bone morphogenetic protein-9 induces epithelial to mesenchymal transition in hepatocellular...

Bone morphogenetic protein-9 induces epithelial tomesenchymal transition in hepatocellularcarcinoma cellsQi Li,1,2,10 Xing Gu,3,10 Honglei Weng,1 Shahrouz Ghafoory,4 Yan Liu,1,5 Teng Feng,1 Johanna Dzieran,1 Li Li,6

Iryna IIkavets,1 Marianna Kruithof-de Julio,5 Stefan Munker,1 Alexander Marx,7 Albrecht Piiper,8 Eduardo AugustoAlonso,8 Norbert Gretz,6 Chunfang Gao,3 Stefan W€olfl,4 Steven Dooley1 and Katja Breitkopf-Heinlein1,9

1Department of Medicine II, Section Molecular Hepatology – Alcohol Associated Diseases, Medical Faculty Mannheim at Heidelberg University, Mannheim,Germany; 2Department of Gastroenterology and Hepatology, Beijing You’an Hospital, Capital Medical University, Beijing; 3Department of LaboratoryMedicine, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai, China; 4Institute of Pharmacy and MolecularBiotechnology, Heidelberg University, Heidelberg, Germany; 5Department of Molecular Cell Biology and Centre for Biomedical Genetics, Leiden UniversityMedical Center, Leiden, the Netherlands; 6Medical Research Center, Medical Faculty Mannheim, University of Heidelberg, Heidelberg; 7Institute ofPathology, University Medical Centre Mannheim, University of Heidelberg, Heidelberg; 8Department of Medicine I, Johann Wolfgang Goethe University,Frankfurt, Germany

(Received July 18, 2012 ⁄ Revised December 11, 2012 ⁄ Accepted December 13, 2012 ⁄ Accepted manuscript online January 3, 2013 ⁄ Article first published online February 13, 2013)

Epithelial-mesenchymal transition (EMT) is an important mecha-nism to initiate cancer invasion and metastasis. Bone morphoge-netic protein (BMP)-9 is a member of the transforming growthfactor (TGF)-b superfamily. It has been suggested to play a role incancer development in some non-hepatic tumors. In the presentstudy, two hepatocellular carcinoma (HCC) lines, HLE and HepG2,were treated with BMP-9 in vitro, and phenotypic changes andcell motility were analyzed. In situ hybridization (ISH) and immu-nohistochemical analyses were performed with human HCCtissue samples in order to assess expression levels of BMP-9.In vivo, BMP-9 protein and mRNA were expressed in all thetested patients to diverse degrees. At the protein level, mildlypositive (1 + ) BMP-9 staining could be observed in 25 ⁄ 41 (61%),and moderately to strongly positive (2 + ) in 16 ⁄ 41 (39%) of thepatients. In 27 ⁄ 41 (65%) patients, the BMP-9 protein expressionlevel was consistent with the mRNA expression level as measuredby ISH. In those patients with 2 + protein level, nuclear pSmad1expression in cancer cells was also significantly increased. Expres-sion of BMP-9 was positively related to nuclear Snail expressionand reversely correlated to cell surface E-cadherin expression,although this did not reach statistical significance. Expression lev-els of BMP-9 were significantly associated with the T stages ofthe investigated tumors and high levels of BMP-9 were detectedby immunofluorescence especially at the tumor borders in sam-ples from an HCC mouse model. In vitro, BMP-9 treatment causeda reduction of E-cadherin and ZO-1 and an induction of Vimentinand Snail expression. Furthermore, cell migration was enhancedby BMP-9 in both HCC cell lines. These results imply that EMTinduced by BMP-9 is related to invasiveness of HCC. (Cancer Sci2013; 104: 398–408)

E ighty to ninety percent of primary liver cancer cases origi-nate from hepatocellular carcinoma (HCC), which has been

regarded as the fifth most common cancer and the third mostcancer-related death in the world.(1) Current therapeutic optionsincluding surgical resection, liver transplantation and chemo-embolization are only used at early stages of HCC with limitedefficacy.(2) Cancer recurrence occurs in around 50% ofpatients.(3,4) Despite extensive scientific efforts, the prognosis ofHCC is nowadays still poor since HCC is inclined to tumor inva-siveness and formation of intra- and extra-hepatic metastases.Epithelial-mesenchymal transition (EMT) is one major

mechanism participating in malignant progression of cancercells. Epithelial-mesenchymal transition is characterized by loss

of differentiated traits in epithelial cells, for example, cell–cellcontacts and cell polarity, as well as acquisition of mesenchy-mal appearances such as higher motility, invasiveness andresistance to apoptosis.(5) Properties typical for EMT comprisedownregulation of epithelial markers like E-cadherin, ZO-1,nuclear translocation of b-catenin and upregulation of mesen-chymal markers like Vimentin, N-cadherin and a-smooth mus-cle actin (SMA).(6,7) The zinc-finger transcription factors Snailand Slug, and the basic helix-loop-helix transcription factorTwist play prominent roles as master regulators of EMT, asthey repress expression of E-cadherin.(8–10) In liver carcinogen-esis, there is growing evidence for a central role of EMT indifferent stages of disease progression. E-cadherin, b-catenin,Twist, Snail, Slug, SOX4 and others have been identified asmarkers for EMT in hepatocytes and HCC.(11)

Hepatocyte growth factor (HGF) has been reported to induceEMT in HCC via c-met signaling and cross-talk with Akt- andCOX-2- pathways.(12,13) Furthermore, transforming growth fac-tor-b (TGF-b) signaling has been described as a critical indu-cer of a complete EMT phenotype in malignant hepatocytes. Itis reported to display dual roles towards epithelial cells includ-ing hepatocytes. In healthy liver and early stages of hepatocar-cinogenesis, TGF-b mediates cell cycle arrest and apoptosis,whereas at later stages, it causes cell dedifferentiation, EMTand metastasis.(14) Morphologically, TGF-b mediates a gain ofplasticity in neoplastic hepatocytes which can be documentedas cell spreading.(11) Transforming growth factor-b additionallyactivates other factors and signaling pathways such as COX-2,platelet derived growth factor (PDGF) or the PI3K ⁄Akt path-way in malignant hepatocytes, which facilitate tumor cell sur-vival.(15) Transforming growth factor-b may provide tumorpromoting effects towards hepatocytes via Smad and non-Smad signaling pathways.(16) Bone morphogenetic proteins(BMPs) (4, 6, 7, 8, 9, 10, 11, 13 and 15) are upregulated inHCC cell lines and there is evidence for their contribution tomigration and invasion of HCC cells, predominantly via Smadsignaling.(17) Further, BMP-2 induces angiogenesis in HCCxenografted nude mice(18) and BMP-4 was shown to promoteHCC progression and has potential as prognostic marker inHCC.(19,20)

9To whom correspondence should be addressed.E-mail: [email protected] authors contributed equally to this manuscript.

