breeze - southampton airport's official passenger magazine

Complimentary copy

Southampton Airport Magazine Autumn 2014

HamburgOur newest destination

Dublin

La Rochelle

A different

Reasons to go to

WinA THREE NIGHT BREAK TO GUERNSEY

AUTUMN 2014 SOUTHAMPTON AIRPORT 3

WELCOME

CONTENTSISSUE26

outhampton Airport is constantly working to improve the service it delivers to its customers. Our aim is to deliver a ‘breeze through’ experience – easy, fast and friendly.

In 2014 we have already undertaken a signifi cant refurbishment of the catering offer, which now provides an even greater range of food, before or after your fl ight. In the next few months we will also be expanding the space in the Departure Lounge with more seating available to provide a relaxing start to your journey. We are aware that many people want to make contact with friends and work colleagues before and after a fl ight, therefore we will shortly be offering free unlimited Wi-Fi access throughout the terminal. Further new exciting improvements to the airport experience are under development and will be announced shortly, highlighting our commitment to making your journey to your destination easier, quicker and friendlier.

To complement these exciting new improvements I am pleased to announce that a new route to the city of Hamburg, operated by Flybe on a daily basis, will commence in October this year. The strong maritime and aerospace links between our region and Hamburg, plus the opportunities which the city of Hamburg and its region brings is an exciting addition to our destinations. Finally whilst you are hopefully enjoying some summer weather, you may be interested to read about the extensive range of ski holidays and fl ights from Southampton Airport.

Thank you for choosing Southampton Airport today, and I hope you enjoy our complimentary copy of ‘Breeze’ magazine which includes many other exciting destinations which are easy to reach from Southampton Airport.

With best wishes,

S

Dave Lees, Managing Director, Southampton Airport

Breeze is published by Newsquest Hampshire. Newspaper House, Test Lane Redbridge, Southampton,Hampshire, SO16 9JX. T: 023 8042 4560. F: 023 8042 4928

Editor: Ian Murray. T: 023 8042 4536 Sales Executives: Karen Skerry. T: 023 8042 4926 [email protected]

Phil McGhan. T: 023 8042 4937 [email protected] and Design: Lee Jeffery

Southampton Airport Information Centre: T: 0844 481 7777Marketing Department: Louise Neville. T: 023 8062 7141. E: [email protected]

Marketing Department, Southampton Airport, Wide Lane, Southampton, SO18 2NL. southamptonairport.com

Printed by Stephens & George, Merthyr Tydfi l. All details and information correct at time of going to press.

Quoted prices correct at time of printing and subject to change. Where not stated, pictures that appear on destination pages are courtesy of Thinkstock www.thinkstockphotos.co.uk

14

21

28

4 Airport News

8 Special Feature Gourmet Breaks

10 Travel destination guide

11 Destination fl ight map

12 Deals & Special Offers

18 Business Focus

25 What's on at our destinations

26 Cruising News

37 Out & About Hampshire’s history and heritage

38 What’s on across Hampshire

40 Community News

42 Competition Win a three night break in Guernsey

Destination HAMBURG14

Destination DUBLIN21

Destination SKIING ROUND-UP31

Destination Reasons to go to...LA ROCHELLE28

31

4 SOUTHAMPTON AIRPORT AUTUMN 2014

AIRPORT NEWS

AIRPORTNEWS

BRAND NEW DAILY SERVICE TO HAMBURG

Southampton Airport led a group of businesses from Hampshire to Bergerac in France to forge closer links with businesses, residents and ex-pats in the Dordogne region. In the winter months, the Southampton Airport connection is one of only two routes from Bergerac to the UK, so the group were promoting the easy links to the rest of the UK via the Flybe hub, rail services and motorways.

The Dordogne region is very popular with the British and many people have second homes in the region. There are 28,350 permanent British ex-pats living in the area and around 6,500 second homes. Joining Southampton Airport were the Port of Southampton, South West Trains, Hampshire Chamber of Commerce, Flybe, Hampshire Top Attractions, Business South, Destination Southampton and the Southampton and Region Hotel Association.

Jan Halliday, Director of Marketing & Communications, who organised the event in partnership with Bergerac Airport

said: “It is important to go out of our region and forge business links with new markets in areas where we have daily air services.

Our visit was the top story on French TV and this shows the importance of air links between Hampshire and the Dordogne.”

SOUTHAMPTON AIRPORT LEADS BUSINESS DELEGATION TO FRANCE

Flybe is introducing a brand new daily service between Southampton and Hamburg, connecting these two important business centres and cruise-ship ports for the fi rst time. The route starts on October 26th 2014 with one way fares available from £49.99 including taxes and charges.

One of Europe’s biggest harbour cities, Hamburg offers laidback life on the Elbe, beautiful neighbourhoods, a hearty welcome and a relaxed city vibe. Visitors can explore open-air markets, lovely long boulevards for shopping on and one of the prettiest city parks in the Planten un Blomen. The city is also a bustling cruise port and has many important links with key Hampshire businesses.

Read more about Hamburg in our destination feature on page 14 and in our Business Focus on pages 18&19.


AIRPORT NEWS

For the latest news, offers and travel deals from Southampton Airport:

@SOU_Airport facebook.com/SOU.airport youtube.com/SOUAirport southamptonairport.com/blog

KEEP IN THE LOOP

BE THE fi rst to hear airport news, share your views and enter our competitions with fantastic prizes – ‘like’ us on Facebook, follow us on Twitter, sign up to our newsletter, bookmark our YouTube page and keep an eye on our blog. See top of page for details.

Southampton Airport and South West Trains joined forces to promote their quick and easy rail-to-air links with a special roadshow at London Waterloo station

The team visited the UK’s busiest railway station to talk to passengers about the ease in which they can travel between London and Southampton Airport. South West Trains offers around 50 train services every day between London and Southampton Airport Parkway station, which is just 99 steps away from the airport’s terminal building.

South West Trains and Southampton Airport created a special joint rail-air ticket offering train travel between

Southampton Airport and London Waterloo for just £30 return, for passengers fl ying with airlines Flybe or Blue Islands. The train journey takes just 68 minutes.

Jan Halliday, Director of Marketing & Communications at Southampton Airport, said: “For people travelling from stations such as London Waterloo, Clapham Junction, Basingstoke and Guildford, Southampton Airport offers a stress-free alternative to the larger airports. Whether they’re travelling on holiday or for business, those who have tried it once repeatedly tell us how easy it is – and that they’ll never go back.”

ADDITIONAL WINTER FLIGHTSFlybe has extended its popular sun routes from Southampton to Alicante, Malaga and Faro to operate until early November, allowing for late-season half-term breaks.

Increased fl ights to Dublin will also operate during the winter, up to four times a day, and routes to regional France will also receive a winter boost with the addition of a twice weekly service to La Rochelle – complementing Flybe’s existing winter routes to Bergerac, Nantes, Rennes and Limoges. Those looking to visit some of Europe’s best ski slopes will be also be pleased to hear of the return of Flybe’s fl ights to Grenoble, Geneva and Chambery.

For more information visit www.southamptonairport.com/airlines

AIRPORT TEAM HITS LONDON WATERLOO

Dublin; Picture courtesy of FailteIreland

A fl eet of rare Gordon-Keeble Cars returned to their ‘birthplace’ to celebrate 50 years since production of the car started in 1964. Built at Southampton Airport, in the building also famous for the production of the early Spitfi re aircraft, the cars were manufactured there until 1966.

Forty-nine cars from around the world assembled in chassis order on the top fl oor of the airport’s car park - the building on the site of the previous factory – and drove in formation through Spitfi re Loop in front of the airport’s terminal.

The cars continued their celebrations by visiting Beaulieu, Southampton Civic Centre,

Winchester and Eastleigh High Street – including a drive along the fabled Jim Keeble test route where Jim personally tested each car at 140mph.

Mike Webster, of the Gordon-Keeble Owners’ Club (GKOC) said “The fi ftieth anniversary is an important milestone and the GKOC felt it was essential to return the cars to their original home and enable the people of Hampshire to enjoy a world record gathering of them. We could think of no better place to start our celebrations than the original factory site”

GORDON-KEEBLE CARS CELEBRATE 50TH ANNIVERSARY

At Southampton Airport we pride ourselves on helping make our passengers’ journeys as easy as possible. Our Breeze Through awards recognise and reward those staff who go the extra mile.

March 2014: Disruption Response Team

One day in March, a number of fl ights were cancelled due to fog and the airport received a number of diversion requests from other airports. Local roads then became gridlocked with traffi c too. A group of volunteers known as the Disruption Response Team (DRT) was brought in and members Mike Glen, Nichola Shaw, Shona Hogg, Anthony Cleightonhills, Hazel Screech and Gay Roberts fell into natural roles. They assisted passengers around the airport, greatly reducing the queuing levels and customer problems.

April 2014Neil MacBrayne -Swissport

Neil, from Passenger Services, was nominated by several staff members and has consistently received great feedback from passengers. Neil is seen by colleagues “always helping customers and always looking to go the extra mile”, “adopting a charming, disarming manner” with child passengers and “having a passion for service, in line with our airport values”. Customers have congratulated him for his great customer care skills – with one person writing that it was “the best service we have ever had”.

