-240-0787
32 Years Good Old Fashion Cleaning
• A+ Rating @ Better Business Bureau
• Listed “Best of the CITY“ by Portland Monthly Magazine
• Rates among the best that companies offer
• Insured, Licensed & Bonded
• Discounts for Seniors
503.646.8653 www.curiositiesvintage.com
12705 SW Beaverdam Road, Beaverton (behind Ludeman’s and Tom’s Pancake House)
OpenTues - Sun:
10am - 6pm
6000 square feet of vintage shopping space to explore!
General
To place your business card here, email [email protected] Bulletin BoardBBBBBBeB
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 5Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
503.350.1234
Same Day Crowns Available!
Conveniently located in Downtown Beaverton (4690 SW Hall Blvd.)
PreferredDentalCareCenter.com
Nic Grasvik, DMD
GENERALCOSMETIC FAMILYDENTISTRY
(503)590-7574
Scott R. Walker, D.M.D.
www.MurraySchollsFamilyDental.com
in Progress Ridge | 503-352-5202 | www.playboutique.com
Healthcare
Advertising Bulletin Board
503-641-5678www.MVPdanceelite.com
12570 SW Farmington Rd. Beaverton (3yrs to Adult)
Jazz | Tap | Ballet | Lyrical | Contemporary | Hip Hop | Breaking | Acting Acro | Stretch-n-Strength | Toddler Combination & Specialty Classes
Bricks & Minifigs503.644.5701
facebook.com/[email protected]
3861 SW 117th Ave | Beaverton, OR 97005
WE DO BIRTHDAY PARTIES!
Announcements
Beaverton City HallMayor’s Office, City Council, Water Utility Billing, Police Dept., City Courts, Neighborhood Programs, Arts Commission & more. (4755 SW Griffith Dr.) www.beavertonor-egon.gov, 503-526-2222
Spring Book & Media Sale (Location: Beaverton City Library) The New Friends of the Beaverton City Library invite you to their 4th annual Grow Your Mind book sale. 5/1 Thursday 10 am - 8 pm 5/2 Friday 10 am - 5:30 pm 5/3 Saturday 10 am - 2 pm Books half price Saturday at noon.
FREE Mediation AssistanceBuilding community one con-versation at a time! The Dispute Resolution Center helps neighbors, landlords, tenants, HOA members, businesses, seniors and others resolve their differences. Call us, we’re here to help. 503-526-2523
History PresentationJoin us at the Beaverton History Center every 2nd Tuesday, 7 - 830pm, for an enjoyable evening. For details, see the History page in this issue.
Got homework? Beaverton City Library offers trained volunteer homework helpers after school and in the evenings. Whether you’re looking for help with math, science, writing, or almost any other subject, our Homework Helpers are here for you! Helpers for grades 6-12 can be found in the Teen Room, Main and Murray Scholls libraries.
Library Storytime Pre-school: Tuesdays at 9:30 (ages 3-6). Toddlers: Thursdays at 11:30 (ages 2-3). 503-644-2197
Restaurant & Office Space Avail. at the Village on Scholls Ferry (16315 SW Barrows Rd) For more information: 503-747-7238 [email protected]
Fundraising@Dairy QueenThe Downtown Beaverton Dairy Queen donates a portion of all cake sales sold at regular price to both the Highland Park Band and the Beaverton High School Bands & Ensembles. Customers simply need to stamp their receipt with the school of their choice and place in the customer comment box. This offer is year round!
11 City NAC Meeting Locations1-Central Beaverton NAC: Beaverton Community Center 2-Denney Whitford / Raleigh West
(Continued Page 6)
Medical Alarm, Inc.
(503)644-4736
www.columbiamedalarm.com
Personal Safety & Health Solutions
Just For Fun
To place your business card here, email [email protected] Beaverton Bulletin BoardB d
6 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
503-644-0129 | 4705 SW Watson Ave
www.beavertonflorists.com
Friday Flowers, ONLY $4.99!Friday Flowers, ONLY $4.99!
(Continued from page 5)
Announcements
503-579-160014661 Teal Blvd, Beaverton, OR 97007 (near Safeway in Murrayhill)
158th & Walker Rd (Across from Fred Meyer) | www.monteauxs.com | 503-439-9942
Join Us For Lunch or Dinner!
Wild Salmon Filet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Roasted salmon, a bed of confit yukon potatoes with leek cream sauce
Chili Verde Burger . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12Topped with roasted new mexico chili, onion and jalapeno blend
Dine in or Take out12600 SW Crescent St #150503-718-7101planetthaibeaverton.com
(Locally owned and operated)Let’s share the meals our moms taught us in Thailand
$5 OFF!Your meal of $30 or more
or
$10 OFF!Your meal of $50 or more
(expires 05/31/2014)
Coupon
Expires 05/31/14 PLU # 19 Expires 05/31/14 PLU # 20
Expires 05/31/14
Advertising Bulletin Board
Beaverton Bulletin Board
Edgewood Downs Retirement Ctr 3-Five Oaks Triple Creek NAC: Elmonica Elementary School 4-Greenway NAC: Conestoga Middle School Library 5-Highland NAC: Beaverton Resource Center 6-Neighbors Southwest NAC: Nancy Ryles Elementary School 7-Sexton Mountain NAC: Sexton Mt Elementary Cafeteria 8-South Beaverton NAC: Southridge HS, Community Room 9-Vose NAC: Beaverton Community Center 10-West Beaverton NAC: Seventh Day Adventist Church 11-West Slope NAC: West Sylvan Middle Sch. Library **For dates and times, visit: www.BeavertonOregon.gov/NAC
Donate Books, CDs & DVDsThe Book Corner is a used bookstore run by the New Friends of the Beaverton City Library. Fiction/Nonfiction/Children’s Books Available. Open: Tues-Sat 10 am - 4 pm, 12470 SW Fifth St., 503-643-5188. Shop our Amazon store at: BookCornerBeaverton.org
Multifamily Recovery Groupto help support positive changes. Learn how to set boundaries and tune in to your own wisdom. Plz call 503-980-3118 (Sliding scale).
Learn about OsteoporosisFrom toddlers to grandmas, learn about the importance of bone density for all ages. May 20, 630pm at 485 NW Saltzman Rd, 97229. Presented by Community Health Education Forum, 503-575-9261
Aloha Historical SocietyAnthony Mills and Eric Squires are taking the initiative to start a historical society for the urban, yet unincorporated area known as Aloha, Oregon. The Aloha Historical Society already has a website and is delivering content of podcasts, the first recorded at the neighboring Beaverton Historical Society of the promi-nent Attorney John Tyner. Learn More & Get Involved, visit www.AlohaHistory.com.
Pop and Paint FundraiserBenefiting Diabetic Support Services. Create your own personalized painting. Artistic directors will be available for your support. All you need to do is show up and have fun. All supplies are included. May 4th, 4-730pm at Hide Away Bar & Grill (18385 SW Tualatin Valley Hwy), $37, RSVP: 503-523-7478
Is it really*less than $100*to put my business card here??Yes!
Restaurant Coupons
To place your business card here, email [email protected]
(Continued Page 7)
Expires 04/30/14
2 Entrees & 2 Beverages
or $2.50 Off the Purchase of 1 Entree & 1 Beverage
OFF!$5
Valid at participating restaurants. Side dishes, kids meals, beverages and pies are not consid-ered an adult entree. Not valid with other offers, promotions or discounts. Not valid with Pie Rush Wednesday. One coupon per person per visit. No cash value. Sales tax, if applicable, must be paid by customer. Gratuity not included. Expires 5/31/14.
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 7Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
L o c a l B u s i n e s s D i r e c t o r yBusiness
Directory
Arts & Culture
Will you help reverse theDIABETES EPIDEMIC in AMERICA!
If not for yourself, a loved one? www.wellnessasalifestyle.net
All local artists, All original art!Free monthly reception! See story in Just For Fun section
www.artonbroadway.net 503-601-3300 C3
Beaverton Civic TheatreBeavertonCivicTheatre.org
503-754-9866
Visitors Center forBeaverton and Washington County
oregonswashingtoncounty.org 503-644-5555 B2
Lana L. Nelson Oil PaintingSee my work LanaLNelson.com &
www.villagegalleryarts.org/ lana-lnelson/ (in Facebook too!)
Call me at 503 830-7894
Sustaining High Quality Artwithin the community. Providing
culturally enriching activities, programs and services. www.beavertonarts.org
Learn About our City’s Pastthrough historic photos, artifacts,
exhibits and more! Open Tu/Th from noon to 4pm.
www.historicbeaverton.org C3
Broadway Rose Theatrewww.broadwayrose.org
503-620-5262
HART Theatrewww.hart-theatre.org
503-693-7815
Auto Care
Alexia's Window TintingSigns & Banners, clear bra paint protection, safety/security film. www.alexiawindowtinting.com
503-671-9615 B2
Local NAPA Auto Auto CareCenter for over 25 years! 16770 SW Shaw St, Aloha www.atbautorepair.com
503-642-7070
www.kunicollisioncenter.comLuxury Services at Affordable
Prices. Free estimates. Rental cars available onsite.
503-372-7563
Proudly celebrating 75 years!Eco-Biz certified, Family owned 11800 SW Bvtn.-Hillsdale Hwy HeitzmanBodyAndPaint.com
503.646.5181 D3
Beaverton Infinitiwww.beavertoninfiniti.com
888-319-6583
Banking
Services
The Right Bankfor your business.
Call one of our client service specialists TODAY! 503-350-1205
www.therightbank.com C3
Personal & businesssolutions, real estate loans
Call a personal banker today. 503-579-1947
www.bannerbank.com B
BankingConsumer and business
accounts, loans, mortgages www.onpointcu.com
503-228-7077 A
Body & Beauty
Tokyo BeautyGreen Peel Treatments
Full Body Waxing, Facials Hair Cuts & Beauty Care
Call Minh Le, 503-643-5907 B2
Make a Day Extraordinary!Specializing in color, cut & styling for every occassion.
We are a Goldwell Alliance Salon. 503-644-0510 C3
Murrayhill MarketplaceVersaSpa Spray on tan 1-only $30, 2-only $50
oasistanningoregon.com 503-521-8268 A
Nutritional MakeoversLearn how to eliminate medication
through eating healthy. Celia Lambert, PhD
971-732-6777
The Catwalk Hair StudioLiving Proof, J Beverly Hills,
Moroccanoil Call Kelly Christiansen at
503-464-6711 S4
Full Service Salonfor Men, Women & Kids,
Facials, Skin Care Head to Toe Waxing
503-430-0008 D
Education &
Learning
Beaverton City Library12375 SW 5th St, Hours:
Sunday 1pm - 5pm, Monday - Thursday: 10am - 9pm, Friday:
10am - 6pm, Saturday: 10am - 5pm (503) 644-2197 D3
Looking for a career in IT?Learn computer science, Python, Mobile development, JavaScript,
ASP.NET, C# and more! 888-503-2906 B3
Support Your Library
by donating to the Beaverton Library Foundation online @
beavertonlibraryfoundation.org
Lim’s Taekwondo AcademyBe competetive, be a champion!
503-277-7711 D2
Learn to sew, quilt and create your own clothes. Kids and Adult
classes. Call 503-526-9999 *Wicked Stitch of the West* B4
French LessonsExperienced Teacher & Native
Speaker. All ages OK! Call Danielle @ 503-746-4424
Preschool- Grade 7Education centered in the heart.
livingwisdomportland.org 4855 SW Watson Ave. Beaverton
503-671-9112 C4
Learn Taoist Tai Chiwww.oregon.usa.taoist.org
503-220-5970
Bilingual Chinese PreschoolReggio inspired & play based
curriculum. After school, enrich- ment activities. 971-225-0698
risingstarchineseschool.com C4
Customized Learningin a choice-based environment.
Small classes, all subjects, PreK - High School.
www.villagehome.org 503-597-9100 C4
Aloha Community Librarywww.alohalibrary.org
503-746-6918
Food & Drink
Local Listings for Beaverton...See Just for Fun section!
HappyHour
Do you find to snacking and drinking with friends fun and
entertaining? Well we sure do and that’s why you’ll find our list of
local happy hours in our Just For Fun section.
Join us for Weekend Brunch!Enjoy Breakfast, Lunch or Dinner
by the Lake at Murrayhill. www.cafemurrayhill.com
503-590-6030
Will you help reverse theDIABETES EPIDEMIC in AMERICA!
If not for yourself, a loved one? www.wellnessasalifestyle.net
Ava Roasteriawww.avaroasteria.com
503-641-7470 C4
Hall Street Grillwww.hallstreetgrill.com
503-641-6161 B1
SW Barrows Rd
SW
Hor
izon
Blv
d
SW Scholls Ferry Rd
CCCCCoommmmeee VVVVViiiissitttt
503-747-7238 | 16315 SW Barrows Rd. Beaverton
g g503-641-6161161666111111116666666611111 BBBBBB111BBBBBB111BB1111111111111BBBBBBBBBB111BBBBBBBBBBBB1111BBBBBBBBBBBBB11BBBBBBB1B1111BB11BB1B11BB111
Retail Space NOW Available!
8 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
BeavertonCity Library
BeavertonPost Office
BeavertonHistoryCenter
Elsie Stuhr Center
BeavertonSwim Center
BeavertonHigh School
TVR&RStation 67
BeavertonTown Square
Canyon PlaceShopping Center Canyon
Square
Beaver Creek VillageShopping Center
Hall Street Center
The Round
A
Parking
Parking
Parking
Parking
A
Parking
Sun ConnectionTravel & Cruises
Columbia MedicalAlarm
HeitzmanBody & Paint
Beaverton FamilyChiropractic
Fred MeyerTrader Joe’s
Starbucks
Starbucks
Cedar HouseMedia
BeavertonPharmacy
Motel 6
Lim’s TaekwondoAcademy
24 HourFitness
Hall Street CenterBeaverton Law GroupPacific Medical GroupFanno Creek Healing ArtsDon Filippi Ins. Agency
fromBlessings
Heaven
Ava Roasteria
La Hacienda RealMexican Restaurant
Bricks & MiniFigs
Assistance Leagueof Portland
PacificContinental
Black Bear Diner
GuaranteedPest Control
Comfort InnBudgetHotel
Things from Another World
Tom’s Pancake
House
Alexia’s WindowTinting
Curiosities
GoodiesCell Phone
Shop
Hometown Buffet
Beaverton EducationFoundation
Goodwill
Goodwill
Optimum Capital Strategies
BESThq
McDonalds
Taco Bell
New Seasons
Hall Street Grill
BeavertonSigns
Planet Thai
Chamber of Commerce
KuniCollision Center
Camelia’sCandles
MVP Dance
Sage Center
Honey ToastCafe
Beaverton Florists
The Vault
Irina Moga, DDSDenture Clinique
Wicked Stitchof the West
GoodnessCoffee
Singing RiverNatural Medicine
Haven Spa,Pool, Hearth
First UnitedMethodist Church
Rising StarChinese School
Book CornerBiZee BirdStore
Living WisdomSchool
Dairy Queen
VillageHomeSchool
Quilter’sCornerStore
Art on Broadway
Gloria’s Secret Cafe
SunsetComputer
Einstein Bros Bagels
Emerald City Smoothies
Noodles & Company
Arts & CommunicationMagnet Academy
(ACMA)
City Hall& Police Dept
Decarli
MattressOutlet
FringeSalon
Mill e Moto
Apple BlossomPhotography
Preferred DentalCare Center
StarkstreetLawn & Garden
Fresh Start DetailRingo’s
Beaverton LodgeCreekside Village
BBB
Farmington Rd
Canyon Rd
Canyon RdBroadway St
Lom
bard
Ave
Lom
bard
Ave
Hoc
ken
Ave
SW
Wat
son
Ave
Millikan Way
Eric
kson
Ave
Gri
ffith
Dr
7th St
Cady Ln7th St
7th St
Was
hing
ton
St
Ang
el S
t
Bet
ts A
ve
Sto
tt A
ve
Mai
n S
t
Fran
klin
Ave
Tuck
er A
ve
Tuck
er A
ve
9th St
9th St
10th St
8th St8th St
6th St
6th St
Hazel St
6th St
2nd St2nd St
3rd St
4th St
1st St
Center St
117t
h A
ve
114t
h A
ve
122t
h A
ve
123t
h A
ve
124t
h A
ve
125t
h A
ve
5th St
5th St
Hal
l Blv
d
Hall Blvd
Wat
son
Ave
Tualatin Valley Hwy
Ced
ar H
ills
Blv
d
217
Bvtn Hillsdale Hwy
Crescent Ave
217
8
10
A B C D E
A B C D E
1
2
3
4
5
1
2
3
4
5
Downtown Map
L o c a l B u s i n e s s D i r e c t o r y
Beaverton First Friday, May 2ndMusic, Sidewalk Vendors, Art and DiscountsODowntown Association will host an International themed First Friday event that includes a variety
addition of free limo service, more musicians, more sidewalk vendors and free First Friday reusable tote bags.
Free Limo Service FREE hop-on/hop-off service
will be available during the hours
of 5-8pm. There will be 5 stops with Limo signs around the First Friday area between Broadway
limo will be making rounds all evening picking up visitors to take them around the area.
Music
Galley (outside at Natural Grocers), Klezmacracy (main band
Brown(harpist outside at Peddler’s
(outside at Beaverton Florist).