Cancer Sci | March 2013 | vol. 104 | no. 3 | 398–408 doi: 10.1111/cas.12093© 2013 Japanese Cancer Association

In the present report, we have investigated BMP-9, amember of the TGF-b superfamily, also named as Growth andDifferentiation Factor (GDF)-2, which was initially cloned from afetal mouse liver cDNA library.(21) Bone morphogenetic pro-tein-9 binds to the type I receptors ALK1 (activin receptor-likekinase 1) and ALK2 to induce osteogenic signaling in mesen-chymal stem cells.(22) After binding BMP-9, type II receptorsphosphorylate the type I receptor and subsequently down-stream signaling via activation of the R-Smads -1, -5, -8 isinitiated. The complex formation of these Smads with Smad4enables nuclear translocation of this transcriptionally activecomplex to regulate BMP-9-target genes.(23) Bone morphoge-netic protein-9 participates in various physiologic processesincluding bone formation, hematopoiesis, glucose homeostasis,iron homeostasis and angiogenesis.(24–27) Bone morphogeneticprotein-9 was recently suggested to be involved in cancerdevelopment in a small number of studies. But its effects ondifferent cancer cells are controversial. It was reported thatabout 25% of epithelial ovarian cancers express BMP-9,whereas normal human ovarian surface epithelial specimens donot. Furthermore, some ovarian cancer cell lines acquire auto-crine BMP-9 signaling that facilitates cancer cell prolifera-tion.(28) On the contrary, in prostate cancer, BMP-9 suppressescancer cell growth via inducing cell apoptosis.(29)

The biological role of BMP-9 in HCC, especially if BMP-9can promote cancer invasion via EMT, has not been elucidatedso far. In the present study, we investigated human samplesfrom HCC patients for BMP-9 expression and HCC cell linesas well as samples from an HCC mouse model to investigateits impact on EMT marker expression and cell migration. InHCC patient samples, we found that BMP-9 expression waspositively associated with T stage and that it enhanced cellmigration and induced EMT in HCC cells in vitro. Therefore,we identified BMP-9 as a new EMT inducing factor in HCC.

Materials and Methods

Antibodies. Polyclonal anti-human BMP-9 antibody fromAbD Serotec (D€usseldorf, Germany) for IHC on human sec-tions, polyclonal rabbit anti BMP-9 (ab35088) from Abcam(Cambridge, UK) for IF on mouse sections, Phospho-Smad1(Ser463 ⁄465) ⁄Smad5 (Ser463 ⁄465) ⁄Smad8 (Ser426 ⁄428) poly-clonal antibody and anti-rabbit E-cadherin from Cell SignalingTechnology (New England Biolabs GmbH), rabbit anti ZO1and rabbit anti Snail from Abcam were used in immunohisto-chemistry. The following antibodies were used for Westernblot: Smad1 rabbit monoclonal antibody and pSmad3 rabbitmonoclonal antibody from Epitomics (Biomol GmbH), poly-clonal anti-rabbit GAPDH antibody from Santa Cruz Biotech-nology (Heidelberg, Germany) and anti-mouse b-actin andrabbit anti snail from Sigma (Munich, Germany). Anti-mouseE-cadherin from BD Biosciences (Heidelberg, Germany), andanti-mouse Vimentin from Abcam were used for both Westernblot and immunofluorescence staining.

Reagents. Recombinant human BMP-9 was purchased fromR&D Systems (Wiesbaden-Nordenstadt, Germany). CellTiter-Glo Luminescent Cell Viability Assay was from Promega(Mannheim, Germany).

Tissue specimens. A total of 41 cases diagnosed as primaryHCC from the surgical files in the Eastern Hepatobiliary Sur-gery Hospital, Second Military Medical University, Shanghai,China were enrolled in this study. Thirty-nine of them(95.12%) were hepatitis B surface antigen (HBsAg)-positive.The diagnosis was determined according to the InternationalUnion Against Cancer TNM classification of primary livercancer, 6th edition.(30) The study protocol conformed to theethical guidelines of the Declaration of Helsinki (1975) andwas approved by the ethics committee of the Second Military

Medical University, Shanghai, China. All patients provided aninformed consent before the study.

Cell culture. Hepatocellular carcinoma cell lines HepG2 andhuman hepatoma cell line (HLE) cells were cultured inDMEM (Lonza, Basel, Switzerland) supplemented with 10%FCS (Invitrogen, Karlsruhe, Germany), 4 mM L-glutamine(Lonza, Basel, Switzerland) and 100 U ⁄mL penicillin ⁄ strep-tomicin (Biochrom KG, Berlin, Germany). Cells were culturedat 37° in 5% CO2 atmosphere.

Adenovirus infection. AddnALK1 ⁄2, AdcaALK1 andAdcaALK2 were kindly provided by Professor Dr Peter tenDijke (Leiden, Netherland). AdSmad1 and AdLacZ was a giftfrom Professor Dr Carl-Henrik Heldin (Uppsala, Sweden). Thevirus stocks were amplified in HEK293A cells. Virus titerswere measured with Adeno-x rapid titer kit (Takara Bio Europe ⁄Clontech, Germany). HLE and HepG2 cells were plated in6-well plates at a density of 0.25 9 105 ⁄well and4 9 105 ⁄well, respectively. In the afternoon of the second day,medium was changed and different adenoviruses of m.o.i 10were added into each well. On the third day, medium (10%FCS) was changed. Serum starvation was performed in themorning of the fourth day so that cells had time to overcomethe stress induced by the viruses. In the afternoon, cells werestimulated with BMP-9 (50 ng ⁄mL). Proteins were harvestedon the seventh day. In total, cells were infected by adenovirus-es for 5 days and stimulated with BMP-9 for 72 h.

Transwell assay. The migration of HepG2 and HLE cells wasdetected in a modified 24-well transwell chamber (BD Bio-sciences). In the upper chamber, 25 000 cells in 0.25 mL ofserum-free culture medium were treated with BMP-9 (50 ng⁄mL). Medium with 10% FCS and with or without BMP-9(50 ng ⁄mL) was loaded in the lower wells serving as chemo-tactic stimulus. After 6 (HLE cells) or 24 (HepG2 cells) h at37°C, the cells on the upper surface of the filter and the under-side were trypsinized, washed with serum-free DMEM andtransferred to a 96-well flat bottomed plate, respectively. Aftercentrifugation at 129g for 10 min, the supernatant was dis-carded and 40 lL buffer of the CellTiter-Glo LuminescentCell Viability Assay (Promega) was added to each well. Lumi-nescence was measured by the iControl1.6 program. The per-centage of migrated cells was calculated. Each experiment wasconducted in triplicate, and the mean � SD was calculated.

Preparation of cell lysates and immunoblotting. Total cell pro-tein was extracted on ice with RIPA lysis buffer (1 9 Tris-buffer saline, 1% Nonidet P40, 0.5% sodium deoxycholate, and0.1% sodium dodecylsulfate) in the presence of freshly addedprotease and phosphatase inhibitors (Roche, Mannheim, Ger-many). Protein concentration was determined using Bradfordmethod with a Bio-Rad protein assay (Biorad, Munich, Ger-many). Thirty micrograms of protein extract was separated by4–12% SDS-PAGE (4–12% Bis-Tris Gel, NuPAGE, Invitrogen)and transferred to nitrocellulose membranes (Pierce, Rockford,IL, USA). Nonspecific binding was blocked with 5% non-fatmilk in tris buffered saline with 0.05% Tween 20 for 1 h. Themembrane was incubated with the primary antibodies at 4°Covernight. Horseradish peroxidase-linked goat anti-mouse andanti-rabbit antibodies (Santa Cruz) were used as secondary anti-bodies. The membranes were developed with Supersignal Ultra(Pierce, Hamburg, Germany) and chemiluminescence wasdetected with a Fujifilms LAS 1 000 image detection system.

RT-PCR. Total RNA was extracted from cells with an RNApurification kit (Roche) according to the manufactures’ instruc-tions. RNA was reverse transcribed into cDNA with the Tran-scriptor First Strand cDNA synthesis kit (Roche). Polymerasechain reaction conditions were 95°C for 5 min, followed by 28or 38 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for75 s. The final extension period consisted of 7 min at 72°C.Polymerase chain reaction products were separated on 1.5%

Li et al. Cancer Sci | March 2013 | vol. 104 | no. 3 | 399© 2013 Japanese Cancer Association

agarose gels stained with ethdium bromide and visualizedunder UV light. Forward and reverse primers for the indicatedgene amplification are described in Table 1.