May 2014 Jenny Woods & Andy Dent

Jenny Woods and Andy Dent from the Commercial Team won this award for their involvement in the changeover of the catering suppliers. Both have been nominated for going above and beyond the call of duty,

particularly for working through

the night whilst the physical changeover took place to both Costa outlets, The Globe and The Olive Tree. The months of work prior to this, in getting everything organised, has also been acknowledged by their colleagues.

BREEZE THROUGHAWARDS

gh ng te

each

n-)

y is

l

ng

Jenny Woods & AndyJenny Woods and An

from the Commercial this award for their inin the changeover of tsuppliers. Both have bnominated for going abeyond the call of dut

particularlyworking

the niwhilschanTheof orth

Has anyone at

Southampton

Airport gone the

extra mile for you?

Has anyone at Southampton

Airport gone the extra mile

for you? If you’d like to

recognise an exceptional

member of staff, please

complete our form at

southamptonairport.com/

feedback

atural

Disruption Response Team

n t g

ical

Jenny Woods and Andy Dent – Commercial Team

Multi-depart mental team

Neil McBrayne – Pass enger Services


AIRPORTNEWSAIRPORT NEWS

@SOU_Airport facebook.com/SOU.airport

youtube.com/SOUAirport southamptonairport.com/blog

AIRPORT SPECIAL FEATURE


Gourmet GuGuernsey is already perfect for a gastronomic break, but now fi fteen ‘Tasty Walks’ have been created so you can enjoy the Bailiwick of Guernsey even more and discover the treasures it has to offer. Guernsey measures just 24 square miles, yet mankind and Mother Nature have combined in

each and every corner to create a landscape that is both beautiful and breathtaking.

The walks, created by VisitGuernsey, are of varying length and diffi culty, with the longer ones being broken up into sections. They will take you

through and around some of the most interesting and beauti-ful areas where you will surely encounter some of Guernsey’s unique practices and quirks. On inland routes and along the fl atter coastlines, you will come across such traditions as ‘hedge veg’ whereby locals display a variety

of wares from home-made jams, fl owers, fruit and vegetables for sale at the side of the road together with an honesty box for payment. Throughout the island there’s a network of small roads labelled ‘Ruettes Tranquille’ and, together with water and green lanes, they provide routes that are ideal for

GueGuernsrnrn ey is alralreadeaddy perfffectect fofor rra ga gastastrronomimic bc bc breareareak, buttt nononow w wfi ffi ffi teeteete n ‘n Tasty ty y WalWalWa ks’ks have ve beebeeenn created sd so yo yyyoou cann enenjoyjoyo the BaiBaiBaiBaiBaiBailiwwliwliwliwliwliwwi ickickicickickickickickkk ofofofofofofffof GuGuGuGuGuGuG ernnnernnnernernernernseyseyseyseyseyseyseyseys evevevevevevveven en en en en een mororomoroormormmormore e e e ee eandandandandd dididididid scoscoververrr thhthththe te te te ttrearear sursurres es eses it itit it hashhashashasha to to to t offoffofffoo er.ee Guernernerne seyseyseyseyse measuuuresresreses jujujujust2424 24 424 squsqusququarearee mimimilesleslesle , y, y, y, et etettt manmanmanmankinkinkinkinnd ad ad add ad and ndndndMothererer NaNaNaNN turtutuuu e haveaveavea cocococ mmmbimm neddddd ininin

eaceachh and eveeveevery ry y corccc ner toto crcreeeate e a lanlana ddscape ththat at at isis both bbbeaueaue titifti ul andandnd breathtahtah kinkinng.g.

TheTheTheTheTheTheh wawawawawawawwalkslkslkslkslkslkslkskss, c, c, c, c, c, c, reareareareareareaeae tedteddtedtedttedtedtedted bybybybybybybyby VisVisVisVissitGititGitGtGitGit uerueru nsensensesnses y, y, y, y areareaaa offfofff vavavaavaryiryiryirrying ngngng nglenlenlenlenngthggg and dd dd ddiffiiffiiffiiffificcculty, wwwwwithithithithhh thtththe lonllonlonongergergergge ononnes es es ese beibeibeibbeing ng ng ng brobrobr kenkenkenkenk upupupuppp into ssssectectectioionionons. Theheheh y wy wy wyy illilil take youyouyouoyo

thrth ough ah aand nd nd aaroundd sosomeme of thethth most t intintn ereerer sting andandan bebeauti-fulfulu areass whwhw ereer yoy u wwwillilli susurely yyyencncounountert some me of of GueG rnssey’ey’s s unininiuninniuniununiuniuniniquequequequequequeqqueq prppprprprprprrp actactactactactactacta iceceiceceiceiciciceceices as as as as as as aandndndndndndnddndnd quiquiquiquiquiquirksksrksrkrksrksksrkskr . O. O. O. O. O. O O OOn n n n n nninlinlinlinlnlandanddanddd roroooouteuteuteutet s ass as s and ddndd alolaloalolalong ng ng ng thehthethethehe flflfl flflfl ttattattttter er erer cococoastlineeees, s, s, youyouyouououyo will comcomcome ae ae ae ae cross sucsucsucsu h thh th radraddradr itiitiitittionsonsonson asasas ‘hhhedgedgedgedgd e ve ve ve veg’eggg wheheheherebrebrebrebr yyy ly ocals s ls disdisdisdisplplaplpp y a vavavarierierieerietyty ty yy

of warrres es frofroom hm omeme-ma-mamade jamms, s, fl owerrs, s, frufruuit i and veveegettgetaables fororo sale at tt tt he he e sidside of tf tthe he roaroaroad togeogeg thetherrrwitwititth ah an honenestystyty bobob x for paypaymment. ThrhrThrThrThrThrThrThrhrouougougouougouugougougoughouhouhouhouhouhououut tt ttt tt tt tttt tt the he hhe he he he he e islislislislislislislslsllandandandaandandandand thhhthththththhereereereereerererere’s ’s s s ss s s aa a a aa

ttnetnetworworwoorrk okk ok ok oof sf sf sf sf s lmalmalllm l rlll rl rll oadoadoadoads ls ls ls ls l babeabebbb llllellelll d ddd d d‘Ruetttes es es e TraTraTraT nnqun ille’ e’ e’ ’ andandandan ,,, togetheheheher r r witwitwi h wh wh wh wh wateateateatter ar ar ar aand nddd gregregregr enen en ee lanlanlannnes,es,s, thththhhey ey eyeyproproprorovidvidvidi e routttes es es thathathaat are idededeal al al forfofoofo

8 SOUTHAMPTON AIRPORT SUMMER 2014

This walk explores the beautiful fl oral parish of St Martin’s from its ancient church to its grand manor house. As you approach the church, you come across reminder of earlier pagan times in the form of an ancient statue known as ‘La Gran’mere du Chimquiere’. She often wears a garland of fl owers offered by couples

marrying in the church as a symbol of good fortune. This rural route affords an opportunity to admire the indigenous cattle of Guernsey with their distinctive brown and white markings and the ancient troughs where they used to drink. One of the island’s fi nest houses, Sausmarez Manor is reputedly haunted. Guern-

Ancient watering holes, a Approximate time of walk: 1.5 to 2 hours

featured walk


ernsey


Love food...Eat your way around these fabulous destina-tions, all just a short fl ight away from South-ampton Airport.

VeronaThe beautiful climate and a centuries-old

love for the land make the Ve-rona Province a foodie’s para-

dise. Make sure you taste the Vialone Nano variety of rice in a risotto, the typical red radish, Soppressa salami, lo-cal cheeses, the fi sh of Lake Garda and the delicious wines of the Verona hills.

FaroFly into Faro, the gateway to

the Algarve’s yummy regional dishes – from the freshest grilled

fi sh, delicious cataplana and spicy piri-piri chicken, to the most heavenly desserts, rich in local almonds, fi gs, oranges and carob.

BordeauxThe capital of the Aquitaine region has the benefi ts of all the specialities of

southwest France: foie gras from the Landes, oysters from Arca-

chon Bay, strawberries from the Périgord and Bazaz beef. Not to mention Bordeaux be-

ing at the heart of the largest fi ne wine producing region in the world!

people keen on walking. During your walk, you can stop at any point if you wish to explore more, visit one of the island’s many eateries or enjoy a picnic of local produce and appre-ciate the lovely views on your way. These routes are designed with walkers of all ages and abilities in mind. Each has an audio guide,

voiced by TV personality James Strawbridge, a full audio transcript and interactive map that highlights all the points of interest along the way. Each route is dotted with res-taurants, beachside kiosks and cliff top cafes to help you make the most of your culinary journey around the island.

Grand Manor Housesey’s mild climate enables a great diversity of fl ora to thrive in its sub-tropical gardens.The South coast cliffs of this walk offer one of the island’s most spectacular viewpoints and were much ad-mired by the likes of Renoir and Victor Hugo. The parish offers many places to stop and eat from

hearty lunches in country pubs to kiosks and cafes. Alternatively, pick a bench that overlooks your favourite bay and enjoy a picnic with a view.