Sidewalk vendorsThere will also be new side-
walk vendors including a distillery, vodka maker, fresh jams, art
photography, art prints and spe-cialty dog treats.
EventsSpecial Performances by:
Rock Creek Campus Choir from 7
Host Business for MayNatural Grocers. Come see
of Africa as she demonstrates the art of African Cuisine. (Sponsored by Beaverton Sister Cities Advisory
Shopping bagsThrough the generous donation
of 6 businesses, we have free First Friday shopping bags available in
while supplies last. Klezmacracy performs live on
Broadway St on May 2nd
Find us on Facebook or visiiiisitttt - - >>>>>>- >- > wwwwwwwwwwwwwwwwwwwwwwwwwwwww bbbbbbbbw bw bw bw bw bw bw bw bw bw bw bw bw bw bw.bw.bw.bbw.bw.bw eaveaveaveaveaveaveaveaveaveaveavaeaveaveaveaveaveaveaveaveaeaveaeaveae erterterterterteertertertertertertertertertertrertertertertertererte onronronronronronrnonronronronronrononronronrnonrononoo esoesoesoesoesoesoesoesoesesoeese urcuruurcurcu eegegegegegegggggggggguguguuuuuuggggeeeguegegg ide.ertert ronronrrn sesoeesooeso rcurcurcurceeegeeee
5 Nights/6 Days, land-only rates, only available at Sandpiper Bay, Florida
(does not include any airfare, transfer or travel insurance.
CLUB MED RESORTSSandpiper, Florida
Sun Connections Travel & Cruises | 503-655-4850 | [email protected]
$830 per adult (all inclusive rate)
$415 per child (15 years and under)
Price includes:
Call/email office for airfare costs or more information
Travel Layaway Plan!
Only $150 per person deposit required to confirm trip.
Final payment is not due until July 7, 2014
Historic Downtown District
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 9Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
L o c a l B u s i n e s s D i r e c t o r y
Sylvan Zoo House & SaloonFull Menu w/Pizza & Patio Seating
--w/e Brunch w/Free Mimosa-- --HH Daily 3-6pm & 9pm -Close--
--all Sports Pkgs, 19 Flat Screens-- www.sylvanzoohouse.com
503-297-5568 (Dine in / Take out)
Authentic Jalisco StyleMexican Cuisine. $5 Lunch
Specials in 5 min or it's FREE! www.guichosrestaurant.com
503-746-5980
Schwan’s Home Food Service*Open Your Door To Delicious!*
Over 350 delicious foods, delivered right to your door! NEW CUSTOMER SAVINGS!
Call Donna at 503.716.2231
A Little Taste of El SalvadorOpen Tues-Sat: 11am-3pm.
Saturday Breakfast 9am-11am. Homemade salsa and soups to go! 503-268-2124 B4
Goodness Coffee HouseA Family Cafe w/ a Healthy menu.
Gluten free welcome. goodnesscoffeehouse.com
503-616-3020 B4
Licensed Preschoolw/school readiness programs Mention ad for 20% discount
[email protected] www.playboutique.com D
In Progress RidgeLunch~Dinner~Late Night Dining
Full Bar~16 Beers on Tap Happy Hour Daily 3-6pm, Su-Th 930p-closing. www.bjwillys.com
503-747-7319 D
Thai & Laos CuisineDaily special from $6.95
Try our Spicy Mango Chicken! M-Th: 11a-9p / F-Su: 11a-10p
503-579-7542 D
Bar & RestaurantLunch, Dinner, Brunch, Cocktails
Happy Hour 4-6p www.watsonhallbar.com
503-596-2153 B3
TapatioMexican Restaurant
503-649-7545
VinotopiaRestaurant & Bar
503-597-6911 D
Honey Toasts, Bubble Tea, illy coffee & more!!
Open Tuesday-Sunday www.honeytoastcafe.net
503-747-2712 C3
Black Bear DinerBreakfast, Lunch, Dinner
503-646-4507 A3
Featuring our Cheesburgers& beer garden. All lottery games.
Happy Hour M-F: 4-7. www.ringosbar.com
503-644-7847 E3
Crazy Sushi ShotenDine in or Take out
503-746-6373
Dairy Queen BeavertonBurgers, hot dogs, chicken,
salads, shakes, cakes and more. Fan Food not Fast Food!
503-644-3469 B3
Italian inspired with a menuthat changes weekly featuring
fresh seasonal ingredients from the Northwest. 503-641-3223
decarlirestaurant.com C3
Sambi Japanese Restaurant;Sushi, Tempura, Ramen & More!
503-296-0045 S4
Village Inn Restaurantwww.villageinn.com
503-644-8848 S2
Monteaux’s Public Housewww.monteauxs.com
503-439-9942
Noodles, Salads & Sandwichesfrom around the world.
All for around $8! www.noodles.com
503-350-0591 E3
M-F Lunch Specials, $5.95Fresh tortilla’s made daily. Happy hour daily, 3-6pm
Dine-in or Take-out. 503-601-7000 D2
Breakfast-Lunch-Diner30 varieties of pancakes & waffles. Beaverton’s Favorite Restaurant!
503-646-2688 B3
Coldstone CreamerySee coupon in Food section
503-646-4507
www.ernestositalian.com*Great Lunch Menu *Dinner Specials *Banquet Facilities
*Happy Hour in Cozy Bar! 503-292-0119 S5
Food Photography Servicesby Cedar House Media
503-641-3320
Azteca Mexican Restaurantwww.aztecamex.com
503-643-8269 N2
Thai Home CookingJust how our mothers taught us! Dine in, take out & happy hour. www.planetthairestaurant.com
503-718-7101 C2
General
Services
Cartridge Network6800 SW Beaverton Hillsdale Hwy
Portland, OR 97225 www.cartridge-network.com
503-246-0665
Crator Lake JanitorialProfessional Cleaning Services
503-591-9031
\
Custom Sewing, Embroidery & Alterations
Wicked Stitch of the West “We make it YOURS!”
503-526-9999 B4
Goodies Cell Phone Shopbuy, sell, repair, bill pay, PCs too!
503-935-4495 B2
FOX OregonChannel 12
www.kptv.com
Brisbin Computer ConsultingFrom corporate networks to home
helpdesk and affordable web design, let me know how i can be
of service... 503-641-3320.
Your Full Service Sign Company!www.beavertonsigns.com
[email protected] 3899 SW Hall Blvd
503-672-9037 C1
Natural Birth Center and Family Care ClinicHealth
Available
2100 SW Camelot Ct., Portland, OR 97225(503) 252-8125 CanyonMedCenter.com
Vaccine Seminars, Birthing Classes and Presentations on Various Health Topics each month… See our website for details!
Clockwise from top left: Dr. Karen DeWitt, ND
Dr. Seth Burrell, ND Dr. Leslie Hamlett, ND
Dr. Nathan McVeigh, ND
SW Barrows Rd
SW
Wal
nut
St
SW
Hor
izon
Blv
d
SW Scholls Ferry Rd
SW
Mur
ray
Blv
d
Gas
SW Teal Blvd
SW Osprey Dr
SW
Dav
ies
Rd
B
A
C
DE
MurrayhillMarketplace
Murray & Scholls Map
Village at Scholls Ferry
Progress Ridge
Albertson's Shopping Center
Murray Scholls Townsquare
10 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Get $10 OFF per monthYou want DirectTV, I have
DirectTV. Use my referral code when you sign up and we both get $10/month OFF! Call Mike @ 503-314-3459
The Strong VoiceCommercial Voiceover
www.thestrongvoice.com
Your Local Business PartnerProfessional printing, graphics,
photography, web design, marketing and advertising. Home
of the Beaverton Resource Guide! www.cedarhousemedia.com
503-641-3320 C3
The Elsie Stuhr Centeris designed for adults 55 years
and better. Classes, trips events, fitness center, lunch and friends
503-629-6342 C5
Sun ConnectionsTravel & Cruises, LLC
**Layaway Plans Available**. www.sunconnections.com
503-655-4850 D3
AM 1360 KUIKThe Voice of Washington County
www.kuik.com
Health Care
Integrated Massage & Reikiharu.massagetherapy.com
971-340-8860
Will you help reverse theDIABETES EPIDEMIC in AMERICA!
If not for yourself, a loved one? www.wellnessasalifestyle.net
Family Chiropractic CenterSpecializing in children and
athletes. Wellness Awaits You! www.tpcportland.com
503-574-4872
Traditional East Asian MedicineAcupuncture, Herbs, Massage,
Qi Gong, Movement Therapy Mill-e-Moto.com
503-372-6463 C3
Precision Compoundswww.pcrxpdx.com
503-292-1146 N4
Natural Healthcare ConsultantAromaTouch & Reiki Therapist
www.doterraculture.com 503-730-8102
Dr. Dan MillerVisit our Maximized Living clinic!
BeavertonFamilyChiropractic.com 5075 SW Griffith Dr, Suite 120
503-644-8844 E5
Medical Alarm, Inc.
Local LifeLine ProviderPersonal health & safety solutions including GPS
& medication dispensing ColumbiaMedAlarm.com D4
Fanno Creek Healing Arts, LLPHall St. Station · 4530 SW Hall
Chiropractic · Acupuncture Naturopathy · Massage
503-644-6555 C3
Preventive, WhiteningAesthetic, Operative Implants, Periodontal
www.murrayhilldental.com 503-521-1333 B
Comprehensive dentalcare for your entire family. Visit us at:
murrayschollsfamilydental.com 503-590-7574 B
Dr. Robert ShermanAuto Accident Injuries,
Spinal Care & more. www.murrayhillchiro.com
503-590-4000 A
Prescription delivery, drive-upwindow, fine giftware,
mobility- DME sales/rentals medicare accredited
503-644-2101 C3
Michael Moga, LDFull and partial dentures
Open 7 days a week by appointment!
503-643-6213 B4
Dr Irina Moga, DDSFor your Smile, For your
health, For you! www.drmoga.com
503-646-5909 B4
Family PracticeSpanish, Hindi & Punjabi
speaking providers available. Mon-Sat Extended Hours
503-644-1171 C3
Office of Dr. MeansNaturopathic physician,
Acupuncturist, Nutritional suppliments & massage
503-641-6400 B4
Rebound Massage Therapyreboundmassagewellness.com
503-746-6585 A
Are You Ready for a Tune Up? Gentle Therapy for
*Individuals, Couples & Families* Groups too! Beaverton and
Sherwood. Please call Coleen Moreno,LCSW
503-980-3118. C3
Housing &
Home care
Free House Painting Estimates!Exterior & interior painting, decks and power washing.
www.smarthomepainting.com Call us at (503) 303-1475
BUY, LIST Your HomeFull service property managements. 9880 SW Bvtn-Hillsdale Hwy, #100
www.PdxHouseForRent.com 503-530-8246
L o c a l B u s i n e s s D i r e c t o r y
217
SW Beaverton Hillsdale HwySW Beaverton Hillsdale Hwy
SW
107th Ave
SW
109th Ave
SW
110th Ave
SW
103rd Ave
SW
99th Ave
SW
96th Ave
SW
91st Ave
SW
White Pine Ln
SW Apple WaySW Apple Way
SW
Laurelwood A
ve
SW
Western A
ve
SW
Jamieson A
ve
Michael’s
KaiserPermanente
US BankChase BankAzteca
PrecisionCompounds
Catwalk Hair Studio
Heritage Schoolof Interior Design
Sambi JapaneseRestaurant
Ernesto’s Italian Restaurant
Sisters N StyleVillage Inn Scandia Imports Craig's
Rare Coins
Borean Realty
SignatureShoes
Smith & BevillJewelers
China Delight
Valley Plaza
JesuitHigh School
AM KennedyPark
McMillianPark
See Downtown Map
1 2 3 4 5
NO
RT
H
N
SO
UT
H
SBeaverton Hillsdale Hwy Map
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 11Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
Raleigh Hills Assisted Livingwww.rhliving.com
503-297-3200
Solar Works in Beaverton!Ask me about my 4kW system on
lease for $0 down and only $31/month. For 5 months last
summer, my PGE bill was $0! For more info, [email protected].
All Gutters & MoreInstallation and Cleaning
Moss removal, pressure washing, gutter cleaning, roof repair.
FREE estimates. Licenced & Ins’d. 503-268-9121
Lisa Fain, Realtor/Prop. Mgmt.Beaverton/Westside Specialist!
Working w/buyers, sellers & investors. The Sunset Group
503-679-8477 A
Retirement ResidenceHit the road with us because we
never stand still for too long! www.beavertonlodge.com
503-646-0635 B5
FOR SALEResidential Listings
(Address | Bdr/Bth/SqFt=$)Sponsored By
Portland Metro's ONLY LocalReal Estate Newspaper!
allthingsrealestatepdx.com503-641-3320
Home$ in 97005
420 SW 133RD AVE 3/1/1132=$205,000
13480 SW RITA DR 2/1/1132=$209,900
12290 SW 12TH ST 3/1/1407=$220,000
13080 SW RITA DR 3/1/1140=$240,000
13381 SW DEVONSHIRE DR 3/1/1008=$260,000
14370 SW LISA LN 4/2/1848=$275,000
11860 SW WALKER RD 2/2.1/1394=$283,900
3340 SW MERCER TER 4/2.1/1961=$305,000
13045 SW CASTLEWOOD ST 3/1.1/1660=$312,000
13466 SW DEVONSHIRE DR 3/1.1/1212=$315,000
1921 SW 144TH AVE 4/2.1/1748=$324,001
10075 SW KENNEDY ST 4/2/2324=$379,950
Home$ in 97006
18146 SW NIKS DR 3/2.1/1538=$214,900
19600 SW ALEXANDER ST 3/1/1978=$220,000
1191 SW 182ND AVE 3/2.1/1419=$224,900
20726 SW GRACIE ST 3/2.1/1399=$229,950
18435 SW LONGACRE ST 3/2.1/1526=$230,000
18660 SW AUGUSTA LN 3/2/1350=$234,900
2790 SW 199TH PL 4/2/1424=$234,900
20603 SW LONGACRE ST 3/2/1332=$234,900
3169 SW 176TH AVE 3/2/1488=$250,000
21485 SW ROCK RD 3/2/1379=$262,000
21795 SW LOIS ST 4/2.1/1760=$265,000
517 SW 199th AVE 4/2.1/1642=$276,990
2195 SW 203RD AVE 3/2/1828=$279,000
577 SW 198th AVE 4/2.1/1642=$289,990
1314 SW 216TH PL 4/2.1/2042=$294,900
21290 SW WINTERFIELD LN 4/2.1/1824=$295,000
3107 SW 197TH AVE 3/2.1/1996=$309,500
19695 SW SHAROAKS DR 4/2.1/2028=$314,500
20531 SW ANNA CT 3/2.1/2112=$318,000
Home$ in 97007
6217 SW 205TH AVE 3/2.1/1672=$200,000
5050 SW 175TH AVE 3/2/1346=$229,900
17080 SW VINCENT CT 3/2.1/1324=$229,900
7295 SW MILLENNIUM TER 4/2.1/1682=$250,000
18478 SW OAKVILLE CT 4/2.1/2216=$259,900
5810 SW 176TH AVE 4/2.1/1760=$259,900
20789 SW EGGERT WAY 4/2.1/1796=$289,900
16821 SW WRIGHT ST 4/2.1/2021=$299,900
14795 SW CITRINE WAY 3/2.1/1366=$319,900
8440 SW 184TH LOOP 3/2.1/2460=$350,000
7606 SW 194TH TER 4/2.1/2231=$369,900
7785 SW GEARHART DR 4/2.1/2408=$374,900
Home$ in 97008
12150 SW KEAS CT 4/2/1612=$289,900
13880 SW MARTINGALE CT 4/2/1773=$289,900
9940 SW 135TH AVE 3/2/1408=$289,950
9740 SW ROBBINS DR 4/3/1590=$300,000
7275 SW CRESMOOR DR 3/2/1984=$319,900
8385 SW CONNEMARA PL 4/2.1/2116=$329,000
13850 SW STIRRUP ST 3/2/1568=$335,000
14230 SW KIMBERLY DR 4/3/2229=$340,000
12675 SW TIGER LILLY LN 4/3/2530=$369,900
Milton Yard MaintenanceFull Yard Service & Clean up
503-330-2137
Senior Living CommunityWe make it easy to feel
right at home. www.creekside-village.com
503-643-9735 B5
Divine Window DecorBlinds, Shades & Shutters Free in Home consultation
www.DivineWindowDecor.com 971-282-2306
Guaranteed Pest ControlProtecting your health and
property since 1949! www.guaranteedpestcontrol.net
503-646-2119
Edgewood DownsIndependent Ret. Community
503-643-5418
MovingForSeniors.comSmooth Transitions
503-590-8562
earthstoneof Beaverton
Charming Boutique-Style Assisted Living
Close to the Elsie Sturh Center! www.hearthstonealc.com
503-641-0911
Pet Care
Companion Pet ClinicQuality Care, Affordable Prices
503-641-9151
Healthy Affordable Pet Supplies Grooming & Self-wash. Cat adoptions available.
www.naturespetmarket.com 503-579-2403 A
The place for all your bird needs.Exotic birds, healthy foods,
toys, boarding & advice. Great prices! 503-644-9515
www.bizeebird.com C4
Grooming at your DoorstepYour Full Service mobile pet
grooming provider since 2007 www.dogvan.com
503-995-8991
Professional
Services
Business Done Here!Printing, Shipping, Freight,
Notary, Gifts, Card and more! $10 PMB boxes available.
