blimp-1/prdm1 alternative promoter usage during mouse

MOLECULAR AND CELLULAR BIOLOGY, Nov. 2009, p. 5813–5827 Vol. 29, No. 210270-7306/09/$12.00 doi:10.1128/MCB.00670-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Blimp-1/Prdm1 Alternative Promoter Usage during MouseDevelopment and Plasma Cell Differentiation�

Marc A. J. Morgan,1 Erna Magnusdottir,2 Tracy C. Kuo,2 Chai Tunyaplin,2 James Harper,1Sebastian J. Arnold,1 Kathryn Calame,2 Elizabeth J. Robertson,1 and Elizabeth K. Bikoff1*

Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, United Kingdom,1 andDepartment of Microbiology, Columbia University College of Physicians and Surgeons, New York, New York 100322

Received 23 May 2009/Returned for modification 11 July 2009/Accepted 22 August 2009

The zinc-finger PR domain transcriptional repressor Blimp-1/Prdm1 plays essential roles in primordial germcell specification, placental, heart, and forelimb development, plasma cell differentiation, and T-cell homeosta-sis. The present experiments demonstrate that the mouse Prdm1 gene has three alternative promoter regions.All three alternative first exons splice directly to exon 3, containing the translational start codon. To examinepossible cell-type-specific functional activities in vivo, we generated targeted deletions that selectively eliminatetwo of these transcriptional start sites. Remarkably, mice lacking the previously described first exon developnormally and are fertile. However, this region contains NF-�B binding sites, and as shown here, NF-�Bsignaling is required for Prdm1 induction. Thus, mutant B cells fail to express Prdm1 in response to lipopoly-saccharide stimulation and lack the ability to become antibody-secreting cells. An alternative distal promoterlocated �70 kb upstream, giving rise to transcripts strongly expressed in the yolk sac, is dispensable. Thus, thedeletion of exon 1B has no noticeable effect on expression levels in the embryo or adult tissues. Collectively,these experiments provide insight into the organization of the Prdm1 gene and demonstrate that NF-�B is akey mediator of Prdm1 expression.

The PR/SET domain zinc-finger transcriptional repressorBlimp-1/Prdm1 was initially cloned as a negative regulator ofIFNB1 (beta interferon) expression (30) and later identified asa factor both necessary and sufficient for B-cell terminal dif-ferentiation and antibody secretion (74, 79). Blimp-1, the pro-tein encoded by Prdm1, silences expression of key transcriptionfactors, such as c-Myc, required for cell cycle progression (43),as well as Pax5, Id3, and Spi-B, which maintain mature B-cellidentity (41, 71). Prdm1 inactivation in the T-cell lineage re-sults in fatal inflammatory bowel disease associated with re-duced interleukin 10 and upregulated expression of interleukin2 and gamma interferon (28, 49). In the skin, Prdm1 is requiredfor sebaceous gland homeostasis (22) and epidermal terminaldifferentiation (48). Prdm1 has a dynamic pattern of expressionin the developing mouse embryo (10, 60, 67, 81). Loss-of-function mutant embryos fail to specify primordial germ cells,display pharyngeal arch defects, and die around embryonic day10.5 (E10.5) due to placental insufficiency (60, 81). Conditionalrescue experiments have revealed additional roles in multipo-tent progenitor cell populations in the forelimb, secondaryheart field, and sensory vibrissae (67). Thus, Prdm1 regulatescell fate decisions in diverse contexts in the embryo and gov-erns tissue homeostasis in multiple cell types in the adult or-ganism.

The cis-acting regulatory elements that direct tissue-spe-cific Prdm1 expression in these specialized cell types arelargely unknown. A Venus fluorescent reporter transgene

embedded within a 230-kb bacterial artificial chromosome(kb �140 to �90 relative to the transcription start site)faithfully drives temporally and spatially restricted expres-sion at numerous sites in the embryo, including primordialgerm cells, anterior definitive endoderm, somites, pharyn-geal arches, limb buds, and dermal papillae (60, 61). Incontrast, an enhanced green fluorescent protein reporterconstruct containing 4.4 kb upstream of the Prdm1 tran-scription start site is sufficient for expression in adult hema-topoietic tissues and mediates lipopolysaccharide (LPS) re-sponsiveness of splenic B cells (83). However, this constructalso leads to ectopic expression at numerous tissue sites.The cis-acting regulatory elements controlling dynamic pat-terns of Prdm1 expression in vivo thus potentially span alarge genomic region. Dose-dependent BMP-Smad signalsactivate Prdm1 expression in committed primordial germcells when they initially appear at the base of the allantois(60). However, it remains unknown whether Prdm1 is adirect Smad target. A recent study identified a Gli3 bindingsite �27 kb downstream of the Prdm1 coding region thatdrives expression in the developing limb (82). Similarly,studies of zebra fish have shown that Sonic Hedgehog con-trols Prdm1 expression during pectoral fin and muscle de-velopment (5, 40). However, multipotent progenitor cellpopulations allocated at numerous tissue sites expressPrdm1 only transiently (67). Multiple, as yet uncharacter-ized enhancer and repressor elements are almost certainlyrequired to regulate graded Prdm1 activities throughout de-velopment.

Alternative promoter usage offers an attractive mechanismfor regulating Prdm1 gene expression. Two alternative promot-ers control spatially and temporally distinct blimp1/krox expres-sion patterns during sea urchin development (44, 45). These

* Corresponding author. Mailing address: University of Oxford, SirWilliam Dunn School of Pathology, South Parks Road, Oxford OX13RE, United Kingdom. Phone: 0044 1865 285649. Fax: 44-1865-285492. E-mail: [email protected].

� Published ahead of print on 8 September 2009.

5813

on March 23, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

alternative transcripts encode nearly identical proteins exceptthat the 1b isoform contains 50 additional residues at its aminoterminus. Specific morpholino knockdown of the 1a and 1btranscripts results in tissue-specific disturbances in the gutendoderm and vegetal plate, respectively (44). The activity ofan alternative promoter region located 5� of PRDM1 exon 4that generates a protein lacking the PR/SET domain with re-duced repressive activity on multiple target genes is elevated inhuman myeloma lines relative to levels in primary B cells (21).

The Prdm1 basal promoter and multiple transcriptionalstart sites were previously mapped immediately upstream ofexon 1 (78). To learn more about developmentally regulatedexpression, we characterized the 5� ends of Prdm1 tran-scripts in the developing embryo. We identified two novelalternative first exons that both splice directly to exon 3,containing the translational start site. Exon 1B, located 70kb upstream of exon 1A, is strongly expressed in the yolksac. An additional first exon (exon 1C) is located in theintron downstream of exon 1A. To evaluate the possiblydistinct functional activities contributed by alternative pro-moters, we generated targeted alleles that selectively elim-inate either exon 1A (�ex1A) or exon 1B (�ex1B) tran-scripts. The exon 1B deletion slightly decreases expressionin the yolk sac but otherwise has no noticeable effect in theembryo or adult tissues. Surprisingly, the exon 1A deletionencompassing NF-�B sites upstream of the promoter elim-inates Prdm1 expression in LPS-stimulated B cells andblocks plasma cell differentiation but fails to disrupt embry-onic development. Consistent with this, we observe onlymodestly reduced Prdm1 expression levels in the embryo.However, compound heterozygotes also carrying the nullallele display partially penetrant developmental defects. Thenovel alternative promoters described in this report arelikely to play important roles in generating regulatory diver-sity and controlling gene dosage effects.