In situ hybridization. Bone morphogenetic protein-9 specificcRNA in situ hybridization probes were prepared using doublestranded cDNA templates with flanking SP6 and T7-RNA-polymerase promoters, prepared using gene specificPCR-primers as described.(31) In short: total RNA was isolatedfrom Jurkat human T lymphocyte cells; first-strand cDNA wassynthesized with 3 lg total RNA using random hexamer prim-ers and AMV Reverse Transcriptase (Promega, Madison, WI,USA); BMP-9 specific PCR primers included SP6-RNA-poly-merase promoter flanking a short gene specific 5′ sequence anda T7-RNA-polymerase promoter flanking a short gene specific3′sequence (amplified fragment: 998nt-1820nt of BMP-9mRNA, GeneBank: NM_016204.1; Primer sequences used; H.BMP-9. SP6: 5′-CAGTGAATTGATTTAGGTGACACTATAGAAGTGGAACAAGAGAGCGTGCTCAAGAAGC-3′ and H. BMP-9.T7: 5′-CAGTGAATTGTAATACGACTCACTATAGGGAGACTCCTCCACCTCTCTAACTTCCATC-3′). Then anti-sense cRNAprobes were synthesized using T7-RNA-polymerase, and sensecRNA probes were obtained with SP6-RNA-polymerase tran-scription. In situ hybridization was performed on 4 lm tissueslices as described.(31) Positive staining is visible as purplecolor from nitro-blue tetrazolium/5-bromo-4 chloro-3′-indolylphosphate precipitate.For the semi-quantitative assessment of ISH staining, stain-

ing scores were calculated with the following method: positivecell number was graded as 0–4 (0, no positive cells; 1, lessthan 25% positive cells; 2, 25–50% positive cells; 3, 50–75%positive cells; 4, more than 75% positive cells). The intensityof positivity was graded as 1–3 (1, weak purple staining; 2,strong and purple staining; 3, very strong and deep purplestaining). The score was calculated according to this formula:number 9 intensity. According to the calculated score, thestaining level was classified into 3 levels: 0, no positive stain-ing; 1 + , score of 1–4; 2 + , 5 and more.

Immunofluorescent staining. Cells were plated on a glasschamber slide and every condition was done in duplicate. Follow-ing serum starvation over-night, the cells were simulated withrh-BMP-9 (50 ng ⁄mL) for 72 h. Cells were fixed with ice-coldacetone and permeabilized with 0.1% Triton for 5 min in TRIS-buffered saline. After blocking with 1% BSA for 60 min, immu-nofluorescent staining was performed using primary antibodiesagainst E-cadherin and vimentin with a dilution of 1:200 and sec-ond antibodies, the Alexa 488 labeled anti-rabbit or mouse IgGwith a dilution of 1:200. The nucleus was stained with DRAQ5(1:5 000) or DAPI (1:10000). Then the slide was mounted usingDakoCytomation Fluorescent Mounting Medium (DakoCytoma-tion, Hamburg, Germany) and visualized by confocal micros-copy. Confocal images were obtained by using a Leica laserscanning spectral confocal microscope, model DM IRE2 (LeicaMicrosystems, Wetzlar, Germany). Excitation was performedwith an argon laser emitting at 488 nm, a krypton laser emitting at568 nm, and a helium ⁄neon laser emitting at 633 nm. Images

were acquired with a TCS SP2 scanner and Leica Confocal soft-ware, version 2.5 (Leica Microsystems, Wetzlar, Germany).Immunofluorescent staining of cryosections of TGFa ⁄ cmyc

stage 3 HCC mice were performed as follows: sections werewashed in PBS and antigen retrieval was performed (10 minhigh pressure antimasking solution vectashield). Sections werethen treated with 3% H2O2 for 10 min followed by PBSwashes and blocked in PBST (tween 20, 0.1%) with 10%serum. Antibodies at appropriate dilution were added. BMP9antibody was amplified with tyramide amplification kit fromInvitrogen according to the manufacturer’s protocol. Secondaryantibodies (Alexa-555 for E-Cadherin) were used at a dilutionof 1:250. TOPRO3 was used as a nuclear dye and sectionswere mounted in Prolog G antifading reagent (Invitrogen).Sections were scanned on a Leica SP5 confocal microscope.

Immunohistochemical staining. Following formalin-fixation,paraffin-embedding and sectioning (4 lm), human liver tissueswere deparaffinized in xylene and rehydrated in graded ethanolbefore being washed with distilled water. Then antigenunmasking in EDTA buffer with microwave was performed.The section slides were immersed in 3% H2O2 for 30 min, andwashed with PBS three times. Then DAKO peroxidase block-ing reagent was used to block the endogenous peroxidase for15 min. After washing with PBS three times, the slides wereincubated with 1st antibody (BMP-9 1:400; pSmad1 ⁄5 ⁄8 1:100;E-cadherin 1:400; Snail 1:1000) at 4°C overnight. On the fol-lowing day, the slides were re-warmed at room temperature for1 h and washed with PBS three times before visualizing theimmune-reactivity with Dako Envision + System-horseradishperoxidase kit according to the manufacturer’s instructions.Slides were counterstained with hematoxylin and mounted.Semi-quantitative assessment was performed for IHC stain-

ing of HCC tissue against BMP-9, pSmad1, E-cadherin andSnail. Staining scores were calculated with the followingmethod: positive cell number was graded as 0–4 (0, no posi-tive cells; 1, less than 25% positive cells; 2, 25–50% positivecells; 3, 50–75% positive cells; 4, more than 75% positivecells). The intensity of positivity was graded as 1–3 (1, weakyellow staining; 2, strong and brown staining; 3, very strongand deep brown staining). The score was calculated accordingto this formula: number 9 intensity. According to the calcu-lated score, the staining level was classified into 3 levels: 0,no positive staining; 1 + , score of 1–4; 2 + , 5 and more.

Statistical analysis. The association between immunohisto-chemical staining levels and clinicopathological features wasevaluated with kendall–tau rank correlation analysis in SAS ver-sion 9.2 (SAS Inc., Cary, NC, USA). Student’s t-test was usedto analyze the result of the migration assay. Error bars werethe standard error of the mean. P < 0.05 was considered statis-tically significant.