503-747-2278 D
ADAMS - UFFELMAN - RAVELO - NGUYEN
Personal Injury, Criminal LawDUII, Immigration, Wills/Trusts Probate, Family/Business Law
www.beavertonlaw.com 503-644-2146 C3
Sunset Computerswww.sunsetcomputer.net
503-866-3747 B3
The RoundRes/Com space avail.
503-381-1670 B2
Village on Scholls FerryClass A Retail Complex.
Restaurant & Office Space Avail. www.guansusa.com
503-747-7238
Raleigh Hills Assisted Living 12290 SW 12TH ST 577 SW 198th AVE 7275 SW CRESMOOR DR
We l c o m e t o B e a v e r t o n , t h e B e s t D a m C i t y i n O r e g o n !
Includes new patient exam, x-rays and routine cleaning.
For your smile, for your health, for you...For your smile, for your health, for you...
Restrictions apply,call for details.$79 Special Offer:
-- Irina Moga, DDS
We offer comprehensive dental care for the whole family.We strive to provide patients with friendly, quality care in a relaxed atmosphere.
4970 SW Main Ave., Suite 200, Beaverton, OR 97005 | www.drmoga.com
503.646.5909
12 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
An Oregon Registered Investment Advisor Firm.
Financial planning Portfolio mgmt www.investocs.com
971-250-0301 E5
Don Filippi Insurance AngencyBusiness & Commercial,
Auto, Home & Life Insurance www.donfilippiagency.com
503-646-4101 C3
Independent Insurance AgentBig and Small, We Write it All. Business Ins., Worker's Comp.,
Home, Auto, Health/Life. 503-644-9945
www.lianenishimura.netAuto, home, life, renters,
health, business, boat & more! Call Liane at
503 579-3005 A
Hough Law | Nicole A. HoughFamily Law | Estate Planning
503.208.6610 www.houghlawfirm.com
Religious
& Spiritual
Open Minds, Open HeartsOpen Doors. Beaverton First
United Methodist Church. www.beavertonumc.org
Sunday Worship: 10:30am 503-646-7107 C4
Retail
Quilter’s Corner StoreFabric, Kits, Gifts & More
503-819-0214 Tues - Sat C3
We do Birthday Parties!www.bricksandminifigs.com
503-644-5701 D2
Classic & New Video GamesBUY-Sell-Trade-Repair
Greenway Shopping Center www.gamehavenclassic.com
503-372-6817
We Buy Gold & Silver!Engagement, Jewelry, Antique,
Timepieces, Gifts, Service/Repair. www.smithandbevill.com
503 644-1333 N3
Thrift & Consignment ShopA bargain shoppers paradise!
Clothing, jewelry, books & more. portland.assistanceleague.org
503-526-9300 D2
Real Local Florist*Flowers for every occasion, plants, cards, gifts & more! www.beavertonflorists.com
503-644-0129 C4
A Vast Selection of Treasures
Purveyers of antique, vintage and collectible merchandise. www.curiositiesvintage.com
503-646-8653 B3
Mattress Outlet$149 Twin Mattress & Box set
503-747-2896
Catholic Book Store & Gift ShopRosaries, statues, crucifixes,
DVDs and more. www.blessingsfromheaven.org
503-644-1814 C4
All natural candlewaxRecycle old candles and get credit towards a new one.
Open Wed-Sat 10-6 or by appt. 503-318-9648 C3
Scandia Importswww.scandiaimports.com
503-643-2424 S3
Signature Shoeswww.signatureshoes.com
503-626-8413 N3
The Vault Vintage Clothing Boutique
Vintage Clothing for the Modern Woman. 503-520-9369 C3
A d v e r t i s i n g h e r e s t a r t s a t o n l y $ 1 0 / m o n t h , C a l l 5 0 3 - 6 4 1 - 3 3 2 0 To d ay !
Oregon Metropolitan Elite Gymnastics Academy
503.466.4872
Locally Owned | Recreational Classes Parent and Me Classes | Camps
Birthday Parties | Competitive Team Field Trips | Drop-In Classes
OMEGA - | 8160 SW Nimbus AVE, 5E, Beaverton OR 97008 | www.omega-gymnastics.com
Aloha Business Association: Shop Local, Shop Aloha!
President’s MessageSupport Our Schools and Local Fire District, PLEASE VOTE!
Mission / VisionVision: Stewards of the Path to 2040. Mission: Serve as a Voice for Changes that Impact the Aloha Com-munity--Property owners, Business owners, Residents/consumers.
About UsThe Aloha Business Assoc. supports a strong community that is affordable, accessible and safe! Be sure to check out our website to see our “Everything Aloha” community calendar. www.alohabusinessassociation.com
Board MembersPresident:Karen Bolin, Edward Jones
Secretary:John Tyner III, Attorney
Treasurer:Mike Holcomb
At-Large:Daryl Welch, Affordable Web Tech. Rebecca Ross, Ross Realty Group
Committee ChairsCommunity Partnerships:Sally Fabre, Agape Com. Ins.
Membership:Rebecca Ross, Ross Realty Group
Webmaster:Daryl Welch, Affordable Web Tech.
Meetings/Programs:Karen Bolin, Edward Jones
Monthly MeetingsMay 8th, Member Showcase!Ten different members will set up their table with a display and give a five minute summary of their business.
Meetings are the 2nd Thursday of each month, 11:30am @Peppermill Restaurant (17455 SW Farmington Rd)
MembershipTier 1 ($60/year)Name Listed in Directory
Tier 2 ($480/year)Logo + 5 line ad
DirectoryB2B ServicesBy All Means VirtualBeaver Express, Inc
Cedar House MediaCommunity NewspaperHolcomb Computer ServicesImpact SignReciProty
CommunityAloha Community Library Assoc.Aloha High SchoolBvtn Education FoundationBeaverton Optimist ClubCooper Mt. Presbyterian FellowshipDomestic Violence Resource Ctr Edwards CenterFoursquare Church of AlohaHabitat for Humanity, Willamette WestJanel K. Josephson, AuthorLove Inc., BeavertonOregonianReedville Presbyterian ChurchTri-MetTualatin Valley Water DistrictWash. Co. Sheriff’s Office
DiningGodfathers PizzaPeppermill RestaurantSakura Teriyaki
General ServicesATB AutoBeaverton TowingDavis Lock & SafeHula Halau, Hawaiian DanceIn Line, Commercial ConstructionKD ContractingSun Connections Travel & CruisesTravel By Tom Higham
HealthABC OptometricPCAloha Animal Medical CenterCarol Cartier w/Juice PlusCurvesEmbracing Health 4 LifeMonroe OrthodonticsRingsage Chiro. & sports Injury ClinicSequoia Mental, Health Services Songbird Healing ArtsTherassageThompson Family DentalTresor Day SpaUsana Health Sciences
Professional ServicesAffordable Web TechnologyAloha CPA, Kenneth Rigert Electronics Unlimited & Comp Srvs
Foundations 4 Your LifeGaroken Energy Co., IncGrass Skirt MarketingHot Tech ComputersInSphere Insurance Solutions John J. Tyner III, Attorney Knipe Realty NWMartin Hunter, CPAMarilyn Mays, RealtorMike Sahagian, AttorneyRoss Realty GroupSchmidt & YeeSource RealtyVeritas FundingYP
RetailA Cut Above PawnCedar West PlazaExclusively MaureenFrom My Bed To YoursJan’s PaperbacksKey Bank - Farmington BranchPostal AnnexSuburban Ace HardwareThe UPS Store, Allen & MurrayUS Bank
AC Communi yInsurance
Agape
AgencyProtecting Your Story...Building
Community. Auto, home, renters, Fire, motorcycles, RV’s, boats.
agapecommunityinsagency.com 503-626-5790
Aloha-Reedville’s FutureBe part of shaping it!
Google: alohareedville [email protected].
or.us, 503-846-3519
18540 SW Vincent, Aloha, OR 970078 40 S
David E. Nevills, DMD Megan L. Nevills, DMD
nevillsfamilydentistry.com (503) 649-3232.
Accepting New Patients!
Funeral Home and Crematory“Your loved ones never leave
the care of our home.” www.springerandson.com
503-356-1000
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 13Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
S u p p o r t yo u r l o c a l n e i g h b o r h o o d b u s i n e s s e s !
West Hills Office Plaza
Troy A. Noland LUTCFSpecializing in home, auto,
commercial & life [email protected]
503-497-2811
Dr. John Tuttle, DC, CKTPChiropractic Ctr of Raleigh Hills
New client specials! www.r3chiropractic.com
503-292-0781
I Get Under Your SkinPersonalized day-spa specializing
in wax, facials and peels. www.facesbyvivian.com
503-292-7546
Holistic Bodywork & Massage. Massage that Makes a Difference. Effective auto, injury, and chronic
pain care (garylwass.com) 509-240-6989
Located in Raleigh Hills!4475 SW Scholls Ferry Rd, Portland OR 97225
SW Scholls Ferry Rd
SW Beaverton Hillsdale Hwy
Business
Directory
BusinessSpotlight
Hot Tubs, Stoves, FireplacesPools, Free Water Analysis
Service & Installation www.HavenSpaPoolHearth.com
503-649-2201 C3
Things From Another World Comics • Toys • Collectibles
4390 Sw Lloyd Ave. • 503.643.4222 Find Us Online at:
www.Tfaw.Com B2
Outdoor Power EquipmentSpecialists
Sales • Service • Parts www.starkstreet.com
503-626-9193 C3
The Book CornerFor gently used books at
affordable prices w/ proceeds donated to the Beaverton library. www.bookcornerbeaverton.org
503-643-5188 C4
Sports &
Activities
Inside Every Child Lies a ChampionRecreational Classes, Birthday
Parties, Camps, Parent’s Night Out, and more!
www.omega-gymnastics.com 503.466.4872
Lim’s Taekwondo AcademySerious yet fun, we specialize
in making champions! www.pdxkarate.com
503-277-7711 D2
CinemarkCedar Hills Crossing 800-FANDANGO+984
My Masterpiece Art StudioOpen Studio, Parties & Classes 7905 SW Cirrus Dr., Beaverton
www.mymasterpieceartstudio.com 503-453-3700
Why see a movie in coach, when you can sit in first class?
For Tickets and Showtimes Visit: www.cinetopia.com
503.597.6900 D
MVP Dance Elitemvpdanceelite.com
503-641-5678 C3
Valley Cinema PubBvtn-Hillsdale Hwy.
503-296-6843
Healthy Lunch & Diner OptionsGluten Free Menu!
Beer, Wine, Soda & Coffee Private Parties & Events
www.playboutique.com D
Beaverton Farmers MarketSee ad in Community section
www.beavertonfarmersmarket.org
JazzerciseStrength-Cardio-Tone
503-646-5299
Billings Dance Company70+ weekly classes
503-670-7008
Beaverton Swim CenterAquatic fitness programs
Lessons for all levels www.thprd.org
503-629-6312 B4
Try the hottest new barre workout!Pilates Based Dance Amplified
Open to ALL fitness levels www.xtendbarrebeaverton.com
503-610-3214 D
Oregon Zoowww.oregonzoo.org
503-226-1561
Washington Square Mallwww.shopwashingtonsquare.com
503-639-8860
**FREE**One week of
KETTLEBELL TRAINING Hellz Bellz Fitness
503-312-5744
Learn Taoist Tai ChiExplore this ancient Chinese
exercise emphasizing balance and health improvement.
www.oregon.usa.taoist.org 503-220-5970
You Found Me!Find more of me thoughout the
paper, and you could win a $25 gift certificate to Black Bear Diner!
There will be 3 winners each month. See back page for details.
Directory Listings start at only
$10/month (Call 503-641-3320)
A Counted Stitch
EstablishmentFabrics, threads, charts & more!
Come see us to start your project. 503-292-4457
www.acornsandthreads.com
Threads, your Portland area counted cross stitch store.
fabrics, threads, charts and kits we’re sure to have something wonderful for you to stitch. Classes are offered for techniques such as cross-stitch, hardanger and embroidery as well as project classes and with some fun events thrown in. Or come stitch with
stitch all summer long outside on the patio on Saturdays, weather permitting. There is an email newsletter that is sent every couple of weeks, to let you know what’s new in the shop!
We hope you’ll stop by and enjoy the variety we have to offer.
If a man does his best, what else is there? - General George S. Patton (1885-1945)
Political correctness is tyranny with manners. - Charlton Heston (1924-2008)
You can avoid reality, but you cannot avoid the consequences of avoiding reality.” - Ayn Rand (1905-1982)
STUDENT SUCCESS: This program has taken the subject of software development and made it simple and easy to understand for anyone. As I went through the curriculum, I felt my fear of learning computers melt away. I recommend attending Prosper IT Academy to anyone looking to break into the IT industry. These guys deliver! -- Cliff Cannon, Portland
888-503-2906 | 12745 SW Beaverdam Rd Suite 210, Beaverton | www.prosperitacademy.com
Looking for a Career as a Software Developer?
In our 12 Week dot.Net training program, you’ll learn:
Computer Science basics Python fundamentalsMobile development
JavaScript (HTML, CSS)ASP.NETC# and more!
14 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Our Town
Keep Shooting!Beaverton Business: Build! Maintain! Grow! Thrive!
smart young man…a hard worker…and looking for a job this summer. I am trying to help
been talking about persistence…and how it is such an important ingredient to success. Keep look-ing for employment after many rejections…keep going back to a desired place of employment and keep checking in…etc…
PERSISTENCE…in sales and business…it is likely the hardest skill, characteristic and daily activ-ity to master.
Giving up is easy. Persistence is the path packed with challenges, barbs, with people saying NO! But it is the road to The Promised Land!
ABE LINCOLN: -
ily was forced out of their home. -
never give up mind set helped land
MILTON HERSHEY: Started three different candy
companies in three different cities,
succeeding with his Lancaster
empire!
THOMAS EDISON:
boy he was labeled as “stupid” and
lost job after job as a young man. Asked in his later years about the many detours and roadblocks on his road to success, the famous inventor said “I never failed once.
process.”Persistence takes mental forti-
tude. It is a must. Some come by it more naturally, but in today’s era of reset buttons…it is more impor-tant than ever.
Giving up, is accepting the sta-tus quo…or worse.
you think you can do a thing or think you can’t do a thing, you’re right!”
It’s all in the mind. Take a chance. Ask a question…if they say no…keep trying.
If you don’t take the shot…it’s
score a goal.Keep Shooting! The worst dis-
tance in golf…or in a marathon…or life…quite often is the 6-inches in between your ears!
By Spencer “The Catalyst” Rubin
Spencer Rubin is a Beaverton Resident with 3 kids attending local schools. With 23 years in the adver-tising and marketing Industry with AM1360-KUIK, Spencer has become a passionate advocate for the success of small, local business owners. This article has been adapted for the BRG from his weekly Catalyst newsletter.
Questions? Contact Spencer at971-732-4745 [email protected]
The history of Mother’s DayTDay dates back to the ancient annual spring festival the Greeks dedicated to maternal goddesses. The Greeks used the occasion to honor Rhea, wife of Cronus and the mother of many deities of Greek mythology.
Ancient Romans celebrated a -
cated to Cybele, a mother goddess. The celebration began on the Ides
the temple of Cybele lasted for three days and included parades, games and masquerades.
Early Christians celebrated a
festival on the fourth Sunday of
England the holiday was expanded to include all mothers. It was then
Gift Ideas for the Modern Mother’s Day.
A gift of enduring beauty will remind her of your appreciation
jewelry she can enjoy every day is a lasting tribute to her love.
Pearls- the ancients favored pearls as an offering to the god-desses. They are still the perfect gift for the mother with classic style.
Lockets- a custom engraved
a lock of baby’s hair makes a wonderful gift for the new mom. It’s also a wonderful idea for new grandmothers.
Colored Gem stones- honoring mom with a custom made piece of jewelry incorporating her chil-dren’s birthstones can be tricky, but a very personal way of bringing the family together.
of Spain has been crafting breath-taking masterworks of enamel and precious gems. Select a fan-
These exquisite pieces make a per-fect way to celebrate mom.
By Kaaren Bedi
Smith & Bevill is your local family jew-elery store has AGS certified appraisers on staff as well as master gold smiths and factory certified watch makers. We are always buying gold, silver and platinum jewelry.
www.smithandbevill.com | 503.644.1333 | 9875 SW Beaverton-Hillsdale Hwy, Beaverton, OR 97005
We Buy Gold, Silver & Diamond Jewelry!Plus: The sun is shining, so bring in your dusty jewelry wardrobe for a complimentary Spring Cleaning!
Dental gold, sterling flatware & broken jewelry Free evaluations while you wait Payment given on the spot No appointment necessary
20% Extrafor your gold and silver
scrap when used towards in store purchases
Expires 6/30/14
SPRING
CLEANING!
www.sm
OCSO P T I M U MC A P I T A LSTRATEGIES LLC
Changing jobs? What should you do with your retirement funds?TAKING ACTION can mean the difference between retiring
comfortably on your terms vs. out-living your money!