MATERIALS AND METHODS

Gene targeting. The �ex1A targeting vector was generated by ligating a 2.9-kb5� homology region (StuI-PstI), a loxP-flanked pgk-neomycin cassette fromPGKneolox2DTA (76), and a 4.7-kb 3� homology region (AfeI-EcoRV) into amodified version of pBSII-KS(�) (Stratagene). An hsv-thymidine kinase (hsv-tk)cassette was inserted outside the 3� homology region. The �ex1B targeting vectorwas generated by ligating a 12.2-kb Acc65I-NdeI fragment from the bMQ-381N6bacterial artificial chromosome (Geneservice, Cambridge, United Kingdom) intoa modified version of pBSIIKS(�) (Stratagene). The loxP-flanked pgk-neomycincassette was introduced at XhoI and SpeI sites, and the hsv-tk cassette wasligated outside of the 3� homology region. Gene targeting was carried out in CCEembryonic stem (ES) cells. A linearized targeting vector (15 �g) was introducedby electroporation. Homologous recombinant clones were selected in the pres-ence of G418 (200 �g/ml) and 1-[2�-deoxy-2�-fluoro-�-D-arabinofuranosyl]-5-iodouracil (0.1 �g/ml). Drug-resistant colonies were screened by Southern blotanalysis using the restriction enzyme and probe combinations shown in Fig. 2.For the �ex1A allele, we recovered 28 correctly targeted clones out of �860drug-resistant colonies, and in the case of the �ex1B allele, 16 correctly targetedclones out of �1,150 colonies. Targeted clones were transiently transfected withpMC1Cre and screened for excision of the loxP-flanked pgk-neomycin cassette bySouthern blotting.

PCR genotyping. DNA was prepared as described previously (53). The followingprimers and conditions were used for the �ex1A allele: common primer, GCCAGACCCTGAGATGACTACATTG; wild-type primer, CACAGCAAAACAAAAGCCCAAC; mutant primer, CGAAGCGGACAAGAACCACTACTG; 54°C an-nealing temperature, 40 cycles; for �ex1B, wild-type primer 1, TTGAGGTTCACGCACGAATG; wild-type primer 2, GACTTTTGCTTGCTATGCCCTG; mutantprimer 1, CCTAAAAAGGTGCGAGTAAGGTGAG; mutant primer 2, TACAT

CCCCAGCCCAGAGGTTG; 58°C annealing temperature, 40 cycles. Prdm1BEH

(81), Prdm1null (74), and Prdm1gfp (27) mice were genotyped as described previously.RNA analysis. 5� random amplification of cDNA ends (RACE) cloning was

performed using the second-generation 5�/3� RACE kit (03 353 621 001; Roche)with slight modifications. Two micrograms of total RNA was reverse transcribedusing a primer annealing in exon 4 (Ex4Rev: CTCCTTACTTACCACGCCAA).First-strand cDNA was purified (11 732 668 001; High Pure PCR product puri-fication kit; Roche), dA-tailed, and PCR amplified (Platinum Pfx polymerase;11708; Invitrogen) using a nested primer in exon 3 (Ex3Rev1, GTGCTCGAGCGTCAGCGCCGGAATCCCAGG) and the oligo(dT)-anchor primer (GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV). The XhoI and SalIcloning sites are underlined. An annealing temperature of 55°C was used for Pfxamplification. Subsequently, 0.5 �l of the reaction mixture was used as a templatefor a second round of amplification (ReddyMix PCR Mastermix; AB-0575/LD;Thermo Scientific) using Ex3Rev1 and the oligo(dT)-anchor primer (60°C an-nealing temperature). Products were gel purified (Qiaex II kit; 20051; Qiagen),digested with XhoI and SalI, cloned into pBSII-KS(�) (Stratagene), and se-quenced (Geneservice). In some cases, where the second round of amplificationfailed to yield discrete products, the Pfx reaction mixture was instead amplifiedusing ReddyMix PCR Mastermix with a nested primer (Ex3Rev2: CTGCCAGTCCTTGAAACTTC) in combination with the oligo(dT)-anchor primer. In thiscase, PCR products were gel purified and cloned directly into pCR-XL-TOPO(Invitrogen). Sequences were aligned to the mouse genome using the BLATfunction of the University of California, Santa Cruz (UCSC), genome browser(31, 37).

The pCAGGS-Blimp-1 expression vector (67) was transiently transfectedinto COS-7 and HEK293 cells using Lipofectamine 2000 (Invitrogen) accord-ing to the manufacturer’s instructions. Total RNA was isolated using Trizol(Invitrogen), and reverse transcription-PCR (RT-PCR) was performed us-ing the OneStep RT-PCR kit (Qiagen). Primers were as follows: exon 1Aforward (Ex1AFor), CGTAGAAAAGGAGGGACCGCC; exon 1B forward(Ex1BFor), GTTTGCATTCACCGAAGTTGC; exon 1C forward (Ex1CFor),CCGGGACACAGGACGCAG; exon 3 reverse no. 1 (Ex3Rev1), CGTCAGCGCCGGAATCCCAGG; exon 3 reverse no. 2 (Ex3Rev2), CTGCCAGTCCTTGAAACTTC; Hprt forward (HprtFor), GCTGGTGAAAAGGACCTCT;Hprt reverse (HprtRev), CACAGGACTAGAACACCTGC.

An RNase protection assay (RPA) was carried out using the RPAIII kit(AM1415; Ambion) as described previously (2). Sizes of the probes and pro-tected fragments are summarized in Table 1. Band intensities were normalized tothe Sp1 signal. Each percentage represents the average for two independentnormalized mutant samples in comparison with the average for two independentnormalized wild-type control littermate samples.

T-cell, B-cell, and bone marrow dendritic cell (BMDC) cultures. Age-matchedand whenever possible sex-matched homozygous mutant and wild-type controllittermates derived from intercross matings were sacrificed at 6 to 8 weeks of age.Spleen cell suspensions were depleted of erythrocytes by ammonium chloride-Tris treatment. To induce plasma cell differentiation, splenocytes (2.5 106

cells/ml) were cultured for 3 days in the presence of LPS (50 �g/ml) (Escherichiacoli 055:B5; Difco Laboratories). Alternatively, for T-cell activation, the B cellswere depleted using anti-CD45R (B220) magnetic microbeads (495-01; MiltenyiBiotec) according to the manufacturer’s instructions. The nonadherent cells werecultured at a density of 5 105 cells/ml for 3 days on anti-mouse T-cell receptor�-chain (553166; BD Biosciences)-coated dishes.

BMDCs were isolated as described previously (24). Cultures were initiallyplated at 4 105 cells/ml in the presence of granulocyte/macrophage-colonystimulating factor (25 ng/ml) (415-ML; R&D Systems), fed on day 3 and day 6,

TABLE 1. RPA probesa

Probe Size (nt) Protected fragment(s)a

Exons 1A-3 401 280 nt � 170 nt (exon 3)Exons 1B-3 #1 310 223 nt � 89 nt (exon 3)Exons 1B-3 #2 386 265 nt � 170 nt (exon 3)Exons 1C-3 449 328 nt � 170 nt (exon 3)1C intron-3 410 315 nt � 170 nt (exon 3)Exons 4-5 456 369 ntExon 6 305 251 ntSp1 270 220 nt

a nt, nucleotides.

5814 MORGAN ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

and harvested on day 7. Where indicated, dendritic cell maturation was inducedduring the last 20 h of culture by the addition of LPS (20 �g/ml).