TRAVEL INFORMATIONFor more information go to: www.visitguernsey.com/tastywalksTo book your fl ights, visit www.southamptonairport.com/airlines


Béziers

ClermontClermont-Ferrand-Ferrand

Menorca

ChambéryChambéry

Ibiza

Barcelona

NantesNantes

ManchesterManchester

LeedsLeeds

GrenobleGrenoble

IInnsbruck

Stornoway Wick

Stavanger

Manchester

Leeds

Clermont-Ferrand

Chambéry

NantesNantes

Grenoble

I

HamburgHamburgHamburg

AndorraAndorraAndorra

PLUS FLY TO

OF WORLDWIDE DESTINATIONS

PLPLPLLUSUSUU FFFLYLYLYY TTOO

OFOF WOWOWOWOOWORLRLRLRLDWDWDWDWDWDWIDIDDDDIDEEEEE

100swith KLM via Amsterdam

TRAVEL DESTINATION GUIDE

through...

DESTINATIONS ACROSS EUROPE

NNAATIOOONNNSST NNDESTID II40 FL

Y TO

ARO

UN

D

ON OVER 900 WEEKLY FLIGHTS

. . .Book a fl ight: southamptonairport.com/destinations


Béziers

Clermont-Ferrand

Menorca

Chambéry

Ibiza

Barcelona

Nantes

Manchester

Leeds

Grenoble

InnsbruckInnsbruck

Stornoway Wick

Stavanger

Innsbruck

Hamburg

Andorra

TRAVEL DESTINATION GUIDE

0871 66 33 777 airfrance.co.uk

01481 822886 aurigny.com

08456 202122 blueislands.com

08703 669 100 easternairways.com

01483 791 900 espritsun.com

0871 231 4787 fi rstchoice.co.uk

0871 700 2000fl ybe.com

01483 371 272 inghams.co.uk

0871 231 0000 klm.com

01425 480 400 prestigeholidays.co.uk

01483 791 933 skitotal.com

0844 412 5970 thomascook.com

0871 895 0095 thomascookstyle.com

0871 231 4787 thomson.co.uk

01983 721 111 italiangetaways.co.ukACCESS BY ROAD

The airport is situated just outside Southampton city centre, on the interchange of the M3 and M27. Passengers should exit at junction 5 of the M27. The airport is also easily reached via the A34 from Oxford and Newbury. The motorways leading to the airport clearly indicate the route to be taken. Pick-up and drop-off for FREE in the short stay car park.

TICKETLESS PAYMENTAutomatic car park number plate recognition is available at Southampton Airport. Simply enter your car details on-line and cameras at the car park barriers will recognise the registration number from information entered on-line. www.southamptonairport.com

SHORT STAY CAR PARKThe multi-storey short term car park is conveniently located next to the airport terminal building, just a short walk to check-in.

LONG STAY CAR PARKThe long term car park is located a few minutes from the terminal. Follow the signs past the multi-storey short stay car park. Free shuttle buses operate on a continuous service to take you directly to the airport terminal.

CONTACT DETAILS APCOA Parking 023 8062 7259

ACCESS BY RAILSouthampton Airport Parkway Train Station is just a 60 second walk from the terminal building, making it one of the closest plane-to-train links of any European airport. The station is served by South West Trains and Crosscountry Trains. Frequent services to many destinations including London, Basingstoke, Reading, Winchester, Bournemouth, Poole, Portsmouth, Oxford and Fareham.

CONTACT DETAILSSouth West Trains 0845 6000 650 southwesttrains.co.ukCrossCountry Trains 0844 811 0124 crosscountrytrains.co.ukNational Rail 08457 484950 nationalrail.co.uk

ACCESS BY BUSTwo operators (Unilink and Velvet) serve Southampton Airport to Southampton City Centre. The National Express terminal is located in the centre of Southampton on Harbour Parade.

Unilink route U1C/A operates from every 10 minutes during the week and every 15 minutes at weekends and public holidays. It stops outside the terminal.Velvet Bus A operates daily services from Eastleigh to Botley (and return) via Southampton Airport Parkway Station. The bus stops at Wide Lane next to the station.

CONTACT DETAILSUnilink 023 8059 5974 unilink.soton.ac.ukVelvet 023 8061 2288 velvetbus.infoNational Express 0870 580 8080 nationalexpress.com

GETTING TO SOUTHAMPTON AIRPORT IS EASY

PRE-BOOK PARKINGSave pounds on parking by booking in advance

at southamptonairport.com/parking

youtube.com/SOUAirport

southamptonairport.com/blog

@SOU_Airport

facebook.com/SOU.airport

Sign up to Southampton Airport's email newsletter: southamptonairport.com/newsletter

All information is correct at time of going to print. Flights are subject to change, particularly during holiday periods. Please check with the relevant airline or tour operator.

0844 879 8155neilson.co.uk

View our online fl ight schedule: southamptonairport.com/timetable


SECTION HEADERDEALS & SPECIAL OFFERS

DEALS & SPECIAL OFFERSAll deals and offers correct at time of printing, and subject to change.


Receive airport news & offers by emailSign up for Southampton Airport’s e-newsletter and receive the latest news and offers: southamptonairport.com/newsletter

WANT TO SAVE MONEY ON YOUR HIRE CAR?

southamptonairport.com/carhire20% discount available on car hire bookings made before 10th October 2014 and used by 31st October 2014. 10% discount applies outside of these dates. Only available for car hire collection from Southampton Airport. Offer cannot be used in conjunction with any other offer, promotion or contracted rate. Europcar standard terms and conditions apply.

Book your hire car with Europcar before 10th October for a fantastic

20% DISCOUNT

Terms & Conditions: Subject to availability in participating stores only. Lowest priced items must be purchased in the same transaction. Not in conjunction with any other offer.

BUY 1 GET 1 HALF PRICE

ON HUNDREDS OF BESTSELLING BOOKS INSTORE TODAY!

A smooth journey to a relaxing time?Order your currency online now at www.moneycorp.com/travelmoney for better rates and collect it at the airport when travelling

10% OFF

YOUR BILL

LOCATED LANDSIDE

FREE COFFEE WITH ANY COOKED

BREAKFASTValid July – October 2014

VALID JULY – OCTOBER 2014

LOCATED AIRSIDE

EXCLUSIVE SUMMER OFFER

10% off all food and drink with this voucher. Available at The Globe Southampton only. Subject to availability. Cannot be used in conjunction with any other offer, discount or promotion. Management reserve the reserves the right to cancel or amend this offer at any time and without prior notice. The Globe, TRG Concessions,

5-7 Marshalsea Road, London SE1 1EP

Free regular coffee or tea with this voucher when purchasing any cooked breakfast. Available at The Olive Tree Southampton only. Subject to availability. Cannot be used in conjunction with any other offer, discount or promotion. Management reserves the right to cancel or amend this offer at any time and without prior notice. The Olive Tree, TRG Concessions,

5-7 Marshalsea Road, London SE1 1EP.


Park For Lessat

Great Value • Safe and Secure 24hr Parking with CCTV coverage • Ticketless Entry and Exit

For more information visit www.southamptonairport.com or call 02380 627159

Quarter £350

£120Month

£1100Year

Season Ticket Offers

£50VOUCHER

S

WORTH O

F

* M&S

WORLD DUTY FREE OFFERS*Terms & Conditions: Saving compared to the average UK high street price.

with al

l annu

al se

ason tic

kets


Don’t fo

rget

our

‘Shop &

Colle

ct’

serv

ice

Duty free spirits

on selected spirits in store when you fl y to the Channel Islands*. Flying elsewhere? You can also take advantage of some great

savings in store.

60%Save up to

40% on Save up to

on selected fragrances in-store*


There’s no escaping the fact Hamburg is a water city.

Second only to Berlin, both in terms of size and overall population, the city of Hamburg is equally impressive and by no means second rate when it comes to tourism.

Hamburg is a very different city, since it is home to one of the biggest harbours in the whole of Europe, together with a series of large lakes and winding waterways, which include the River Elbe.

Without the Elbe river Hamburg wouldn’t be the economic power it is today. The river is 1091.47 kilometres long, originating high up in the Czech mountains and crossing two other German state capitals, Dresden and Magdeburg, before passing through the city of Hamburg, eventually

reaching the North Sea at Cuxhaven.The northern and southern branches of

the Elbe, along with numerous outfl owing channels and canals, are what shape the character of the city. Where would Hamburg be without its river and the sprawling port area that opens the door to the rest of the world?

Boat sightseeing trips of the harbour are particularly popular, with most departing from the jetties at Landungsbrücken. With the HVV-ferry a visitor can travel across to the opposite shore.

Thanks to the Old Elbe Tunnel, visitors can also walk or cycle under the river through to Steinwerder. At the weekends, the tunnel is closed to traffi c, making it a calmer time to pass through. On the other side, you can continue on to Wilhelmsburg,

or take in the view of the cityscape framed by the river.

Cycling enthusiasts can also enjoy the 23 kilometre long Elbewanderweg path which leads from Wedel, past the nature reserve Wittenberger Heide to Blankenese, then onwards through the beautiful Övelgönne all the way to Landungsbrücken. There are plenty of shortcuts, and return ferries depart from many points along the way.

In the summer the Elbe bank (Elbestrände) around Blankenese is thriving. Thanks to an increase in water quality in recent years, swimming in the Elbe is pleasant. However, make sure you’re aware of the changes in tides and currents.