James Bauman971.250.0301 [email protected]
For a free consultation contact:
5075 SW Griffith Drive, Suite 100 Beaverton, OR 97005
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 15Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
S u s t a i n a b l e B e a v e r t o n
Local Green ResourcesAccording to the
Environmental Protection Agency, sustainability is based on a simple principle: Everything that we need for our survival and well-being depends, either directly or indirectly, on our natural envi-ronment. Sustainability creates and maintains the conditions under which humans and nature can exist
in productive harmony, that permit
other requirements of present and future generations.
Sustainability is important to making sure that we have and will continue to have, the water, materials, and resources to protect human health and our environment.
Beaverton’s Native Plant of the MonthCascara (Rhamnus Purshiana)Cascara is native from north-
ern California to British Columbia, as far east as the Rocky
in fairly dry to wet sites in full to partial sun and is most common in mixed woods and along stream
sides.Cascara is an erect, tall shrub
tall, with thin, smooth, silver-grey bark. The shiny, deciduous leaves are simple, alternate and are clus-tered near the ends of twigs. They
wide), are darker green on top than the bottom, have tiny teeth on the margins, and parallel veins.
mm long) and greenish-yellow in color. Its fruits (5-8 mm across) are edible but have a distinctive taste and look like blue-black to purplish-black berries. Cascara’s
originally used for this purpose
Native Americans. It can also be used as a medicine for washing sores, swellings and for internal strains.
has been brought to you by the City of Beaverton’s Landscape and Urban Forestry Department along
Finder webpage for interactive
By Katie Wilson, City of Beaverton
This Native Plant of the Month has been brought to you by the City of Beaverton’s Landscape and Urban Forestry Department along with Clean Water Services. Visit Clean Water Service’s Native Plant Finder webpage for interactive questions to help you find the right native plant to fit your needs!
Common Name: Cascara
Binomial Name: Rhamnus purshiana
Soil Type: Moist to Dry
Sunlight: Full Sun to Partial Sun
Spreads/Multiples: No
Plant Type: Tall Shrub/Small Tree
Foliage: Deciduous
Flowering: Yes
Sustainable BeavertonEnergy Efficiency Opportunities for Local Businesses One of the main pillars of
a sustainable community is the economic security of our
local businesses. This is why the Sustainability Division works hand in hand with Portland General Electric (PGE) to help local businesses cut energy use and save money through ener-
the Sustainability Division does this is through the Beaverton Better Buildings Challenge where
receive free assistance with their
visit www.BeavertonOregon.gov/BBC.
Right now there’s another exciting opportunity: PGE is
Businesses who sign up for an
a free lighting upgrade – this year
each!Through the free consultation,
business owners will get smart
out how Energy Trust of Oregon cash incentives can make lighting upgrades more affordable and con-nect with local contractors.
Already had a consultation?
by visiting the website above. By City of Beaverton, Sustainability Staff
Visit www.portlandgeneral.com/lightsweeps or call 800-822-1077 to schedule your consultation today.
For more information about the city’s sustainability efforts, visit www.BeavertonOregon.gov/Green.
Howdy folks! May I interest you in
an energy eFFICiency upgrade?
Does Solar Work in Beaverton?Ask me about my 4 kW system in Sexton Mt. that I’m leasing for $0 down, $31/month and credits from PGE over the Summer months! Email: [email protected]
Paula Conway, PGE Energy Expert, doing a consultation
with a local business.
Sustainability ResourcesBeaverton Farmers Market: Check out weekly events, vendors, schedules and more. BeavertonFarmersMarket.com (503) 643-5345
Community GardensLearn where community gardens are located and their associated fees. BeavertonOregon.gov/Gardens (503) 526-2665
THPRD Community Gardens thprd.org/parks/communi-tygardens.cfm (503) 645-6433
Beaverton CompostingLearn about the new Beaverton Composts program for local busi-nesses, www.BeavertonOregon.gov/Compost (503) 526–2460
Energy Trust of OregonSchedule a free home energy review, learn about cash incen-tives, or find a contractor. (www.EnergyTrust.org) (866) 368-7878
Beaverton Sustainability DivisionLearn more about the city’s sustainability division, its activities and community events ((503) 526-2474) www.BeavertonOregon.gov/Green
Beaverton Recycling & Waste ProgramsRecycling at work, home, or school. Learn more about recy-cling programs in Beaverton and what to do with hard-to-recycle items. www.BeavertonOregon.gov/Recycling 503) 526-2460
PGE Green Power ProgramLearn the renewable power options and costs offered by PGE www.GreenPowerOregon.com (800) 542-8818
Solar OregonLearn about the steps and costs of installing a residential solar electric system. www.solarore-gon.org (503) 231-5662
16 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
C o m m u n i t y N ew s
Viral Video HitBeaverton Girl Juggles Soccer Ball All Over Town
A amazing soccer juggling act is getting some love online from U.S.
Katelyn Penner’s video of her juggling a soccer ball all around the Portland metro area has more
Katelyn’s personal juggling
touches without the ball hitting
minutes.Sure, it’s an impressive number,
but juggling a ball in place started to get “a little boring” for her. So
skill challenges posted by U.S.
“They inspired her to try some different things,” said Loren Penner, Katelyn’s father.
Katelyn’s completed skill chal-
it’s her recent juggling act around Beaverton and Portland that takes the cake.
The “walkabout” starts at her home in Beaverton, crosses
a neighborhood bridge, heads to Chehalem Elementary School and then tours the Nike campus. She eventually ends up in front of Providence Park, home of the Portland Timbers and Portland Thorns, but not before a quick trip through the Dairy Queen drive-through.
Averbuch even commented on
awesome!!!!!”The video was taken over the
course of a couple sunny days in
plays for the Portland Thorns and made her own “walkabout” video a few years ago.
weeks -- came as a big surprise to Katelyn.
“I wouldn’t think so many people would see it as they have, I thought maybe a couple hundred,” she said.
By FOX 12 Staff
Watch the video at kptv.tv/12juggle.
The Dispute Resolution Center Offers HOA HelpIs your homeowner asso-
Professionally trained volunteer mediators at The Dispute Resolution Center are ready to help.
to provide a means for home-owners to care for common spaces in the neighborhood as well as to provide a structure for maintaining property values of its member homes. In managing these respon-
and homeowners may experience
effectively be addressed with the help of a neutral third party.
HOA issues that can be addressed in mediation include:• Board elections / appointments• Understandings of bylaws• Application of rules • Roles and responsibilities of
board / tenants The Dispute Resolution
Center’s professionally trained volunteer medi-ators are available to
their members resolve all types of disputes. Oregon
laws that govern planned communities and condominiums
offer mediation as a way to resolve issues (except those involving col-lection of assessments) before either party can pursue a remedy through the court system. Our services are free and are completely voluntary
costly litigation while helping to promote a more livable community.If you would like more information about mediation and the Dispute Resolution Center visit the City Website at www.beavertonoregon.gov/disputeresolution or call us at (503) 526-2523.
HOAHELP
Become a CASA VolunteerMake a Difference in a Child’s Life
Dianna Schmid long had wanted to work with people
who need a hand in bettering their lives. “I wanted,” she says, “to get into the trenches.”
That she did. A former news-paper journalist who since the
marketing and communications
CASA – Court Appointed Special
in those counties, Schmid looks
out for the interests of abused and neglected children in state custody.
For her impressive work dur-
recently was honored as the
her attention to the seven cases assigned to her. She also works with the Oregon State CASA Nework in a marketing capacity.
Like those other volunteers,
of training and works with a CASA supervisor. Like those other vol-unteers, Schmid is appointed by the court to a case that she follows to conclusion by working with
case workers, therapists, foster parents, the biological parents and others.
The rewards are deep. “I don’t do it for me,” Schmid said. “I do it to make a tiny bit of difference in a child’s life.”
In the process, parents who have faced challenges and lost custody of their children because
of their neglect or physical harm might turn their lives around, often because a CASA volunteer has provided the support not just to the children but to the parents as well. If that ideal does not work out, vol-
with relatives or other foster fami-lies or, sometimes, adoption.
The work is far-reaching.
appointed CASAs to advocate for
Upon completion of the train-
have the ever-present support of their supervisors to guide them.
By Dan Hortsch, CASA Volunteer
Those interested in learning about volunteering can email [email protected] or telephone 503.988.5115
New Business Spotlight:Learn Software Development at Prosper IT AcademyThe World’s Premier Career Oriented Software Developer Institute
Prosper IT Academy is rapidly becoming a vital part of the
strong Information Technology business community that makes the west side such a desirable place to live and work.
is a major shortage of competent software developers. Over the next
exist in IT but at the current rate
will be trained as computer pro-grammers/software developers in that time. There is a great need for software developers in the US and Prosper IT Academy was founded
“I created the school because I really like to help people,” says Erik Gross, the Academy’s founder. A senior software developer with over thirty years’ experience in
experience in mentoring junior developers.
“It is so cool to see these stu-dents get it. They walk in the door
actually afraid; worried that they aren’t smart enough, that the tech-nical nature of the subject will be beyond them. Then you see them just a few weeks later - they’re
They’ve got a set of skills that they know will make them valuable.”
One of the Academy’s main training offerings is the Dot
“immersive” course is designed to train even a novice in the funda-mentals of software development.
camp’ model for making soft-ware developers began in the San Francisco Bay Area only a few years ago, but has rapidly become one of the most popular methods
of software development. The students and staff of
Prosper IT Academy are very diverse. About half of the current
working men and women looking for a career change. There are also young people, fresh out of high school and college, working hard to become entry-level professionals.
The focus of the training isn’t just on learning the technical skills needed to do the job - it’s on becoming comfortable with the
job market, hiring managers want to see strong skills in communica-tion, teamwork and leadership. The Academy addresses those needed skills through a dynamic combina-
leadership roles, communication workshops and mock interviews.
Finally, they work closely with
Technology Group to help the graduates get hired. So far, says the Academy’s CEO, Jack Stanley,
-ten jobs in IT.
In addition to the individual training Prosper IT Academy offers, they provide customized training curriculums for companies looking to train staff in software development and computer pro-gramming languages. If you have
employees in Python, for example, you can send them down to Prosper IT Academy (as other companies
will have staff that can write appli-cations, websites, programs, etc. in Python.
For more information, send an email to [email protected]. They are located at 12745 SW Beaverdam Rd Ste 210 Beaverton, OR 97005.
Erik Gross, founder of Prosper IT Academy in Beaverton
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 17Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
B e a v e r t o n H i s t o r y
12412 SW Broadway St | www.historicbeaverton.org | 503-430-0106
ON Exhibit• We Remember• Men’s Case (1920s – 1940s)• Early Medicine (1880s – 1930s)• Children’s Games (1920 - 1965)• Country Store (1900s - 1940)• Farming Tools (1890 - 1920)• On the Oregon Trail Display• Beavers of Beaverton Display• Early Farming (1900s – 1950s)
FEATURED Exhibit‘We Remember’ is a military exhibit honoring the veterans of Spanish-American, World War I, World War II, and Vietnam Wars. Come see: the uniform of Cor-poral Ernest Hite, ration books, medals, honorable discharge papers, the use of sphagnum moss and more.
Interested in Local History?Volunteer or become a member! 503-430-0106
Beaverton History CenterBeaverton History Center
History PresentationThe Spruce Goose and how it got to the Evergreen Museum, May 13, 7pm
Learn about the Spruce Goose.
it, why is it wood, when was it
Long Beach, CA, and the move
exciting things are happening at the Evergreen Aviation and Space
in Portland and attended Benson
he was commissioned in the United
squadrons, was an instructor pilot in training squadrons and an air-
commanded both a squadron and an aircraft group. Retiring in
returned to Oregon and taught mid-dle school science in Keizer, OR.
the Evergreen Aviation and Space
was named executive director of
live in Salem and have three grown children and four grandchildren.
Speaker: Larry Wood, Marine Corps Fighter Pilot
Tuesday, May 13, 7pm at The Bea-verton History Center (12412 SW Broadway). Admission: $2.00 suggest-ed donation, members free
For more information: HistoricBeaverton.org, (503) 430-0106
Early Beaverton BusinessesM.P. Cady and Monopole
A familiar photograph depicts -
chandise store in Beaverton about
one-story, wood structure is the
behind the image.
early Beaverton’s most prominent families. Alonzo Brockway Cady,
town’s landmark brick structure. All were politically active leading businessmen.
was the youngest of three boys in a family that moved to Kansas
they would have two daughters and
for good roads as a member of the Oregon Letter Carriers’ Association, and within a few years opened a mercantile.
resigned before the end of his term
notes that he was past president
County automobile dealers’ asso-
popular brand of canned goods manufactured, packaged, and dis-
wholesale grocers and coffee roast-
Samuel, and Frank Kerr to establish
building on Portland’s Front Street.
expanding enterprise relocated to a larger, more advantageous site with
They packaged two product -
pensive Palace Car. Oils and olives from Spain and Italy added an exotic touch to a household’s well-
vegetables, seafood, jellies, spices, peanut butter, and much more. Foods were packed in glass jars, tin cans, and cartons; coffee was the exception. It was sold only in reusable glass containers, patented
homemakers then had a useful con-tainer for home canning, although
in the home makes you ready
customers were requesting out-of-season fruits and vegetables.
Newspaper advertising empha-sized fresh taste, high quality, and purity, important in an era when tinned foods were usually bland
wanted to serve the best natural
than, homemade preserved fare
The many varieties were readily
Cady, and several other retailers
After three decades, the corpo-
story building is currently used as a commercial warehouse in the Pearl District. Listed on the National
legacy of the city’s manufacturing history.
By Ann Koppy, Center Director
For more information, contact:Beaverton History Center 503-430-0106
Fred Willis Cady, Mayor and Builder of the Cady Bldg on
Farmington & Watson
Cady Building, Beaverton’s Oldest Brick Structure
EERR’’SS DAAYSS DDAMMMOOOTTTHHEE att
Oppeneniningg ata 1pm With Full Dinner MenuWith Full DDininnOpNow Accceepting Reservationsow Ac g ResserNo
Fresh Fillet of King Salmon filled with crab stuffing and topped with a Béarnaise sauce and served with shrimp scampi ravioli and seasonal vegetables.
14 oz. Choice T-Bone Steak topped with a Gorgonzola Compound Butter and served with roasted fingerling potatoes and seasonal vegetables.
Dinner Specials and Menu entrees will include our holiday once through salad bar featuring many brunch style salads.
Ernesto’s Italian Restaurant: 8544 SW Apple Way, Portland OR 97225503.292.0119 | [email protected] | www.ernestositalian.com
18 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Ninja vs Samurai Beaverton Roll Tekka Don Monkey Brains
Tonkotsu Ramen
Ask about our Sushi or Sashimi Lunch and Dinner Combination Specials!
Monkey Brain . . . . . . . . . . . . . . . . . . . . . . $7Half an avocado with spicy tuna and spicy crab, battered and deep fried. Served with 3 sauces.Salmon Miso Yaki . . . . . . . . . . . . . . . . . . . . $7Salmon marinated in miso and sweet sake, finished with our house “sweety“ sauce. Tuna on Fire (Sushi) . . . . . . . . . . . . . . . . . . $14Spicy tuna, spicy crab and avocado with pepper tuna on top with jalapeno & garlic chips.Beaverton Roll (Sushi) . . . . . . . . . . . . . . . . . $12Shrimp tempura, spicy crab and avocado topped with seared salmon and eel sauce. Crusty Philly (Sushi) . . . . . . . . . . . . . . . . . . $11Creamy philly cheese, salmon and avacado with a fried corn flake crust.
Dine in or Take out
503-746-6373www.shotendining.com
16165 SW Regatta Lane #500, BeavertonOpen Mon. - Sat. 11:30am - 2:30pm (Lunch),
5pm - 10pm (Dinner)
L o c a l E a t s & Tr e a t s
ALOHA 185th & Farmington18615 SW Farmington | www.eltapatiomexican.com
FULL LOUNGE: Happy Hour3:00-6:00pm Daily (bar only)Daily Food & Drink Specials
503.649.7545503.649.7545
CATERING AVAILABLE: For any event
guichosrestaurant.com
$5 Lunch Special in 5 Minutes or it’s FREE!
BEAVERTONMURRAY & ALLEN
6159 SW Murray Blvd(Behind Shari’s)
503.746.5980
TAPATIOTAPATIO MEXICAN RESTAURANTCelebrating 10 Years in Aloha
Lunch or Dinner
FREE
Coupon
Buy 1 lunch or dinner & 2 beverages at reg. price & get the 2nd lunch or dinner of equal or lesser value free. Lunch value up to $6.25, dinner value up to $8.00.
1 coupon per table. Not valid with other offers or specials.Good at Tapatio or Guichos restaurants. Expires 12/31/13Expires 03/31/14
Swedish Pancakes ..............................................................................$9.553 delicately rolled pancakes, dusted with powdered sugar and served with lingonberry butter.
Three Little Pigs ..................................................................................$8.65Link sausage rolled in 3 large pancakes with apple sauce on the side.
Master Burger .....................................................................................$9.25Deluxe burger, served with cheddar cheese and sliced lean ham, served on sesame bun with all the fixings.
Monte Cristo Sandwich......................................................................$9.25Our own thick french toast bread with turkey, ham and Swiss cheese.
Pot Roast ........................................................................................... $11.95Just like mom’s. Served with creamy mashed potatoes that we made from scratch and fresh sauteed vegitables. Satisfying!
Open Daily: 7am - 9pm
Breakfast served daily till 3pm
Dinners served from 4pm
Join us for Weekend Brunch!