Immunoblotting. Cells were lysed in radioimmunoprecipitation assay bufferplus protease inhibitors and extracts prepared as described previously (67).Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteinswere transferred onto a polyvinylidene difluoride membrane (Millipore) at 300 Vfor 2 h. Membranes were blocked for 1 h at room temperature in Tris-bufferedsaline–Tween containing 7% nonfat dry milk and incubated in primary anti-Blimp-1 (1:500, rat monoclonal 5E7) (27) antibody overnight at 4°C or in primaryanti-ß-tubulin (1:1,000, rabbit polyclonal, sc-9104; Santa Cruz) or anti-mouseimmunoglobulin (Ig) (H�L)-horseradish peroxidase (HRP) (1:500; NA931V;GE Healthcare) for 1 h at room temperature. Anti-rat Ig-HRP (1:1,000;NA935V; GE Healthcare) and anti-rabbit Ig (1:2,000; NA934V; GE Healthcare)secondary antibody incubations were for 1 h at room temperature. Bands werequantified using a ChemiDoc XRS imager (Bio-Rad) and the QuantityOnesoftware program (Bio-Rad) and normalized to ß-tubulin.

Histology. E9.5 placentae were fixed overnight in 4% paraformaldehyde, de-hydrated in ethanol, embedded, and sectioned at 6 �m. Sections were boiled for20 min in antigen retrieval solution (Dako), blocked for 5 min in peroxidasequenching buffer (K4011; Dako), incubated in anti-Blimp-1 (1:1,000, rabbit poly-clonal) (22) at 4°C overnight, washed in phosphate-buffered saline, developedusing 3,3�-diaminobenzidine and the Dako peroxidase-labeled polymer kit, andthen counterstained with hematoxylin. Visualization of primordial germ cells bystaining for alkaline phosphatase activity was performed as described previously(39). For IgA staining, sections of intestine were submerged in optimal-cutting-temperature freezing compound and frozen in a dry-ice isopentane bath. Blockswere cryosectioned at 6 �m and stained with goat anti-mouse IgA-HRP (1:200;1040-05; Southern Biotech).

Testes and ovaries were fixed overnight in Bouin’s fixative, dehydrated inethanol, embedded in paraffin wax, sectioned at 8 �m, and stained with hema-toxylin and eosin. For skeletal staining, limbs were skinned, fixed in 95% ethanol,stained with alcian blue, cleared with 1% potassium hydroxide, stained withalizarin red, cleared again in 1% potassium hydroxide, and equilibrated in 100%glycerol as described previously (53).

Virus infection, NF-�B inhibitors, and quantitative RT-PCR. Wild-type andp50/p65 doubly deficient 3T3 fibroblasts (63) were maintained in Dulbecco’smodified Eagle medium with 10% fetal bovine serum and gentamicin (10 �g/ml).Cells were split the day before infection, cultured overnight to achieve 90%confluence, and rinsed twice with phosphate-buffered saline before addition ofserum-free Dulbecco’s modified Eagle medium. Following a 2-h incubation withSendai virus (ATCC, Rockville, MD) at a multiplicity of infection of 2, mediumwas aspirated and cells were cultured with complete medium and at the appro-priate times postinfection directly lysed in Trizol (Invitrogen, Carlsbad, CA).M12 B cells (32) were cultured in RPMI 1640 with 10% fetal bovine serum,gentamicin (10 �g/ml), and where appropriate LPS (2.5 �g/ml). The NF-�Binhibitor helenalin (10 �M; Biomol, Plymouth Meeting, PA) or BMS341380(30 uM) (Bristol-Myers Squibb, Princeton, NJ) was added for 1 h. RNA wasisolated using TRIzol reagent (Life Technologies), and cDNA was preparedusing SuperScript III reverse transcriptase (Invitrogen) according to the manu-facturer’s protocol.

Quantitative PCR was performed using an ABI 7700 instrument (AppliedBiosystems). Concentrations for stock reagents are as follows: 1 PCR buffer,200 mM deoxynucleoside triphosphate, 0.4 SYBR green (Sigma), 150 nM6-carboxy-x-rhodamine (Sigma), 1% dimethyl sulfoxide, and 1.25 U Taq poly-merase. Conditions and primer concentrations used were as follows: mousePrdm1, 500 nM 5�-GACGGGGGTACTTCTGTTCA-3� and 50 nM 5�-GGCATTCTTGGGAACTGTGT-3�; 2.5 mM MgCl2; mouse beta-2-microglobulin, 300nM 5�-AGACTGATACATACGCCTGCAG-3� and 50 nM 5�-GCAGGTTCAAATGAATCTTCAG-3�. The amplification program for beta-2-microglobulin wasas follows: 95°C for 5 min, 95°C for 20 s, 59°C for 1 min, and 82 to 84°C for 20s(collect data) for 40 cycles; melting curve, 95°C for 20 s, 59°C for 15 s, and up to95°C for 20 s with a 19-min ramping time. For mouse Prdm1, the amplificationstep was as follows: 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s (collect data)for 40 cycles.

ChIP. Chromatin immunoprecipitation (ChIP) quantified by semiquantitativePCR and Southern blotting was performed as described previously (25) usinganti-p65 (sc-372; SantaCruz Biotechnology, Santa Cruz, CA). The PCR primerswere designed to amplify the following regions: the potential NF-�B binding sitelocated at �94 to �85 relative to the transcriptional start site of Prdm1 exon 1apromoter. The Ig� intronic enhancer encompasses the previously describedNF-�B binding site (72). The Bcl-6 binding site within intron 5 of mouse Prdm1(77) was amplified as a negative control. Quantitative PCR was performed as

previously described (48) with FastStart SYBR green master mix (Roche) on aStratagene MX3000 real-time PCR system.

RESULTS

A distal alternative promoter and first exon is located 70 kbupstream of exon 1A. The TATA-less GC-rich promoter re-gion upstream of exon 1A contains multiple transcription ini-tiation sites (51, 78). Early experiments suggested that thein-frame translational start site present in mouse exon 1Atogether with exon 2 encodes an N-terminal extension (78, 79).However, exon 2 sequences are not found in human PRDM1transcripts (23, 30, 78). We also noticed that exon 2 is notpresent in several mouse GenBank clones that splice directlyfrom exon 1A to exon 3. To further characterize Prdm1 tran-scripts expressed during mouse development, we performed 5�RACE and sequenced the products recovered from E9.5 em-bryos and yolk sacs. Interestingly, the majority of clones (sevenof nine) isolated from yolk sacs contain an alternative first exon(exon 1B) located approximately 70 kb upstream of exon 1A(Fig. 1A to C). Consistent with this observation, RPA experi-ments demonstrate that exon 1B transcripts are selectivelyexpressed in the yolk sac and barely detectable in the embryo(Fig. 1E). We found a single GenBank Prdm1 clone (accessionno. AK077622) derived from E8.0-stage embryos that containsexon 1B spliced to exon 3 (29). Moreover, cap analysis geneexpression (CAGE) tags indicative of transcription start sites(35, 75) have been mapped to the region immediately up-stream of exon 1B (Fig. 1D). Additionally, recent reports de-scribe bivalent chromatin domains containing both transcrip-tionally active (H3K4 trimethyl) and repressed (H3K27trimethyl) histone modifications at promoters of developmen-tally regulated genes (3, 6). We used the UCSC genomebrowser (37) together with ChIP-sequencing data (36, 50)(http://www.broad.mit.edu/node/681) to visualize histone mod-ifications across the Prdm1 locus. Interestingly, exon 1B isbivalent in both human and mouse ES cells (Fig. 1F).