The rural municipality of Övelgönne is part of the Othmarschen district. The most bustling part of the Elbe bank is popular

Above: Hamburg’s Bustling Port. Right: Cycling along the Elbe.Pictures courtesy of Marketing Hamburg

Ian Murray discovers just what is so great about this German city


DESTINATION HAMBURG


among the locals, particularly in the summer. The ‘Strandperle’ (beach pearl) is considered the mother of all urban beach clubs. Beach clubs in Hamburg provide a relaxed summer atmosphere with a view over the Elbe. As well as the Strandperle there is the Hamburg City Beach Club, Lago Baz, Hamburg del Mar and Strand Pauli.

Also of note is the ‘Alter Schwede’ – a 217 ton stone pulled out of the Elbe River. This colossal rock was found during dredging work in the river in October 1999. The Elbe beach is very popular for locals and tourists alike. Here one can sunbathe, BBQ, or simply enjoy the view of the Elbe and the container harbour on the other side of the river. Along the beach a small path leads past several cafés and restaurants

The true heart of commerce in the city of Hamburg is located within the Merchant’s District, which is dominated by imposing historic red-brick architecture and many major companies.

With a famous red-light district (St. Georg), an exciting local fi sh market (Fischmarkt) in the St. Pauli area, fi ne dining with river views, boating along the Speicherstadt canals, and a huge selection of top nightspots around the university quarter (Universitatsviertel), tourism in Hamburg is thriving.

Highlights include the vast Alster Lake and its surrounding recreational space, the historic Alter Elbtunnel (Old Elbe Tunnel) which leads to the island of Steinwerder, the seasonal Hamburger Dom amusement fair, the huge concentration of bars and theatres within the lively Reeperbahn area of Hamburg, and the many horticultural highlights and plant collections within both the Arboretum and the Klein Flottbek Botanical Gardens.

Culture lovers will also appreciate Hamburg’s diverse collection of museums, which cover a range of topics and offer interesting local information. For

The Elbe at night

• The Hamburger Kunsthalle on Glockengießerwall is the largest art museum in Germany. The Italian Renaissance style building from the year 1869 later received post modern additions to its structure. The highlights of the collection are the medieval altars of Master Bertram and Master Francke, Dutch paint work of the 17th century (incl. Rembrandt), paintings of the German romanticism period (incl. P.O Runge, C.D. Friedrich), impressionism and classic modernism, as well as international contemporary art as of 1950 (incl. Pop Art, Concept Art, Minimal, video art and photography).

• Since its opening in 2000, The Miniatur Wunderland has become one of the tourist highlights of the Hanseatic city. The world’s largest model railroad system is a must see for every Hamburg visitor. Visitors can admire different countries and even an airport in miniature. Currently the sections Hamburg, Harz, Austria, America and Scandinavia are completed. There are also open construction sites, so the visitors can observe and understand the construction. The 200 square metre Hamburg section includes all of Hamburg’s main attractions such as Michel and Hagenbecks Tierpark. With over 50,000 “Wunderländer” (as its inhabitants are called) the miniature replica of Hamburg is a bustling city. 1,500 trains arrive in the Hamburger Hauptbahnhof on a daily basis

• The City Hall is an impressive and eclectic building which was built in 1897. In the City Hall you can fi nd the senate (State government) and the Hamburg Parliament. There are regular guided tours and exhibitions in the Rathausdiele of the City Hall. The current City Hall is the sixth one in Hamburg’s history.

• The Hamburg Fish Market attracts over 70,000 visitors to the Elbe every Sunday. Here you can fi nd fresh fi sh, fruit baskets

and tropical fl owers. Rumour has it that the hawkers loudly shouting their wares at the Fischmarkt can be heard all the way over in nearby Reeperbahn. Without a doubt, every Sunday morning everything springs up in the Fishmarket area. Whether fi sh, fruit, fl owers, vegetables or clothes, anything can be bought on the stands lined up along the open space next to the Elbe’s harbour basin.

• The wonderful Jungfernstieg, located between the Reesendammbridge and the Gänsemarkt, is one of the most beautiful and exquisite shopping streets in the whole world. In front of the Binnenalster (“Inner Alster Lake”) you will fi nd Hamburg’s most popular promenade – the Jungfernstieg. Its name leads back to a old tradition. A long time ago families came to the Jungfernstieg on Sundays for taking a walk with their unmarried ladies, the damsels (german word: “Jungfer”). The name “Jungfern”stieg resulted from this rite. Interesting is also that the Jungfernstieg was the fi rst street in Germany to be asphalted. The most traditional building is the Alster-Pavillon. Here you can have a coffee and a phenomenal view over the Alster. One of Hamburg’s former mayors Max Brauer was sure that this was the most beautiful restaurant in the whole of Germany. Today you’ll fi nd the Café Alex in the Alster-Pavillon. Right next to the Café there is the Alster-pier. It is just perfect to have a relaxing trip by boat after a shopping expedition. The Binnenalster makes downtown a special place. The fountain in the middle of the lake turned into a special landmark of Hamburg City.

• On the Reeperbahn, Hamburg’s red-light district rubs shoulders with restaurants, bars, theatres and nightclubs. Recently the street was voted Hamburg’s best street in Prinze.de, the city’s entertainment guide, followed by Schulterblatt and Mühlenkamp. The street’s nightlife has something for everyone and is the fi rst stop for every night owl. In a song well-known in Germany,

Hans Albers sings: ‘On the Reeperbahn at half 12 at night...’Of course, the emphasis is on ‘at night’. If you were to visit this Hamburg neighbourhood during the day, you would fi nd a rather quiet street with a few shops, and you would perhaps wonder why there were so many closed doors. But when it gets dark, St. Pauli springs to life: neon signs fl ashing everywhere in competition. The hottest clubs on the Reeperbahn and Hamburger Berg open, with Irish pubs and Hans-Albers-Platz packed full of live music. The most famous street in Hamburg got its name from the old German word ‘reep’, which means an old heavy rope for a ship. During 1600 and 1880 the space north of today’s Reeperbahn street was used as a ‘ropewalk’ for the production of ropes for the nearby harbour. Nowadays, the street is the fi rst-stop for all sorts of entertainment.

• The St Michaelis church.This distinctive landmark in Hamburg is better known locally as the “Michel”. Visitors can admire the church’s impressive central vaulted nave, containing three music organs, and enjoy a beautiful view of the city from the tower. As you pass through the Hamburg inner city, the church tower of Michel can seem to follow you everywhere. This may be due to the fact that, at 132 metres, the tower of the main church dwarfs most buildings in the city centre and can be seen from many angles.Whether on a walk through Außenalster; a visit to the ‘Planten un Blomen’ park; strolling by the city walls; or along Landungsbrücken – the history-rich Church, nicknamed ‘Michel’ is a constant feature in the cityscape.The St Michaelis church as you can see it today is the third one to be built on the site. The original church, built between 1648 – 61 in the baroque style, was destroyed by a lightning strike. The second building was laid out in a form similar to a Greek cross, and later a 132 metre high tower was added (1777-85).

Don’t miss adventures in Hamburg:


DESTINATION HAMBURGDESDDDDDD TINATION HAMBURG

TRAVEL INFORMATIONRead more about this destination

or visit your local travel agent

southamptonairport.com/destinationsbook your fl ight at southamptonairport.com/airlines

the ghoulish, the guided tours of the Hamburg Dungeon are designed to make you jump, while the Museum of Hamburg History suits history buffs and provides in-depth information about the region, dating from the Middle Ages. Also notable is the highly acclaimed Zoological and Botanical

Museum, St. Pauli Museum, and the many art-related attractions and galleries lining the ‘Art Mile’ (Kunstmeile), which are to be found between the Deichtorstrasse and Glockengiesserwall.

More information visit: english.hamburg.de.

BUSINESS FOCUS

BUSINESSFOCUS @SOU_Airport

18 SOUTHAMPTON AIRPORT AUTAUTUMN 2014

facebook.com/SOU.Airport twitter.com/SOU_Airport

Breeze Through...From parking to check-inwww.southamptonairport.com/priority

Next time you fly, chooseBreeze Priority Parking

Wider bays

From entrance to parking space in under 60 seconds

Ground floor and under cover

Closest parking to the terminal

n Flexible space for up to 30 peoplen Free Wi-Fin Smart board with projectorn Spider phonen TV/DVDn Flip chart and pensn External telephone linen Catering available n Free parking opposite the terminalTo book email [email protected] or for more information call 02380 627187

Terms & Conditions: to take advantage of 20% discount, the room must be booked by 31 August 2014 and used by 31 December 2014. Customers must quote ‘SUMMER’ to obtain the discount.

If you’re looking to organise a meeting, need some time on your own to work on an important business deadline or want to conduct a training course, the Spitfi re Meeting Room can cater for all your needs.

MEETING FACILITIES20%

EXCLU

SIVE

DISCOUNT!

QUOTE ‘SU

MMER’

AT SOUTHAMPTON AIRPORT

www.southamptonairport.com/priorityparking

Breeze Priority Parking* gives you

the advantage of ground fl oor, under cover parking, with wider bays that are situated as close to the terminal as possible for ease and convenience. Priority Parking can be pre-booked online or purchased on the day. Simply turn up and follow the signs to the Priority Parking area. By pre-booking, passengers can make considerable savings on parking prices as well as gaining automatic access to the car park.

*Priority Parking costs £33 per 24 hour period (less if pre-booked in advance), or part thereof, which is just £5 more than the standard car parking prices. It also offers complimentary access for up to two people to the Breeze Priority Security service (when pre-booked). **This product can be purchased online for £3.50 per person or for £4 per person if purchased within the terminal. Prices correct at the time of going to print and are subject to change.