Everyday 3pm - 6pm
join us forHAPPY HOUR
503-590-6030www.cafemurrayhill.com
14500 Murray Scholls Drive #103
Cafe Murrayhill Eggs Benedict .. .. .. .. .. .. .. .. .. .. .. .. 11.95avacado. tomato. spinach. poached eggs. pesto hollandaise sauce.
Club Panini.. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 11.50roasted turkey. applewood smoked bacon. herb mayo. avacado spread. lettuce. tomato. served on sourdough.
Butternut Squash Ravioli . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 17.00gorgonzola. candied hazelnets. balsamic reduction. sage-brown butter.
Grilled Steelhead .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 24.00quinoa. fresh seasonal vegetables. chimmichurri sauce.
C f M hill E B di t 11 95
Enjoy Breakfast, Lunch or Dinner by the Lake at Murrayhill
WELCOME TO GREAT BEAVERTON DINING
dec
arli
italian inspired cuisine...where rustic meets modern
503.641.3223
www.dec
arlir
esta
uran
t.co
m
4545 SW Watson Ave | Beaverton, OR 97005
HOURS
Tues - Thurs: 11a - 11p
Fri - Sat: 11a - midnight
Sunday Brunch: 10a - 2p
Happy Hour 4p - 6p
503-616-2416 | watsonhallbar.com12655 SW 1st Street, Beaverton
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 19Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
R e s t a u r a n t R e v i ew
La Hacienda Real Mexican Restaurant
Arestaurant reminds you of a
hacienda means “a large estate or plantation with a dwelling house”. As you walk in, you are immedi-ately greeted with bienvenido or “welcome” and that’s exactly how I felt. The restaurant is adorned with bright colors, traditional Jaliscomurals of farm life.
Jose Arechiga is the General
is the owner and together they run
run restaurant opened in Salem
I’m not kidding. Jose told me that
dispersed throughout the four eat-eries! The restaurants are known for their homemade tortillas (more on that later) and margaritas. The Beaverton location is the only one with an open air patio and full bar (I assured Jose that I would men-tion this little detail).
menu is extensive, serving Jalisco-
about what Jose and his family were going to serve. I think their three choices were spot on:
������Chicken Fajitas (Price: $12.95)
you can share with a loved one. The chicken is grilled into a secret sauce and presented in traditional, sizzling fashion to your table
beans, rice, sautéed onions and green peppers, pico de gallo, sour cream, guacamole and homemade
are what make this plate so tasty. There’s something so refreshing about having homemade tortillas with your meal. Store-bought tor-tillas leave little to be desired. The tortillas are the vessel to hold all of
to force myself to stop eating since I had two more dishes to go!
�������Pollo Mazatlan (Price: $12.95)
editor of the BRG loved this dish.
and this plate has plenty. In all, the charcoaled grilled chicken is served with guacamole and topped with a cream sauce, the aforemen-tioned mushrooms, onions, celery and carrots. The chicken has a smoky quality, thanks to the char-coal, and pairs well with the cream
had a stew-like quality which I found unique, but inviting.
������Burrito Chipotle (Price: $13.95)
I harken this to a wet burrito, since it is topped with a cream
with grilled chicken breast and bell pepper and onion. It is then
and fresh peppers, lettuce, tomato and sour cream. Essentially, this
is a simple dish which I like. The chicken, as the other two dishes have been, is tender and perfectly cooked. The veggies are fresh not overcooked.
All three of these dishes come with beans and rice and as I have talked about in a past articles, tasty beans and rice is a telling sign to
-plishes this in addition to their fabulous tortillas.
-ing anything alcoholic so I unfor-tunately was unable to try their award-winning margaritas (I guess I will have to make a personal trip back soon). Overall, this is a nice establishment, with the right mix of scenic décor and delicious options. Thank you to both Joses, for inviting us into your hacienda.
Until next time, these were my
going to try?Story & Photos By Greg Mattie
Mexican Restaurant
503-601-7000 | 12025 SW Canyon Rd. Beaverton | Open: Sun - Thurs: 11am - 10pm, Fri - Sat: 11am - 11pm
Enjoy Authentic Mexican Food at its Best!
Dine-in or Take-outPollo Fundido ...................................................................................$13.95Deep fried four tortilla filled with chicken breast and monterey jack cheese.
Burrito Chipotle ................................................................................$13.95Wrapped flour tortilla with grilled chicken breast, onion and bell pepper.
Suiza Enchilada ..................................................................................$9.95Two corn tortillas stuffed with your choice of filling with a delicious green tomatillo sauce and melted cheese.
Arroz con Pollo .........................................................................$11.95Boneless chicken breast sauteed in a traditional sauce with mushrooms, carrots, celery and spring onions.
As a graduate of the Le Cordon Bleu Program in Culinary Studies, I enjoy experiencing the fine dining avail-able at so many of our local eating establishments. Beaverton has such diversity to offer the curious palate that it’s hard to know where to begin. Well, now you can start your month off right here with me and my 3 Dish-es Review.
Greg may be contacted at: [email protected]
20 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Beaverton Infinitiwww.BeavertonInfiniti.com9500 SW Canyon Rd, Portland / (888) 319-6583
The Infiniti Q50Powerful. Luxurious. Revolutionary.
And now available at Beaverton Infiniti.
C o m m u n i t y N ew s
Automotive Q&A: With the Beaverton Car Guy
Q: I left my dome light on over-night and I was surprised &
relieved that my vehicle started. If my battery is fully charged, how many hours could have passed for me vehicle to start?A: Different vehicles have different amounts of interior lighting, so in most cases on a newer vehicle, or a vehicle with a new or recent battery, the interior lights would easily stay on, as well as allow the vehicle to start after a 12 hour period. If it were the headlights, they draw a much greater amount of power so the time is greatly reduced. I think that 6 hours would be the maximum amount of time.
Q: Last February we had a big snow storm, I had to use my tire chains, however my neighbor men-
tioned that his snow tires worked just as well if not better. Is this true?A: It is well known that snow tires are far better in the snow & ice than highway tires, however getting going in slick driving conditions is certainly a plus, stopping is quite another story. The addition of chains when there is snow or ice, provides much better traction, not only for getting the vehicle going, but it will help the vehicle to stop as well. Most accidents during slick driving conditions occur, due to inability to stop your vehicle.
Larry has been in the automotive industry for over 25 years and has several degrees in automotive technology. Although currently working for Beaverton Infiniti, Larry prides himself on shooting straight with practical, unbiased information and advice.
If you have an automotive question for the Car Guy, please email us at: [email protected]. For all other questions, call Larry at 503-930-1493.
By Larry Ferguson New BusinessSpot l ightBIO Force Youth Fitness
Acenter in Beaverton Oregon that was developed to provide children, their parents, and coaches proper strength training tech-niques, proper nutrition, and proper bio-mechanical development in an effort to battle youth obesity to promote a healthy lifestyle, increase injury prevention, excel in sports, and empower them to
specialized strength equipment has -
Now kids have a place where they can work out, whether they want to increase their sports performance and become a better athlete, or they just want to work out in a
variety of different programs for kids and parents including personal training, circuit training, group training, long term development, after school programs, boot camps, summer camps, and much more.
For More Information, contact Tyler: 971-238-0048 www.bioforceyouthfitness.com
New Natural PlaygroundComing To Cedar Hills KindergartenTKindergarten and Preschool
old parent-child cooperative school in North Beaverton, are swing-ing into full gear to build an entirely new kind of play-g r o u n d that will give chil-dren even more opportunity to direct their play using their imag-inations and creativity rather than allowing play equipment to dictate play time.
Nationally renowned nature playscape designer Leon Smith with Earthplay (www.Earthplay.net), has been working with the students, teachers and parents this year to design a unique nature
imaginations surprise their senses, and allow children of all abilities to interact with nature as they play
Research shows that chil-dren who play regularly in nat-ural environments show more
coordination, balance and agility. Children also develop observation and social skills as they interact with their peers.
“ T h e new natural playground will be a barri-e r - f r e e , i n c l u s i v e playground for our c o m m u -n i t y , ” said Lori
Gamroth, Three’s Teacher and Playground Committee Chair, “Everyone is invited to join us in building this extraordinary playground for our children. As a
for local community business support—both monetary and labor—especially anyone in the construction arena.”
by Kristie Cox
Build dates will begin in June continue through August. Everyone is welcome. For more information or to find out how you can contribute email Teacher Lori at [email protected].
Learn more about Cedar Hills Kindergarten & Preschool at www.cedarhillskp.org.
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 21Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
Traffic Q&A: With the Beaverton Police Department
Q: My mother is disabled and does not drive.
There are times that I go to the store for her while she stays home. Because I’m shopping for her, can I use her permit to park in a disabled space?A: (No) Oregon Revised Statute 811.625, “A person commits the offense of unlawful use of a disabled persons parking permit if the person is not a person with a disability and is not transporting the holder of a disabled person parking permit to or from the parking location; and uses a disabled person parking permit.”
Q: I have noticed that more and more cars are equipped with these super bright white head-
lights, sometimes in different colors. It sure makes driving more difficult when the on-coming vehicles use these lights. Are these headlights legal?A: Although there is a section in the Oregon statute regarding headlight specifications (ORS 816.050), Oregon has adopted the Federal Department of Transportation’s definition which does indeed allow for many of these kinds of headlights. Use of high beams or having misaligned lights that would shine into oncoming traffic is enforceable under ORS811.520 and/or ORS816.300.
Q: I heard that jaywalking is only an offence if the nearest cross streets have signals like in a com-
mercial district. But can one technically get a jaywalk-ing ticket for walking across a residential street in a quiet neighborhood?A. It’s possible. Part of ORS 814.040 (Failure to yield to vehicle) says “Pedestrian Fails to yield the right of way to a vehicle upon a roadway when the pedestrian is crossing the roadway at any point other than within a marked crosswalk or an unmarked crosswalk at an intersection”. Beaverton code 6.02.510 Pedestrian must use available crosswalk says “ No pedestrian shall cross a roadway outside of a marked crosswalk if within 150 feet of a marked crosswalk”.
If you have a traffic question that you'd like us to ask the Beaverton Police Department for this column, email us at: [email protected] (For all other police questions, call the police non-emergency number: 503-526-2260)
Beaverton Police Department2014 Police Service Awards Ceremony
Police and the public gathered at Southwest Bible church
whose actions during the calendar -
We have included a list of recipients as well as an edited version of their actions.•
for providing training guidance and support to new and veteran reserves.
• was honored with the Citizen Commendation Award after he helped pull a woman to safety after threatening to jump off an overpass.
• Civilian Eileen Rice was also honored with the Citizen Commendation Award after she witnessed a robbery/assault and took cell phone pictures of the suspect and suspect auto as he
in part, led to his capture and conviction.
• Civilian employees Traci
service to the city.•
retired, was recognized for his years of service to the agency and city.
•
Beane and Rebecca Cline were given a Unit Commendation for their work in the training division that included stream-lining the in-service training and developing a self-defense program for victims of domestic violence.
• bestowed on Sgt. Robert Davis
their actions in taking into custody a suspect high on drugs
received during the same incident.
•
acknowledged for life saving efforts locating a suicidal person
into a local park.• -
food and saving his life.•
the life of a man threatening to jump off of a parking structure.
• Detectives Jason Buelt and Alara DeLand received the
their work on a counterfeit ring that worked the metro area.
· honored with the Distinguished
· The Dan Bortolin Community
recognized for her work in the schools and Katrina for her work with crime victims.•
Team.• The Civilian Employee of the
work as the departments False Alarm coordinator.
•
honored for nine years of ded-icated service as a team. Barak retired at the end of last year.
• The Chiefs award went to
his work with the FBI and the Regional Computer Forensics Laboratory.
Our sincere thanks to Southwest Bible Church for hosting the event for the third straight year.
By Officer Mark Hyde
For questions about this story, call the BPD at 503-526-2260
C r u i s i n ’ B e a v e r t o n
3725 SW Cedar Hills Blvd., Beaverton, OR 97005 | kunicollisioncenter.comLuxury Service
at affordable pricesLuxury Service FREE Estimates
Rental Cars available onsite
Lifetime Warranty on all workmanship
503.372.7563Oregon’s only BMW certified collision center
By BPD Staff
Welcome Spring SafelyTips from Your Friends at TVF&R
Spring has sprung and many of
into the yard and cleaning up from winter. As you head outdoors and your body awakens from winter’s
some stretching exercises before you dive into your yard chores. This can help you feel better overall and may reduce yard work-related muscle strains and pains.
Remember that ladders are tools. If you need to climb a ladder, make sure someone is there to keep an eye on you and help steady the ladder. A Consumer Product Safety Commission (CPSC) report on
ladder safety showed that more than
room treatment from ladder-re-lated injuries every year. Ladder accidents are entirely preventable. The following four causes account for the vast majority: selecting the wrong type of ladder, using worn or damaged ladders, incorrect use of ladders, and incorrect placement of ladders.
As you open your doors and windows to spring, consider the following:
•
fall involving a child of the season in April. Remember that screens are meant to keep bugs out, not children in. Install window stops to windows you want to open no more than four inches.
•
your doors, patios, porches, steps, and walkways are well lit and clear of obstacles.
• secure and in place and use them.
• Even if you’ve cleaned that walkway from winter’s moss, keep in mind that there may still be uneven or slippery areas.
urges you to consider these tips as you get outside and smell the roses during this beautiful time of year to ensure that your spring is safe and enjoyable.
By TVF&R Staff
For more information, visit www.tvfr.com.
SAFETYSpring
By BPBBPBBPDPDDDDBPDBPDPDDPDD SttStStSSt fffafff
22 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
C o m m u n i t y N ew s
Providence Elderplace Maintaining Dignity & Emphasizing independence for our Seniors
Senior Citizen’s Advisory Committee
As we age, we all want to remain as independent as possible.
that independence, we look for programs to provide options. Providence ElderPlace offers an option to help keep older adults healthy and independent as possi-ble. They provide comprehensive, high quality health care and social services tailored to meet the unique needs of each individual.
This is a long-term health plan that strives to keep participants out of the hospital and rehab. It is a Program of All-inclusive Care for the Elderly (PACE), a federally recognized program which offers total care and enhances the quality of live for seniors.
receive medical and social ser-vices while attending one of
receive those services in their own home. Transportation is provided to and from medical appointments and to the social center.
This program is open to anyone
counties who is 55 or older and in
by the state of Oregon. The cost?
services. Those who do not qualify
ElderPlace premium. By Beverlee Ryan
For more information phone 503-215-6556 or online www.providence.org/elderplace.
About the Senior Citizens Advisory CommitteeServing as a liaison between Beaver-ton’s senior community and the City, the SCAC is here for you!
Edgewood DownsIndependent Retirement Community
Come and join us for
Resident Spring ConcertMay 10th at Noon
Immediately followed by a Complimentary Lunch
Please RSVP at 503-643-5418Reserved Seating
7799 SW Scholls Ferry Road, Beaverton, OR 97008 | 503-643-5418 | www.holidaytouch.com
May 10th at
Noon
Speeder Spotlight: Moving for SeniorsFor those of us who have been
more years we have managed to accumulate a lot of “stuff”. The very thought of tackling the clutter can be discouraging. The organizational and physical tasks associated with planning and accomplishing a complex project can be overwhelming. That’s when an experienced, non-judgmental professional can be invaluable: with high energy, enthusiasm and expertise, the worry and the work are taken off your shoulders.
Karen Brandenburger, owner of Smooth Transitions of Portland LLC, and a member of the Smooth Transitions national network, pro-vides individuals and families the emotional and physical assistance needed to make a change in living arrangements. Services include pre-move planning, deciding what to take to the new home, moving
-ing, unpacking and setting up the new home, and taking care of all aspects related to closing out the former home.
Over the years, Karen has developed useful guidelines for folks thinking about or needing to make a change. Try a “virtual move”: take a look at your stuff and ask yourself the following questions:
Do I actually use this? Does this work properly and do I know how to use it?If I get rid of this, how hard will
need it?
own versus how many do I really need?
5. Is this a memento I want to keep?
6. Am I keeping this because I’ll
feel guilty if I give it away?7. And, most importantly, do I
love it? Karen is a graduate of George
Fox University with over twen-
professional project manager. In addition to helping seniors and their families make smooth transitions in life, she is a mem-ber of the National Association
Better Business Bureau, Tualatin
Gardener, and a weekly driver for
Remember to check your speed and enjoy the ride!
As former chair of the SCAC, Jolene Guptill has been advocating for Beaverton seniors for the past 12 years and continues to bring awareness to senior issues and news through the BRG.
