Vol. 3, No. 6MOLECULAR AND CELLULAR BIOLOGY, June 1983, p. 1108-11220270-7306/83/061108-15$02.00/0Copyright © 1983, American Society for Microbiology

Bovine Papilloma Virus Contains an Activator of GeneExpression at the Distal End of the Early Transcription Unit

MONIKA LUSKY, LESLIE BERG, HANS WEIHER, AND MICHAEL BOTCHAN*

Department of Molecular Biology, University of California, Berkeley, California 94720

Received 24 February 1983/Accepted 25 March 1983

Bovine papilloma virus (BPV) contains a cis-acting DNA element which canenhance transcription of distal promotors. Utilizing both direct and indirecttransient transfection assays, we showed that a 59-base-pair DNA sequence fromthe BPV genome could activate the simian virus 40 promoter from distancesexceeding 2.5 kilobases and in an orientation-independent manner. In contrast tothe promoter 5'-proximal localization of other known viral activators, this elementwas located immediately 3' to the early polyadenylation signal in the BPVgenome. Deletion of these sequences from the BPV genome inactivated thetransforming ability of BPV recombinant plasmids. Orientation-independentreinsertion of this 59-base-pair sequence, or alternatively of activator DNAsequences from simian virus 40 or polyoma virus, restored the transformingactivity of the BPV recombinant plasmids. Furthermore, the stable transforma-tion frequency of the herpes simplex virus type 1 thymidine kinase gene wasenhanced when linked to restriction fragments of BPV DNA which included thedefined activator element. This enhancement was orientation independent withrespect to the thymidine kinase promoter. The enhancement also appeared to beunrelated to the establishment of the recombinant plasmids as episomes, since intransformed cells these sequences are found linked to high-molecular-weightDNA. We propose that the enhancement of stable transformation frequencies andthe activation of transcription units are in this case alternate manifestations of thesame biochemical events.

DNA-mediated transformation is a commonapproach to the study of gene expression andregulation in mammalian cells, yet factors whichaffect the frequency of stable transformation arepoorly understood. Comparison of the expres-sion of marker genes in transient and stabletransformation assays (4, 14) suggests that inmammalian cells DNA-mediated transformationis limited by either the stable incorporation ofthe DNA into the genome, or its stable expres-sion or both. In procaryotes and lower eucary-otes, establishment of the DNA is indeed limit-ing; in the absence of a site for homologousrecombination, transformation efficiencies fallclose to zero. The stringency of this requirementhas allowed, in the yeast system, the selection ofsequences which presumably serve as origins ofreplication (ARS elements) by their ability todramatically increase the transformation effi-ciency of a linked genetic marker (38). In theresulting transformants, the marker DNA linkedto an ARS element is maintained in an extra-chromosomal state. Therefore, in yeasts, auton-omous replication can bypass the need for inte-gration of the transforming DNA and thus, in a

single step, can enhance transformation frequen-cies by several orders of magnitude.Bovine papilloma virus type 1 (BPV) provides

a model system in mammalian cells for testingthe assumptions implicit in the arguments de-scribed above. BPV viral DNA, as well as a 69%subgenomic fragment (69T), can transformrodent cells in culture (26); the viral genome inthese cells is maintained as a multicopy nuclearepisome (2a, 24). We reasoned that linking aselectable genetic marker to the BPV genomemight substantially increase the transformationefficiency of that marker, by bypassing the needfor integration of the foreign DNA. In this waywe could test whether the establishment of thetransforming DNA is a limiting step in transfor-mation.We have reported previously (27) that linking

BPV DNA to the herpes simplex virus (HSV)thymidine kinase (TK) gene can enhance thetransformation frequency of TK- cells to TK+more than 100-fold. This effect is independent ofthe position and orientation of the BPV se-quences relative to the direction of HSV TKtranscription. However, the enhanced transfor-

1108

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR

BomHI

FIG. 1. Structure of BPV-HSV-TK recombinant plasmids. A physical map of the BPV genome (BPV1) isshown with the positions of restriction sites (5) that were used for subcloning. Arrows indicate directions andlengths of the early transcripts (20). The structures of the BPV-HSV-TK recombinant plasmids are shown below.The single-lined region is the 2.9-kilobase plasmid vector pML1 (28); the hatched region is the 3.4-kilobaseBamHI fragment containing the HSV TK gene; the 69T fragment of the BPV genome is represented by the solidregion. Arrows show directions of transcription. A, B, C, BPV fragments used for the constructions to map theactivator function (see text). ori, Origin; kb, kilobases.

mation is not the result of establishment of thetransforming DNAs as episomes in the TK+cells; instead, all BPV TK sequences are foundlinked to high-molecular-weight chromosomalDNA. In this report, we show that the BPVsequences responsible for the enhanced trans-formation of TK- cells to TK+ map to a 613-base-pair (bp) fragment which lies at the,-3' endof the BPV early transcription unit. We specu-late that enhanced transformation frequenciesare the result of an increased probability of HSVTK gene expression when integrated in chromo-somal DNA. Consistent with this notion, thefragment containing the BPV enhancer elementalso has activator function: this fragment canactivate transcription from the simian virus 40(SV40) early promoter in a position- and orienta-tion-independent manner. The activator elementhas been mapped to within a 59-bp fragmentwhich lies outside the putative polyadenylationsignal for the BPV early genes (5, 20). Deletionof this fragment from the viral genome destroysthe ability of BPV plasmids to transform cells inculture. Morphological transformation mediatedby these deletion mutant constructions can berestored by reipsertion of the 59-bp fragmentindependent of s orientation with respect to the

BPV early transcription units and also by inser-tion of activator fragments from either SV40 orpolyoma virus.

MATERIAS1 AND METHODSRecombinant plasmids. The vector plasmid for all

constructions was pML1, a derivative of pBR322lacking sequences that inhibit SV40 replication insimian cells (28). The plasmids pMLBPVTK2 andpMLBPVTK4 contain the 3.4-kilobase BamHI restric-tion fragment which encodes the HSV TK gene andthe BPV HindIII-BamHI fragment which encodes thetransforming and replication functions of the BPVvirus (26). pMLBPVTK2 differs from pMLBPVTK4 inthe orientation of the HSV TK gene with respect to theBPV early transcription units (20) (Fig. 1).To test for activator function in various BPV frag-

ments, we used an SV40-pML1 recombinant whichlacked the SV40 enhancer but maintained an intactSV40 early region. The various constructions areshown in Fig. 3 and described in the text. HSV-TK-BPV recombinants derived from these constructionsare described below.

Cells and DNA transfections. The TK- cell linesused were Rat 2 TK- cells (41) and human 143 TK-cells (15). DNA transfections were done by the proce-dure of Wigler et al. (43). For the DNA-calciumphosphate coprecipitates, 10 ,ug of mouse LTK- DNA

1109VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1110 LUSKY ET AL.

per ml was used as carrier. The amounts of plasmidDNAs (100 to 200 ng) used are indicated in Table 1.The precipitate was left on the cells for 12 to 16 hbefore the medium was replaced with fresh medium.TK+ colonies were selected in three types of medium:normal HAT (per ml: 15 ,ug of hypoxanthine, 1 ,ug ofaminopterin, 5 ,ug of thymidine); HAT/10 (0.5 ,ug ofthymidine per ml); HAT/100 (0.05 ,ug of thymidine perml). The medium was changed every 2 days for thenormal HAT selection; for those experiments withreduced levels of thymidine, the medium was changedevery day. Colonies were stained and counted 12 to 14days after transfection. Individual colonies werepicked and established as cell lines. Mouse C127 cells,kindly provided by P. Howley, and NIH 3T3 cells,obtained from G. Cooper, were used for morphologi-cal transformation assays with BPV recombinantDNAs. After DNA transfection, the cultures wereincubated for 2 to 3 weeks to allow foci to appear. Fortransient replication assays with SV40 plasmids, simi-an CV-1 cells and COS7 cells (13) were transfected,using the DEAE-dextran technique (30) as describedpreviously by Lusky and Botchan (28).