Results

BMP-9 is expressed in HCC tissue from patients. We analyzedBMP-9 mRNA and protein expression in 41 HCC tissues and

Table 1. Primer sequences used in this study

Gene name Forward Reverse Size of PCR products (bp)

ALK1 CTTCTCCTCGAGGGATGAAC TGGTTTGCCCTGTGTACCG 283

ALK2 TTCCAGGTTTATGAGCAGGG CGTTTCCCTGAACCATGACT 537

BMPRII GGACGCATGGAATATTTGCT TGGCTGCATTATCTTCCTCC 310

ACVR2A CAAACTGGTGTTGAACCGTG GCACCAAGGAATAGAGCAGG 307

Smad1 CCAGCCGCTATGAATGTGAC GAGTGAGGGTAGGTGCTGC 625

Smad4 CCTCATGTGATCTATGCCCG CTGTGGACATTGGAGAGTTG 844

rS6 GACTGATACTACAGTGCCTC GTAGAAGCTCGCAGAGAGG 371

Snail AATCGGAAGCCTAACTACAGCG GTCCCAGATGAGCATTGGCA 147

400 doi: 10.1111/cas.12093© 2013 Japanese Cancer Association

36 paired non-cancer liver tissues from liver cancer patients byimmunohistochemical staining (IHC) and in situ hybridization(ISH). We found that BMP-9 protein and mRNA expressionexisted in all 41 patients, although the expression levelsstrongly varied. In 6 ⁄36 (17%) patients BMP-9 protein expres-sion levels were equally high (2 + ) in the cancer area as com-pared to surrounding liver tissue. In another 6 ⁄36 (17%) thenon-cancerous tissue showed highest expression (2 + )although the corresponding HCC tissue showed only interme-diate (1 + ) levels. In 15 ⁄36 (42%) the surrounding and theHCC tissues showed both intermediate levels (1 + ). Finally inone case each (3%) the tumor levels were either high (2 + ) orintermediate (1 + ) whereas in the surrounding tissue therewas no BMP-9 detectable (Table 2). A detailed classificationof all these “non-tumor” samples revealed that these tumorsurrounding tissues were already highly fibrotic ⁄ cirrhotic(Table S1) and can therefore not be considered as “normal”liver tissue. Bone morphogenetic protein-9 staining was foundin cancerous regions, and ISH data show that it is not onlybinding to the cell surface, but that BMP-9 mRNA is also pro-duced by HCC cells themselves (Fig. 1a,b). According to anevaluation system as indicated in Materials and Methods,mildly positive (1 + ) BMP-9 protein staining was observed in25 ⁄41 (61%), and moderately to strongly positive (2 + ) stain-ing was present in 16 ⁄41 (39%) cancer samples of the patients(Fig. 1a and Table 3). In 27 ⁄41 (66%) patients, BMP-9 proteinand mRNA expression levels were consistent (Fig. 1a,b). In 7⁄41 (17%) patients, there were 1 + mRNA levels correlatedwith 2 + protein levels, whereas in another 7 ⁄41 (17%)patients, it was the other way around.A comparison of BMP-9 expression levels with clinicopatho-

logical features of the 41 investigated HCC patients indicates asignificant association of the BMP-9 protein expression levelwith T stage (τB = 0.381, P = 0.016) and Child–Pugh score(τB = �0.328, P = 0.04) (Table 2), indicating that BMP-9 lev-els are positively correlated with invasion, but negatively withthe severity of disease.

BMP-9 expression is associated with increased pSmad1 andSnail and decreased E-cadherin levels in HCC. We next examinedBMP-9 downstream signaling and features of EMT usingantibodies for phosphorylated Smad1 (pSmad1), Snail andE-cadherin and associated their occurrence ⁄ expression withBMP-9 protein expression. In HCC patients with 1 + BMP-9levels, E-cadherin signals were stronger, while those of Snailand pSmad1 were weaker, as compared to liver cancer sampleswith 2 + BMP-9 levels (Fig. 1c). A semi-quantitative analysisof the staining results indicates a significant correlation ofBMP-9 expression with increased activity of the Smad1 signaltransduction. Further, expression of BMP-9 was positivelyrelated to Snail expression and negatively correlated to E-cadherin expression, although this trend did not reach statisticalsignificance (Fig. 1d).Because there were no patient samples available showing

the invasive front of the tumor, we searched for an HCC ani-mal model that could be used to investigate if BMP-9 isexpressed preferentially at the tumor borders. To do so we

used cryo sections from mouse livers of TGFa ⁄ c-myc bitrans-genic mice, which develop HCC endogenously.(32) Immunoflu-orescent staining of such sections showed that indeed strongBMP-9 positive cells are located at the tumor borders and thatcells with high expression of BMP-9 show rather low expres-sion of the epithelial marker E-Cadherin and vice versa(Fig. 1e).

BMP-9 signaling is functional in HCC cell lines. In order toinvestigate BMP-9 signaling in liver cancer cells in moredetail, we assessed whether BMP-9 ⁄Smad1 signaling compo-nents are expressed in the well-established HCC cell lines,HepG2 and HLE. These cells were originally derived from pri-mary tumors.(33,34) Histologically, HepG2 are classified as awell-differentiated liver cancer cell line and HLE as an inva-sive HCC cell line, but commonly representing epithelial phe-notypes.BMP-type I and II receptors ALK1, ALK2, BMPRII and

ACVR2A as well as Smads-1 and -4 were expressed in bothcell lines at different levels, as determined by PCR (Fig. 2a).To investigate whether expression of the receptors correlated

with BMP-9 responsiveness of the cells, we treated them withrhBMP-9 (50 ng ⁄mL) and examined Smad1 C-terminal phos-phorylation. Both HCC cell lines were responsive to BMP-9even at concentrations as low as 5 ng ⁄mL. Smad1 phosphory-lation occurred as early as 10 min after the stimulation, lastingat least 72 h (Fig. 2b,c). Taken together, these data indicatethat the BMP-9 ⁄Smad1 pathway is functional in HCC cellsin vitro with a prolonged instead of a short term response,which is in line with previous descriptions of Smad signalingparticipating in EMT.(35)

BMP-9 induces EMT in HCC cells in vitro. The immunohisto-chemical analyses of patient samples shown above point to acorrelation between BMP-9 levels and EMT in HCC. Sinceincreased migration is a typical feature of EMT, we performedTranswell assays to investigate if BMP-9 induces EMT inHCC cells in vitro. Treatment with BMP-9 (50 ng ⁄mL)increased cell migration in HLE and HepG2 cells by 2.38- and3.72-fold, respectively (Fig. 3a). We then investigated cellmorphology and expression levels of EMT markers upon stim-ulation of the cells with BMP-9 for 72 h. Cell morphologyshowed that BMP-9 led to a conversion from epithelial tofibroblastic cell morphology (Fig. 3b). Although both cell linesare considered to be of epithelial phenotype, basal E-cadherinexpression was rather diffuse and not strictly localized to thecell membranes and cell-cell contacts (Fig. 3c). However,BMP-9 treatment reduced the staining intensity for E-cadherinand enhanced that of the mesenchymal marker Vimentin(Fig. 3c). By Western blot analyses we confirmed downregula-tion of E-cadherin and induced expression of Vimentin(Fig. 3d). Snail, a key transcription factor responsible for thedownregulation of E-cadherin was significantly induced byBMP-9 at the RNA level (Fig. 3e).Collectively, these results support the conclusion that BMP-

9 mediates EMT and enhances migration in HCC cells, whichmight be an important feature during tumor invasion and for-mation of metastasis in vivo.

ALK1 and ALK2 are essential type I receptors for BMP-9-induced downregulation of E-cadherin in HCC cells. Some studiesusing other cell types have demonstrated that ALK1 andALK2 are BMP-9 specific type I receptors.(22) In this study,we used adenoviral infection to functionally link BMP-9 medi-ated signal transduction with downregulation of E-cadherin inHCC cell lines (Fig. 4a). Overexpression of dominant negativeforms of these receptors (AddnALK1 ⁄2) strongly reducedphosphorylation of Smad1 along with downregulation ofE-cadherin upon stimulation with BMP-9 (Fig. 4b). Further-more, overexpression of constitutive active mutants of bothreceptors (AdcaALK1 or AdcaALK2) could mimic the effects

Table 2. Bone morphogenetic protein-9 expression in cancer area

and paired non-cancer area

T n Total

2+ 1+ 0

2+ 6 (17) 7 (19) 1 (3) 14

1+ 6 (17) 15 (42) 1 (3) 22

Total 12 (33) 22 (61) 2 (6) 36


(a)(b)

(c)

(e)

(d)


of BMP-9, leading to phosphorylation of Smad1 and downre-gulation of E-cadherin (Fig. 4c,d). Similarly BMP-9 mediatedupregulation of Snail was mimicked by overexpression of con-stitutively active Alks and was inhibited by dominant negativeforms (Fig. 4e). We further performed immunofluorescent sta-inings on adenovirally transduced cells. We stained for twomarkers, ZO-1 (epithelial marker for cell–cell contact sites)

and vimentin (mesenchymal marker). In accordance with theabove-described Western blot results we found that dominantnegative Alks neutralized the BMP-9 effect on EMT whileboth constitutive active forms induced EMT (Fig. 5a,b). Theseresults imply that BMP-9 induces an EMT response in HCCvia the type I receptors ALK1 and ALK2 in HCC cells.