Questions? Contact:Jolene at: [email protected]
MINIMUMSPEED
55YEARS OF AGE
OR OLDER
Last October, Of cer Anthony Jenkins of the Beaverton
Police Department received word that a woman was in “the woods” intending to kill herself. Her whereabouts were unknown, so Jenkins called Brady Schwartz of THPRD’s Park Patrol and asked if he might have an idea where she could be.Schwartz had a hunch, and it was a good one. He led Jenkins to a spot deep in the forest off the Fanno Creek Trail, and there they found the woman, wet and barely breathing but alive.Schwartz helped Jenkins carry the woman about 150 yards out
of the woods. He also called emergency personnel and helped them determine the exact location so they could get there ef ciently to render aid.In a letter of recognition to the district, Jenkins wrote, “Schwartz had a calm and collected demeanor throughout the call and followed direction without hesitation. Schwartz was integral in the successful retrieval...from the woods. Without Schwartz’s knowledge of locations within the park (she) would not have been found.”For his efforts, Beaverton Police honored him on April 3 with a citizen commendation award. Schwartz also was selected as a quarterly winner of THPRD’s “PRIDE” award, which is presented to employees for extraordinary service.Schwartz has had a special
connection to BPD since high school when, in the darkest hour of his life, his father committed suicide. Of cer Mike Rowe helped the young man get through it.“He reached into his pocket and pulled out his business card,” Schwartz recalled. “He wrote on it, handed it to me and said, ‘This is my personal cellphone. Anytime you need anything, even if you wake up in the middle of the night and need someone to talk to, call me.’ ” Schwartz never forgot the gesture and showed his gratitude in a personal way last fall after Rowe’s wife, Kendall, died of colon cancer. He helped raise money in Kendall Rowe’s name for OHSU’s Knight Cancer Institute.“Doing the fundraiser in my wife’s name, it was very attering,” Rowe said. “Most of us get into law enforcement because we want to
help people.”He added, “I’m glad it stuck with him, and that he’s trying to do things to help other people. He’s paying it forward.”
Before & After
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 23Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
Active retirement at it’s best!
5450 SW Erickson Ave. Beaverton, OR 97005
Call Julie Miller to schedule your lunch tour today!
503-643-9735www.creekside-village.com
S p e e d e r N ew s . . . f o r S e n i o r s !
503.646.0635
12900 SW 9th St, Beaverton, OR 97005 | www.BeavertonLodge.com
Take the plunge!
Call or stop by today. We look forward to
showing you around!
We have some of the largest studio, 1-bedroomand 2-bedroom apartments in the area.
Prices start at $1,695, including all utilities,(except telephone) and you will enjoy your weekly
housekeeping and linen service along with a
Heated indoor mineral saline pool with seniorwater aerobic classes, art gallery, full activity
schedule and so much more...
Join us for Retirement Living at its Very Best!
Life is Great at Beaverton Lodge!
Elsie Stuhr Center
21st Annual National Senior Health & Fitness
Day, May 28th
Make A Move Toward Better Health on May 28th, 2-3:30pm•
Introduction •
•
The Elsie Stuhr Center is designed for adults 55 years and better. Classes, trips events, fitness center, lunch and friends.
For more information, call us at 503/629-6342 or stop by for a visit.
[email protected] | (503) 590-8562
Right-SizingDone Right!
MOVING for SENIORS . com
Food for ThoughtEating Right at the Farmers Market
ello Beaverton, with the sun shining upon us, isn’t it time
to think healthy, look healthy and be healthy? Forget all those diet books and let’s start having fun by heading down to the Farmers
Losing weight and being healthy is as simple as that!
Today’s family can gather at our local farmers market to hunt for goodies, visit with our local farmers and choose fresh produce among the plentiful spring harvest! The yield at this time of year brings a variety of greens as well as car-rots, beets and asparagus.• Any of these vegetables would
be wonderful combined with a complex carbohydrate in the form of whole grains, pasta or
potatoes. •
produce from the market with a lean protein.
• Serving a meal with ingredients from just two different food groups will ease the digestion process, allow the body to absorb more nutrients and eliminate indigestion and acid
• Finish the meal with a salad and you will be keeping in the vegetable family of foods.
it be fresh fruit or from a variety of delicious baked goods that are also quite plentiful at the mar-ket. Remember to eat it mid-day because the digestion process for
sweets can take up to two hours.
Have fun, eat well and remember, “Let food be thy medicine!” - - Hippacrates
Celia Lambert has earned her PhD in Holistic Nutrition and fine tuned it through the school of life. She is the mother of six happy, health children. Questions? Contact me! [email protected]
Learn to Draw & Paint Loved ones, pets and family members!
and observe the class, then sign up for this most fun and rewarding type of artwork learning. To register, contact Kumi Pickford:
[email protected], 503-436-8502, www.kumipickfrord.com
t me! celia.lam
healthy and l those ddddddieeieeei tt t ttttthaving ffffffffffffuunununununnunnunnu
the Farmemeemememmmememmmmmemmmmmmeeerrsrsrssrsrss
ng hhhhehhhhh alalthhththy yyy is
an gggggggaattatattataataaa hhhhehhhhh rr r at rkettttttttt tttttttttto ooooooooo hhhuhhh ntntnttt th ooouuuuouooooo rrrr r lolololollololocal esh ppppppppprororodududududududuucecc ring hhhhhhhhhhhararraaa vevev st!!!!f year bbbbbbbbbbririiringn s well as ccccaar-us.bles would nenedd iwi hth raratete in the
produce frolean protein
• Serving a mfrom just twgrgggggggg oups willprprprrrrocess, allabbbsorb morelleelelliminate in
• FFFFiFFFFFFFF nish the maaaanaaaaaa d you wivevvvv getable f
it be fresh frof delicious balso q iuitete ppket. Reme emembb
24 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
C o m m u n i t y N ew s
The Care & Feeding of Your HomeHow to Earthquake Proof Your House
Growing up in Portland, I remember hearing about the
“big one” that scientists were cer-
each major earthquake that occurs somewhere else in the world, we are reminded that we are sitting on
sense then that it is not a matter of “if”, but a matter of “when” it will strike here.
-
years ago is that they have virtually no building codes. Construction technique in that situation is left
had building codes in place since -
general, won’t withstand an earth-quake as well as newer ones.
And, just so there’s no mis-understanding, seismic building codes are not designed to build earthquake proof structures, rather they help us build earthquake resistant structures. The intent is to build something that won’t collapse on the occupants and will allow them to escape safely.
For the most part, old fashioned building techniques simply relied on gravity to hold a house on its foundation, so the addition of anchor bolts through the sill plate into the concrete makes good sense. But, that only keeps the house from sliding off the foundation.
Once the house is anchored in place, shear wall hold-down anchors should be attached at each corner. This will keep the house from being tipped over like an old
All post and beam construction under the house should be tied together to keep the posts from coming off their piers and to pre-vent the beams from sliding off the
posts. Gravity is great so long as all forces are straight down. But when the earth begins to pitch and roll and twist and heave, all bets are off for any parts of the house that aren’t tied together.
Now, let’s go back into the house and see what we should do in there to make things safer. If your water heater isn’t strapped to a nearby wall, it should be. In a major earthquake, this container
precious commodity you will ever
spill out could be the difference between life and death. Of course,
full of water tip over can also cause a lot of serious damage, too.
Are they all attached to the wall, so they won’t tip over and crush someone?
Outside your home, do you have an earthquake wrench strapped to your gas meter, so you can shut the gas off at the source in the event the gas line gets broken? They’re
-able on line or at many plumbing supply and hardware stores.
That’s a real quick primer on earthquake protection for your home. If it’s something you really want to investigate more fully,
kxl.com and I’ll be happy to point you in the direction of some good contractors who can discuss it in a lot more detail with you.
By “Handyman Bob“ Strong
Handyman Bob offers home improve-ment advice on his radio show, Around The House, every Saturday from noon to 2:00 on FM News 101 KXL.
And, during the week, he is the Development Director for Molly’s Fund Fighting Lupus. For information on this debilitating disease, visit www.mollysfund.org.
Zoo News is Good NewsSet For Another Summer Concert Season
country singer’s favorite
where the word is overused, and
kicking off a summer’s worth of fantastic music.
-mer concert series — presented by Regence BlueCross Blue Shield of Oregon, the Oregon College
-concerts.com.
“Nothing says summer in Portland like a warm evening on the concert lawn listening to some great music,” said Kim Smith, zoo director. “And the best part is these
for animal welfare, education and conservation.”
This year’s series brings some familiar faces back to the zoo.
will close the series with two
And, really, are there more familiar faces than Pat Benatar and Rick
with all-time greats and some contenders. For more information, including show times and a full schedule, visit zooconcerts.com.
New this year: Tickets printed at home come with a coupon good
-age purchases (excluding alcohol) at the AfriCafé, right next to the concert lawn. Coupons are vali-dafter 5 p.m. on concert nights.
By Oregon Zoo Staff
Spring Hours thru May 24: 9am to 4pm, grounds open until 5 p.m.
14611 SW Teal Blvd, Beaverton, OR 97007 | 503-579-2403
“Wholesome Grub for the Pets You Love!”
Locally Owned and Operated
Successful Business Expo West 2014“Sustainable Impact”Obusiness professionals gath-ered for BESThq’s Business Expo
and the Triple Bottom Line,” the business-business event demon-strated true community in action featuring student volunteers from Portland Community College and
-itors created lasting relationships fueling our growing and vibrant economic recovery.
Attendees found themselves amidst hundreds of business build-ing opportunities from large, small,
dedicated to making a difference
action, food was readily available thanks to local food vendors includ-ing Curry and Crust, Red Tomato
industry sectors demonstrated the diversity of our recovery and community opportunity. BESThq
the crowd introducing Beaverton
Journal editor Suzanne Stevens and
Event highlights included spe-cial lounges where participants could interact with selected special guests. The theme of sustainability
-nies was explained in more detail
Bank, a B Corp. Once the par-ticipants understood more about
-
Building Services, Kate Taylor from Beaverton Recycling at
Better Business Bureau discussed the importance of the triple bottom line. Presented by BBSI, the line-up of special guests included State
School District Superintendent Dr.
By Chelsea Ploof
Attendees (and those not able to attend) are encouraged to reunite with all of their new connections at ReCONNECT on Friday, May 16th , 4-6 PM at BESThq in Beaverton, 12745 SW Beaverdam Road. For more informa-tion visit besthq.net.
Th CTh C
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 25Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
Te e n T h i n k i n g
Musings of a Beaverton TeenRight is Wrong: How our school system does not help everyone
ave you ever felt like your teachers’ lessons don’t make
sense to you? Are you more of a hands-on, visual learner? Some of us teens are right-brained ori-ented, but the school system is designed almost exclusively for the left-brain.
Which are You?So what am I talking about?
Simply put, the right brain is in charge of the “overall picture” in your mind, as well as creativity, music, art, and emotion. The left brain is in charge of reasoning, numbers and words, analysis, and linear/straight-forward thinking.
sides, and a few people have an
each. No matter which brain is more of your style, it’s clear that
-ferent ways of thinking and under-standing the world.
discover the type of brain you are:
http://en.sommer-sommer.com/braintest/
The Impact on SchoolworkAnd our society doesn’t honor
that. It seems like to me that the way we’re taught to think is that the left-brain is the only worth-while brain. In school, the lessons are taught in a very left-brain heavy style, with lectures and very little
-cally art-oriented classes. I’ve seen so many of my peers become frus-trated and hateful towards school because they’ve never found a way to fully understand or connect to the work. That doesn’t seem good at all. There’s been so many times when one of my classmates asked for my help during school and I
my thinking to them. People so obviously have different ways to learn, yet we’re all placed in the same styles of learning.
variety in the styles of schoolwork to make sure that all doors are open for every brain-type. Perhaps more creative, hands-on activity in the classes that usually don’t have that sort of thing, like in math or science. There needs to be an equal amount of logical, black-and-white lessons and creative, colorful classes, and that is not the case now. I feel like there would be a better appreciation of schoolwork and learning if we have variety and newness in every lessons.
Overall, teens shouldn’t be dis-advantaged if they have a different style of learning. The ability to solve equations and other left-brained activity is very important, but so is the creation of artwork and originality in ideas and styles of the right-brain. If you have either brain, you should be cele-brated for being an individual and given equal opportunity.
By Brigid Fitzpatrick
Brigid Fitzpatrick is a student at Southridge High School. She is an active member of the Color Guard and hopes to pursue a career in journalism one day. Brigid is an intern at Cedar House Media.
Busy Beavers: Outstanding Students at Beaverton HighIntroducing Kaya Patton and her visit with Vice President, Joe Biden
Spring Break is an exciting time for any high school student.
Some students get to travel, some spend their time hibernating to make up for lost sleep, but few can say they had dinner with one of the most powerful men in America:
student, senior Kaya Patten, could make such a claim.
lives. Some of the most important women in the United States were in attendance, including Supreme Court Justice Sonia Sontemayor and, of course, Dr. Jill Biden. Patten’s mother helped work for Susan Bonamici’s campaign and was invited to accompany her to the dinner, an invitation she and her daughter excitedly accepted.
The dinner was not the tradi-tional sit-down meal that most were anticipating. They served appetiz-ers such as crab puffs and quarter sized ice cream sandwiches, which were to die for, according to Patten. Though it was not what Patten had envisioned, she was still not disap-pointed at all, “It was amazing. The
it was relaxed, but there was a buzz of intellect which was really fun.”
At the event, Patten listened to the vice president discuss how women are sculpting the United States. Then Dr. Jill Biden’s presented what she would like to see happen for women in the future. For Patten, the experience was almost unbelievable, “Every time we turned a corner there was someone really important standing there… it was crazy.”
Patten even had the opportunity
to talk to the vice president him-self, and was surprised at how
got to meet him afterwards and he
Kaya, I’m a senior in high school, I’m graduating soon,’ and he was just so excited about that, he told
-uating high school!’ and I was like
For Patten, it was an experience she wouldn’t trade for the world. “I’ve gone to work with my mom and I’ve lobbied and I’ve talked with powerful people but never that many that quickly, and I learned a lot about presenting yourself and introducing yourself and talking yourself up.” As an aspiring politi-cian herself, this will certainly be a day to remember.
By Hailee Meacham and Laila Mottaghi
Hailee and Laila are senior editors of Beaverton High School’s newspaper, the Hummer, and enjoy reading, writing, and watching documentaries. You can contact them at: [email protected].
Virtual Office Space
Jackie Butts(503) 734-8885
Identity theft solutions, to make your world a safer place
Independent Insurance AgentServing Portland to Salem
(503) 307-4811 Guiding You Around Life’s Bases
Edible Sculptured ArtCakes, Pies, Pastries and More!
*I MAKE SMILES* www.KatisCakes.com
503-961-4397
Sustainable construction Framing and Drywall
(503) 646-6164 www.bronzeconstruction.net
State-of-the-art technologyTraining & Prints
[email protected] Located at BESThq
RESOLVING your commercial& residential pest issues
(503) 895-2510 www.pestsolutionsllc.com
Green As Can Be
Residential, commercial,Maintenance construction
(503) 231-9444 www.nwrconstructionllc.com
Creating unexpected value
Join our business community and take Your business to the next level!
503-626-1700www.BESThq.net
Virtual Office SpaceCollaborative Business Community,
Conference Rooms & More!
FREE Business Event
Join us Tuesdays at 7:30am for our Executive Briefing!
Connections, opportunities, events, and more!
Join Us!
New Location inDowntown Beaverton
12745 SW Beaverdam Rd
Canyon Rd
Ceda
r Hill
Blvd
Wats
on R
d
Kaya Patton (far left) with Vice President Joe Biden
26 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
Vendor Guide
Offering an exclusive selectionof Oregon wines, handcrafted by our dedicated winemaker.
www.ArcaneCellars.com 503-868-7076Booth # 118
From our hives to your homeLocal raw honey, creamed raw
honey, bee pollen, royal jelly, and more. www.tbshoney.com
503-858-7207Booth # 35
41Pine Mountain
Ranch
43Spring Hill
Organic Farm
24Lady-Lane
Farm
67Moh'sMobileKitchen
59Ken & June’s
Hazelnuts65Stephens Farm
67Kuys Cambodian
Sauces
57Kimo’s Dips &For the Love
of Pasta
55Henry Higgins Boiled Bagels
52Sun Gold Farm
69Champoeg Farm
70Garden Lane Farm
51
49Pumpkin Ridge
Gardens
48PearsonNursery
71Stoller Farms
78Humdinger
Foods
80Martinez
Family Farm
83Decadent Creations
87Willamette Valley
Cheese
88DeNoble's FarmFresh Produce
91Rose City
Pepperheads
95Kaleng
Produce
98Salmon
Creek Farm
136Ambacht Brewing
128May's Produce
and Flowers
127Price Right Nursery
and Produce
126Portland
JuiceCompany
135Bloominghill
Vineyards
145ELA Farms
146Rainbow Nursery
123May's Produce
and Flowers
122Grandma Candys
Jam/Country CharmAcres
121Sweet Briar Farms
120Tabor Bread
119Zoe Ann's
Cheesecakes
117NW Cactus &
Succulents
139House Spirits
Distillery
140New DealDistilling
141Eastside Distilling
143Pete's Mtn. Perennials
138Wild Roots
Vodka
130Loibl Farms
147Mak Lilies &
Perennials, Inc
148Greenville Farms
149Northern Pacific Farm
152Liepold Farms
154Happy Campers
Gluten Free
155Happy Cup Coffee
9SimingtonGardens
184Clint’s Ice Pops
181Fetzer’s German
Saugage
104It’s
PartytimeCatering
111McCarthy’sBeverages
101-5Malou's Gourmet
Brittle
101-4Olympic
Provisions
101-9Don
Felipe
101-10EsoticaPasta
15Briar Rose Creamery
16Margie’s Buds
and Blooms
101-8March
Biological Control
115Country GrainsDeli & Catering
177Smokin
RoseBBQ
161Casa deTamales
164McCarthy'sBeverages
175Liquid
Sunshine
173C’est
Si Bon!