Isolation and analysis of cellular DNA. Total chromo-somal DNA from TK+ and parental TK- cell lines wasprepared by the procedure ofThomas et al. (40). Low-molecular-weight DNA from TK+ rodent cells andCV-1 cells was extracted by the method of Hirt (21).For DNA analysis, approximately 10 jig of total chro-mosomal DNA, either undigested or digested withseveral restriction endonucleases, was fractionated onagarose gels. Before gel electrophoresis, the extractedDNA was sheared to detect form I and form II DNA ofthe recombinant BPV plasmids, as it has been reportedthat BPV DNA often forms interlocked rings in trans-formed cells (24). For blot hybridization, standardprocedures were used.

Isolation ofRNA and Si analysis. To map the 5' endsof SV40 early mRNAs, we transfected CV-1 cells bythe DEAE-dextran technique with SV40 recombinantplasmids or SV40 viral DNA. About 42 to 45 h aftertransfection, total cytoplasmic RNA was isolated asdescribed previously by Favaloro et al. (8). For nucle-ase S1 analysis, the coding strand of a 240-bp Hinfl-SphI fragment (positions 5135 to 128) spanning theSV40 origin was labeled at the 5' end with [y-32P]ATPand polynucleotide kinase and used as DNA probe.After denaturation, the RNA and the probe DNA werehybridized under aqueous conditions (40 mM PIPES[piperazine-N,N'-bis(2-ethanesulfonic acid)] [pH 6.4],1 mM EDTA [pH 8.0], 0.4 M NaCl) at 65°C for 5 h.Hybrids were incubated with 200 U of S1 (SigmaChemical Co.) per ml for 2 h at 15°C. The S1-resistantDNA was fractionated on a 7 M urea-8% polyacryl-amide sequencing gel.

RESULTSTransformation of TK- cells with BPV-HSV-

TK plasmids. The HSV TK gene was linked inboth orientations to the 69T fragment of the BPVgenome (Fig. 1). The transformation efficienciesof the resulting plasmids, pMLBPVTK2 andpMLBPVTK4, were compared with that of aplasmid (pMLTK or pBRTK) containing onlythe HSV TK gene. Transfection into two differ-

ent TK- cell lines (Rat 2 TK- and human 143TK-) followed by selection in HAT mediumyielded the data presented in Table 1. Threedifferent selective conditions containing succes-sively lower concentrations of thymidine in theHAT medium were employed. In each indepen-dent experiment, and in all cell types examined,BPV DNA enhanced the transforming activity ofthe TK gene. The enhancement effect was inde-pendent of the relative orientations of the twosequences.Capecchi (4) has described an enhancer ofTK

transformation within the SV40 control region.Lee et al. (25) reported a similar effect uponstable transformation mediated by the SV40control region. To examine the cell type speci-ficity and the relative effectiveness of the BPVand the SV40 elements in enhancing TK trans-formation, a series of experiments was per-formed in Rat 2 TK- and human 143 TK-cells. A BPV-HSV-TK plasmid and a plasmidcontaining the HSV TK gene linked to the SV40enhancer (see legend to Table 1) were scored fortheir ability to transform TK- cells to TK+, incomparison with a plasmid containing the HSVTK gene alone. Cell specificity was exhibited byboth enhancer elements: enhancement of TKtransformation by BPV-HSV-TK plasmids wasmuch greater in Rat 2 TK- cells than in human143 TK-cells, whereas, in contrast, the SV40enhancer was much more effective in human 143TK- than in Rat 2 TK- cells (Table 1). Forexample, the plasmid containing an SV40 en-hancer fragment, pMLSV4OH3CTK, increasedthe number of positive colonies by factors ofgreater than 50 in human 143 cells. In these samecells, the BPV enhancer TK constructions wereonly marginally (three- to fivefold) effective (Ta-ble 1, column 143 TK-). In contrast, thepMLSV4OH3CTK construction was only margin-ally more effective as a donor of the TK genewhen compared with pMLTK in Rat 2 cells (seeTable 1, experiment 4). (A more extensive tabu-lation of these results in human cells will bepresented elsewhere; P. Robbins and H. Bot-chan, manuscript in preparation.) Consequently,the relative strengths of the two viral enhancerscannot, in this case, be meaningfully compared;the activity of each depends on the specific celltype in which it is assayed.

Analysis of BPV-HSV-TK plaid DNA intransformed TK+ cells. To characterize the stateof the foreign DNA in the TK+ transformants,we established cell lines from individual coloniesobtained under each selective condition. Low-molecular-weight DNA as well as total cellularDNA were isolated and analyzed by blot hybrid-ization. Contrary to our expectations, no auton-omously replicating supercoiled plasmid DNAcould be detected in any of the cell lines ana-

MOL. CELL. BIOL.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR 1111

TABLE 1. Transfection of TK- cellsaRat 2 TK- (colonies per ILg of DNA) Human

143 TK-Plasmid Medium used Expt 1 Expt 2 Expt 3 Expt 4 Expt 5 (colonies

per 5 Fgof DNA)

pMLTK (pBRTK) HAT 160 50 40 97 33 58HAT/10 b 25 40 80 30 39HAT/100 20 20 75 30 16

pMLBPVTK2 HAT 1,300 >2,000 420 880 270 131HAT/10 >2,500 460 1,010 300 215HAT/100 3,600 - 500 1,050 170 289

pMLBPVTK4 HAT 400 -HAT/10 - -HAT/100 1,300 -

pMLBPVB5'TK HAT 120HAT/10 - 140HAT/100 - 140 -

pMLBPVB3'TK HAT 490 140HAT/10 - 640 150HAT/100 450 250

pMLBPVc5'TK HAT 450 120HAT/10 480 140HAT/100 420 100 -

pMLSV40H3CTK HAT 150 >3,000HAT/10 - 80 >3,000HAT/100 0 -600

a The structures of the plasmids pMLBPVTK2 and pMLBPVTK4 are shown in Fig. 1. The plasmidspMLBPVB5'TK, pMLBPVB3'TK, and pMLBPVc3'TK are derivatives of pSV5'-BPVA and pSV5'-BPVC (Fig.3). pMLBPVB5'TK and pMLBPVB3'TK contain the 1.8-kilobase BPV BamHI-SphI fragment (designated B inFig. 1) inserted into the polylinker, and the SV40 sequences were replaced by the HSV TK BamHI fragment inboth orientations. pMLBPVc5'TK is a derivative of pSV5'-BPVC, the HSV TK BamHI fragment replacing theSV40 early region in the same orientation. The plasmid pMLSV40H3CTK has the SV40 HindIII-C fragmentinserted into the HindlIl site of pMLTK. Direction of transcription from the TK gene is clockwise, whereas theSV40 early promotor within the HindIII-C fragment is oriented counterclockwise with respect to the TKtranscription unit. TK+ colonies were selected in HAT medium with various thymidine concentrations: HAT (5,Lg of thymidine per ml), HAT/10 (0.5 F.g of thymidine per ml), HAT/100 (0.05 ~Lg of thymidine per ml). In allexperiments, 5 x 10' cells were initially plated as recipients for the given plasmids. Note that the enhancedtransformation is not dependent on the initial DNA concentrations used for the transfections, as the number ofcolonies scored follows (for any particular experiment) a simple dose-response relationship. For the Rat 2 cells,this value saturates at 2 to 5 jg of plasmid DNA. It is difficult to assess the magnitude of the effectiveenhancement. For example, in experiment 2 with standard HAT selection conditions, pMLBPVTK2 trans-formed Rat 2 cells with an absolute efficiency of 4 x 10-' colonies per cell per ,gg of DNA compared with anabsolute efficiency of -10' for pMLTK. In experiment 4, however, the enhancement ratio was only ninefoldunder similar selective conditions. We believe that certain variables in the protocol (e.g., cell growth conditions,calcium phosphate-DNA precipitate size) make absolute quantitation difficult; therefore, we present the resultsobtained from five separate experiments.

b , Plasmids not tested for transformation frequency.

lyzed (Fig. 2). All sequences hybridizing to theinput BPV-HSV-TK plasmid comigrated withhigh-molecular-weight chromosomal DNA. Re-construction experiments shown in Fig. 2B(lanes 1 through 4) indicate that we could havedetected a single copy of supercoiled DNA percell. Control experiments showed that we coulddetect autonomously replicating molecules in a

variety of BPV-transformed cell lines. In Fig.2C, the lanes marked ID13 and C127BPV 2 showform I and form II BPV DNA isolated from celllines tranformed with virus and cloned genomicDNA respectively. Furthermore, recombinantplasmids carrying either the entire viral genome(Fig. 2C, pMLBPV,ooA or pMLBPV,OOB) orthe 69T fragment of the BPV genome linked to

VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

5siormA !_ D h1 ,',-r- "l

.e'~-~ .h"4 , - > D4 4cr41bt__S~~~~~~~ -I..