Discussion

Bone morphogenetic protein-9, which belongs to the TGF-bsuperfamily of cytokines is one of the most potent BMPs toinduce bone formation and is predominantly synthesized in theliver.(36,37) In healthy rat liver, non-parenchymal cells, likehepatic stellate cells, Kupffer cells and endothelial cells werereported as major sources of BMP-9. In another study, cholan-giocytes and hepatocytes were identified as major producers ofBMP-9.(37) These authors also detected BMP-9 expression inwhole liver lysates as well as different liver cell types includ-ing cholangiocytes, hepatocytes, hepatic stellate cells andhepatic sinusoidal endothelial cells at the RNA and proteinlevels. These data indicate that basal expression of BMP-9exists in healthy liver. Furthermore, the BMP-9 mRNA levelin cholangiocytes was 6 times higher than in hepatocytes andnearly 100 times higher than in hepatic stellate cells and hepa-tic sinusoidal endothelial cells. These results are mainly con-sistent with ours. With ISH we found a positive signal forBMP-9 mRNA in normal mouse liver, which was locatedmainly in cholangiocytes, whereas in hepatocytes and othercell types, it was rather low or negative (data not shown). Mostlikely, ISH is not sensitive enough to detect basal BMP-9levels in these other cell types under healthy conditions.Regarding the physiological functions of BMP-9, it was

found to circulate in plasma and keep endothelial cells in aresting state. Further, significant roles in glucose-(38) and ironhomeostasis(39) were identified. In liver cells, BMP-9 has beenreported to induce proliferation of rat hepatocytes(40) and par-ticipate in liver regeneration. Although these findings givesome preliminary hints, BMP-9′s function, especially in dis-eased liver, is only poorly understood up to now.The functions of TGF-b in carcinogenesis and tumor

progression of various cancer entities have been intenselystudied already. In premalignant cells, TGF-b serves as a tumorsuppressor, whereas in later stages of cancer, it functions asa tumor promoter. It has not been clearly clarified how andwhen TGF-b is converted from a tumor suppressor to atumor promoter during carcinogenesis. Bone morphogeneticproteins have also been demonstrated to participate in forma-tion and progression of human cancer. For example, BMP-2inhibits growth of gastric cancer cells through increasing thelevels of p21 ⁄WAF1 ⁄CIP1, leading to cell cycle arrest in theG1-phase,(41) while it facilitates proliferation of lung cancercells through Smad1 ⁄5 signaling and induction of Id-1

Table 3. The association between immunohistochemical staining

levels of all 41 hepato cellular carcinoma (HCC) samples and

clinicopathological features of the patients was evaluated with

kendall-tau rank correlation analysis

BMP-9 protein

expressionClinicopathological

factorn

1 + (%) 2 + (%)

sB P value

Total 41 25 (61) 16 (39)

Age

<60 32 18 (56) 14 (44) 0.059 0.709

>60 9 7 (78) 2 (22)

Gender

Male 37 21 (57) 16 (43) 0.263 0.096

Female 4 4 (100) 0 (0)

T stage

T1, 2 20 16 (80) 4 (20) 0.381 0.016

T3, 4 21 9 (43) 12 (57)

Size (cm)

<5 18 12 (67) 6 (33) 0.103 0.514

>5 23 13 (57) 10 (43)

Tumor grade

1,2 10 8 (80) 2 (20) �0.036 0.822

3,4 31 17 (55) 14 (45)

Tumor number

Single 32 21 (66) 11 (34) 0.180 0.256

Multiple 9 4 (44) 5 (56)

Child–class

A 22 10 (45) 12 (55) �0.328 0.040

B,C 19 15 (79) 4 (21)

TNM stage

l + ll 19 16 (84) 3 (16) 0.042 0.793

lll + IV 22 9 (41) 13 (59)

Fig. 1. Bone morphogenetic protein-9 (BMP-9) is expressed in hepatocellular carcinoma (HCC) and expression of BMP-9 is associated with Smad1phosphorylation, E-cadherin and Snail expression. Bone morphogenetic protein-9 expression analyses were performed in paraffin-embedded HCCtissues from liver cancer patients using immunohistochemical staining (IHC) and ISH (n = 41 for tumor area and n = 36 for non-tumor area).(a) Immunohistochemical staining for BMP-9 in tumor and paired non-tumor regions of livers from HCC patients (brown color) varied from caseto case. The extent was determined as mild (1 + ) and moderate to strong (2 + ). Magnification, 40 9. (b) Detection of BMP-9 mRNA expressionby ISH (violet color). In situ hybridization with sense probe was used as a negative control. Magnification, 40 9. (c) At 1 + BMP-9 expression lev-els, pSmad1 staining was mildly positive, E-cadherin cell surface expression was present and positive nuclear Snail expression was lower com-pared with those samples having 2 + BMP-9 expression levels. Representative images are shown. Magnification, 40 9. (d) Immunohistochemicalstaining of pSmad1, Snail and E-cadherin in HCC cells was semi-quantitatively evaluated in three grades (–, 1 + , 2 + ) as described in Materialsand Methods, and the association with BMP-9 expression was calculated, demonstrating that BMP-9 expression is significantly correlated withnuclear pSmad1, positively related to nuclear Snail, and reversely related to cell surface E-cadherin in HCC cells. (e) Immunofluorescent stainingagainst BMP-9 (green) and E-Cadherin (red) of cryo sections from tumor necrosis factor (TNF)a ⁄ cmyc bitransgenic mice, which spontaneouslydevelop HCC. The upper two pictures show typical examples of stage 3 HCC border areas, the second example is shown further enlarged.Black arrows point to cells with high expression of E-Cadherin but low expression of BMP-9 and white arrows point to cells with an oppositepattern.


expression.(42) Nine different BMPs are upregulated in HCCcells and their described functions in disease progressioninclude cell proliferation, migration and angiogenesis.(17)

Bone morphogenetic protein-4 and BMP-7 are upregulated inHBx-induced HCC mouse models and in HBV-related HCCpatients and were therefore included to what they defined“most common regulators” during the transition from normalliver to HCC. Furthermore, their ectopic overexpressionincreased cell viability and promoted migration in Hep3Bcells.(43) Overexpression of BMP-4 is significantly associatedwith the number of tumor nodules, TNM stage and vascularinvasion, and was proposed as a new marker to predictrecurrence and prognosis of HCC patients.(20) Further, BMP-4 induces cell proliferation and migration in CC cells,HepG2 and Hep3B,(44) whereas BMP-2 induces angiogenesisin Bel7402 and SMMC7721 tumor xenografted nude mice.WSS25, an antagonist of BMP-2, inhibits angiogenesis viablocking BMP ⁄Smad1 ⁄ Id1 signaling in these mouse models.(18)