Breeze through the Priority

security lane to save time. Passengers can now opt to upgrade their airport experience by purchasing priority access to the security search area**. After checking-in for your fl ight, you can now choose to enjoy fast-track access to the security search area through a dedicated entrance, ensuring security screening is completed more swiftly and saving precious time.

PRIORITY UPGRADE SERVICES

Book at southamptonairport.com

Pre-book via www.southamptonairport.com/prioritylounge. Access to the lounge is £15 per person and includes free Breeze Priority Security.

Book on the day Before security you can purchase your ticket from the machine next to the check-in desks. Alternatively, after security, you can purchase your ticket at the Breeze Priority Lounge entrance.

Membership Card holders The Breeze Priority Lounge is also available for use by Airport Angel, Priority Pass, Diners Club, Lounge Club, Lounge Key and Lounge Pass card holders. Card holders should present their membership card at the Breeze Priority Lounge entrance to gain entry.

Free Wi-Fi n Laptop & mobile charging points n Refreshments n Comfortable seating

START YOUR journey as you mean to go on; relaxed and hassle-free with our Priority Upgrade Services – Priority Parking, Priority Security and Priority Lounge.

To access the lounge:

The Breeze Priority Lounge has now been moved to a larger location. Choose to relax in the comfortable tub chairs or station yourself with your laptop over-looking the runway on the high

bistro stools and tables. You can fi nd the Breeze Priority Lounge upstairs in the departure lounge, past the Olive Tree. Follow signs for the ‘Business Lounge’.

Where do you want to fl y to?Let us know at southamptonairport.com/fl yto


Southampton Airport’s new route to Hamburg starts in October 2014

with Flybe. Business experts in the region have warmly welcomed the

addition to Southampton Airport’s offering.

Stewart Dunn, Chief Executive of Hampshire Chamber of Commerce,

said: “We welcome the new route from Southampton to Hamburg. From

a business viewpoint, there is synergy between the two cities with the

aerospace and marine connections, which

are both LEP Sector priorities; and from

a leisure point of view the city will be

ideal for weekend breaks.”

Sally Lynskey, CEO of Business South,

also welcomed the news about the new

Hamburg route, saying: “Hamburg is

the second largest city in Germany

and a major economic hub in mainland

Europe. We welcome the news about

this new route and the opportunity it

provides to build greater connections

between the two port cities of Southampton

and Hamburg. It strengthens the offering of fl ights from

Southampton Airport and helps our region to be recognised as a well-

connected place to do business.”

Councillor Seán Woodward, Hampshire County Council’s Executive

Member for Economy, Transport and Environment, added: “This is

great news. There are strong similarities between the Solent region and

Hamburg, Germany’s second largest city and Europe’s second largest sea

port. Greater connectivity between our respective business communities

and groupings of particular business activity can only help in developing

a stronger Solent economy, whether through access to new clients, new

supply chains or collaborative innovation.”

Kim Yeomans, Operations Manager of

Farnborough Aerospace Consortium, said:

“There has been a demand for low fare fl ights

to key European destinations within the

South East at convenient times for business

travellers within the aerospace industry for

quite a while. Southampton Airport is not

only convenient for onward travel but is

a stress free experience. This new route

from Southampton to Hamburg will be very

welcomed.”

Book your fl ight at

www.southamptonairport.com/airlines

Stewart Dunn

BUSINESSES WELCOME HAMBURG ROUTE

h

ton

sup

F

“

t


DESTINATION DUBLIN

It remains one of the top destinations worldwide for British travellers, so Breeze asked Tourism Ireland just why the Irish capital remains so

popular, and why there’s always a good reason to visit


DESTINATION DUBLIN

ripAdvisor twice hailed Dublin as the friendliest city in Europe. So what’s the fi rst thing you should

do? Why, meet a Dubliner, of course. We’ve even got a programme in place to connect fi rst-time visitors with hospitable locals. It’s called City of a 1,000 Welcomes (you’ve heard of the céad míle fáilte, right?), and it’s going down a treat.

Another way to stock up on the low-down is by taking a tour. As well as traditional bus sightseeing experiences, visitors to Dublin can explore the city’s haunted corners with Hidden Dublin Walking Tours, visit the latest cultural happenings and new openings with the Le Cool Dublin Experience, or explore the emerging docklands on a Segway tour.

Dublin has its big hits and historic sights (we’re looking at you, Trinity College and the Guinness Storehouse). But truly, a visit is as much about the here and now.

New ideas and sparky start-ups are fl ourishing, with fresh scenes popping up along South William Street, Essex Street West and most recently, Capel Street. You can still hit up Grafton Street for high street shopping,

but don’t miss the buzzing bars and boutiques of the emerging Creative Quarter around South William Street to George’s Street, and from Lower Stephen’s Street to Exchequer Street.

The quays are quite the architectural catwalk, too. From Daniel Libeskind’s Bord Gáis Energy Theatre at Grand Canal Dock to the Custom House and U2’s Clarence Hotel, Dublin’s skyline seems at once rooted in present and past. All that’s missing, as the late poet Seamus Heaney said, are “the Vikings coming sniffi ng up the Liffey”.

Dublin, of course, is famous beyond its friendliness. James Joyce immortalised the city and its people in masterpieces such as Ulysses, and it continues to live and breathe the written word. Dublin is a UNESCO World City of Literature, but it’s not just its authors who are interested in spinning yarns... hence the famous local greeting: What’s the story?

The best places to join the conversation are Dublin’s pubs, clubs and cafés. New or old, fashionable or funky, gorgeous or grimy – there’s something for everyone’s taste here. Three to make aim for are The Fumbally (a café-cum-collective on Fumbally Lane),

Izakaya (the Japanese whiskey bar on South Great George’s Street) and Everleigh Garden (“70% outdoors, 30% indoors and 100% friendly,” as it says itself) on Harcourt Street.

Finally, don’t forget Temple Bar – a cobblestoned enclave of galleries, restaurants, hopping pubs, buskers and the shape-shifting Meeting House Square. Perhaps check out another newbie to the urban landscape, which went unappreciated until relatively recently: Dublin’s twist on grafi tti, murals and tagging. Challenge your perceptions with a Street Art tour around Temple Bar’s streets and alleys – who knows what you’ll discover…

Dublin wants to meet you... come say hello.

Top Five Things to Do in Dublin?So, is it possible to squeeze Dublin into

fi ve experiences? Of course not. But don’t let that stop you trying. Get ready for an unforgettable city break.

1. Big it up at the Little MuseumThe Little Museum of Dublin in St.

Stephen’s Street is David to the National

T


Museum’s Goliath, a miniature marvel telling the story of city through joyfully eclectic exhibits (a signed U2 album, an old bus ticket machine, a facsimile of James Joyce’s death mask). There’s a reboot of a traditional Irish kitchen in the basement, too. Hatch & Sons does heart-warming all-day breakfasts, with 21st century takes on classics, such as Beef & Guinness stew. All this mouthwatering food in a basement that could have been airlifted straight from Downton Abbey.

2. Eat Tweetie pieIt’s fresh and it’s funky. It’s lo-fi and high

on fl avour. It’s Skinfl int on Crane Street, and it’s gonna push every last pizza button in your body. The pies are long, thin and delicious – and they’re named after the staff’s mums (aww...). Is yours a Sadie (roast garlic confi t, toasted hazelnuts, spinach) or a Tess (pulled pork, fennel seeds, braised fennel and mascarpone)? A Gráinne or a Vonnie? Hit up #tweetseats on Twitter – it’s a lottery for free eats.

3. Paddle your own canoeYou can tour Dublin on foot, by bike, bus,

car or coach. Or you could think different and connect with the good folk at City Kayaking. You’ll fi nd them by the Jeanie Johnson tall ship at Custom House Quay – this is the only kayaking operation in the city centre, and it offers the chance to explore the River Liffey, its bridges and Dublin’s iconic sights from an entirely different angle. Don’t want the full tour? No worries. Rentals are an option, too.

4. Get to a galleryDublin’s museums and galleries may be

home to priceless treasures, but most are absolutely free to visit. For a quick fi x with a difference, step out of the tourist throngs and into the Temple Bar Gallery & Studios in Temple Bar. This cool little cube specialises in cutting-edge visual art, and a few minutes is all it takes to immerse yourself in its ideas. Afterwards, rejoin the world with a new perspective and a pep in your step.

5. Pull the perfect pintThe Gravity Bar at St. James’s Gate is

like a bird’s nest, with views stretching from Dublin’s city skyline to the coast and mountains beyond. Best of all, it’s perched on

top of the Guinness Storehouse. Yup, that’s seven storeys devoted to the world’s most famous stout, and you can even learn how to pull the perfect pint along the way. Cheers!

• For lots more ideas for lively places to visit and things to see and do visit: Dublin www.ireland.com/en-gb/campaign/craic-dublin or enter “Craic Dublin” into Ireland.com for lots of other ideas.

• With thanks to Tourism Ireland.. More information visit www.ireland.com.

Above left: The Gravity Bar at the Guiness Musuem. Above Kayaking along the river.Top right: The Little Museum of Dublin sign.