C~~~~~~r

Ca'

.I

4

Bm1 2 3

N f,r.T._- >yrr'.neTre

4 2a _D 2c 2 4 4c 4t

0go_

D o--j-.2~;

.1dl

FIG. 2. Southern blot analysis of Hirt-extracted (low-molecular-weight) and total (high-molecular-weight)genomic DNA of Rat 2 TK+ cell lines transformed with BPV-HSV-TK plasmids and of mouse C127 cell linestransformed with BPV plasmids or BPV viral DNA. (A) Ethidium bromide-stained 0.8% agarose gel of DNAextracted from TK+ cell lines. (B) Autoradiogram of (A) after transfer of the DNA to nitrocellulose andhybridization with 32P-labeled nick-translated pMLBPVTK DNA. Scanning from left to right: lanes 1 through 4,BPV-HSV-TK plasmid reconstructions (10 ng, 1 ng, 100 pg, and 10 pg, respectively); lanes 2a, 2b, and 2c, DNAfrom TK+ cell lines transformed with pMLBPVTK2 DNA, selected in HAT/100 medium; lanes 2 and 4, DNAsextracted from 20 TK+ colonies, not individually cloned but expanded as populations, transformed withpMLBPVTK2 or pMLBPVTK4 DNA, selected and maintained in HAT/100 medium; lanes 4a and 4b, DNAsamples extracted from TK+ cell lines selected in HAT medium. (C) Southern blot analysis of Hirt-extractedDNA from mouse C127 cell lines established after transformation with recombinant BPV plasmids. Lanes 1 and 2are reconstuctions of the plasmid pMLBPVLTR; lane ID13 contains 10 iLg of DNA isolated from the ID13 cellline; arrows indicate the positions ofform I and II of the marker DNAs. The other lanes contain DNAs isolatedfrom cell lines (as indicated above the lanes) transformed with the plasmid DNAs pMLBPV69-LTR(-) (seeTable 2, footnote a) (lanes BPVLTR A and B) and pMLBPV1oo (lanes pMLBPV8 A and B) and with full-lengthBPV DNA digested away from the bacterial vector (lane C127BPV 2). In general, cell lines transformed with full-length genomic BPV DNA either linked or unlinked to plasmid sequences maintain the episomal sequenceswhich comigrate with the input markers. On occasion (e.g., lane C127BPV 2), altered forms are seen. The probeused for hybridization was 32P-labeled nick-translated pMLBPV DNA. (D) HindlIl and HindIII-BamHIrestriction analysis ofDNAs extracted from TK+ cell lines shown in (B). Lanes R, 50 pg ofpMLBPVTK2 DNA;lanes 4a, 4b, and 4c, 10 pg of total cellular DNA from cell lines transformed with pMLBPVTK4 DNA, selectedand maintained in HAT medium; lane ID13, 10 ,ug of total cellular DNA from mouse C127 cells, transformed withBPV virus.

1112

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BamHli\ BamnHIJ-

EcoRi EcoRI-'-/'mpr Early

,sY1-

SV40 ErlypBR originorigin pBR

,qiIjtXeLat \\ origin'--SV40

Sph I LSphI S hinBamnI BglIII

pJYM pJYMASph

2 ~~~~~~~~~~~~~~~~~~~~~~~~~~I

m , r_A-n r-km_ r-Am-.to OD co St O T OD

2 O C\j rst ON0 t ONtO\0N

EcoRlI

mpr Early

PBRVIorigin

S-V40Pvull \ origin

PYUllII =\LSphltBornH}1I) HaeIIl (Bc

SphI LSphIpSV5'-72

I-Y 1

wwDCZ) j- coO Prr¢ON r q

SphI-\ \Sphl_pHA\oe IIIPvulmI am#HI)

EcoRI x

(j'amPr Earrly)

pBRorigin SV4C

K originSphl

amHl)

pSV33-72

14 (D D II, CD CDO NwI19 ¢ O t " S

W(ID, (OW0

Epoi

_"

40 -0*

e

j----rI-

pSV5'- BPVA pSV3'-BPVA pSSph-, SV40

BomHI /arigin BmEcoRI y EcoRoi EcoRI-

EaprEarl MP' Early

PBR V pBR pBRorgin oii rigin'

BglII Bgltl BamHlLBOmH

IB

BPV BclI BPV Bcll

;V5'-BPVC pSV3'-BPVCSph -, S4Sph SV4Q

BomH I /-originEcoaRI j

¢pr Earlly

pBR~origin

BclI t -BarnHIBPV

FIG. 3. Replication of recombinant plasmids in simian CV-1 cells. Transfection of subconfluent monolayersof CV-1 cells, extraction of low-molecular-weight DNA at the indicated timepoints, and analysis of the DNA bygel electrophoresis and Southern blotting were done as described previously (28). 32P-labeled nick-translatedpJYM DNA was used in all cases as the hybridization probe. The structures of the plasmids are described in thetext. In all constructions, solid lines represent SV40 sequences, open lines BPV sequences, and thin lines pMLsequences. The small hatched region in pJYMASph and derivatives thereof indicates the position of thepolylinker fragment, within which only the BglII site is shown. The autoradiograms of the Southern blots showthe detection of the DNAs extracted at various times (as indicated above the lanes) after transfection. In eachexperiment, 10 to 20 ng ofDNA was used to transfect CV-1 cells. Each set of timepoints is connected by bracketsand lines to the diagram of the plasmids used in the particular experiment. Lane M contains 1 ng of pJYM DNAas transfer marker; the fastest migrating bands are form I DNA, and the two slower migrating bands indicate formIII and form II DNA. The inset figure in the middle shows the replication assay of the two control plasmids pJYMand pJYMASph in COS7 cells.

1113

-

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1114 LUSKY ET AL.

the Harvey murine sarcoma virus long termi-nal repeat (LTR) (Fig. 2C, BPVLTR A orBPVLTR B) were also maintained as autono-mously replicating supercoiled molecules intransformed mouse C127 cells. In cell lines inwhich the BPV plasmids are maintained as au-tonomous replicons, the selection for colonieswas based on morphological transformation. Incontrast, in all our assays using the Rat 2 TK-cell line, which is highly contact inhibited, noneof the BPV-HSV-TK+ transformants displayeda morphologically transformed phenotype.

Restriction analysis and Southern blotting ofthe total cellular DNA from TK+ cell linesdirectly showed that BPV sequences were pre-sent in these cell lines. After digestion withHindlll, which cleaves once in BPV-HSV-TKplasmids (see Fig. 2D), a complex set of frag-ments was generated, which was characteristicof each cell line. A complex pattern offragmentswas also detected after HindIII-BamHI doubledigestion. In contrast, total cellular DNA isolat-ed from the ID13 cell line digested with HindIlIplus BamHI generated the unique internal BPV69T fragment. We also found no correlationbetween the copy number of the integratedDNAs and the selective conditions employed.One of the cell lines, Rat 2 4a, which had beenselected in normal HAT medium, appeared infact to have the highest number of integratedplasmid BPV-HSV-TK sequences. Further-more, although we can routinely shuttle BPVplasmids between mammalian cells and Esche-richia coli, we were unable to do so with theBPV-HSV-TK constructions which had beenintroduced into the Rat 2 cells. The absence ofepisomal DNA in these cell lines suggests thatthe mechanism by which BPV sequences en-hance TK transformation is unrelated to autono-mous replication of the recombinant DNAs.From these data alone, we cannot exclude thepossibility that the hybrid plasmids persisted fora few cell divisions in an episomal state, leadingto an increase in stable integration and thusenhancing TK transformation frequencies.However, in view of the data presented below,we favor an alternative hypothesis.