Neither exon 1A nor exon 1B 5� RACE clones contain exon2 sequences. Rather, both exons splice directly to exon 3. Tofurther investigate exon 2 expression, we performed RT-PCRanalysis using primers anchored in exon 1A and exon 3. Wescreened a panel of tissues and cell lines including the BCL1cell line originally used for cloning Prdm1 (79). As expected,exon 2 expression is detectable in cells transfected with thefull-length cDNA containing exon 2 (79). However, endoge-nous transcripts exclusively contain exon 1A sequences joineddirectly to exon 3 (Fig. 1G). Four GenBank expressed se-quence tag (EST) clones contain exon 1A spliced to exon 3(accession no. AK133503, AK149344, BC129801, andCX733088), whereas exon 2 is present only in the originalPrdm1 clone (accession no. U08185) (79).

Targeted deletion of Prdm1 alternative promoters has noeffect on embryonic development. One possibility is that alter-native promoters govern cell-type-specific patterns of Prdm1expression. Selective loss of alternative transcripts could po-tentially cause tissue-specific developmental defects. To testthis possibility, we engineered targeted deletions designed tospecifically eliminate either exon 1A or 1B transcripts (Fig. 2).The exon 1A deletion (�ex1A) removes 2.18 kb (UCSC ge-nome browser coordinates, chromosome 10: 44,178,130 to

VOL. 29, 2009 Blimp-1 ALTERNATIVE PROMOTERS 5815


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

FIG. 1. An alternative first exon located 70 kb upstream of the previously characterized transcription initiation site drives Prdm1 expression inthe yolk sac. (A) Schematic of Prdm1 alternative promoters. Exons 1 to 3 are depicted as black boxes, with exons 4 to 8 (gray box) shown in acondensed format. Black arrows indicate transcription start sites. The alternative first exon, exon 1B, located approximately 70 kb upstream, andthe previously characterized exon 1A both splice directly to exon 3. (B) Summary of 5� RACE clones recovered from E9.5 embryo and yolk sacRNA. (C) Sequence of a representative clone containing exon 1B (underlined in black) spliced to exon 3 (underlined in gray). The black verticalarrow indicates the splice junction. The PCR primer annealing site is underlined in red. In-frame AUG codons in exon 3 are underlined in green.(D) Exon 1B clones were aligned to the mouse genome using the UCSC genome browser (31, 37). The CAGE tags (35, 75) are shown as blackbars with white chevrons. The splice junctions align precisely to GenBank clone AK077622. (E) RPA analysis. The full-length protected fragmentcorresponds to exon 1B spliced to exon 3. The lower band corresponds to exon 3 alone due to expression of alternative exon 1A spliced to exon3 transcripts. The exon 1B-3 probe #1 detects expression specifically in the E9.5 yolk sac. (F) ChIP-seq data (36, 50) demonstrate that exon 1Bis bivalent in both mouse and human ES cells. The positions of histone H3K4me3 (green) and H3K27me3 (red) enrichment are shown in relationto exon 1B and the clone AK077622. (G) RT-PCR analysis. HEK293 and COS-7 cells transfected with a pCAGGS (56) expression vectorcontaining the full-length Prdm1 cDNA (79) (lanes 3 and 5) are analyzed. The expression plasmid (pCAGGS-Blimp-1) and a cDNA containingexon 1A spliced to exon 3 (accession no. CX733088) also serve as controls (lanes 9 and 10). The primers Ex1AFor and Ex3Rev2 exclusively detecta product corresponding to exon 1A spliced to exon 3 expressed by J558L, BCL1 lymphoma cells induced to secrete Ig, and LPS-stimulated BALB/csplenocytes (lanes 1, 7, and 8).

5816


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

44,180,309; July 2007 assembly, mm9) encompassing roughly�1.8 kb to �380 bp, including the basal promoter and tran-scriptional start sites (78) (Fig. 2A). To ensure efficient splicingof exon 1B to exon 3, sequences 3� to exon 1A were left largelyintact (�150 bp was removed). The exon 1B deletion (�ex1B)

removes 3.9 kb (chromosome 10: 44,247,021 to 44,250,926),approximately �2.6 kb to �1.3 kb relative to the transcrip-tional start site on clone AK077622 (Fig. 2D).

Because Blimp-1 requirements in the embryo are exquisitelydose dependent (60, 67, 81), we expected that the �ex1A or

FIG. 2. Prdm1 alternative promoter deletion alleles. (A) Schematic representation of the wild-type locus, targeting vector, �ex1A mutant allele,and Southern blot screening probes. A, AfeI; RI, EcoRI; RV, EcoRV; P, PstI; Sp, SphI; St, StuI. (B) Southern blot analysis of representativedrug-resistant colonies. The positions of diagnostic wild-type (8.4-kb) and targeted (5.4-kb) fragments are shown. (C) PCR genotyping screen.Primers specific for the wild-type (blue arrow) and mutant (red arrow) alleles and a common primer (black arrow) generate a 550-bp wild-typeand 310-bp mutant product as shown. (D) Schematic of the wild-type locus, targeting vector, �ex1B mutant allele, and Southern blot screeningprobes. A65I, Acc65I; B, BamHI; N, NdeI; P, PstI; S, SpeI; X, XhoI. (E) Southern blot analysis of representative drug-resistant colonies. Thepositions of diagnostic wild-type (16.5-kb) and targeted (6.7-kb) fragments are shown. (F) PCR genotyping screen. The four primers (wild type,blue arrows; mutant, red arrows) produce a 278-bp wild-type and 340-bp mutant product as shown.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

�ex1B deletion alleles would cause germ cell defects or em-bryonic lethality or perturb other Blimp-1-dependent develop-mental processes, such as forelimb and heart development.Remarkably, both Prdm1�ex1A/�ex1A and Prdm1�ex1B/�ex1B ho-mozygous mutants (hereafter referred to as �ex1A and �ex1Bmice) were recovered at Mendelian ratios from heterozygousintercross matings (Table 2). Adult homozygous mutants failedto display any gross abnormalities. Moreover, these mice arefertile and can be maintained as homozygous mutant breedingpairs.

To confirm the �ex1A and �ex1B targeted deletions selec-tively eliminate mRNA expression of the alternative tran-scripts as predicted, we analyzed E9.5 embryo and yolk sacmRNA by RT-PCR (Fig. 3A). As expected, the �ex1A mutantsentirely lack exon 1A but express exon 1B transcripts. Con-versely, �ex1B mutants express exon 1A transcripts but lackexon 1B mRNA. Thus, our targeting strategies selectively elim-inate expression of the alternative transcripts as intended.

As shown in Fig. 3, RPA experiments demonstrated that the�ex1A and �ex1B deletion alleles modestly reduce total Prdm1expression levels in the embryo and yolk sac, respectively.Thus, in �ex1A embryos, total Prdm1 mRNA levels detectablewith the exon 4-5 probe are reduced by approximately 50%(Fig. 3B). Similarly, in �ex1B yolk sac samples, alternative exon1A transcripts are slightly upregulated, but total Prdm1 levelsare reduced by approximately 60% (Fig. 3C).

Next, we examined Blimp-1 protein expression via Westernblot analysis. At E9.5, Blimp-1 expression by �ex1B mice isindistinguishable from wild-type expression whereas �ex1Aembryos contain slightly reduced levels of total Blimp-1 pro-tein (Fig. 3D). However, alkaline phosphatase staining re-vealed only a slight decrease in the numbers of primordialgerm cells (Fig. 3F). Similarly, we observed normal patterns ofBlimp-1 expression in �ex1A E9.5 placentae (Fig. 3E). In com-parison, Prdm1�/� heterozygous embryos express reduced lev-els of the Blimp-1 protein (Fig. 3D) and have roughly half thenormal number of migrating primordial germ cells at the earlyheadfold stage but otherwise fail to exhibit any detectabledevelopmental abnormalities (60, 81).