166Homemade
HappyCuisine
167Gabriel'sBakery
168PBJ's
37Fressen
Artisan Bakery
1Greens Bridge
Gardens
4Skipanon
Brand Seafood
29Denison Farms
25The Berry Patch
34SOMA Evolutionary
Refreshment
36Portland Creamery
38Souper Natural
39Sterling Cookies
40Hammer & Tuffy's
23Danielle's Sauces
18N & M Herb
Nursery
169Big O’s
DeliciousPizza
102Master
Gardeners
105GatheringTogether
Farm
113Pony
Espresso
56True Nature
Parking
178-AEdgemaster
MobileSharpening
7 Alex Farm
11Packer
Orchards
172Feastworks
97Feastworks
101Nut-
Tricious Foods
101-1Simply Grown
Beef
101-3Pacific
NW KaleChips
118Arcane Cellars
157Hoda’s Middle
EasternCuisine
84Linda
Brand Crab
103Bleu
DiamondDressings
101-7DovetailCoffee
101-6Bone Yard
Bakery
92ProFarmProduce
125Quinn’s
Crab Cakes
109Unger Farms
100Hummus
Stop
73WintersFarms
85Lonely Lane
Farms
58Sedum Chicks
61Red Pot Spot
165IC
Confections
33AlottoGelato
35TBees
MusicStage
Hand made & local dressing.
Do you like fresh chopped garlic, pepper & chunks of bleu cheese?
Stop by our booth for a treat.Booth # 103
Ageless WinesYou Can Drink Right Now
Lovingly Handcrafted. Tasting room open F- Su. 503-992-1196
www.abloominghillvineyardBooth # 135
Exceptional coffees from around the world
artfully roasted with pride in Beaverton OR.
www.dovetailcoffee.comBooth # 101-6
Fresh Falafel SandwichesAll Local.Flavorful.Made from
scratch! Stop by and try our Leba-nese Omelette! Gluten Free
Menu. www.hodas.comBooth # 157
Fresh Dungeness CrabAlso salmon, halibut, tuna,
rock fish, oysters and more! www.lindabrandcrab.com
866-569-4891Booth # 84
100% Grass Fed Beef Heritage Pork
On-Farm USDA processing www.lonelylanefarms.com
503-845-4252Booth# 85
Continued on Next Page
M U I Cat the Market
MAY3rd: Beaverton Community Band
10th: Water Tower Bucket Boys
17th: Boka Marimba
24th: Sandy Saunders Band
31st: Water Tower Bucket Boys
WHATS IN SEASON?
May: Asparagus, Rhu-barb
June (early): Aspara-gus, Cherries , Greens, Herbs, Rhubarb, Straw-berries
June (late): add Rasp-berries to the list
July (early): Apricots, Beans, Beets, Black-berries, Blueberries, Broccoli, Cabbage, Carrots , Celery, Cherries , Cucumber, Eggplant, Gooseberries, Greens, Herbs, Nectarines, Peaches, Raspberries, Strawberries , Summer squash, Tomatoes
Message From the Market MasterJoin us for Opening Day at the Beaverton Farmer’s Market: Saturday, May 3rd from 8am 1:30pm.
F
open for the summer season on the
Day weekend, but this year the market is expanding the summer
This year, the market boasts -
brand new vendors, including Tabor Bread, Jacobsen Salt Co.,
another record-breaking season, -
asked about the lengthened season, Ginger states, “our vendors have
responded to the nearly year-round demand for their products, to the point where there are only two months in the year when we do not have a market. Opening our regular Summer Season market a week earlier this year was a logical extension of the increased supply and demand for locally produced plants, produce and artisan foods.”
On opening day, the market will showcase an outstanding selection of locally grown and crafted prod-ucts from local farmers, produc-ers, and artisans. The Beaverton
largest selection of nursery stock available at any regional farmers market including lush hanging baskets, veggie starts, annuals,
Beaverton Farmers MarketSaturdays: May - November (8am - 1:30pm)
Located on SW Hall Blvd between 3rd & 5th Streetswww.beavertonfarmersmarket.com
To Key Bank andFarmington Rd
- 3rd St -
- 4th St -
- Was
hin
gto
n A
ve -
- H
all
Blv
d -
To BeavertonArt Court Booths
�� �������������
To Beaverton City Library
Beaverton City Park
To Public Restrooms,Playground &
Fountain
Just for Fun
I
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 27Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
B e a v e r t o n Fa r m e r s M a r k e t
Vendor SpotlightMoh’s Mobile Kitchen (Booth # 67)
authentic Pan-Asian food?
that’s never hit the food scene?
where all these wonder can be found and more. From our wide selection that is customizable to any customers liking, we make even the most selective taste buds
From our famously known Pad
Thai that put us on the map, to our fresh salad rolls and eggroll wraps handcrafted right in front of you to name a few, we offer a selection of items that can be consumed at
and Gluten-free options are also available, as we want everyone to
not want to miss our unique take on Pan-Asian cuisine every Saturday
and a wide variety of the beautiful nursery stock grown in Oregon.
area for a sampling of Oregon’s best distillers and craft breweries.
to offer the popular pet care service -
allows both market goers and their pets the opportunity to enjoy the
has always been pet-free, but now customers may bring their pet and pay a small donation for a dog-sit
-
The popular kids program,
activities this year, with more hands-on educational activities and scavenger hunts to educate and excite young people about where
All of that to say, we are excited to kick off another season.
See you at the Market!
Market MasterGinger Rapport
Quinn’s CrabcakesSimply the best!
Fresh and handmade from locally caught dungeness.
503-709-6984Booth # 125
Ask to Join Our CSACome see us for your fresh
and picked asperagus www.profarmproduce.com
509-280-3900Booth # 92
Oregon grown strawberries,blueberries, raspberries, blackberries and grapes.
www.ungerfarms.com 503-992-0710Booth # 109
Mediterranian AppetizersFresh Pita Bread Fresh Pita Chips
503-209-5517Booth # 100
Sustainable Family FarmWide variety of vegetables,
berries, fruit, flowers, honey, jams & syrup.
www.wintersfarms.comBooth # 73
Artisan Gelato Handcrafted from natural
ingredients & made fresh daily! www.alottogelato.biz
503-228-1709Booth # 33
Cold-Pressed Raw Fruit & Veggie Juice. No preservatives or sugars. Delivered to your doorstep
daily! portlandjuicepress.com 503-913-3367
Booth # 126
Delicious Laotian CuisineEgg Rolls, Pad Thai, Salad Rolls,
Lemon Grass Beef Sticks, Chicken Sticks & Fried Rice. Gluten Free
and Vegetarian Menu. Booth # 67
SMALL FAMILY FARMLocated in Aurora, Oregon
Organic produce 12 months a year Join our CSA farm share
www.simingtongardens.comBooth # 9
Ken & June’s Hazelnutsoffer a delicious selection of Raw, Dry Roasted and Roasted & Salted
Hazelnuts. Milk, Dark, & White Chocolate coated Hazelnuts too!
Booth # 59 (May Vary)
Wild Roots Vodka produces all-natural spirits that
strive to embody the true essence of the Northwest.
www.simingtongardens.comBooth # 138
The Ultimate Dog TreatBaked and organic, we believe in healthy pet treats. No wheat,
soy, corn, grain or GMO’s! www.boneyardbakery.net
Booth # 101-5
Vendor SpotlightKen & June’s Hazelnuts (Booth Varies)
Dup and moved their family from Norfolk, Nebraska to St. Paul, Oregon where they purchased
orchard. It was one of the largest
-
After Ken died in the fall of
son took over the family business
grown the farming operation to
his wife, Sylvia, decided to expand their farming success into what
-
appropriate to name the business after the original hazelnut farm-
-ing fresh, Oregon grown, farmer direct hazelnuts.
67)
Message
Continued
28 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
W h a t ’s H a p p e n i n g i n B e a v e r t o n t h i s M o n t h ?
Raleigh Hills K-8 Middle School Presents:
5225 SW Scholls Ferry Rd, Portland, Oregon 97225 | 503.259.7385
Washington County Open StudiosCall to ArtistsCall to Artists for 5th Annual
process and promote your work in
a full-color catalog and website. Artists with a working studio
must be willing to open their stu-
both days. Participation fee $100. Application online beginning March 1 at wash-coart.org. Deadline June 1.
Oregon SymphonyClassical Up Close comes to Beaverton!
Oregon Symphony musicians are on the loose and headed to Beaverton!•
• Church of Christ
• brings world class symphony
musicians to you. • Cost: FREE!For more information, please visit www.classicalupclose.com.
Art On Broadway Gallery Pam Nichol’s Special Fundraising Exhibit to Benefit Susan G. KomenTigard resident and encaus-
tic artist, Pam Nichols, has
G. Komen breast cancer organ-ization. To accomplish this, she has invited local artists to donate
works of art for a special sale at Art On Broadway Gallery during
For more information, please visit http://www.artonbroadway.net/.
Audition NoticeMay, 4, 5, 6 – 6 - 8pm at HART Theatre
OPEN CALL, NO APPOINTMENTS MADE.
ART Theatre is very proud to announce a special audition
opportunity for the premiere of an original full-length, fully pro-duced musical comedy written by local playwrights Darrell Baker, Tina Arth and Carl Coughlan, and directed by Paul Roder.
Noah, his family, his neighbors, his vision, and the carnival that comes
to town. Like the current Russell Crowe movie, it is loosely based
but that is where the resemblance ends!
This is your chance to be part of a unique process and to put your stamp on an original role.
Auditions will consist of cold readings and a prepared song of no longer than two minutes. We will have an accompanist, please do not bring your own.
African Cooking Exhibit, May 2ndWith Wambui Machua
The Sister Cities Program will be participating at the season
opening First Friday “interna-
5 – 8 p.m. Natural Grocers will host, opening their kitchen to Sister Cities Advisory Board mem-
share her African cooking exper-tise. Entertainment provided by
See page 8 for First Friday informationBumper Sticker: to order, email [email protected]
Bumper Stick
ers
Only $2.50
!
Service to Beaverton
Award
2014Complete a nomination form for a Service to Beaverton Award in the following categories: • Outstanding Beaverton Individual • Business • Neighborhood Association Committee (NAC) Member • Service Organization • Emerging Leader (18 and under) • Educator/Teacher
For tips on submitting a great nomination and to complete a nomination form, visit www.BeavertonOregon.gov/Service or email [email protected]. For more information, call Megan Cohen at 503-526-2584.Winners will be announced at the Service to Beaverton Awards Luncheon on July 18, 2014. Tickets will be available for purchase.
Who do you know that deserves recognition for contributions to our community? Let us know!
Nomination Form Deadline: Tuesday, May 27 at 4 PM
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 29Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
B e a v e r t o n C i t y L i b r a r y
Library News
Beaverton City Library12375 SW 5th St., Beaverton www.BeavertonLibrary.org
503-644-2197
All events are free. Registration, where noted, is one month in advance. www.BeavertonLibrary.org/register. For more informa-tion, call or visit library website.
General
Third Thursday Film SeriesColorful Films: How Hollywood Gets its Green On (where all the films have the word “Green” in the title!). Please call the library at 503-644-2197 to find out which movie will be shown. This event is free and open to the public. No registration required.
Portland Opera Sneak Peak Tuesday May 6. 7pm in the Auditorium. Pirates of Penzance sneak peak presented by Portland Opera
Events for Kids,
Tweens and Teens
Planes, Trains, and Automobiles!Monday, May 5, 10:30-11:30am Are you crazy about planes, trains, and automobiles? Come and play with your favorite kinds of transportation! There will be crafts and lots of fun! Ages 2-6 with adult.
Tween Book ClubWednesdays, May 7 & June 4, 4-5pm. Come by the Teen Desk to check out your copy of the latest pick. Then join us for pizza and chat! Grades 5-8, drop-off.
Poetry CoffeehouseThursday, May 8, 6 – 7:30pm Bring something to share— it could be a poem, monologue, skit, or the limerick you entered in the April poetry contest—and
read it out loud! Also, enjoy deli-cious coffee. Grades 6-12.
SAT Practice TestSaturday, May 10, 12-4:30pm Take a free SAT Practice Test, proctored by Kaplan. To regis-ter, call 1-800-KAPTEST, or visit http://www.kaptest.com/enroll/SAT/97005/events
Mother’s Day Crafts and TeaSunday, May 11, 1:30-2:30pm Come by the library and make something to show your mom how much you love her and relax with tea or lemonade. Ages 0-12 with family, drop-in.
Anime ClubTuesdays, May 13 & 27, 6-8pm Chill out with other anime fanat-ics while you eat snacks, watch anime, and master surprise anime activities! Grades 6-12.
Chess ClubSaturday, May 17, 10:30-11:30am Hone your skills against oth-er players or learn the game. Grades 3-8, drop-off.
Puppet Show: Rascally Rabbit TalesSaturday, May 17, 11-11:45am Celebrate Children’s Book Week with a puppet show, Rascally Rabbit Tales. Enjoy this hilarious and interactive puppet show by Pink Pig Puppet Theater. Ages 4-8 with family, drop-in.
Family MoviesSunday, May 18, 2pm Enjoy a great new DVD release on the big screen! All ages, chil-dren under 10 must be accompa-nied by an adult.
Messy ArtFriday, May 23, 4-5pm Create messy art together. Ages 2-6 with adult.
Library Sponsors
Support Your Library
by donating to the Beaverton Library Foundation online @
beavertonlibraryfoundation.org
The Book CornerFor gently used books at
affordable prices w/ proceeds donated to the Beaverton Library. www.bookcornerbeaverton.org
503-643-5188
New at Washington Square
Learn more here: www.shopwashingtonsquare.com/Events/KidsClub
HappyHour
AztecaSun & Mon-All Day!
Tues-Sat, 3-6:30pm/9pm-close Try our Sangria or Mojitos
Well Drinks are $2.50 503-643-8269
BenihanaMon-Thurs: 3-7pm
Sake, Beer, Wine & Specialty Cocktails; Sushi rolls from $4.50,
Teriyaki Wings & more 503-643-4016
Big Al’sMon-Thurs 3-6pm & 9pm-close
Fri 3-6pm; 10pm-close Sat 10-close; Sun 9pm-close
Food & Drink Specials 503-748-6118
Bistro 153Mon-Fri 2-7pm & 9-close
All Day Sat & Sun Food, Beer, Wine, Cocktails 3203 SW 153rd Dr., Suite 419
503-626-8282
BJ Willy’s Progress RidgeDaily: 3-6pm
Sun-Thu: 9:30p-closing Full Bar~16 Beers on Tap
www.bjwillys.com 503-747-7319
Black Bear DinerMon-Fri: 3 - 6pm
$4.95 Small Taco Salad Choice of Chicken or Beef
includes beverage! 503-646-4507
Brickyard TavernEveryday 3-7pm and 10pm-Close
$2 to $6 Food Specials Daily Drink Specials
13095 SW Canyon Road 503-718-7033
Broadway Saloonin Old Town Beaverton
Daily 4:30-6:30pm & 10pm-12am $3.95 HH food & $1 off drinks
12434 SW Broadway St 503-641-7474
Buffalo Wild WingsTue & Thurs 12pm-12am
Mon-Fri 3-6pm & 10pm-12am $1 off tall pints, 50¢ wings allday
www.buffalowildwings.com 503-645-9424
Cafe MurrayhillEveryday from 3:00-6:00pm
Discounted appetizers! Wine, Beer & Cocktails.
www.cafemurrayhill.com 503-590-6030
CinetopiaEveryday 3-6pm & 8pm-close $3.99 & $4.99 Food Specials Discounted Beer and Wine
www.cinetopia.com 503-597-6911
Coach’s Bar & GrillSat-Thur: 3-7pm & Fri: 3-8pm
Great Burgers, pizza, sandwiches and dessert.
Pool, shuffle board & karaoke. 503-203-8250
decarli RestaurantTue-Sat: 4:30-6pm
9pm-close; Sun 5-9pm Panini’s, Pizzetta’s & more!
Try a Cool Hand Cuke! 503-641-3223
Ernesto’sMon-Fri: 3:00-6:30pm Sat-Sun: 4:00-6:30pm
$3.50-5.50 Food Specials & More Discounted Beer, Wine, Well
Drinks. 503-292-0119
Hall Street GrillM–Sa: 3–630 & 9-close
Sun: 3-close Drink specials,
tasty morsels & nibbles. 503-641-6161
Ickabod’s“Stimulus Hour”
Everyday from 4:00 to 6:00pm Domestic pint & pitcher specials.
Best Burger in Town! 503-646-0222
La Hacienda RealHappy Hour Daily from 3-6pm
Any dish only $3.95! Margaritas, well drinks & beer.
12025 SW Canyon Rd 503-601-7000
Malones Cafe & BarDaily 4:00-7:00pm & 10pm-12am
$1 - $4 Food Specials Pizza, sliders, & more Draft & Well Specials
503-579-3663
The Mark Lounge& The Mark Cigar Bar
Daily 3:00-6:00pm; Drinks, Apps, Sports, Cigars & more!
www.themarkpdx.com 503-643-5451
McCormick’s Fish HouseDaily 4-6pm & 9-cl,
Food starting at $2.95! Beer, Cocktail and Wine specials,
never offered before! 503-643-1322
McGrath’s Fish HouseMon-Thu 3-6pm & 9-9:30pm,
Fridays 3:00-5:00pm, Enjoy $3 Food Specials, $4 Beers,
www.mcgrathsfishhouse.com 503-646-1881
McMenamins-Murray & AllenDaily 3-6pm & 10pm-close
Drink Specials. Food starting at $1.75! 6179 SW Murray Blvd.