Detection of an activator element in BPVgenome by a transient assay system. As the BPV-HSV-TK plasmids appear to be stably integratedinto the genomes of the TK+ cells, the enhancedtransformation efficiencies of these plasmidscould be due to the presence of specific se-quences in the BPV genome which allow forincreased HSV TK gene expression. A prece-dent for this reasoning is provided by analogy tothe SV40 system. Fragments of the SV40genome which span the viral control regionenhance the transformation efficiency of theHSV TK gene after microinjection into LTK-

cells (4). Furthermore, within this region, theDNA sequences spanning the 72-bp repeatshave been shown to activate in cis transcriptionof heterologous promoters in a position- andorientation-independent manner (1, 32). Ourstudies comparing the transformation efficiencyof the HSV TK gene when linked to variousfragments of the SV40 genome indicate that theenhancement of stable TK transformation re-quires an intact SV40 activator. Deletion mu-tants which destroy the activator (1) also elimi-nate enhancement of TK transformation (S.Conrad, P. Robbins, and M. Botchan, unpub-lished data). These results suggested that en-hanced transformation frequencies and activa-tion of distal promoters are linked phenomena.To test this hypothesis, we designed a tran-

sient expression assay for activator elementsbased on an SV40 replication system. Since theinitiation of viral replication requires expressionof the SV40 A gene (39), an assay which mea-sures replication can be used as an indirect andconvenient test for A gene expression. Thisassay allows us to ask if sequences in the BPVgenome are capable of substituting for SV40sequences in activating SV40 early gene expres-sion. Several studies have shown that deletionsspanning the region from position 128 to position294 on the conventional SV40 map inactivate Agene expression in vivo (2, 9, 16).The plasmid pJYM contains an entire SV40

genome inserted into the vector pML1 at theBamHI site (28). Complete digestion of thisplasmid with SphI, which cleaves twice withinthe SV40 72-bp repeats and once in the vectorsequences (position 561), produced the plasmidpJYMASph (Fig. 3). This deleted plasmid con-tains an entire SV40 early region, the origin ofreplication, and 23 bp from the origin-proximal72-bp repeat. In contrast to the parental plasmid,pJYM, pJYMASph did not replicate to any de-tectable level in monkey CV-1 cells (Fig. 3). Thisdeficiency could be overcome by providing theSV40 A gene product in trans, by transfectioninto COS7 cells (see inset in Fig. 3). This resultshows that all cis-acting functions required forSV40 replication are intact. Removal of the 72-bp repeat region thus prevents sufficient A geneexpression to initiate replication in CV-1 cells;T-antigen immunofluorescence (data notshown), as well as analysis of SV40 early mRNA(data presented below), confirms these conclu-sions. To facilitate cloning procedures, a 90-bppolylinker fragment from 7rVX (B. Seed, person-al communication) was inserted into the Sall siteof pJYMASph (Fig. 3). An SV40 HaeIII-PvuIIfragment (postions 6 to 270), spanning the 72-bprepeats, was ligated to BamHI linkers and in-serted into pJYMASph either (i) in the polylinkerfragment at the BglII site 5' to the SV40 A gene

MOL. CELL. BIOL.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR 1115

or (ii) at the BamHI site 3' to the A gene-ineach case in both orientations. The four result-ing plasmids and the parental plasmid pJYMreplicate to equivalent levels; for two of these,pSV5'72 and pSV3'72, the data are shown inFig. 3. Observations consistent with these re-sults have recently been reported by others (9,32).The fact that A gene expression, as measured

by indirect immunofluorescence and replicationof these recombinant plasmids, is indistinguish-able from that of pJYM and wild-type SV40encouraged us to use this assay to screen for apotential BPV activator element. The entireBPV genome cleaved at the BamHI site was firstinserted 5' and 3' to the SV40 A gene, andreplication in monkey CV-1 cells was assayed;in both cases the replication of these plasmidswas comparable to pJYM (data not shown).When BPV plasmid DNA was mixed withpJYMASph DNA and cotransfected into cells bythe DEAE-dextran procedure, neither plasmidreplicated to any detectable level. These resultsshow that (i) BPV sequences function only in cisto allow for SV40 specific replication and that(ii) the BPV sequences cannot provide an originof replication capable of functioning at lyticlevels in CV-1 cells.

Digestion of the BPV genome with the restric-tion endonucleases BglII and BamHI generatesfour large fragments (5) (Fig. 1). Each of thesefragments was inserted into the plasmidpJYMASph to assay for activator elements.Only one of the fragments (labeled A in Fig. 1)gave a positive result when tested both 5' and 3'to the SV40 A gene promoter and in eachorientation (i.e., four separate plasmids). Theresults of the replication data for two of the fourpositive plasmids, pSV5'-BPVA and pSV3'-BPVA, are shown in Fig. 3. The BglII fragmentspanning the putative BPV promoter (5; Y.Nakabayashi, S. K. Chattopadhyay, D. Lowy,N. Sarver, Y. C. Yang, J. C. Byrne, and P.Howley, personal communication) restored rep-lication of pJYMASph, but only when it wasinserted 5' and in a tandem orientation to theSV40 early promoter (data not shown).The activator element detected in fragment A

was mapped to within a 613-bp BclI-BamHIfragment (positions 3837 to 4450), designatedfragment C in Fig. 1. Again, the fragment wastested in the four orientations relative to theSV40 A gene and was found to be equallyeffective in all cases. The results of a transientreplication assay for two of the SV40 plasmidscontaining BPV fragment C (pSV5'-BPVC andpSV3'-BPVC) are shown in Fig. 3. Furtherdetails on mapping the BPV activator region aredescribed below. We observed that the kineticsof plasmid replication and the kinetics of appear-

ance of SV40 T-antigen-positive cells withpSV5'-BPVC and pSV3'-BPVC were equivalentto those of pJYM (data not shown). Theseobservations are consistent with the notion thatBPV fragment C contains a transcriptional acti-vator.Further deletion mapping with the replication

assay has led to the localization of the BPVactivator element to a 59-bp Sau3A-BamHI frag-ment (positions 4391 to 4450) of the BPVgenome. This fragment, which lies 3' to allknown BPV early transcripts (20), was capableof restoring SV40-specific replication to wild-type levels in a position- and orientation-inde-pendent manner. The DNA sequence of thiselement is shown in the legend to Fig. 4.To correlate these results with the BPV-medi-

ated enhancement of TK transformation, stabletransformation assays were performed withplasmids containing the HSV TK gene linked tothe BPV-B or BPV-C fragments (Fig. 1). Datafrom these experiments (Table 1) show that theactivator-containing fragment of the BPVgenome is responsible for the enhanced transfor-mation of TK- cells to TK+.The activator is required for BPV transforma-

tion. Both the stable TK transformation experi-ments and the transient SV40-specific replica-tion assays examine the activity of the BPVelement on heterologous genes. To determinethe importance of this region in BPV-mediatedtransformation of mouse cells, we introducedsmall deletions into the papilloma viral genomeand assayed their effects. A recombinant plas-mid containing the entire BPV genome(pMLBPV,ooA; Fig. 4) which is capable of in-ducing morphological transformation of mousecells (36) (Table 2) was digested with Sall andthen treated with nuclease Bal31. Plasmids con-taining small deletions spanning the activatorregion were recovered. Extensive restrictionanalysis showed that the deletions do not extendinto the putative polyadenylation signal for theBPV early RNAs, but remove only sequenceswith no other known regulatory function (5, 20).The approximate endpoints of these deletionsare shown in Fig. 4. After transfection, thedeletion plasmids (Bal2, Bal3) were incapable ofyielding foci in either NIH 3T3 or C127 cells,whereas the parental plasmid transformed bothcell lines efficiently (Table 2). These experi-ments show that concomitant with the deletionsof the 59-bp sequence, an important cis regula-tory element is removed from the BPV genome.We then asked whether: (i) reinsertion of the 59-bp activator fragment could restore BPV-specif-ic transformation and (ii) whether focus forma-tion could also be obtained by replacing the BPVfragment with other viral activators. The 59-bpSau3A-BamHI BPV fragnent was reinserted at

VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1116 LUSKY ET AL.