Gene dosage effects in ex1A/null compound heterozygotes.To explore possible gene dosage effects, we crossed �ex1A and�ex1B homozygous mutants with Prdm1�/null mice (74). Wereasoned that further reducing Blimp-1 expression levels incompound heterozygotes could potentially reveal developmen-tal defects. As expected, null/�ex1B compound heterozygoteswere born at Mendelian ratios (Table 2), exhibited no visibleabnormalities, and were fertile. In contrast, null/�ex1A animalswere underrepresented at weaning. Homozygous null embryosfail to survive beyond E10.5 (60, 81). The null/�ex1A embryos

were present at Mendelian ratios at E10.5 but underrepre-sented beginning at E14.5 (Table 3). We observed a spectrumof developmental abnormalities similar to those described pre-viously for Sox2-Cre rescued and Blimp-1gfp/gfp embryos (67).However, in contrast, here we recovered substantial numbersof live-born null/�ex1A animals. Interestingly, many of thesurviving compound heterozygotes displayed partially pene-trant phenotypic disturbances, including germ cell defects (12of 13 mice) in both males and females (Fig. 4C to E) and arudimentary or missing fifth digit of the forelimb (6 of 13 mice)(Fig. 4A and B).

�ex1A deletion selectively eliminates Prdm1 function inplasma cells. Mice lacking Prdm1 expression in B cells displaydefects in antibody production, but these mice are otherwisehealthy and fertile (26, 27, 74). In contrast, conditional loss inT cells results in diarrhea, weight loss, and fatal colitis (28, 49).Our �ex1A and �ex1B mice, maintained under specific-patho-gen-free conditions, fail to display any overt signs of disease.

To evaluate the possibility that alternative promoter usageregulates Prdm1 activities in B cells, we examined �ex1A and�ex1B spleen cells treated ex vivo under conditions that pro-mote terminal B-cell differentiation. Strikingly, RPA experi-ments demonstrate that LPS-treated �ex1B splenocytes areindistinguishable from wild-type controls whereas, in contrast,�ex1A mutants show a greater than 95% reduction in totalmRNA expression levels (Fig. 5A). The mutation results in aloss of exon 1A transcripts and also eliminates alternativetranscripts detectable with downstream probes spanning exons3, 4-5, and 6 (Fig. 5A). Blimp-1 protein levels were also dra-matically reduced (Fig. 5B). As predicted for loss of Prdm1function in B cells (26, 27, 74), �ex1A LPS-stimulated spleno-cytes also display defective (�90% reduced) secreted IgMproduction (Fig. 5C). The �ex1A deletion also results in mark-edly reduced levels of mucosal IgA expression on intestinalepithelial cells (Fig. 5D) (26). Thus, we conclude that the�ex1A deletion eliminates Prdm1 function in the B-cell lineage.

Next, we tested Prdm1 expression in T lymphocytes anddendritic cells. RPA experiments demonstrate that �ex1A mu-tant T cells lack exon 1A transcripts and express marginallyreduced levels of total Prdm1 mRNA (Fig. 6A). As shown inFig. 6B, Western blots similarly demonstrate protein expres-sion is downregulated in �ex1A mutant T cells. We also ob-serve reduced mRNA (Fig. 6C) and protein (Fig. 6D) expres-sion by �ex1A BMDCs. In contrast, �ex1B mutant B-, T-, anddendritic-cell populations lack exon 1B transcripts, but totalPrdm1 expression levels are indistinguishable from wild-typelevels (Fig. 5 and 6).

Alternative promoter and first exon located upstream ofexon 3 generates a novel transcript that contains intronicsequences. Results above demonstrate upregulated expressionof alternative transcripts in �ex1A embryos and �ex1B yolksacs (Fig. 3B and C). Similarly, �ex1A BMDCs also displayelevated expression of alternative exon 1B transcripts (Fig. 7Gand H). However, exon 3 expression detectable with an exon1B-3 probe was only marginally reduced in �ex1A embryos,suggesting that the Prdm1 gene has additional alternative tran-scriptional start sites (Fig. 7A). To examine this possibility, weperformed 5� RACE on E9.5 �ex1A mutant embryos. A novel5� exon (exon 1C), located in the intron between exon 1A andexon 3 approximately 1.2 kb downstream of exon 1A, was

TABLE 2. Genotypes of heterozygous intercross progeny

Intercross No. (%) of weanlings withgenotype Total

Prdm1�/�ex1A Prdml�/�ex1A �/� �/�ex1A �ex1A/�ex1A70 110 64 (26) 244

Prdml�/�ex1B Prdml�/�ex1B �/� �/�ex1B �ex1B/�ex1B28 50 26 (25) 104



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

cloned (Fig. 7B, E, and F). RT-PCR and RPA experimentsconfirmed that exon 1C transcripts are spliced to exon 3 (Fig.7C and G to K). We also detected 1C transcripts that retainintronic sequences (Fig. 7D). Exon 1C expression is not simplydue to aberrant activation of a cryptic promoter caused by the�ex1A deletion, because exon 1C transcripts are present inwild-type LPS-treated spleen cells, activated T cells, and em-bryonic tissues (Fig. 7C and D). Moreover, the region up-stream of exon 1C contains numerous CAGE tags (35, 75) andhas been identified as an ancient noncoding element conservedbetween human and elephant shark (80) (Fig. 7E).

NF-�B signaling selectively regulates exon 1A transcrip-tional start site. To learn more about the possible underlyingmechanism(s) responsible for selective loss of Prdm1 expres-sion caused by the exon 1A deletion in plasma cells, wesearched for candidate transcription factor binding sitesmapped within this 2.1-kb genomic region. Additionally, wecompared conserved binding motifs located near the alterna-tive upstream exon 1B, as well as those located close to thealternative exon 1C transcriptional start site. As shown in Fig.8A and B, the region surrounding exon 1B displays greaterdiversity than relatively well-conserved sequences located ad-

FIG. 3. Targeted deletion of alternative first exons 1A and 1B mar-ginally affects Prdm1 expression levels. (A) RT-PCR analysis. PrimersEx1AFor and Ex1BFor in combination with Ex3Rev1 demonstratethat �ex1A embryos (e) and yolk sacs (y) lack exon 1A transcripts butexpress exon 1B. Likewise, the �ex1B deletion results in selective lossof exon 1B transcripts. (B) RPA experiments using the exon 1A-3probe demonstrate loss of exon 1A transcripts in �ex1A mutant E9.5embryos, whereas total Prdm1 mRNA expression levels detected withthe exon 4-5 probe are moderately reduced. (C) RPA of E9.5 yolk sacRNA demonstrates a reduction in total Prdm1 transcripts in �ex1Byolk sac. (D) Western blot analysis demonstrates that Blimp-1 proteinexpression levels are marginally reduced in �ex1A/�ex1A E9.5 embryos(lane 5) but remain unchanged in �ex1B/�ex1B lysates (lane 8). Bandintensities were calculated as percentages of those for the wild-typecontrol littermates within each boxed set of samples. SNH fibroblastsare a control for background signal (lanes 1 and 12). The positions offull-length Blimp-1 (Blimp-1FL) and truncated Blimp-1 (Blimp-1T)produced by the Blimp-1gfp allele (67) are indicated. (E) Immunohis-tochemical analysis using a rabbit polyclonal antibody (22) demon-strates normal Blimp-1 expression in the spongiotrophoblast layer of�ex1A/�ex1A E9.5 mutant placentae. (F) Fast red alkaline phos-phatase staining of primordial germ cells in the dorsal hindgut at E9.5.�ex1A/�ex1A mice have slightly reduced numbers of primordial germcells relative to wild-type littermates.