Right: Visitors head to the Temple Bar Gallery and Studios.





by Shelly Fountain

WHAT’S ON AT OUR DESTINATIONS

See page 9 for our destination map and airline/tour operator details. Information is correct at time of going to press. Please check details with event organisers before making travel arrangements.

For What 's On in Hampshire see page 38

What's on...at our destinations

TASTE GUERNSEY FOOD FESTIVALAugust 30 – September 1 Fly to Guernsey with Blue Island and FlybeA chance to enjoy three days of fun food heaven. There is so much to enjoy during this weekend event with the Taste Guernsey kitchen being at the heart of the festival, where visiting and local experts will tantalise your taste buds in a series of free events and there are lots of opportunities to join in the fun with quizzes, tastings and behind the scenes tours taking place around the island.

For more information visit: www.tasteguernsey.com

BELFAST MELAAugust 24, Botanic Gardens Belfast Fly to Belfast with FlybeThe Mela returns to Botanic Gardens on the 24th August 2014 from 12pm-6pm for the eighth year of world music, dance, food, fashion and fun!This year’s event is jam packed with a show stopping line up featuring music, dance, food, fashion, street theatre, circus and carnival from across the globe, all presented in a high energy and vibrant day out. For more information visit: www.belfastmela.org.uk

MANCHESTER FOOD & DRINK FESTIVALSeptember 18-29 Fly to Manchester with FlybeThis nationally acclaimed event will once again return in 2014 to take over the City Centre with a huge programme of events taking place both indoor and outdoor.It is an urban food and drink festival, there is no single location, rath-er the Festival takes over as much of the City Centre and surrounding districts of Greater Manchester as possible.The Festival highlights a number of ‘Festival themes’, issues which affect the food and drink industry in the region.Like Manchester itself, the Festival is both Original and Modern. Events and participation have ranged from a children’s food work-shop at a community library in Salford, to a glittering Gala Dinner at The Lowry Hotel.

For further information visit: www.foodanddrinkfestival.com

ALDERNEY AUTUMN FOOD & DRINK FESTIVALOctober 13 – November 1 Fly to Alderney with AurignyRunning for its second consecutive year, the Autumn food and drink festival features the very best local produce from fruits and vegetables, dairy produce and our delicious home-reared meat and line-caught fi sh.There will be a varied programme of events, including themed food nights, cookery classes, Halloween suppers, Oktoberfest beer festival and wine tasting events.The prestigious Alderney Masterchef Competition will also return again in 2014.

HISTORIC CHRISTMAS MARKET, HAMBURGNovember 25 – Dec 23 Fly to Hamburg with FlybeThis famous Christmas market takes place against the historical backdrop of the Hamburg Town Hall. The Christmas market includes ‘toy alley’, crafts and wood carvings plus delicious food and drink (try the traditional Lebkuchen and mulled wine). The market is loved by Hamburgers and international visitors alike.


CRUISING NEWS

TROUBLE-FREE CRUISINGIf you are one of the many hundreds of

thousands now choosing to take a cruise as a holiday then Southampton Airport

is the trouble-free and convenient way of joining your ship.

The airport is just a short distance away from the city’s port so the transfer from air-craft to ship could not be more straight for-ward.

Southampton is now the UK’s premier port for cruising and the busiest centre for the ever growing industry in northern Europe.

The many routes served by the airport bring cruise ship passengers from all over the UK all heading for the high life on the high seas, and when your holiday is at an end then a fl ight back home could not be easier.

Flying to Southampton means no long, tir-ing coach trips, which could last hours, or having the strain of driving to the port and then facing the extra cost of parking in or around the docks while the ship is away.

Taxis are available to take passengers, and their luggage, direct from the airport to the dockside or a mainline train service is only a short step away from the terminal with links to the city centre.

Many ship passengers, who choose to arrive in Southampton the day before they embark on their voyage, take advantage of special

overnight cruise rates offered by local hotels in the city.

The area around the port has a wide choice of hotels, including fi ve in West Quay Road, which overlooks the docks, to suit every budget.

In Southampton the port is divided into two

separate areas. Passengers heading for the Ocean Terminal or the Queen Elizabeth II Ter-minal should make their way to the Eastern Docks while the City Cruise Terminal and the Mayfl ower Terminal are both in the Western Docks.

Almost all the major cruise lines have ships based in Southampton, including some of the biggest vessels afl oat today.

Among the operators with vessels in South-ampton are Cunard, P&O Cruises, Princess Cruises, Royal Caribbean, Celebrity, Fred Ols-en Cruise Lines, while there are also regular visits from Saga, Holland America, Oceania and MSC ships.

Cruises leave from Southampton all the year round and among the destinations are the Mediterranean, Canary Islands, Baltic Sea, Black Sea, Caribbean, and increasingly popular cruises around Great Britain as well as annual round-the-world voyages.

Southampton is also the traditional depar-ture point for trans-Atlantic crossings by Cu-nard liners to New York and back.

CRUISINGNEWS


DESTINATION REASONS TO GO TO...

REASONSTO GO TO...

LA ROCHELLE

One unusual day trip turned out to be one of the highlights of a trip to this region of the French west coast words by Ian Murray

Who would ever have thought salt could be so interesting.

Certainly, you wouldn’t neces-sarily place it high on your list of must-see attractions.

Yet the gathering of sea salt from the marshes on the coast just a short drive from the city of La Rochelle turned out to be one of the highlights of our trip to the region.

It was salt that brought prosper-ity to this corner of Pays de la Loire region centuries ago. There was enough wealth in harvesting the valuable commodity from the Atlantic to create a whole walled city to defend the loot.

Today visitors to the region can experience the on-going success of the Terre de Sel with its fascinating museum.

Situated just a short drive from the glamorous resorts of the Cote Sauvage – La Baule with its nine kilometres of fi ne sands, Pouliguen and Pornichet la Baule – the salt fl ats are just part of what makes this region so attractive – and nationally famous.

The French adore the region, not least thanks to one of their most famous comedians Jacques Tati. It was here, in the small resort of Saint-Marc-Sur-Mer the fi lm maker created one of his most famous characters Monsieur Hulot. Today there is even a beach named after him – Plage de Monsieur Hulot – and travellers can stay in the hotel where the fi lm (Les Vacances de M. Hulot) was created: Hotel de la Plage.

A statue of the character over-looks his namesake beach – a must for photographs.

And no stay at the hotel would be complete without a short walk to the famous nearby Le France res-taurant set in the sands themselves. Magical.

But then again the whole region is surprising, and all just a short drive from the wonderful city of La Rochelle itself.

The city is actually across the departmental border into Poitou-Charentes. A fi shing village in the Middle Ages, La Rochelle is famous today for its beautiful Vieux Port, guarded by medieval twin tow-ers. Relax at a restaurant on the quayside, discover the temptations of historic shopping streets fringed with arcades, and visit the city’s many museums. Step on board the ships of the Maritime Museum and visit the Aquarium – one of Europe’s largest.

Easy to explore on foot, La Rochelle also operates a bike hire scheme with 160 km of designated cycle tracks. The city has a vibrant contemporary scene too with music festivals, sports events and shows throughout the year, including Le Grand Pavois, Europe’s biggest fl oating boat show.

Guarded by medieval twin tow-ers, the Vieux Port at La Rochelle is one of the most photographed harbours on France’s Atlantic coast, the colourful hub of a town packed with history and heritage, tempting boutiques and cosy restaurants.

Pick up a town guide from the Tourist Offi ce in the colourful Gabut district beside the harbour. Once a collection of old fi shermen’s huts, the brightly painted clap-board buildings now house shops and cafes.


Above: St Martin cafes at harbourside

Opposite the Tourist Offi ce is La Rochelle Aquarium, home to 12,000 marine animals, whilst the fl oating Maritime Museum nearby includes a weather ship, trawler and tug boat.

The historic old town features vaulted stone arcades and historic public buildings, as well as impos-ing private mansions from the 17th and 18th centuries. Visit the newly restored Natural History Museum, the Fine Arts Museum, or one of several themed collections.

Easy to explore on foot, La Ro-chelle is ideal as a short-break desti-nation or as part of a longer holiday. It also offers 160 km of designated cycle paths, accessible to everyone thanks to the fl eet of 350 yellow municipal bikes or ‘Yélos’.

Enjoy one of the many music and fi lm festivals, sports events and concerts, not forgetting Le Grand Pavois, Europe’s biggest fl oating boat show every September.

For a break from the city a short drive takes visitors to the toll bridge to Ile de Re, known as The White Island for the quality of its light and whitewashed houses. Explore the island’s ten villages which include two classifi ed amongst the Most Beautiful Villages of France; follow a network of trails by bike or on horseback; and wander the Vauban

ramparts of Saint-Martin-de-Ré where you might even spot one of the famous ‘Donkeys in Trousers’.

Visit in summer to enjoy swim-ming, sunbathing and water sports along its many sandy beaches. Stay out-of-season and ride a horse along empty trails, pilot a sand yacht on a deserted beach; and experience the relaxed pace of authentic island life.

Explore Ile de Re’s ten enchant-ing villages where narrow lanes are fringed with whitewashed houses. Taste island produce at the daily food market in La Flotte-en-Ré. Browse the craft shops and gal-leries of Saint-Martin-de-Re with its Vauban citadel, star-shaped ramparts and bustling harbour. For a seagull’s eye view, climb the bell tower in Saint-Martin or head to the Phare des Baleines lighthouse.