100 bpi I

RNA

tAATb AAAA _

E \ 10 0 0 E0 wmco 1; z mcI, I\l I I

Con-pMLBPV,OOA

Bal

Bal 2

Bal 3 ------------------------------

pML-1 DNARetained BPV DNA

-Deleted DNA

FIG. 4. Structure of BPV DNA deletion mutants. The structure of pMLBPV,ooA is described in the legend toTable 2. Important landmarks of the BPV DNA are indicated above the line; these include the putativepolyadenylation recognition site (AATAAA) and the restriction sites used for mapping the deletions. Thehatched region is the 59-bp BPV MboI-BamHI fragment which contains the activator function:

4391 4450

5 A5)' GATCACCAAGGTACACACCACTCCGAACAGCAGGGTCCACATCATCGCTTGCATCANIALAGGATC 3'

the unique BamHI site in the plasmid Bal2 (Fig.4) in both orientations relative to the BPV earlytranscription unit, yielding the plasmids Bal2-BPV7 and Bal2-BPV10 (Fig. 5). Similarly, theSV40 HaeIII-PvuII fragment (positions 6 to270), ligated to BamHI linkers (as describedabove), was inserted at the BamHI site of Bal2in promoter-plus (Bal2-SV3) and promoter-mi-nus (Bal2-SV4) orientation(s) (Fig. 5). In anotherseries of constructions, subfragments of the wildtype and mutant polyoma virus A region, whichplays a critical regulatory role in polyoma earlygene expression, were inserted into Bal2. ThePvuII-4 fragments (positions 5128 to 5262 of-polyoma A-2 strain) from wild-type polyoma andpolyoma embryonal carcinoma mutants PylOland Py441 (11), ligated to BamHI linkers, wereeach inserted in both possible orientations, re-sulting in the recombinants Bal2-PyWT1,4, Bal2-PylOl1,2, and Bal2-Py4411,2 (Fig. 5). All of theresulting plasmid DNAs were capable of induc-ing foci in mouse C127 cells with efficienciesequivalent to those of pMLBPV100. DNA analy-sis showed that these plasmids were maintainedas autonomously replicating molecules in thetransformed cells (Fig. 5). Since the wild-typepolyoma PvuII-4 fragment is also capable ofactivating the SV40 early region in CV-1 cells(H. Weiher and M. Botchan, unpublished data),this demonstrates that these three papovavirusactivators are interchangeable in two indepen-dent assays. These results also support ourinterpretation that the 59-bp BPV fragment,identified as an activator of the SV40 earlypromoter, also plays a critical role as an activa-tor for the papilloma virus itself. As the SV40and polyoma virus fragments used do not con-tain replication origins, it is unlikely that theyreplace a BPV replication origin.

Analysis of SV40 early mRNA in CV-1 cellstransfected with hybrid BPV-SV40 plasmids. Toascertain that the activation of SV40 early geneexpression by BPV is not due to a promoterelement within the BPV fragments discussedabove, we mapped the 5' ends of SV40-specific

TABLE 2. Transformation of mouse C127 and NIH3T3 cells

C127 NIH 3T3DNA° (foci per (foci per 3g

DNA)b of DNA)pML 0, 0 0, 0pMLBPV (BamHI cut) 83, 79 95,110pMLBPV1ooA 81, 73 112, 91pMLBPV,ooB 83, 10 25pMLBPVOGAIBal1 75 89pMLBPVOGA/Bal2 0 0pMLBPVOOAIBal3 0 0pMLBPV69r 0 0pMLBPV69T-LTR(-) 12 100pMLBPV69rLTR(+) 10, 20 120

a The plasmids pMLBPV,ooA and pMLBPV,oDBcontain the full-length BPV genome inserted into theBamHI site of pML1, in counterclockwise orientation(A) and clockwise orientation (B) relative to the tran-scription of the ampr gene of the vector. The struc-tures of the BaI31 deletion mutants are shown in Fig.5. pMLBPV69r contains the HindIII-BamHI fragmentof BPV inserted between the HindlIl and BamHI siteof the vector. The pMLBPV69T-LTR plasmids containa 700-bp Hindlll fragment spanning the Harvey mu-rine sarcoma virus LTR element derived from theplasmid pSVLTR1 (17) in promoter-minus (-) andpromoter-plus (+) orientation relative to the 69T BPVfragment.

b The two numbers given on a line represent thenumber of foci from independent experiments.

4 1.v

MOL. CELL. BIOL.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR 1117

cP

00-0

mL)C

ICM

m m

a0CP aCL o0 0

C +J

CM-6 ;

C4

2 2 u) cn cra

CL0

0

ca + +

N ?' PL o? °

.. X CL h~ Q:E m m ena:

t + +

0.1

m 3... >|.

40'6 04 a' da-t b- ---c- a

a 4eb5

Bom HI

SalBam HI-

BPV7

BPV O1

(c)

early mRNA after transfection of CV-1 cellswith various BPV-SV40 hybrid plasmids. Totalcellular RNA isolated 42 to 45 h after transfec-tion with plasmids pJYMASph, pSV3'72, pSV5'-BPVC, and pSV3'-BPVC, and 36 h after trans-fection with wild-type SV40 viral DNA, washybridized to a 240-nucleotide Hinfl-SphI (posi-tions 5135 to 128) single-stranded DNA fragmentspanning the known 5' end of SV40 early RNA(Fig. 6). 5'-Labeled DNA probes formed hybridswith cellular RNA from SV40-transfected cells;after treatment with nuclease Si, the protectedfragments had lengths which indicate start sitesclustered around position 5236 as well as 25 to 30nucleotides upstream at positions 14 to 16 on theSV40 genome (Fig. 6, lane 6). An identicalpattern was observed with RNA extracted fromCV-1 cells after transfection of plasmids con-taining the SV40 72-bp repeats 3' to the A geneor the BPV activator (C fragment) both 5' and 3'to the SV40 A gene (Fig. 6, lanes 3 to 5). Thesizes of the Si-resistant fragments in these lanescorresponded to the previously determinedmRNA cap sites for SV40 early RNA as mea-sured by this procedure (9, 12, 19, 35). Nonuclease-resistant fragments were detected afterhybridization of the single-stranded probe tocarrier RNA alone or to RNA extracted frompJYMASph-transfected cells (Fig. 6, lanes 1 and2). Northern analysis (data not shown) con-firmed that the lengths of SV40 early mRNAsfrom BPV-SV40 hybrid plasmids were indistin-guishable from those of wild-type SV40. Weconclude that the BPV activator does not alterthe initiation sites for transcription ofSV40 earlymRNA.

DISCUSSIONLocalization of an activator element within the

BPV genome. In most cases, enhancer-activatorelements have been discovered serendipitously

FIG. 5. Southern blot analysis of total genomicDNA of Cl27 cells transformed with BPV plasmids.Four recombinant plasmids were used in morphologi-cal transformation assays. The parental plasmidpMLBPV,ooA has a specific transformation efficiencyof 100 to 300 colonies per jg ofDNA when applied to106 cells. Enhancer-activator fragments from the threepapovaviruses were inserted into the Bal2 deletionderivative of pMLBPV1oo (Fig. 4). The deletion deriv-atives with enhancer insertions at the BamHI site, asshown above and as described in the text, restored thetransforming potential to wild-type levels. Thehatched bars depict the various enhancer elements,the solid bars depict BPV sequences, and the thin linesrepresent pML plasmid sequences. The lanes labeledM contain the indicated amounts of the various plas-mid DNAs as transfer markers and show the positionsof the supercoiled and nicked-circle forms of theplasmids. Next to each marker are the bands of BPV

plasmid sequences, detected by Southern analysis, intotal cell DNAs isolated from transformed C127 cells;in each case, 10 p.g of total sheared genomic DNA wasapplied to a 0.8% agarose gel, separated by electro-phoresis, transferred to nitrocellulose, and hybridizedto nick-translated pMLBPV DNA. (a) Two cell lines(BPV8-C, -D) transformed with pMLBPV1oo. (b) Threecell lines (SV3-C, -D; SV4-E) transformed with theplasmids BaI2-SV3 and Bal2-SV4 containing the SV40activator in promoter-plus (+) (SV3) and promoter-minus (-) (SV4) orientation. (c) Four cell lines (BPV7-A, -B and BPV10-A, -B) transformed with the plas-mids Bal2-BPV7 and Bal2-BPV10. (d) Two cell lines(PyWT-A, PylOl-A) transformed with the plasmidsBal2-PyWT and Bal2-PY101. The autoradiogramshows that the BPV plasmid sequences are maintainedas multicopy episomes in these cells at levels equiva-lent to virus-transformed cells (ID13) or full-lengthpMLBPV1oo.

VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1118 LUSKY ET AL.

.0 --C

_g 242

-- 201190

i -180

(238

I .-160- 147

t22

*- 110

-90

-76

--67

100 bp

SphI

Hinf -Sph I probe

FIG. 6. Analysis of 5' ends of SV40 early mRNA inCV-1 cells by nuclease SI mapping. Samples (40 ,ug) oftotal cytoplasmic RNA extracted from CV-1 cellstransfected with either recombinant plasmids or SV40viral DNA were hybridized to the single-strandedSV40 Hinfl-SphI fragment labeled at the 5' end (indi-cated by a dot in the diagram below the autoradio-gram). S1 nuclease digestion was followed by electro-phoresis of the protected DNA fragments on an 8%sequencing gel as described in the text. Autoradiogra-phy with two intensifier screens at -70°C was for 4days. Lanes Ml and M2 provide size markers; Ml is apartial piperidine reaction performed on the probeDNA. M2 shows 5'-labeled DNA fragments ofpBR322DNA digested with HpaII. Numbers on right showmarker positions. Lane P, Input probe; lane 1, hybrid-ization of the probe to carrier tRNA followed bytreatment with S1; lanes 2 through 6, DNA fragmentsprotected by RNAs from CV-1 cells transfected withthe following DNAs: pJYMASph (lane 2), pSV3'-BPVC (lane 3), pSV5'-BPVC (lane 4), pSV3'72 (lane5), and SV40 (lane 6). The 5' termini of cytoplasmicSV40 early mRNAs isolated from the transfected CV-1cells map in all cases to a cluster of bands around

in the course of experiments whose goals wereunrelated to elucidating the structure of eucary-otic promoters. The presence of such an elementwithin the BPV genome was revealed first by itseffect on stable transformation of TK- cells bythe HSV TK gene. In transient in vivo assays, itwas further studied by its ability to activatetranscription from the SV40 early promoter,otherwise apparently inactivated by deletion ofits own enhancer element. This activation isindependent of its position and orientation withrespect to the SV40 early transcription unit. The5' ends of the SV40 early transcripts from suchBPV-SV40 recombinant plasmids appear to beidentical to those obtained from wild-type SV40-transfected cells. The minimal BPV activatorsequence lies within a 59-bp fragment and isnaturally locatedjust outside the early polyaden-ylation signal in the papilloma viral genome. Toassess the role of this element in the BPVgenome, we created deletion mutants whichremoved this sequence from the viral DNA.These mutants were then inactive in inducingmorphological transformation. Focus formationcould be restored by orientation-independentreinsertion of the 59-bp BPV fragment, or by itsreplacement with the SV40 or polyoma virusactivator elements.One of the functions of the BPV genome

which might require this element is the activa-tion of the early promoter and, therefore,expression of the transforming or replicationgenes, or both. As the BPV element has aprofound effect on transcription from the SV40early promoter when it is situated 3' to the Agene, it seems likely that it also influences BPVgene expression. Recent observations (C. Heil-man, L. Engel, and P. Howley, personal com-munication) suggest that the BPV genome con-tains a single region with promoter activitywhich directs transcription of both the early andthe late genes; the location of the BPV activatorwith respect to this putative promoter(s) is

nucleotides 5234 to 5236 on the SV40 genome (arrowat marker positions 100 to 102) and to a second set ofbands 25 to 30 nucleotides upstream (arrow at markerpositions 125 to 130). These positions are consistentwith previous mapping data of the SV40 early tran-scripts (13, 19, 35). We note that in the presence of anactivator, a substantial amount of intact probe remainsat the origin (lanes 3 through 6). Since Northernanalysis does not show any discrete RNA specieshigher in molecular weight than the bona fide SV40early transcripts, we consider this not to indicatetranscripts from a defined promoter. Partial S1 cleav-age or nonspecific initiations could account for thedifferences seen in the amounts of the protected DNAfragments; therefore, these gels cannot be used toquantitate the absolute level of expression in thedifferent constructions.

P Ml 1 2 3 4 5 6 M2

g

6

Hinf I BgII

3.

MOL. CELL. BIOL.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR 1119

unique and in marked contrast to the location ofthe SV40 activator with respect to the SV40early promoter. Alternatively, the BPV activa-tor might be required for BPV replication per se,as has recently been shown for the polyomavirus activator (10, 42). Experiments in thislaboratory are in progress to analyze the trans-forming and replication functions of BPV; theuncoupling of these processes might provide aclue to the involvement of enhancer-activatorelements in either or both of these functions.The apparent functional equivalence of the

BPV and the SV40 activator elements in severalassays led us to compare the two sequences.Although no large regions of homology weredetected, two short stretches of sequence sepa-rated by a spacer region were found to bestrikingly similar between the two viral activa-tors:

quencies. The mechanism of transcriptional acti-vation and its relationship to the enhancement ofstable marker transformation are not under-stood. We can consider two types of mecha-nisms which may account for the enhancementof TK-transformation frequencies mediated bythe BPV sequences. (i) The activator fragmentsmay increase the penetrance of the TK markergene. Enhanced probability of expression mayresult through the binding of positive factorswhich increase its intrinsic promoter strength orby preventing the TK promoter from being ac-tively shut off when integrated in some chromo-somal positions. (ii) The BPV sequences mayincrease the probability of establishing the mark-er extrachromosomally or may facilitate integra-tion into the genome of the recipient cells.We find no indication from our data in support

of the latter hypothesis. None of our TK+ cell

BPV: -TACACACC-16-TCCACATC-(positions 4402 to 4433)SV40: -TCCACACC-15-TCCACAGC-(positions 243 to 273)

In addition, the polyoma virus A region, whichplays a critical regulatory role in polyoma earlygene expression, contains a similar sequencearrangement:

-TCCACCCA-13-TCCACCCA-(positions 5217 to 5245, polyoma A-2 strain)

It is this region of the genome which is found tobe rearranged in polyoma virus mutants selectedfor growth in mouse teratocarcinoma cells (10,22, 37).Some ambiguity remains in the genetic dis-

tinction between activator and promoter ele-ments, as both types of signals appear to berequired for effective transcription. GenerallyRNA polymerase II promoter function involvesa relatively inflexible arrangement of DNA se-quences upstream from the 5' end of the tran-scribed region (3, 31). In contrast, activatorelements appear to function independently oftheir relative location to RNA start sites.

Questions regarding the intrinsic polarity (ifany) of activator elements with respect to RNAstart sites are difficult to address on circulartemplates-any point on a circle is both 5' in onedirection and 3' in the other direction to anyother reference position. Therefore, in the con-text of our transient assays which utilize circularmolecules, we cannot conclude that activatorshave or do not have a directionality. The en-hancement of stable TK transformation, indicat-ed by different BPV-TK constructions, providesevidence that the enhancing sequences do notdisplay strong orientation dependence. In theseexperiments, the plasmid molecules are linear-ized by the integration events.