In human cancer, variant functions for BMP-9 have beendescribed depending on the cancer type. In prostate and breastcancer, BMP-9 provides tumor suppressor activity, since itinhibits growth, migration and invasion,(29,45) whereas in ovar-ian cancer, it acts as a proliferation promoter via activation ofALK2 ⁄Smad1 signaling.(28) Although BMP-9 was foundupregulated in certain HCC cell lines,(17) so far, its contributionto HCC development and progression has not been explored.In the present study, we demonstrate that BMP-9 mRNA

and protein are expressed at different degrees in liver tissuesfrom HCC patients. Slightly positive (1 + ) staining of BMP-9protein was observed in 61% and moderately to strongly posi-tive staining (2 + ) in 39% of HCC tissue. Bone morphoge-netic protein-9 protein expression levels were higher in the

cancer area than in its adjacent liver tissue in 25% of thepatients and were similar in both areas in 58% of patients. Inthe remaining 16%, expression levels were even lower in thecancer area than in its adjacent liver tissue. Based on the find-ing that liver is the main organ producing BMP-9,(40) we canexpect that low levels of BMP-9 expression should always bedetectable. Furthermore, the “normal” liver tissues investigatedin the present study came from HCC patients and should there-fore not be considered healthy (see Table S1). Comparingthese results with our ISH of healthy livers, which showedstrong positivity only in cholangiocytes (data not shown),together with the 25% of patients showing increased presenceof BMP-9 in HCC compared to adjacent tissue, we concludethat there is a tendency of increase in BMP-9 in diseased liver,especially in HCC. In order to further investigate if BMP-9 isespecially expressed within the tumor, at the borders of thetumor or in the adjacent tissue, we used sections from livers ofTGFa ⁄ c-myc bitransgenic mice, which develop HCC endoge-nously.(32) The resulting stainings show high presence ofBMP-9 especially in cells at the tumor border. In addition,many cells in this area express either the epithelial markerE-Cadherin or are strongly positive for BMP-9, giving firsthints that BMP-9 leads to reduced expression of E-Cadherin.We want to mention also that 95% of the investigated HCCpatients were HBV-infected and it will be an interesting taskto investigate in the future if HBV infection as such impactsBMP-9 expression and if there are differences in regard to dis-ease etiology.Expression of BMP-9 in HCC, as resolved with IHC stain-

ing, was significantly associated with the T stage, showingstronger expression in patients with T3, T4 than in those withT1, T2, indicating that high levels of BMP-9 correlate with the

(a)

(b)

(c)

Fig. 2. Bone morphogenetic protein-9 (BMP-9)induces Smad1 phosphorylation in hepatocellularcarcinoma (HCC) cells. (a) Components of the Smad1pathway were slightly or strongly expressed in HepG2and HLE cells as determined by polymerase chainreaction (PCR). (b) Cells were untreated or treatedwith different concentrations of BMP-9 for 1 h.pSmad1 and total Smad1 were analyzed by Westernblot. (c) Cells were treated with 50 ng ⁄mL BMP-9 fordifferent times as indicated. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or b-actin wasused as a loading control.


degree of tumor invasion into the surrounding tissue. Whencorrelating BMP-9 expression with the Child–Pugh class of thepatients, we found that Child–Pugh class B ⁄C was strongerassociated with the group with lower BMP-9 levels (1 + ;79%), while in patients with Child–Pugh class A the distribu-tion was almost 50% (1 + ) and 50% (2 + ). This inverse cor-relation shows that although BMP-9 correlates withinvasiveness of the tumor (T stage), it does not seem toincrease along with loss of liver function as determined byChild–Pugh classification.Studying HCC cells in vitro, we found that BMP-9 promotes

cell migration, a typical feature of mesenchymal cells.Together with the known pro-proliferative effect of BMP-9 inliver cells,(40) this observation prompted us to investigate ifBMP-9 induces EMT in HCC cells. Epithelial-mesenchymaltransition is required for epithelial cancer cell migration andmetastasis and downregulated epithelial (E)-Cadherin andupregulated Snail are well described features of EMT. E-cadher-in is a Ca2 + -dependent cell adhesion transmembrane glycopro-tein, which links adjacent cells by hemophilic interactions,(46)

thus representing a typical marker for epithelial polarity.

Membranous E-cadherin as well as the cell–cell contact proteinZO-1 are downregulated during loss of the epithelial pheno-type representing classical molecular hall marks of EMT.Expression of E-cadherin is negatively regulated by Snail atthe transcriptional level. Appearance of mesenchymal markerslike Vimentin or N-cadherin is another typical feature of EMT.Indeed, besides promoting cell migration, BMP-9 downregulat-ed E-cadherin and ZO-1 and induced Snail and Vimentinexpression, indicating that BMP-9 induces EMT in HCC cells.In accordance with these in vitro findings, in HCC patientsamples, BMP-9 expression was positively correlated withSnail expression and was reversely correlated with E-cadherinexpression, although these correlations did not reach statisticalsignificance, which may be due to the relatively small numberof samples. Hence, our results are supportive of the hypothesisthat BMP-9 may promote migration and metastasis of HCCcells via induction of EMT.We further investigated the BMP-9 downstream signaling

pathway involved in EMT, and especially in BMP-9 induceddownregulation of E-cadherin. In mesenchymal stem cells,BMP-9 was reported to signal via the BMP type I receptors

(a)

(b)(c)

(d) (e)

Fig. 3. Bone morphogenetic protein-9 (BMP-9) enhances cell motility and induces epithelial-mesenchymal transition (EMT) in hepatocellular car-cinoma (HCC)cells. (a) Hepatocellular carcinoma cell lines were plated into transwell chambers and treated or not with BMP-9 (50 ng ⁄mL). At theend point of the migration assay, cells in the upper and lower chambers were trypsinized and transferred to a fresh 96-well flat bottom plate.Adenosine triphosphate (ATP) content, which correlates to cell number, was evaluated for migrated and non-migrated cells. Error bars reflectstandard error of the mean. *P < 0.05, Student’s t-test was done to analyze statistical difference. Experiments were performed in triplicate andrepeated three times. The average � standard error of the mean (SEM) of all experiments is shown. (b) Photographs of HCC cells taken after72 h of stimulation with BMP-9 or left untreated. (c) HLE or HepG2 cells were untreated or treated with BMP-9 50 ng ⁄mL for 72 h after serum-starvation overnight. Cells were immunostained with anti-E-cadherin or anti-Vimentin antibodies. DRAQ5 was used to show the nuclei (scale asindicated in the image). (d) Western blots against E-cadherin and Vimentin using lysates of HCC cells. Glyceraldehyde 3-phosphate dehydroge-nase (GAPDH) served as a loading control. (e) Polymerase chain reaction (PCR) showing that BMP-9 induced Snail mRNA expression in both HCCcell lines.