503-644-4562
MiNGO RestaurantTues-Fri 2:30-6:00
Sun & Mon 5:00-6:00 pastas, pizzas, burgers & more
wine, beer & cocktails mingowest.com
Monteaux’s Public HouseHappy Hour Menu Early: 3:00-6:00pm
Late: Last 2 hours to close and 10 Terrific Taps too
Ask about ‘oomph’!
Newport BayM-Sa: 3-6p/8-10p, Sun.-all day
Food specials $.99 - $5.99. $1 off Draft Beers.
Wine & Well Drink Specials. 503-645-2526
Peppermill LoungeMon-Fri: 4:00-7:00pm
(22 draft beers) · Food & drink specials + huge late nite menu.
Open till 2:30am daily. 503-642-5193
Planet ThaiDaily 3-6pm and all day Sunday.
Drink and appetizer specials. Try our Philly Crab Puffs ($4), or Crispy Spring Rolls ($3.50)
503-718-7101
Red RobinMon-Fri: 3-6pm & 8pm-close
Beverage & Appetizer Specials www.redrobin.com
10100 SW Wash. Square Road 503-624-3955
Ringo’s Bar & GrillMon-Fri: 4:00-7:00pm
Cocktails, Food & Juke Box Voted Portland’s Best Burger!
12300 SW Broadway St. 503-644-7847
Ruby TuesdayDaily: 3-6pm & 9pm-close
Chips, Dips, Shrimp & Chicken Cocktails, Beer & Wine www.rubytuesday.com
503-579-3737
House
30 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
D o yo u h a v e a n e v e n t w e s h o u l d k n o w a b o u t ?
WASHINGTON COUNTY Event Calendar
Oregon's Washington County is a short drive from Portland, and is home to nationally renowned golf courses, award-winning wineries, tax-free shopping, agricultural experiences, outdoor recreational activities & more. With a combination of suburban and rural settings, Washington County offers an unparalleled experience for all travelers.
503-644-5555 | www.oregonswashingtoncounty.org
Messages: The Art of Carolyn ColeThrough June 1 – WashCo Museum (Hillsboro Civic Center) washingtoncountymuseum.org
Downtown Beaverton First Friday EventMay 2 – Beaverton History Center, HistoricBeaverton.org
Over the River and Through the WoodsMay 2 -18 – Mask & Mirror Community Theatre (Tigard) www.maskandmirror.com
Annual Oyster & Saké EventMay 3 – SakéOne (Forest Grove) www.sakeone.com
Faire in the GroveMay 3 and 4 – Grand Lodge (Forest Grove), www.fairein-thegrove.com/index.html
Nature Days in the ParkMay 5, Vista Brook Park (Portland), May 10 – Pioneer Park (Beaverton) www.thprd.org
First Tuesday Art WalkMay 6 – WashCo Museum (Hillsboro), www.washington-countymuseum.org
First Wednesday Forest GroveMay 7 (“Spring into Action”) – Downtown Forest Grove www.fgcityclub.com/
Evening Hour at the HawkMay 8 – Hawks View Cellars (Sherwood) www.hawksviewcellars.com
Private LivesMay 8 - 30 – Bag&Baggage (Venetian Theatre – Hillsboro) www.bagnbaggage.org/events
A Musical FeastMay 9 and 10 – Voices for the Performing Arts (Sherwood) www.vpafoundation.org
Date NightMay 9 – Plum Hill Vineyards (Gaston), plumhillwine.com
Guys and DollsMay 9 through 11 – Theatre in the Grove (Forest Grove) www.theatreinthegrove.org
Tillamook TalesMay 10 – Tillamook Forest Center
www.tillamookforestcenter.com
Hippie Chick Half & Quarter MarathonMay 10 – Gordon Faber Rec- reational Complex (Hillsboro), www.betterseries.com
Tears of Joy Theatre: Malika, Queen of CatsMay 10 – Walters Cultural Arts Center, hillsboro-oregon.gov
OMSI Star Party: Astronomy Day CelebrationMay 10 – Stub Stewart State Park (Buxton), www.omsi.edu
Family Fun DayMay 11 – Washington County Museum (Hillsboro Civic Center) washingtoncountymuseum.org
Mother’s Day at Garden VineyardsMay 11 – Garden Vineyards (Hillsboro), gardenvineyards.com
Mother’s Day Wine BrunchMay 11 – Plum Hill Vineyards (Gaston), plumhillwines.com
Tualatin River Bird FestivalMay 17 – Tualatin River National Wildlife Refuge (Sherwood) tualatinriverbirdfestival.org/
Tualatin River Bird Fest PaddleMay 17 – Tualatin Riverkeepers (Sherwood) tualatinriverkeepers.org
Friar TrotMay 17 – St. Francis School (Sherwood), thefriartrot.com
The Sum of Many Parts: Quiltmakers in Contemporary AmericaMay 21 - June 15 – Washington County Museum (Hillsboro) washingtoncountymuseum.org
Open Alpaca BarnMay 24 and 25 – Alpacas of Oregon (Sherwood), www.easy-gofarm.net/AOOMemDay.html
Memorial Weekend in Wine CountryMay 24 - 26: Washington County Wineries, www.ore-gonswashingtoncounty.com/Discover-Wine-Country
MAY 2ND - MAY 17TH$15 ADULT | $12 STUDENT, GROUP, SENIOR | $5 YOUTH
PRESENTS
FRI & SAT 7:30 PM | SUN 2 PM - BEAVERTON LIBRARY AUDITIORIUM
WRITTEN BY BERNARD POMERANCEDIRECTED BY JESSICA REED
503-754-9866 | www.BeavertonCivicTheatre.org
BEAVERTON CIVIC THEATRE
Synopsis: Bernard Pomerance’s The Elephant Man poses many questions that remain relevant today. The most obvious revolve around the eponymous Joseph Merrick. We are asked to consider the true measure of a man. Merrick’s condition sets him apart from the rest of the world but the pursuit of normalcy is a capricious quest when no one can really decide what normalcy is. He was put up in comfortable lodgings and supposedly made friends with a great many important people. He became something of a celebrity in his own right. Yet were these people really his friends or had they simply come to gawk as others had done during the sideshow? The intrinsic brutality of society is a recurring image in the piece.
The character of Frederick Treves presents other questions. The play begins and ends with Treves and it is his crisis of conscience that the audience must experience. Are the rules set out “for our own good” really so good after all? As Mer-rick’s condition deteriorates, we see Treves’s certainties about goodness, faith, and propriety do the same. The audience must feel the same heartache as Treves as he comes to realize that all he has held to be true and righteous is in reality false and hollow. The Elephant Man is a play about questions and ques-tioning and it leaves it up to the audience to seek the answers for themselves.
Black Bear DinerMon-Fri: 3 - 6pm
$4.95 Small Taco Salad Choice of Chicken or Beef
includes beverage! 503-646-4507
Dairy QueenWeekdays 2:00-4:00pm Half-Price Soft Drinks Shakes & Arctic Rush
12870 SW Farmington Rd. 503-644-3469
Einstein Bros BagelsDaily 3pm to 430pm (closing)
all bagels & beverages! Beaverton Town Sq. Location
503-643-2334
Honey Toast CafeTue-Fri: 3-6pm
20% OFF all appetizers $8.88 Petite Honey Toast
+ tea or coffee. 503-747-2712
John's Incredible Pizza Co.$2.99 Kids' Buffet Tuesdays
For more Spring specials johnspizza.com
503-520-0000
Mom’s Dessert CafeHappy Hour on Sat / Sun
Say the Secret Word ‘Longbottom’ to get a 12 oz Long Bottom House Coffee for only $.99 (or have a 12
oz latte $1.50) 503-579-1600
Taco Bell$1 Happier Hour
Medium Drinks or Loaded Grillers 2pm - 5pm Everyday
www.tacobell.com/happier_hour
Happy
FamilyFriendly
Hour
Stockpot BroilerDaily 4:00-6:00pm &
9:00pm-close Menu items from $2.50
and bar items from $3.25. 503-643-5451
Sylvan Zoo House & SaloonDaily 3-6pm & 9pm-Close
Free Food w/2 drinks M-F 4pm-6pm
$3.25 Wells - $4.00 Micros Sylvan Exit off Hwy 26
503-297-5568
Thai Bloom!Daily: 4:00-6:00pm; 8pm-close
Mon-Thurs; 9pm-close Fri & Sat All Day on Sundays.
3800 SW Cedar Hills Blvd. 503-644-8010
The Pit StopMon-Fri: 3:00-6:00pm; Sat & Sun,
food only 11pm-close Beer, Blood Mary, Micro Brews
10245 SW Canyon Road 503-643-4758
SStStStStSStSStSSSSSSSStSSSSSSS oD
Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 31Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.
W h a t ’s H a p p e n i n g i n B e a v e r t o n t h i s M o n t h ?
CinemarkCedar Hills Crossing 800-FANDANGO+984
CinetopiaProgress Ridge 503-597-6900
Valley Cinema PubBvtn-Hillsdale Hwy. 503-296-6843
Call Theaters for Show Times
TheaterListings
Bold Text = Nationwide Release
Synopsis: Back together after 20 years! That girl group from the sixties everyone loves is bringing back the sun, fun and all the great songs they sang down on the boardwalk at the Jersey Shore... all to raise money for the good folks at Sandy Shores Mobile Home Beach Resort. With a show that promises to get everyone dancing in the aisles, The Bikinis, relive their heyday and beyond, beginning the summer of 1964, the night these four in-separable friends got their name, winning the Belmar Beach Talent Contest, wearing just their bikinis!
NEW FRIENDS OF THE BEAVERTON CITY LIBRARY INVITE YOU TO THEIR 4TH ANNUAL
GROW YOUR MINDSpring Book & Media Sale
If you love books and want to serve a community of readers, fill out a volunteer application and join us.
All proceeds benefit the Beaverton City Library & the Murray Scholls Branch.
MEMBERS ONLY PREVIEW SALEWednesday, April 30
5:30-7:30 pmMembership ($15) is available at the door
Open Sale: May 1-35/1 Thursday 10 am - 8 pm5/2 Friday 10 am - 5:30 pm5/3 Saturday 10 am - 2 pm
All books 50% off on Saturday After 12:00 pm
To learn more about us: www.bookcornerbeaverton.org. or call 503.643.5188.
Beaverton City Library Lobby & Conference Room12375 SW Fifth Street, Beaverton
TICKETS 503.620.5262 www.broadwayrose.org
APRIL 17 - MAY 18Featuring hit tunes from the‘60s such as “It’s In His Kiss,” “Yellow Polka Dot
Bikini,” “Heat Wave,” “Under The Boardwalk,” “These Boots AreMade For Walkin’,” and “It’s Raining Men.”
OregonCultural
Trust
Friday May 2Bad Johnson NR
Belle PG
Beneath the Harvest Sky NR
Decoding Annie Parker NR
Mr. Jones PG-13
The Amazing Spiderman 2 PG-13
The Protector 2 R
The Walk of Shame R
Whitewash NR
Friday May 9Chef NR
Devil's Knot NR
Fed Up PG
God's Pocket NR
Legends of Oz: Dorothy's Return PG
Moms' Night Out PG
Neighbors R
Palo Alto R
Stage Fright NR
The Double R
The Hornet's Nest NR
Friday May 16A Night in Old Mexico NR
Godzilla PG-13
Million Dollar Arm PG
The Immigrant R
Wolf Creek 2 NR
Friday May 23Blended PG-13
The Angriest Man in Brooklyn R
Tracks PG-13
Words and Pictures PG-13
X-Men: Days of Future Past NR
Friday May 30A Million Ways to Die in the West NR
Filth NR
Maleficent PG
Night Moves NR
Party Central NR
The Grand Seduction NR
We are The Best NR
Volume 44444 IIIIII–Isssssss ueueueueue 55555555555555555 ((((((((((((((MMMMMMMMMaMMaMaMaMaMaMaMaMaMaMayyyyyyyyyyyy 20202202020202020202020202020202020202020200 ) BeeeeeeeeeeeeeeeBeBBBeavavavavavavaavavavavavavavavavavavererererererererererererererererererererrtototototototototototoototototottototototototoonnnnnnnnnnnnnnnnnnnnn RRRRRRReReReReReReReReReReReRReReReReReReReReResososoososososososososososososourururururururururururcececececececece GGGGGGGGGGGG iiiiiiuidddddde – 31000000000000000000000111111114141414141414141411141114) | BBBBB
What’s showing in
Beaverton
32 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com
A d v e n t u r e s i n B e a v e r t o n
Beaverton Kids CornerThis month’s Kids Corner features 11 year old Ayla Maldarelli, 5th grader at Chehalem Elementary School.
The waterfall tricklesTrickles down the creek
It washes over my feetBuried in the sand
I close my eyes and listenTo the quiet orcestra of nature
The Orcestra
(Do you have a talented pre-teen? Submit your child’s poem and artwork to: [email protected])
Thursday, May 1, 2014Thursday, May 1, 2014
Questions for the Candidates or Bond Measures?
Email in advance to: [email protected].
Deadline for submission of questions is Wednesday, April 30.
For more information: Call Miles Glowacki in the Neighborhood Program
at 503-526-3706 or visit www.BeavertonOregon.gov/VotersForum.
Presented by: Beaverton Committee for Citizen Involvement
6:30 PM — Meet the Candidates and enjoy refreshments
7 PM — Voters’ Forum
Beaverton City Hall • 4755 SW Griffith Dr.
Spring Voters’ ForumJoin us for the Join us for the
Spring Voters’ ForumThe Voters’ Forum will highlight candidates and bond measures
for the Primary Election. Come listen, learn and ask questions.
Featured Races:
Beaverton City Council Position 1
Lacey Beaty
Alton Harvey, Sr.
Ian King (Incumbent)
Beaverton City Council Position 5
Marc San Soucie (Incumbent)
John A. Somoza
Measure 34-211 Tualatin Valley Fire & Rescue
Replacement local option levy for fire and medical emergency response
Measure 34-219 Beaverton School District
Bonds for repairs, reducing overcrowding, modernization, safety and technology upgrades
Washington County Commissioner at Large
Allen Amabisca
Andy Duyck (Incumbent)
Candidates for City Council Position No. 1, Ian King (Incumbent)Beaverton is a great place to
call home. As a husband, father, and community member I appreciate all that Beaverton
I are glad to be raising our son, Samuel, in such a vibrant and diverse community.
Over the past four years we have done a lot we can be proud of in this city! Beaverton has been rebranded as “open
of our community with our growing outreach efforts, and with our focus on public safety we continue to be ranked among the safest cities in the Northwest.
successes for granted. It takes experience, dedication,
tough questions, and demand accountability. A city councilor needs to be more than just a rubber stamp for others’ ideas. I will continue to be an independ-ent voice that will challenge and advocate for a solid future for Beaverton.
Position No. 1, Lacey BeatyLacey Beaty, I am a com-
munity-focused resident and cur-
Committee and sit on the board
only drop in center for youth experiencing homelessness.
As a military veteran, wife, and avid community volunteer I care deeply about Beaverton- because
it’s more than just a great city, it’s my home. I bring passion and sincerity in everything that I do and make decisions that I know will not only affect me, but my next door neighbor. I will treat everyone with respect and when community members reach out to me, I will respond. I am pleased to announce my candidacy for Beaverton City Council for the upcoming elec-
information about me and a list of local supporters at- www.BeatyForBeaverton.com or Facebook.com/laceybeatyforbeaverton
Position No. 1, Alton Harvey, Sr.Aservant to the betterment of the City of Beaverton and all our city’s residents and businesses. Alton’s tireless spirit is the breath of fresh air the citizens and businesses of this city need to address every concern, no matter the size. Alton’s sense of fairness,
his loyalty, and his desire to serve are truly worthy of
Maria I. Moreno, Former Commissioner of the Beaverton Human Rights Advisory Commision
Position No. 5, Marc San Soucie (Incumbent)ello, all! Beaverton is a very exciting place to live
great opportunities ahead of us, and I’ll keep working to make
upcoming priorities for me:• Develop strong market-
ing campaigns to raise Beaverton’s reputation and
• Continue to invest in techniques to encourage people to engage, volunteer, and offer thoughts about city work.
• Keep enhancing opportunities for public input
regarding the budget and the Capital Improvement Program.
• Complete the downtown streetscape projects so people see change happen - Canyon Road improve-
system, alternative street networks.• Complete the Allen Blvd. corridor improvement
study and take action.• Support the development of the Timberland area,
the Peterkort Sunset Station properties, and South
• Continue work to attract investment in our city by landowners, businesses, local developers, and
Position No. 5, John A. Somoza• No marijuana dispensaries in beaverton•
• • Stronger neighborhoods not denser neighborhoods
Let’s have fun in the BRG! Throughout the paper there are 6 happy veggie toons scattered about. Find and count up Mr. Carrot (shown below) and you could win a $25 gift certificate to Black Bear Diner!
Email your answer to [email protected] and the 3 winners will be chosen at random from all the correct answers at the end of the month. Good luck and Happy Hunting!
C dC d
May “Easter Egg” Hunt Contest
*Win A $25 Gift Certificate*
Find Me! Win
a $25
Gift
CertiF
icate!
Win
a $25
Gift
CertiF
icate!