Activators and enhanced transformation fre-

lines contains the recombinant plasmids in anepisomal state., In addition, the integration fre-quency, as measured by copy number, was nothigher in those cell lines transformed by recom-binant BPV-TK plasmids than in those cell linestransformed by simple TK plasmids; indeed, inmany of the cell lines transformed with pMLTK,multiple integrated copies could be detected.These results render untenable the hypothesisthat an activator increases the chance of a singleintegration event.Our results do indicate that the BPV se-

quences can exert a strong effect upon a remotepromoter. We suggest that linking a gene to anelement capable of activating gene expressioncan render the marker independent of its posi-tion in the chrotnosome upon integration. Forinstance, BPV-TK plasmids which are integrat-ed into normally silent chromosomal regionsmight express the TK gene sufficiently to allowfor cell survival in HAT medium, whereas TKgenes unlinked to an activator sequence would,in a similar position, remain silent. In this con-text, cotransformation frequencies of two inde-pendent markers with intrinsically different lev-els of expression are often quite low (18, 34);multiple cryptic insertions have been docu-mented in these cases. Kriegler and Botchan(17) have reported that insertion of an LTRenhancer into SV40 constructions increases theTK-SV40 cotransformation frequencies in ro-dent cells from 5% to close to 100lo, apparentlyabolishing cryptic insertions. Our finding thatthe same BPV DNA fragment contains se-quences capable of both enhancing stable trans-formation frequencies and activating transcrip-tion in a transient expression assay suggests that

VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1120 LUSKY ET AL.

the two phenomena are linked. Implicit in themodel presented above is the notion that geneexpression will be more dependent on activatorelements in some chromosomal positions than inothers; in fact, for the unintegrated TK gene intransient expression assays, activators mayshow little or no effect upon promoter strength.One interesting feature of enhancers is their

apparent cell specificity (6, 10, 17, 22, 23, 37; J.de Villiers and W. Schaffner, Abstr. Annu.Meet. Union Swiss Soc. Exp. Biol. 13th Exper-entia 37:6, 1981). This is a complex phenome-non, as the relative strengths exhibited by theseelements are dependent upon the assay as wellas on the specific cell line used. The BPVenhancer was more efficient in increasing TKtransformation frequencies in Rat 2 TK- cellsthan was the SV40 enhancer, whereas the re-verse was the case in human 143 TK- cells.However, in CV-1 cells, the BPV 59-bp activatorfragment, the polyoma virus 134-bp PvuII-4fragment, and the SV40 activator were all func-tionally equivalent in our replication assays (seeabove), in contrast to the inactivity of the Har-vey murine sarcoma virus LTR (17); further-more, we show here that for BPV-specific trans-fosmation of mouse C127 cells, the threepapovavirus activator elements were also inter-changeable. It is clear that different thresholdlevels of gene expression are required in thevarious assays (SV40 replication, TK transfor-mation, BPV transformation); an additionallevel of complexity exists since established viralepisomes in BPV-transformed cells are free fromconstraints imposed by flanking chromosomalsequences which may play a role in the TKtransformation assays. Although viral activatorsdo show certain cell specificities, this does notappear to correlate with known specificities ofviral host range. In light of these considerations,we must leave open the possibility that the BPVgenome contains other transcriptional activatorsthat may remain cryptic in our assays.

Integrated versus episomal BPV DNA. Con-trary to our initial expectations, BPV-HSV-TKplasmids were not maintained as episomes inRat 2 TK+ cells. These results indicate that theBPV 69T fragnent does not contain a cis-actingsequence, which precludes integration of the virlDNA. Several possible explanations can ac-count for the integration of these plasmids. (i)Selection for TK gene expression itself, orgrowth in HAT medium, might interfere with orprevent episomal BPV replication. (ii) Certainplasmid constructions and their propagation inbacteria might inhibit establishment as episomesin eucaryotic cells. (ii) The 69T fragment of theBPV genome may be partiall¶ defective in trans-formation or replication functions, or in both.

These possibilities are not mutually exclusive,

and a combination offactors may account for thelack of episomal DNA by interference directlywith BPV genome expression or by aggravationof a preexisting defect in either replication orexpression. For instance, the 69T fragment isinherently less efficient than the entire viralgenome in mediating morphological transforma-tion (26), and, when linked to plasmid sequencesand propagated in certain bacterial strains,transformation frequencies of this subgenomicfragment are lowered at least 100-fold (Table 2)(7, 36). In different cases, both positive andnegative effects on BPV transformation can beobserved after linking either the full-length viralgenome or the 69T fragment to various DNAsequences. Certain DNA sequences added tothe recombinant plasmids mentioned above re-store their transforming activity (Table 2 andFig. 2) (6). Our results show that transformationcan be restored when the Harvey murine sarco-ma virus LTR fragment is inserted either in apromoter-plus or promoter-minus orientation 5'to the BPV 69T fragment. Since the LTR isknown to have enhancer function (17, 23, 33),we suggest that BPV gene expression is onelimiting factor which determines the fate of theDNA after transfection.The state ofDNA modification may also influ-

ence the transforming ability and autonomousreplication of the BPV 69T fragment. BPV-HSV-TK recombinant plasmids propagated inthe bacterial strain HB101 are not capable ofautonomous replication and morphologicaltransformation of mouse C127 or NIH 3T3 cells;however, propagation of these plasmids in an E.coli dam strain (GM113; see reference 29)restores their transforming ability in both celllines. Analysis of the recombinant DNAs inthese transformed cells reveals that the plasmidsare maintained as unrearranged episomes (ourunpublished observations).

It appears that the episomal versus integrativepathways available to BPV recombinant plas-mids involve multiple components; an under-standing of these events may allow us to designexperiments that address our initial question:Are transformation frequencies enhanced whenthe transforming marker DNA is present on anepisomal replicon? At present, it seems likelythat a selection for chromosomal origins ofDNAreplication, as outlined above, will be difficultgiven the rather promiscuous tendency of mam-malian cells to integrate foreign DNA. Screeninga library of random DNA fragments linked to agenetic marker for sequences which enhancetransformation frequencies may often result inthe isolation of sequences which activate geneexpression. These enhancer sequences now ap-pear to be prevalent among viral genomes andmay also exist in cellular DNA (6).

MOL. CELL. BIOL.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

BOVINE PAPILLOMA VIRUS GENE ACTIVATOR 1121

ACKNOWLEDGMENTS

We thank M. Yaniv (Institut Pasteur) and P. Howley(National Institutes of Health) for providing us with clonedBPV DNA. P. Howley also provided us with the C127 andID13 cell lines. Plasmids containing the polyoma virus PvuII4fragments were generously provided by Elwood Linney (LaJolla Cancer Research Foundation). We are indebted to E.Chen and P. Seeburg (Genentech) for making available theirBPV sequence data before publication. We thank D. Rio andR. Tjian (University of California, Berkeley) for technicaladvice in RNA analysis. We also acknowledge the technicalassistance of S. Y. Kim.

This work was supported by Public Health Service grant CA30490 from the National Cancer Institute and by grant MV-91from the American Cancer Society. M.L. was supported by afellowship from Deutsche Forschungsgemeinschaft and is nowa recipient of a Leukemia Society postdoctoral fellowship.L.B. is recipient of a National Science Foundation predoctoralfellowship. H.W. is supported by a fellowship from DeutscheForschungsgemeinschaft.

LITERATURE CITED

1. Banerji, Y., J. Rusconi, and W. Schaffner. 1981. Expres-sion of a 0-globin gene is enhanced by remote SV40 DNAsequences. Cell 27:299-308.

2. Benoist, C., and P. Chambon. 1981. In vivo sequencerequirements of the SV40 early promoter region. Nature(London) 290:304-310.

2a.Binetruy, B., G. Meneguzzi, R. Breathnach, and F. Cuzin.1982. Recombinant DNA molecules comprising bovinepapillomavirus type 1 DNA linked to plasmid DNA aremaintained in a plasmidial state both in rodent fibroblastand in bacterial cells. EMBO J. 1:621-628.

3. Breathnach, R., and P. Chambon. 1981. Organization andexpression of eukaryotic split genes coding for proteins.Annu. Rev. Biochem. 50:349-383.

4. Capecchi, M. R. 1980. High efficiency transformation bydirect microinjection of DNA into cultured mammaliancells. Cell 22:479-488.

5. Chen, E. Y., P. M. Howley, A. D. Levinson, and P. H.Seeburg. 1982. The primary structure and genetic organi-zation of the bovine papillomavirus type 1 genome. Na-ture (London) 299:529-534.

6. Conrad, S., and M. Botchan. 1982. Isolation and charac-terization of human DNA fragments with nucleotide se-quence homologies with the simian virus 40 regulatoryregion. Mol. Cell. Biol. 2:949-965.

7. Di Maio, D., R. Treisman, and T. Maniatis. 1982. Bovinepapillomavirus vector that propagates as a plasmid in bothmouse and bacterial cells. Proc. Natl. Acad. Sci. U.S.A.79:4030-4034.

8. Favaloro, J. M., R. H. Treisman, and R. I. Kamen. 1980.Transcription maps of polyoma virus-specific RNA: anal-ysis by two-dimensional nuclease S1 gel mapping. Meth-ods Enzymol. 65:718-749.