TABLE 3. Genotypes of compound heterozygousintercross progeny

Intercross Age No. (%) of progeny withgenotype Total

Prdm1�ex1A/�ex1A �ex1A/� �ex1A/nullPrdml�/null E10.5 35 (54) 30 (46) 65

E14.5 24 (63) 14 (37)a 38Weanlings 58 (82) 13 (18) 71

�ex1B/� �ex1B/nullPrdml�ex1B/�ex1B

Prdml�/nullWeanlings 22 (49) 23 (51) 45

a Including two dead (32% live at E14.5).



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

jacent to the proximal exons 1A and 1C. Indeed, we foundmultiple transcription factor binding sites tightly clustered to-gether immediately upstream of exon 1A. Besides previouslydescribed c-Fos/AP-1 (62) and Pax 5 (41) binding sites, strik-ingly conserved NF-�B binding sites are present within theexon 1A deletion. NF-�B transcription factors are known tofunction downstream of a wide variety of inflammatory stimuli(54, 64, 65). Blimp-1/Prdm1 was initially cloned as a negativeregulator of IFNB1 (beta interferon) expression in virally in-fected cells (30).

To explore this possible relationship and directly testwhether NF-�B is required for activation of Prdm1 expression,we examined wild-type and p50/p65 doubly deficient 3T3 fi-broblasts (63) infected with Sendai virus. Results shown in Fig.9A demonstrate that fibroblasts lacking the NF-�B subunitsp50 and p65 fail to express Prdm1 in response to Sendai virusinfection. As in the case of endoplasmic reticulum stress (16),we also found here that Prdm1 induction in response to Sendaivirus infection is insensitive to cycloheximide treatment, dem-onstrating a direct requirement for NF-�B independent of newprotein synthesis (data not shown). Similarly, as shown in Fig.9B, treatment with NF-�B inhibitors prevents Prdm1 inductionin response to LPS in B-cell lines. Helenalin, which selectivelyalkylates p65/RelA (46), or BMS341380, which selectively in-hibits IKK� phosphorylation, both gave indistinguishable re-sults. Thus, we conclude that NF-�B signaling is required forinduction of Prdm1 in response to LPS stimulation. Finally, todemonstrate that NF-�B binds to the region immediately up-stream of exon 1A, we performed ChIP experiments. As shownin Fig. 9C and D, significant levels of p65/RelA binding weredetectable in LPS-treated M12 B-lymphoma cells. These re-sults strongly suggest that occupancy of the NF-�B bindingsites upstream of the exon 1A promoter is required for LPS-inducible Prdm1 expression.

DISCUSSION

Alternative promoter usage is a prevalent feature of mam-malian genome architecture and evolution (4, 8, 34). Alterna-tive promoters located in different genomic regions are oftenresponsible for governing tissue-specific patterns of expression.Alternative first exons may also introduce sequence substitu-tions that change protein structure and/or influence mRNAstability (13, 38, 69). As many as 58% of mouse genes havealternative promoters (8, 34), but only a handful have beenfunctionally characterized by targeted mutagenesis. Here wedemonstrate for the first time that the murine Prdm1 gene usesalternative promoters that share overlapping activities duringearly development, whereas the previously characterized pro-moter region selectively functions to drive expression inplasma cells.

Revised picture of Prdm1 gene structure. Our 5� RACEexperiments have identified an alternative promoter located 70kb upstream of exon 1A. Thus, the Prdm1 transcription unitspans a much greater genomic distance than previously real-ized (�91 kb versus �23 kb). Exon 1B transcripts are stronglyexpressed in the yolk sac. This alternative promoter also bearsbivalent chromatin modifications in embryonic stem cells.However, our gene targeting experiments unequivocally dem-onstrate that this alternative first exon is dispensable for nor-

FIG. 4. Decreased levels of Prdm1 expression in �ex1/null com-pound heterozygotes leads to developmental abnormalities. (A) Com-parison of �/�ex1A and null/�ex1A forelimbs. The white arrow indi-cates the vestigial digit 5. (B) Alcian blue-alizarin red staining offorelimbs demonstrates the absence of bone tissue in digit 5 in the�ex1A/null compound heterozygote. (C) Size comparison of control�/�ex1A and null/�ex1A testes. (D) Hematoxylin-and-eosin-stainedsections reveal that null/�ex1A testes lack spermatocytes. (E) Hema-toxylin-and-eosin-stained sections reveal that null/�ex1A ovaries lackoocytes (arrowheads).



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

mal development. Thus, mice carrying the �ex1B targeted de-letion express wild-type levels of Prdm1. Even in the context ofa compound heterozygote, we fail to detect any evidence fordevelopmental defects. The Prdm1 locus is adjacent to a genedesert (57) devoid of known protein-coding information, withthe nearest annotated gene, Prep, located approximately 600kb upstream. Interestingly, the region downstream of exon 1Bis more highly conserved than upstream sequences and in alllikelihood contains tissue-specific regulatory elements that actat a distance to govern Prdm1 gene expression.

We have demonstrated that exon 2, present in the originalPrdm1 clone isolated by Turner and coworkers (79), is notnormally expressed. Similarly, GenBank EST clones containexon 1A spliced directly to exon 3. Our analysis of �ex1Adeletion mice establishes that the AUG translational startcodon present in exon 1A is not required for protein expres-sion. The cluster of in-frame AUG codons in exon 3 isconserved across vertebrates (23, 78). During the course ofthis study, we discovered an additional first exon (exon 1C)

located in the intron between exon 1A and exon 3. Besidesexon 1C transcripts spliced to exon 3, additionally we ob-serve exon 1C transcripts that contain intervening intronicsequences. These alternative transcripts are normally ex-pressed at low levels in diverse cell types, including T cells,B cells, and dendritic cells. Given its evolutionary conserva-tion, it is tempting to speculate that exon 1C may representan ancient promoter region that has been superseded by themore distal exon 1A promoter. Interestingly, exon 1C tran-scripts contain two additional upstream in-frame AUGcodons. Future experiments will evaluate whether these al-ternate translational start sites may contribute functionaldiversity.

The revised picture of the Prdm1 gene structure shouldprove useful for designing experiments aimed at mapping cis-acting regulatory elements and comparative studies of the 16Prdm family members encoded in the mouse genome (17). Aclosely related family member, Prdm14, is also activated byBMP-Smad signals in prospective primordial germ cells and

FIG. 5. �ex1A deletion disrupts Prdm1 activity in B lymphocytes. (A) RPA experiments demonstrate that LPS-treated �ex1A splenocytes failto express Prdm1 transcripts. Probes spanning Prdm1 exons 1A-3, 4-5, and 6 detect minimal mRNA expression in �ex1A mutant B cells.(B) Western blot analysis demonstrates near-wild-type levels of the Blimp-1 protein in LPS-treated �ex1B splenocytes. In contrast, �ex1A mutantB cells give an almost undetectable signal. (C) Immunoblotting shows a selective loss of secreted IgM in LPS-treated �ex1A splenocytes relativeto levels for wild-type controls. Membrane IgM (�M), secreted IgM (�S), and light chain (L) are indicated. (D) Immunohistochemical stainingof small intestines for mucosal IgA. Scale bar, 100 �M.