The highest point of Ile de Re is just 19 metres above sea level so there’s no better way to experience the island’s natural environment than to cycle its 100 km network of marked trails. Along the way you can learn about salt production and fi shing, fl ora, fauna and local tradi-tions at a variety of heritage centres and nature reserves.

For more information visit: www.visit-poitou-charentes.com.





DESTINATION SKI RESORTS

HIT THE SLOPESIt may seem a long way off but your skiing holiday made be closer than you think.

Ed Stilliard checks out some great resorts to go to from Southampton

Ari

nsal

mou

ntai

ns


T’S never too early for skiers and snowboarders to be planning their winter holiday.

Southampton Airport has access to a variety of destinations allowing people

to hit the slopes of some of the best resorts Europe has to offer.

Fans of the piste can easily enjoy the delights of four different countries with a variety of activities on offer.

And there is something for everyone, from novices trying out for the fi rst time to those wanting to take on the black runs.

Holiday operator Inghams has started fl ying anyone keen to take up the sport to the family-friendly resort of Oberperfuss in Austria.

Nestled on a sunny plateau among the foothills, the reason that the area is so hugely popular with families is undoubtedly the Rangger Köpfl , with its glorious views overlooking the Inn valley.

Located a handy 20 minutes from Innsbruck Airport, the new resort is exclusive to Inghams customers looking to try out a new pastime on the snow.

Oberperfuss may not slip off the tongue like other Tyrol resorts such as Kitzbuhel and Kirchberg but by being small it allows minnows to try out their ski legs without feeling all at sea.

The ski area is set up to progress from a dedicated beginners’ area onto longer blue runs as your confi dence builds, with a couple of more challenging pistes and a snowboard fun-park to round off the week.

The slopes are not over-run with high-speed show-offs, leaving ski-school groups able to simply relax and enjoy the mountain in safety.

Also part of the Rangger Köpfl ski area is the 10 kilometre-long, fl oodlit natural toboggan run guaranteeing fun for all the family.

Inghams prides itself of making sure that the value for money here is second to none with friendly but professional English-speaking ski-instructors.

They also promise lively bars, great food and good company at all-inclusive prices to guarantee a wonderful week’s holiday.

Snuggled in the heart of the Pyrenees the largely forgotten principality of Andorra is the perfect venue for those who ski as hard as they party.

Andorra may be tiny compared to its neighbours France and Spain but it boasts some of the best ski schools and après-ski in Europe and the Grandvilara ski area is up there with the best.

Adventure holiday fi rm Neilsons provides fun in the mountains at three resorts covering 210 kilometres of varied runs – Soldeu, El Tarter and Pas de la Casa.

Soldeu provides some of the best

accommodation in Andorra while El Tarter makes for a convenient, quieter base with accommodation centred around a high-speed gondola.

At both resorts beginners can enjoy the nursery slopes at the top of the gondola and for those wanting to take their skiing or boarding to the next level, the snow park in El Tarter is the perfect place to go.

Those who want to take things to the next level should head to the highest ski resort in Andorra, Pas de la Casa.

The resort’s nightlife however remains one of the top attractions as scores of bars and clubs offer lively and reasonably priced nightlife.

But what about those who just want to head out to ski and experience the true tranquil Alpine life?

Flybe operate fl ights out of Southampton to the popular winter destinations of Chambery,

I


DESTINATION FARO, PORTUGAL

Grenoble, Geneva and Salzburg.Set in the rugged yet spectacular region near

Lyon, Chambery and Grenoble are popular all year round.

As the host city of the 1968 Winter Olympics, Grenoble has a proud history of snow-based sports.

With more than 40 ski resorts situated locally, you really are spoilt for choice, whatever your experience and ability.

Many of the resorts run shuttle buses and coaches from Grenoble Airport, making your onward journey as straightforward as possible.

But it is the popular Val d’Isere with its cobbled alleys lined with restaurants and bars which draws the biggest crowds.

The Swiss capital of Geneva is another popular destination for those keen to head to the picturesque French-Swiss countryside.

Forever a top skiing destination with more than 200 resorts from south Grenoble to Lake Geneva, the charming villages and preserved natural spaces create a special atmosphere.

It is possible to ski all year round thanks to its location and high altitudes up to 3,600 metres above sea level.

Salzburg might have been the home of Mozart but it is this Austrian city where planes land bringing in hordes of holidaymakers looking for fun on the slopes.

There are more than 200 ski resorts located within three hours’ travelling distance of this medieval city and many choose to take advantage of Flybe’s low cost fl ights in the winter months.

Above: Beuatiful Austrian mountains. Left: Top Star in Obergurgle.





OUT & ABOUT HAMPSHIRE’S HISTORY AND HERITAGE

Walk in Jane Austen’s footsteps, re-live the tragic story of RMS Titanic, climb on board Nelson’s HMS Victory

or marvel at one of the greatest symbols of medieval mythology, King Arthur’s Round Table – Hampshire has a wealth of history and heritage waiting to be discovered.

Literary HeritageHampshire’s countryside and historic buildings were an important inspiration for literary heroine Jane Austen, who lived in the county during the 19th century. Jane was born in the village of Steventon near Basingstoke and following the death of her father, moved to Southampton. She wrote some of her most famous novels at her home in Chawton, which is now an intimate museum. Here you can stand behind her small writing table, see some of her personal items on display and walk around the pretty garden. Winchester Cathedral is Jane Austen’s fi nal resting place, where there is a permanent illustrated exhibition next to her grave.

The popular novelist Charles Dickens spent his early life in Portsmouth, where he was born in 1812. His birthplace is now a museum where you can experience the authentic atmosphere of his former Regency home. Portsmouth is also famous for Sir Arthur Conan Doyle, the author of Sherlock Holmes, who lived in the city and is buried in the New Forest.

Other famous writers with connections to Hampshire include poet John Keats, who stayed in Winchester and wrote his ode ‘To Autumn’, poet Edward Thomas, novelist Flora Thompson and naturalist Reverend Gilbert White.

Martime HeritageThe city of Southampton has a rich maritime heritage and is considered to be the cruise capital of the UK. The city offers many vantage points to watch the ships go by, including Mayfl ower Park and the waterside village of Hythe.

Southampton is also home to the largest working cargo-passenger steamship, the SS Shieldhall, which is an important part of Britain’s maritime heritage. Enjoy the cruising style of yesterday as you step aboard the ship for a cruise around the Solent. While on board, see the engine room with its original steam engines and get close to large cruise and container ships passing by.

The RMS Titanic set sail on her ill-fated maiden voyage from the White Star Dock in Southampton. Learn about the fascinating historical connection between the city and RMS Titanic with a visit to the state-of-the-art SeaCity Museum. The museum houses a permanent exhibition of Southampton’s Titanic story with interactive activities. You can also explore some of the city’s major

OUT&ABOUTIN ASSOCIATION WITH

www.visit-hampshire.co.uk

The offi cial tourism website for the county

N AIN ASSOCSSOC AIATION WON WITHIN ASSOCIATION WITH

www visit hampshire co uki i h hi k

words by Hannah Gayler

Above: Sailing at Warsash.

Left: HMS Victory and the Mary Rose Museum at Portsmouth Historic Dockyard.

HAMPSHIRE’S HISTORY AND HERITAGE


OUT & ABOUT HAMPSHIRE’S HISTORY AND HERITAGE

OUT&ABOUT HAMPSHIRE’S HISTORY AND HERITAGE

What's on...in Hampshire

Information is correct at time of going to press. Please check details

with event organisers before making travel arrangements.

Aberdeen Asset Management Cowes Week

2-9th August 2014, Cowes, Isle of Wight

One of the longest regular sailing regattas in the world, Cowes Week

is held each year along the Solent in the town of Cowes on the Isle of

Wight. Approximately 1000 boats and a wide range of competitors

gather to take part in up to 40 daily races during the week. Travel to the

Isle of Wight from various Hampshire locations including Southampton,

Portsmouth and Lymington in the New Forest.

www.aamcowesweek.co.uk .

Victorious Festival 23rd-24th August 2014, Southsea Seafront

Dizzie Rascal, Seastick Steve, Tom Odell and Ocean Colour Scene are just

some of the big names performing at the Victorious Festival this year.

Held on Southsea Seafront, there will be free entry to all of the seafront

attractions including Blue Reef Aquarium, D-Day Museum and Southsea

Castle. Plus there will be a free kids’ arena, real ale festival, boutique

markets, silent disco and loads more!

www.victoriousfestival.co.uk.

P1 Grand Prix of the Sea 6-7th September 2014, Gosport

The big season fi nale for P1 powerboat racers and Jet Ski riders is taking

place this year in Gosport. More than thirty personal watercraft racers

will take to the water for the UK SuperStock and AquaX championships

showdown. Get up close to the fast and furious action and enjoy freestyle

Jet Ski stunts all weekend, for free, along the seafront. www.p1superstock.

co.uk and www.p1aquax.co.uk.

PSP Southampton Boat Show

12-21st September 2014, Mayfl ower Park

One of the biggest marine events of the year, the PSP Southampton Boat

Show has over 300 boats of all classes, shapes and sizes. Stroll around the

marina and see million pound vessels, hear adrenaline-fi lled stories from

experienced sailors and a raft of shoreside events! Browse the very latest

products and services from over 500 exhibitors at special show prices.

www.southamptonboatshow.com.