9. Fromm, M., and P. Berg. 1982. Deletion mapping of DNAregions required for SV40 early region promoter functionin vivo. J. Mol. Appl. Genet. 1:457-481.

10. Fujimura, F. K., P. L. Deininger, T. Friedmann, and E.Linney. 1981. Mutation near the polyoma DNA replica-tion origin permits productive infection of F9 embryonalcarcinoma cells. Proc. NatI. Acad. Sci. U.S.A. 78:1100-1104.

11. Fujimura, F. K., and E. Linney. 1982. Polyoma mutantsthat productively infect F9 embryonal carcinoma cells donot rescue wild-type polyoma in F9 cells. Proc. Natl.Acad. Sci. U.S.A. 79:1479-1483.

12. Ghosh, P. K., and P. Lebowitz. 1981. Simian virus 40 earlymRNA's contain multiple 5' termini upstream and down-stream from a Hogness-Goldberg sequence; a shift in 5'termini during the lytic cycle is mediated by large Tantigen. J. Virol. 40:224-240.

13. Gluzman, Y. 1981. SV40 transformed simian cells support

the replication of early SV40 mutants. Cell 23:175-182.14. Graessmann, A., M. Graessmann, W. C. Topp, and M.

Botchan. 1979. Retransformation of a simian virus 40revertant cell line, which is resistant to viral and DNAinfections, by microinjection of viral DNA. J. Virol.32:989-994.

15. Grodzicker, T., and D. F. Kkessig. 1980. Expression ofunselected Adenovirus genes in human cells cotrans-formed with HSV-1 TK gene and adenovirus 2 DNA. Cell21:453-463.

16. Gruss, P., R. Dhar, and G. Khoury. 1981. Simian virus 40tandem repeated sequences as an element of the earlypromoter. Proc. NatI. Acad. Sci. U.S.A. 78:943-947.

17. Kriegler, M., and M. Botchan. 1983. Enhanced transfor-mation by a simian virus 40 recombinant virus containinga Harvey murine sarcoma virus long terminal repeat. Mol.Cell. Biol. 3:325-339.

18. Hanshan, D., D. Lane, L. Lipsich, M. Wigler, and M.Botchan. 1980. Characteristics of an SV40-plasmid recom-binant and its movement into and out of the genome of amurine cell. Cell 21:127-139.

19. Hansen, U., D. G. Tenen, D. M. Livingston, and P. A.Sharp. 1981. T antigen repression of SV40 early transcrip-tion from two promoters. Cell 27:603-612.

20. Heixman, C. A., L. Engel, D. R. Lowy, and P. Howley.1982. Virus specific transcription in bovine papillomavirus transformed mouse cells. Virology 119:22-34.

21. Hirt, B. 1967. Selective extraction of polyoma DNA frominfected mouse cell cultures. J. Mol. Biol. 26:365-369.

22. Katinka, M., M. Vasseur, N. Montreau, M. Yaniv, and D.Blangy. 1981. Polyoma DNA sequences involved in con-trol of viral gene expression of murine embryonal carcino-ma cells. Nature (London) 290:720-722.

23. Laimins, L. A., G. Khoury, C. Gorman, B. Howard, andP. Gruss. 1982. Host specific activation of transcription bytandem repeats from SV40 and Moloney murine sarcomavirus. Proc. Natl. Acad. Sci. U.S.A. 79:6453-6456.

24. Law, M.-F., D. R. Lowy, J. Dvoretzky, and P. M. Howley.1981. Mouse cells transformed by bovine papillomaviruscontain only extra-chromosomal viral DNA sequences.Proc. Natl. Acad. Sci. U.S.A. 78:2727-2731.

25. Lee, F., R. Mulligan, P. Berg, and G. Ringold. 1981.Glucocorticoids regulate expression of dihydrofolate re-ductase cDNA in mouse mammary tumor virus chimaericplasmids. Nature (London) 294:228-232.

26. Lowy, D. R., J. Dvoretzky, R. Shaber, M.-F. Law, L.Engel, and P. M. Howley. 1980. In vitro tumorigenictransformation by a defined subgenomic fragment of bo-vine papilloma virus DNA. Nature (London) 287:72-74.

27. Lusky, M., L. Berg, and M. Botchan. 1982. Enhancementof thymidine kinase transformation by sequences of bo-vine papilloma virus, p. 99-109. In Y. Gluzman (ed.),Eukaryotic viral vectors. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

28. Lusky, M., and M. Botchan. 1981. Inhibition of SV40replication in simian cells by specific pBR322 DNA se-quences. Nature (London) 293:79-81.

29. Marinus, M. G., and E. B. Konrad. 1976. Hyperrecombin-ation in dam mutants of Escherichia coli K-12. Mol. Gen.Genet. 149:273-277.

30. McCutchan, J. H., and Y. S. Pagano. 1968. Enhancementof the infectivity of simian virus 40 deoxyribonucleic acidwith diethylaminoethyldextran. J. Natl. Cancer Inst.41:351-357.

31. McKnight, S. L. 1982. Functional relationships betweentranscriptional control signals of the thymidine kinasegene of herpes simplex virus. Cell 31:355-365.

32. Moreau, P., R. Hen, B. Wasylyk, R. Everett, M. P. Gaub,and P. Chambon. 1981. The SV40 72 base pair repeat has astriking effect on gene expression both in SV40 and otherchimeric recombinants. Nucleic Acids Res. 9:6047-6068.

33. Oskarsson, M., W. L. McClements, D. G. Blair, Y. V.Maizel, and G. F. VandeWoude. 1980. Properties of anormal mouse cell DNA sequence (sarc) homologous tothe src sequence of Moloney sarcoma virus. Science

VOL. 3, 1983

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

1122 LUSKY ET AL.

207:1222-1224.34. Perucho, M., and M. Wigler. 1980. Linkage and expres-

sion of foreign DNA in cultured animal cells. Cold SpringHarbor Symp. Quant. Biol. 44:829-838.

35. Reddy, V. B., P. K. Ghosh, P. Lebowitz, M. Platak, andS. M. Welssman. 1979. Simian virus 40 early mRNA's. I.Genomic localization of 3' and 5' termini and two majorsplices in mRNA from transformed and lytically infectedcells. J. Virol. 30:279-296.

36. Sarver, N., J. C. Byrne, and P. Howley. 1982. Transforma-tion and replication in mouse cells of a bovine papillomavirus/pML2 plasmid vector that can be rescued in bacte-ria. Proc. Natl. Acad. Sci. U.S.A. 79:7147-7151.

37. Sekikawa, K., and A. J. Levine. 1981. Isolation andcharacterization of polyoma host range mutants that repli-cate in nullipotential embryonal carcinoma cells. Proc.NatI. Acad. Sci. U.S.A. 78:1100-1104.

38. Stinchcomb, D. T., K. Struhl, and R. W. Davis. 1979.Isolation and characterization of a yeast chromosomal

MOL. CELL. BIOL.

replicator. Nature (London) 282:39-43.39. Tegtneyer, P. 1972. Simian virus 40 deoxyribonucleic acid

synthesis: the viral replicon. J. Virol. 10:591-598.40. Tbomas, C. A., K. I. Berns, Jr., and T. Kelly, Jr. 1966.

Isolation of high molecular weight DNA from bacteria andcell nuclei. p. 535. In G. L. Cantoni and D. R. Davies(ed.), Procedures in nucleic acid research. Harper andRow, New York.

41. Topp, W. C. 1981. Normal rat cell lines deficient innuclear thymidine kinase. Virology 113:408-411.

42. Tyndall, C. L., G. LaMantia, C. M. Thacker, Y. Favaloro,and R. Kamen. 1981. A region of the polyoma virusgenome between the replication origin and late proteincoding sequence is required in cis for both early geneexpression and viral DNA replication. Nucleic Acids Res.9:6231-6250.

43. Wigler, M., A. PeUicer, S. Silverstein, and R. Axel. 1978.Biochemical transfer of single copy eukaryotic genesusing total cellular DNA as donor. Cell 24:729-731.

on March 17, 2018 by guest

http://mcb.asm

.org/D

ownloaded from