FIG. 6. Prdm1 expression by T lymphocytes and BMDCs. (A) RPA experiments demonstrate activated �ex1A T lymphocytes express reducedlevels of Prdm1 transcripts. (B) Western blots demonstrate reduced levels of Blimp-1 protein expression by �ex1A T lymphocytes. (C) RPAexperiments demonstrate �ex1A BMDCs express reduced levels of Prdm1 transcripts. (D) Western blots demonstrate reduced levels of Blimp-1protein expression by �ex1A BMDCs.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

FIG. 7. Alternative promoter usage in �ex1A mice. (A) RPA using exon 1B-3 probe #2. Product for exon 3 alone demonstrates substantialexpression of non-exon 1B transcripts in �ex1A mice. (B) Location of exon 1C. The dashed line represents the retained intron. (C) RPAdemonstrates that exon 1C spliced to exon 3 transcripts are present in J558L myeloma cells and LPS-stimulated splenocytes. (D) RPA



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

plays an essential role in establishment of the germ cell lineage(84). It will be interesting to compare Prdm1 and Prdm14cis-regulatory sequences controlling gene expression and toengineer knock-in alleles that swap coding information to testfor functional redundancy.

Exon 1A is selectively required in the B-cell lineage. The�ex1A deletion eliminates Prdm1 expression, required for ter-minal B-cell differentiation into antibody-secreting cells. Thesimplest explanation is that this discrete 2.18-kb genomic re-gion contains essential sequences normally bound by key tran-scription factors upstream of Prdm1. Consistent with this no-tion, c-Fos/AP-1 binding sites have been mapped to a fragmentcontaining approximately kb �1.3 to �1.0 relative to the exon1A transcription start site (62). Moreover, c-Fos is known toinduce Prdm1 expression in B cells (62). However, c-Fos-defi-cient B cells still undergo plasmacytic differentiation in re-sponse to LPS (62). Thus, c-Fos binding is not essential forPrdm1 expression in B cells.

Similarly, previous studies demonstrated that Prdm1 expres-sion is dramatically upregulated in response to viral infection,endoplasmic reticulum stress, cytokine signaling, and inflam-matory stimuli (54, 64, 65) and the NF-�B signaling pathwayplays a key role in B-cell development (11, 19, 64). The presentexperiments demonstrate for the first time that NF-�B signal-ing plays a key role in Prdm1 induction. Thus, NF-�B inhibi-tors block Prdm1 induction in B cells, and fibroblasts lackingthe NF-�B subunits p50 and p65 fail to express Prdm1 inresponse to Sendai virus infection. ChIP experiments demon-strate LPS-inducible occupancy of a conserved NF-�B siteupstream of the proximal exon 1A promoter in B cells. Theexon 1A deletion encompasses these c-Fos/AP-1 and NF-�Bbinding sites as well as conserved Stat sites (15) and maytherefore eliminate essential signals required for activation ofPrdm1 expression.

The exon 1A deletion also removes two highly conservedconsensus CTCF binding motifs. The CTCF protein has 11zinc fingers that display nearly 100% amino acid sequenceidentity shared among vertebrates (66). Recent genome-wide mapping studies demonstrate that roughly half of theCTCF-binding sites mapped far away from genes, consistentwith a potential role for these sequences as insulators (33).Only about 20% of CTCF sites are located near transcrip-tional start sites, and interestingly, as for Prdm1, a commoncharacteristic shared by many of these genes is alternativepromoter usage. The CTCF sites upstream of exon 1A areprobably involved in organizing higher-order chromatinstructure that controls developmentally regulated Prdm1gene expression.

Another well-known Blimp-1 direct target is Pax5. Pax5 isrequired to establish and maintain B-cell lineage identity (12,

58), and elimination of Pax5 expression is an essential prereq-uisite for terminal differentiation (41). Mutually exclusivePrdm1 and Pax5 expression involves an autoregulatory feed-back loop (41, 52, 71). The conserved Pax5 binding site islocated inside the �ex1A deletion (52). Repression of Prdm1expression also depends on a downstream Bcl-6 binding site(73, 77) and a Bach-2 binding site located near the exon 1Apromoter (59). Thus, another, not mutually exclusive interpre-tation is that the �ex1A deletion causes a change in chromatinarchitecture and shifts the dynamic positioning of nucleosomesalong the locus, which, selectively in the B-cell lineage, leads tosustained silencing and long-term occupancy by these Prdm1transcriptional repressors.

In striking contrast to B cells, �ex1A T cells and BMDCsretain moderate levels of expression. Perhaps assembly ofsilent chromatin is less tightly controlled in these cell lin-eages. Alternatively, Prdm1 expression in these cell typesmay be governed by nonoverlapping, as yet ill-defined cis-acting regulatory elements. Consistent with this suggestion,we note with interest the two conserved NFAT bindingmotifs located immediately upstream of exon 1C. Membersof the NFAT family of transcriptional factors associate withdifferent partners to regulate key aspects of T-helper-celldifferentiation (47). In T lymphocytes, Prdm1 expression isinduced by inflammatory cytokines and in response to re-ceptor signaling (20, 28, 49, 70). Prdm1 regulates T-cellproliferation, survival, homeostasis, and terminal differen-tiation (28, 49). However, expression does not seem to berestricted to a discrete subset. It will be important to learnhow these NFAT binding sites mapped upstream of exon 1Cmay regulate Prdm1 expression levels and influence T-celldevelopment and function. Prdm1 is induced during macro-phage differentiation (9). The present experiments demon-strate for the first time that Prdm1 expression is dramaticallyupregulated during dendritic-cell maturation. It will be in-teresting to characterize functional activities of T-lympho-cyte and dendritic-cell subsets carrying the �ex1A hypomor-phic allele.

Regulatory cues controlling alternative promoter usage andexpression levels. The �ex1A deletion selectively eliminatesexpression in plasma cells but only slightly decreases expres-sion in the embryo. In the absence of the basal promoter,alternative promoters compensate and rescue all aspects ofembryonic development. Compound heterozygotes also car-rying the null allele with further reduced expression levelsdisplay a broad spectrum of developmental defects reflect-ing a generic loss of Prdm1 activities rather than inactivationwithin any particular expression domain. Thus, in the em-bryo, Prdm1 alternative promoters seem to regulate overallexpression levels as opposed to governing tissue-specific

demonstrates expression of exon 1C transcripts with a retained intron in wild-type E9.5 embryo, yolk sac, placenta, and LPS-treated splenocytes.(E) Representative 5� RACE clone containing exon 1C spliced to exon 3 aligned to the UCSC genome browser (31, 37). CAGE tags are shownas black boxes with white chevrons (35, 75). The location of an ancient conserved noncoding element (80) is indicated by a bracket. (F) Sequenceof a representative 5� RACE clone. Exon 1C (underlined in black) is spliced directly to exon 3 (underlined in gray). The arrow indicates the splicejunction. The PCR primer annealing site for PCR is underlined in red. In-frame AUG codons are underlined in green. (G and H) RT-PCR (G)and RPA (H) demonstrate that exon 1B and exon 1C transcripts are increased in LPS-treated �ex1A BMDCs relative to the wild type. (I and J)RT-PCR (I) and RPA (J) demonstrate exon 1C spliced transcripts are increased in �ex1A T lymphocytes relative to the wild type. (K) RT-PCRexperiments demonstrate upregulation of exon 1B transcripts and loss of exon 1C retained intron transcripts in �ex1A LPS-treated splenocytes.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

expression patterns. Developmentally regulated Prdm1 ex-pression in the embryo is known to be governed by BMP-Smad signaling cues (60), whereas in contrast, Prdm1expression in different B-cell subpopulations responds toToll-like receptor–NF-�B pathways (18, 42). Quite different

regulatory cues are likely to control Prdm1 functional activ-ities in diverse cell types.