ALK1 and ALK2, which both activate Smad1 signaling tomediate osteogenesis.(22) We here show that ALK2 isexpressed in both HCC cell lines tested and by using adenovi-rally overexpressed receptor mutants, we could confirm thatdominant negative or constitutive active ALKs 1 and 2 impactE-cadherin, ZO-1 and vimentin expression levels and EMT inHLE and HepG2 cells. We conclude that similar to other celltypes, in HCC cells BMP-9 also signals via ALKs 1 and ⁄ or 2.Downstream of ALK1 ⁄ 2 activation, Smad1 is phosphory-

lated and mediates the signal transduction to the nucleus. Bonemorphogenetic protein ⁄Smad1 signaling was described to par-ticipate in different tumor types with diverse outcomes, eitheras tumor promoter or as tumor suppressor. Activation ofSmad1 ⁄ 5 is correlated with TGF-b-induced growth inhibitionin B-cell lymphoma.(47) In human breast cancer cells, activa-tion of BMP-2 ⁄Smad1 signaling inhibits cancer cell prolifera-tion via upregulation of p21.(48) In breast cancer patients and acorresponding xenograft mouse model, enhanced phospho-Smad1 staining was found in bone metastasis as compared tothe primary tumor or lymph node metastases, which suggests

that Smad1 signaling contributes to bone metastasis of breastcancer.(49) In pancreatic cancer, BMP-2, 4 and 7 induce EMTand increase cancer cell invasiveness, and their commoncanonical downstream signaling component, Smad1 is indis-pensable for BMP-mediated invasiveness.(50) In liver cells,BMP-9 signaling has not been characterized in detail yet, butsimilar to HCC cells primary mouse hepatocytes respond toBMP-9 with strong activation of the Smad1 pathway (data notshown). In line with the presence of BMP-9, Smad1 phosphor-ylation was increased in HCC cells of liver samples frompatients. These results further support the conclusion that theBMP-9 ⁄Smad1 pathway might be involved in the pathogenesisof HCC. However, we can at this stage not exclude thatbesides BMP-9, other members of the TGF-b superfamily (e.g.other BMPs or TGF-b) also take part in inducing Smad1 phos-phorylation in vivo.In summary, our results implicate the BMP-9 ⁄Smad1 path-

way as a potential promoter of HCC via inducing EMT. Fur-ther studies with larger numbers of human patient samplesand using animal models with a disturbed BMP-9 signaling

(a)

(b) (c) (d)

(e)

Fig. 4. ALK1 and ⁄ or 2 are required for bone morphogenetic protein-9 (BMP-9) mediated E-cadherin expression. HepG2 and HLE cells wereinfected or not with either a control virus (AdLacZ), a virus expressing a dominant negative mutant of the receptor (AddnALK1 ⁄ 2) or a virusexpressing a constitutive active mutant of the receptors (AdcaALK1 ⁄ 2), and treated or not with BMP-9, as indicated. (a) Schema of the experi-mental setup for adenovirus infection. (b–e) Immunoblots showing Smad1 phosphorylation, total Smad1 expression, E-cadherin and Snail expres-sion and b-actin as a loading control and presence of the HA-tag demonstrates successful overexpression of the constructs.


pathway are planned to elucidate the functional implication ofBMP-9 and its downstream signaling in liver cancer progres-sion and to estimate its potential as new marker for HCC pro-gression and prognosis as well as therapeutic target to treatHCC.

Acknowledgments

The study was supported by German Research Foundation programs“SFB TRR77 Liver Cancer” and “Do373 ⁄ 8-1″ and Federal Ministry ofEducation and Research grants “The Virtual Liver” and “cell therapy

in Liver Regeneration” (S.D). Qi Li is a fellow supported by ChinaScholarship Council. We wish to thank Professor Dr Peter ten Dijke(Leiden, Netherland) for providing AddnALK1 ⁄ 2, AdcaALK1,AdcaALK2, Professor Dr Carl-Henrik Heldin (Uppsala, Sweden) forAdLacZ and AdSmad1 and Professor S. Thorgeirsson (National CancerInstitute, NIH, Bethesda, Maryland, USA) for giving permission toProfessor Piiper to perform the TNFa ⁄ c-myc HCC mouse model.

Disclosure Statement

The authors have no conflict of interest.

References

1 Yang JD, Roberts LR. Hepatocellular carcinoma: a global view. Nat RevGastroenterol Hepatol 2010; 7: 448–58.

2 Lau WY, Lai EC. Hepatocellular carcinoma: current management and recentadvances. HBPD INT 2008; 7: 237–57.

3 Whittaker S, Marais R, Zhu AX. The role of signaling pathways in thedevelopment and treatment of hepatocellular carcinoma. Oncogene 2010; 29:4989–5005.

4 Josephs DH, Ross PJ. Sorafenib in hepatocellular carcinoma. Br J Hosp Med(Lond) 2010; 71: 451–6.

(a) (b)

Fig. 5. Immunofluorescent stainings for ZO-1 (green), vimentin (red) and 4´6´-diamidino-2-phenylindole dihydrochloride (DAPI) (blue; stainingthe nuclei) were performed on hepatocellular carcinoma (HCC) cells that were treated as described for Fig. 4. (a) HLE cells and (b) HepG2 (origi-nal magnification: 400-fold).


5 Polyak K, Weinberg RA. Transitions between epithelial and mesenchymalstates: acquisition of malignant and stem cell traits. Nat Rev Cancer 2009; 9:265–73.

6 Thiery JP. Epithelial-mesenchymal transitions in tumour progression. NatRev Cancer 2002; 2: 442–54.

7 Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroadsof development and tumor metastasis. Dev Cell 2008; 14: 818–29.

8 Cano A, Perez-Moreno MA, Rodrigo I et al. The transcription factor snailcontrols epithelial-mesenchymal transitions by repressing E-cadherin expres-sion. Nat Cell Biol 2000; 2: 76–83.

9 Bolos V, Peinado H, Perez-Moreno MA, Fraga MF, Esteller M, Cano A.The transcription factor Slug represses E-cadherin expression and inducesepithelial to mesenchymal transitions: a comparison with Snail and E47repressors. J Cell Sci 2003; 116: 499–511.

10 Yang J, Mani SA, Donaher JL et al. Twist, a master regulator of morpho-genesis, plays an essential role in tumor metastasis. Cell 2004; 117: 927–39.

11 van Zijl F, Zulehner G, Petz M et al. Epithelial-mesenchymal transition inhepatocellular carcinoma. Future Oncol 2009; 5: 1169–79.

12 Ogunwobi OO, Liu C. Hepatocyte growth factor upregulation promotes car-cinogenesis and epithelial-mesenchymal transition in hepatocellular carci-noma via Akt and COX-2 pathways. Clin Exp Metastasis 2011; 28: 721–31.

13 You H, Ding W, Dang H, Jiang Y, Rountree CB. c-Met represents a poten-tial therapeutic target for personalized treatment in hepatocellular carcinoma.Hepatology 2011; 54: 879–89.

14 Gotzmann J, Huber H, Thallinger C et al. Hepatocytes convert to a fibro-blastoid phenotype through the cooperation of TGF-beta1 and Ha-Ras: stepstowards invasiveness. J Cell Sci 2002; 115: 1189–202.

15 Ogunwobi OO, Wang T, Zhang L, Liu C. Cyclooxygenase-2 and Akt medi-ate multiple growth-factor-induced epithelial-mesenchymal transition inhuman hepatocellular carcinoma. J Gastroenterol Hepatol 2012; 27: 566–78.

16 Dooley S, Weng H, Mertens PR. Hypotheses on the role of transforminggrowth factor-beta in the onset and progression of hepatocellular carcinoma.Dig Dis 2009; 27: 93–101.

17 Maegdefrau U, Bosserhoff AK. BMP activated Smad signaling strongly pro-motes migration and invasion of hepatocellular carcinoma cells. Exp MolPathol 2012; 92: 74–81.

18 Qiu H, Yang B, Pei ZC, Zhang Z, Ding K. WSS25 inhibits growth of xeno-grafted hepatocellular cancer cells in nude mice by disrupting angiogenesisvia blocking bone morphogenetic protein (BMP) ⁄ Smad ⁄ Id1 signaling. J BiolChem 2010; 285: 32–638.