Romsey Show 13th September 2014, Broadlands, Romsey

Showcasing the best of British farming, the Romsey Agricultural and

Horse Show takes place this year at Broadlands, Romsey. It is one of

the oldest shows in England and has been running since 1842. Events

include cattle and sheep competing in livestock classes, a range of horse

based activities, dog shows and falconry displays. There will also be a

chance to buy award winning local produce and browse over 500 trade

stands. www.romseyshow.co.uk.

Victorian Festival of Christmas

28th-30th November 2014, Portsmouth Historic Dockyard

Now in its 15th year, Portsmouth Historic Dockyard presents a

Victorian Festival of Christmas. Step back in time with a host of

traditional characters, costumes, music and entertainment. Festival

favourites are set to return including the largest ever Christmas Market,

Fagin’s Real Ale Tavern, Dickensian-style snow covered streets and a

traditional Father Christmas (dressed in green).

www.christmasfestival.co.uk.

Winchester Cathedral Christmas Market and Ice Rink

20th November-21st December 2014, Winchester Cathedral

Winchester Cathedral’s Christmas Market is recognised as one of the

best in Europe. Based on the traditional German

markets, it is known for its superb location, great

stalls and busy atmosphere. Each year thousands

of people visit the local craft stalls and food outlets

serving mulled wine. At the centre of it all is a real

ice rink, providing fun for all the family.

www.winchester-cathedral.org.uk.

IN ASSOCIATION WITH

www.visit-hampshire.co.uk

The offi cial tourism website for the county

Top: Jane Austen’s House Museum. Inset : Jane Austen’s writing tableAbove right: King Alfred Statue, by Daniel Bosworth.

Titanic related sights on foot, which include war memorials, the former White Star Line headquarters and the Grapes pub.

Naval HeritageSurrounded by the sea, Portsmouth is strongly linked with the Royal Navy and has played a key part in many historical events, including Nelson’s last battle at Trafalgar and the D-Day landings. Portsmouth Historic Dockyard showcases 800 years of naval history and is home to world famous ships HMS Warrior 1860, Nelson’s HMS Victory and Henry VIII’s fl agship the Mary Rose. Discover fi rst-hand what it was like to serve and fi ght on board the ships that shaped Britain’s history alongside the modern warships of the Royal Navy. Visitors can also take a harbour tour by boat, visit the interactive Action Stations or the National Museum of the Royal Navy.

Step back in time at Buckler’s Hard, an 18th century shipbuilding village where the ships for Nelson’s Navy were once built. Find out about the history of the village, which was originally founded as a free port for the trading of sugar. See a recreation of the Shipwright’s Cottage and discover what life was like in the village at the time at the Maritime Museum. Go for a walk beside the Beaulieu River or take a cruise to see some of the wildlife that inhabits its banks.

Royal HeritageThe cathedral city of Winchester is England’s ancient capital and former seat of King Alfred the Great. Visit his statue at the bottom of the high street or his last known resting place which is commemorated at Hyde Abbey Garden. Learn more about Winchester’s role in English history at Winchester City Museum.

Whilst in the city you can also visit one of the fi nest examples of a medieval hall and the only surviving part of Winchester Castle. The Great Hall is home to legendary King Arthur’s Round Table, which dates back to the early 14th century. The table contains the names of 24 of the Knights of the Round Table, surmounted by King Arthur on his throne.

To fi nd out more information on places to discover in Hampshire, visit www.visit-hampshire.co.uk.

By Hannah Gayler

Gdot

v

For What 's On at our destinations see page 25

Ti i l d i h


COMMUNITY NEWS

COMMUNITYNEWS

Southampton Airport has unveiled a brand new ‘welcome’ photo wall as part of the celebrations of the 50th anniversary of the city of Southampton. The airport commissioned Southampton Solent University photography student, James Robinson, to take images of people and iconic landmarks of the city. The result is ‘Fifty’ - a stunning wall of fi fty photos which is displayed in the arrivals area of the airport.

‘Fifty’ features famous locations around Southampton such as the Mayfl ower Theatre, St Mary’s Stadium, Tudor House and the port. It was unveiled by The Right Worshipful the Mayor of Southampton, Councillor Mrs Sue Blatchford.

Photographer James Robinson, of Southampton Solent University, said: “I am delighted to have been given this fantastic

opportunity by Southampton Airport to capture the diversity, beauty and excitement of the city. This assignment has given me the chance to explore with a new perspective the fascinating breadth of our historic city. My personal highlight was photographing the enormous container ships from a small vessel darting around the docks. Undertaking this commission during the fi nal weeks of my degree has been hard work but tremendous fun; hopefully it will showcase Southampton to passengers as they arrive at and depart from the airport, increase my exposure with potential clients and help me forge a successful career as a professional photographer.”

Look out for ‘Fifty’ as you travel through Arrivals.

For information on how local projects can benefi t from the Southampton Airport Community Fund, please visit: southamptonairport.com/community

FURTHER INFORMATION

NEW PHOTO WALL CELEBRATES 50 YEARS OF SOUTHAMPTON AS A CITY

MP goes ‘back to the fl oor’at Southampton Airport

Cycle challenge raises over £400 for RAF Benevolent fund A team of nurses and healthcare assistants from the Ministry of Defence Hospital Unit brought a cycle challenge to Southampton Airport, to raise money for the Royal Air Force Benevolent Fund. The team – a mixture of Navy, Army and Air Force personnel from Queen Alexandra Hospital in Portsmouth – cycled an astonishing 377 miles in just fi ve hours on exercise bikes in the airport terminal.

Generous passengers donated more than £400 to the charity as a result of the incredible cycling challenge – which is the equivalent distance of a fl ight from Southampton to Dublin.

Anthony Cleightonhills, Terminal Operations Co-ordinator from Southampton Airport, said: “This entertaining cycle challenge certainly

caught the attention of our passengers and made for a lively terminal. We’re thrilled to have helped raise money for this worthy cause.”

Heather Kemp, Regional Fundraiser from the RAF Benevolent Fund said: “We are delighted to have worked with Southampton Airport. The cycle challenge was such a fun event and we appreciate the generosity of both the participants and the passengers who donated to support members of the RAF family in need.”

MP for Eastleigh, Mike Thornton, visited Southampton Airport as part of English Tourism Week. Mike spent time shadowing the Airport Duty Manager and Airport Ambassadors; getting a feel for the day-to-day operations of the airport and delivering customer service.

Southampton Airport is famous for its levels of customer service. It has been the top performing airport in the UK over the last year according to the Airport Service Quality survey and Which? readers voted Southampton as one of the few 5 star airports in the UK.

English Tourism Week is a week-long celebration of events to kick start the main tourism season. Mike Thornton, MP for Eastleigh commented “I’m delighted to be here at Southampton Airport – a vital gateway for the region’s tourism industry – to help celebrate English Tourism Week 2014. It’s great to meet some of the industry’s employees and learn more about the lengths they go to in order to ensure excellent customer service. Tourism is big business here in Hampshire, supporting over 45,000 jobs and contributing £2.5 billion to the local economy, so it is quite right that we celebrate this ever- growing local industry. Whether it’s taking a stroll through Itchen Valley Country Park, sailing at Hamble Marina or exploring the ‘Strawberry Coast’ at Hamble Valley, Hampshire, and in particular Eastleigh Borough, has lots to offer.”

HOW TO ENTERFor your chance to win, simply enter our competition online at www.southamptonairport.com/breeze

facebook.com/SOU.Airport twitter.com/SOU_Airport

breeze through...to the best ski destinationswww.southamptonairport.com/ski

Just a short hop over the English Channel, Guernsey is close to home but once on the island you feel as if you are miles away.

Despite being a part of the British Crown, the Anglo- French charm with the French road signs, unique touches such as blue post boxes and the slow pace of life with a 35mph speed limit really sets it apart from the Britain we know.

Visitors can enjoy miles of dramatic coastline, white sand beaches, adventurous activities from kayaking to surfi ng, great food and island hopping on Guernsey’s sister islands.

Win 3 nights’ Bed & Breakfast for 2 people

at the luxurious 4 star Fermain Valley Hotel, located down a peaceful valley overlooking the stunning Fermain Bay and only a few minutes from St Peter Port.

You’ll travel to Guernsey with Blue Islands. Blue Islands provide fl exible travel to Guernsey with a unique, transparent pricing policy & no baggage charges! All passengers travelling from Southampton also enjoy a complimentary drinks service.

For more information on the hotel visit www.fermainvalley.com, airline www.blueislands.com and Guernsey www.visitguernsey.com.

Terms and conditions: Prize includes three nights’ bed and breakfast for two people at the Fermain Valley Hotel in Guernsey, and return fl ights for two people from Southampton to Guernsey with Blue Islands. Competition closes on 1st October 2014. Prize must be taken by end of October 2015. Flights & accommodation are subject to availability. Full competition terms and conditions apply – please visit www.southamptonairport.com/competitions for details before entering.

A THREE NIGHT BREAK TO GUERNSEY!

breeze - southampton airport's official passenger magazine

Documents

airport experience

southampton airportbreeze

new exciting improvements

exciting new improvements

exciting destinations

destination pages

destination easier

fl ights