19 Maegdefrau U, Amann T, Winklmeier A et al. Bone morphogenetic protein4 is induced in hepatocellular carcinoma by hypoxia and promotes tumourprogression. J Pathol 2009; 218: 520–9.

20 Guo X, Xiong L, Zou L, Zhao J. Upregulation of bone morphogenetic pro-tein 4 is associated with poor prognosis in patients with hepatocellular carci-noma. Pathol Oncol Res 2012; 7: 44.

21 Celeste AJS, Cox K, Rosen V, Wozney JM. Bone morphogenetic protein-9,a new member of the TGF-b superfamily. J Bone Miner Res 1994; 9: 136.

22 Luo J, Tang M, Huang J et al. TGFbeta ⁄BMP type I receptors ALK1 andALK2 are essential for BMP9-induced osteogenic signaling in mesenchymalstem cells. J Biol Chem 2010; 285: 29.

23 Miyazono K, Kamiya Y, Morikawa M. Bone morphogenetic protein recep-tors and signal transduction. J Biochem 2010; 147: 35–51.

24 Chen C, Grzegorzewski KJ, Barash S et al. An integrated functional genom-ics screening program reveals a role for BMP-9 in glucose homeostasis. NatBiotechnol 2003; 21: 294–301.

25 Truksa J, Peng H, Lee P, Beutler E. Bone morphogenetic proteins 2, 4, and9 stimulate murine hepcidin 1 expression independently of Hfe, transferrinreceptor 2 (Tfr2), and IL-6. Proc Natl Acad Sci U S A 2006; 103: 10289–93.

26 Bessa PC, Cerqueira MT, Rada T et al. Expression, purification and osteo-genic bioactivity of recombinant human BMP-4, -9, -10, -11 and -14. Pro-tein Expr Purif 2009; 63: 89–94.

27 Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9induces proliferation of multiple types of endothelial cells in vitro and invivo. J Cell Sci 2010; 123: 1684–92.

28 Herrera B, van Dinther M, Ten Dijke P, Inman GJ. Autocrine bone morpho-genetic protein-9 signals through activin receptor-like kinase-2 ⁄ Smad1 ⁄Smad4 to promote ovarian cancer cell proliferation. Cancer Res 2009; 69:9254–62.

29 Ye L, Kynaston H, Jiang WG. Bone morphogenetic protein-9 induces apop-tosis in prostate cancer cells, the role of prostate apoptosis response-4. MolCancer Res 2008; 6: 1594–606.

30 Sobin LH WC. TNM classification of malignant tumors, 6th edn. Hoboken,New Jersey: John Wiley & Sons, 2002.

31 Ghafoory S, Breitkopf-Heinlein K, Li Q et al. A fast and efficient polymer-ase chain reaction-based method for the preparation of in situ hybridizationprobes. Histopathology 2012; 61: 306–13.

32 Aden DP, Fogel A, Plotkin S, Damjanov I, Knowles BB. Controlled synthe-sis of HBsAg in a differentiated human liver carcinoma-derived cell line.Nature 1979; 282: 615–6.

33 Dor I, Namba M, Sato J. Establishment and some biological characteristicsof human hepatoma cell lines. Gann 1975; 66: 385–92.

34 Murakami H, Sanderson ND, Nagy P, Marino PA, Merlino G, ThorgeirssonSS. Transgenic mouse model for synergistic effects of nuclear oncogenesand growth factors in tumorigenesis: interaction of c-myc and transforminggrowth factor a in hepatic oncogenesis. Cancer Res 1993; 53: 1719–23.

35 Xu T, Yu CY, Sun JJ et al. Bone morphogenetic protein-4-induced epithe-lial-mesenchymal transition and invasiveness through Smad1-mediated signalpathway in squamous cell carcinoma of the head and neck. Arch Med Res2011; 42: 128–37.

36 Miller AF, Harvey SA, Thies RS, Olson MS. Bone morphogenetic protein-9. An autocrine ⁄ paracrine cytokine in the liver. J Biol Chem 2000; 275:17937–45.

37 Bidart M, Ricard N, Levet S et al. BMP9 is produced by hepatocytes andcirculates mainly in an active mature form complexed to its prodomain. CellMol Life Sci 2012; 69: 313–24.

38 Caperuto LC, Anhe GF, Cambiaghi TD et al. Modulation of bone morpho-genetic protein-9 expression and processing by insulin, glucose, and gluco-corticoids: possible candidate for hepatic insulin-sensitizing substance.Endocrinology 2008; 149: 6326–35.

39 Truksa J, Peng H, Lee P, Beutler E. Different regulatory elements arerequired for response of hepcidin to interleukin-6 and bone morphogeneticproteins 4 and 9. Br J Haematol 2007; 139: 138–47.

40 Song JJ, Celeste AJ, Kong FM, Jirtle RL, Rosen V, Thies RS. Bonemorphogenetic protein-9 binds to liver cells and stimulates proliferation.Endocrinology 1995; 136: 4293–7.

41 Wen XZ, Miyake S, Akiyama Y, Yuasa Y. BMP-2 modulates the prolifera-tion and differentiation of normal and cancerous gastric cells. Biochem Bio-phys Res Commun 2004; 316: 100–6.

42 Langenfeld EM, Kong Y, Langenfeld J. Bone morphogenetic protein 2 stim-ulation of tumor growth involves the activation of Smad-1 ⁄ 5. Oncogene2006; 25: 685–92.

43 Lu JW, Hsia Y, Yang WY et al. Identification of the common regulators forhepatocellular carcinoma induced by hepatitis B virus X antigen in a mousemodel. Carcinogenesis 2012; 33: 209–19.

44 Chiu CY, Kuo KK, Kuo TL, Lee KT, Cheng KH. The activation of MEK⁄ ERK signaling pathway by bone morphogenetic protein 4 to increase hepa-tocellular carcinoma cell proliferation and migration. Mol Cancer Res 2012;10: 415–27.

45 Wang K, Feng H, Ren W et al. BMP9 inhibits the proliferation and inva-siveness of breast cancer cells MDA-MB-231. J Cancer Res Clin Oncol2011; 137: 1687–96.

46 Kemler R. From cadherins to catenins: cytoplasmic protein interactions andregulation of cell adhesion. Trends Genet 1993; 9: 317–21.

47 Bakkebo M, Huse K, Hilden VI, Smeland EB, Oksvold MP. TGF-beta-induced growth inhibition in B-cell lymphoma correlates with Smad1 ⁄ 5signalling and constitutively active p38 MAPK. BMC Immunol 2010; 11:57.

48 Pouliot F, Labrie C. Role of Smad1 and Smad4 proteins in the induction ofp21WAF1, Cip1 during bone morphogenetic protein-induced growth arrestin human breast cancer cells. J Endocrinol 2002; 172: 187–98.

49 Katsuno Y, Hanyu A, Kanda H et al. Bone morphogenetic protein signalingenhances invasion and bone metastasis of breast cancer cells through Smadpathway. Oncogene 2008; 27: 6322–33.

50 Gordon KJ, Kirkbride KC, How T, Blobe GC. Bone morphogenetic proteinsinduce pancreatic cancer cell invasiveness through a Smad1-dependentmechanism that involves matrix metalloproteinase-2. Carcinogenesis 2009;30: 238–48.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Table S1. Evaluation of fibrosis in the samples of tumor-adjacent tissues based on H&E stainings.


bone morphogenetic protein-9 induces epithelial to mesenchymal transition in hepatocellular...

Documents