Interestingly, in the skin, Prdm1 mRNA expression was in-creased in the absence of functional Blimp-1 (48). These re-sults provide evidence for repression via an autoregulatory

FIG. 8. The regions surrounding alternative Prdm1 first exons contain different transcription factor binding motifs. The schematic diagramsshow the conserved transcription factor binding motifs identified within the regions near exon 1A (A) in comparison with those near exon 1B. (B).DNA sequences conserved between mouse and human were identified using the UCSC genomic browser (http://genome.ucsc.edu/). Sequenceswere then analyzed with the GenomeNet MOTIF tool (http://motif.genome.jp/) using the TRANSFAC library and a cutoff score of 85. Thegenomic locus was also manually inspected for conserved sequences not present in the online motif libraries, such as the CACCC (KLF) andCCCTC (CTCF) motifs.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

mechanism. Consistent with this idea, conserved Blimp-1 bind-ing sites were characterized within intron 2 (48). DecreasedBlimp-1 expression levels may therefore inactivate this nega-tive autoregulatory feedback circuit and allow normally silentalternative promoters to become activated. Our �ex1A and�ex1B mutant strains may be valuable tools for studying thestructural basis of these divergent regulatory inputs.

Evolution of Prdm1 cis-regulatory elements may requirepromoter diversification. Prdm1 homologs have been foundin many metazoans (17) and play important roles in zebrafish (5, 68), Xenopus (14), Drosophila (1, 55), and sea urchindevelopment (44, 45). Even between Caenorhabditis elegansand humans, the coding sequence of the PR/SET domainand zinc fingers is relatively well conserved (78). However,Prdm1 expression patterns and functional activities showstriking species differences. For instance, in mice Prdm1 isessential for placental development and germ cell specifica-tion (60, 81). In contrast, in zebra fish Prdm1 controls mus-cle cell fate (5, 68). Evidence to date strongly argues thatthese roles are not conserved across vertebrates. Thus,Prdm1 represents an early metazoan gene, having gainednovel expression domains and diverse functions through thecourse of animal evolution.

Interestingly, Prdm1 first exon usage varies widely amongvertebrates. A survey of Xenopus tropicalis GenBank ESTsusing the UCSC genome browser shows a single clone ini-tiated at the genomic region homologous to mouse exon 1A(accession no. CR414136). There are four Xenopus clones(accession no. CF784176, CR432771, CR417246, andAL649398) that initiate at an alternative first exon approx-imately 4 kb upstream of Xenopus exon 1, corresponding toa region approximately 8.5 kb upstream of exon 1A inmouse. The zebra fish ESTs all start at the same first exon.However, this promoter region shares no homology with se-quences in the mouse genome. Similarly, alternative promoterregions found in sea urchin (44, 45) share no homology withmouse alternative exon 1A, 1B, or 1C. Considerable evidencedemonstrates that motif-specific enhancer-promoter interac-tions regulate gene expression patterns (7). It seems likely thatevolutionary changes in Prdm1 expression patterns involve notonly changes in enhancer sequences but also changes in the

FIG. 9. NF-�B sites located upstream of the exon 1A promotermediate Prdm1 transcriptional activation in response to Toll-like re-ceptor/Nod-like receptor signaling. (A) Prdm1 transcriptional activa-

tion by Sendai virus requires NF-�B signaling. Steady-state Prdm1mRNA levels in wild-type (WT) or p50/p65-deficient (KO) 3T3 fibro-blasts following infection with Sendai virus, assessed by quantitativeRT-PCR, were normalized to beta-2-microglobulin. Results are rep-resentative of three independent experiments. (B) Induction of Prdm1in response to LPS treatment requires NF-�B. Prdm1 mRNA expres-sion levels by M12 B cells cultured with LPS for 2 h in the presence orabsence of NF-�B inhibitors, helenalin, or BMS341380 were assessedby quantitative RT-PCR. The numbers above the bars indicate then-fold induction with LPS in comparison with results for uninducedcultures. Representative results of triplicate experiments are shown. (Cand D) NF-�B p65 binds to the Prdm1 exon 1A promoter region inLPS-treated M12 B cells. Association of p65/relA with the Ig� intronicenhancer, the prdm1 exon 1A promoter region, or control Prdm1intron 5 sequences was compared in control and LPS-treated M12 Bcells by semiquantitative PCR, Southern blotting, and hybridization(C) or quantitative RT-PCR (D). The dilution for input or immuno-precipitated (IP) chromatin was fourfold (C) or twofold (D), respec-tively.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

promoter motifs with which they interact. Thus, the emergenceof alternative promoters may mark the beginnings of new func-tions for this old gene.

ACKNOWLEDGMENTS

We thank Ayesha Islam and Stephane Vincent for initial character-ization of exon 1B transcripts, Chad Koonce for assistance with genetargeting in ES cells, and Carol Paterson and Emily Lejsek for blas-tocyst injections and genotyping assistance. We thank Reuben Toozeand Lynn Corcoran for generously providing rabbit polyclonal and ratmonoclonal Blimp-1 antibodies, respectively.

This work was supported by a program grant from the WellcomeTrust.

REFERENCES

1. Agawa, Y., M. Sarhan, Y. Kageyama, K. Akagi, M. Takai, K. Hashiyama, T.Wada, H. Handa, A. Iwamatsu, S. Hirose, and H. Ueda. 2007. DrosophilaBlimp-1 is a transient transcriptional repressor that controls timing of theecdysone-induced developmental pathway. Mol. Cell. Biol. 27:8739–8747.

2. Arnold, S. J., S. Maretto, A. Islam, E. K. Bikoff, and E. J. Robertson. 2006.Dose-dependent Smad1, Smad5 and Smad8 signaling in the early mouseembryo. Dev. Biol. 296:104–118.

3. Azuara, V., P. Perry, S. Sauer, M. Spivakov, H. F. Jorgensen, R. M. John, M.Gouti, M. Casanova, G. Warnes, M. Merkenschlager, and A. G. Fisher. 2006.Chromatin signatures of pluripotent cell lines. Nat. Cell Biol. 8:532–538.

4. Baek, D., C. Davis, B. Ewing, D. Gordon, and P. Green. 2007. Characteriza-tion and predictive discovery of evolutionarily conserved mammalian alter-native promoters. Genome Res. 17:145–155.

5. Baxendale, S., C. Davison, C. Muxworthy, C. Wolff, P. W. Ingham, and S.Roy. 2004. The B-cell maturation factor Blimp-1 specifies vertebrate slow-twitch muscle fiber identity in response to Hedgehog signaling. Nat. Genet.36:88–93.

6. Bernstein, B. E., T. S. Mikkelsen, X. Xie, M. Kamal, D. J. Huebert, J. Cuff,B. Fry, A. Meissner, M. Wernig, K. Plath, R. Jaenisch, A. Wagschal, R. Feil,S. L. Schreiber, and E. S. Lander. 2006. A bivalent chromatin structuremarks key developmental genes in embryonic stem cells. Cell 125:315–326.

7. Butler, J. E., and J. T. Kadonaga. 2001. Enhancer-promoter specificity me-diated by DPE or TATA core promoter motifs. Genes Dev. 15:2515–2519.

8. Carninci, P., A. Sandelin, B. Lenhard, S. Katayama, K. Shimokawa, J.Ponjavic, C. A. Semple, M. S. Taylor, P. G. Engstrom, M. C. Frith, A. R.Forrest, W. B. Alkema, S. L. Tan, C. Plessy, R. Kodzius, T. Ravasi, T.Kasukawa, S. Fukuda, M. Kanamori-Katayama, Y. Kitazume, H. Kawaji, C.Kai, M. Nakamura, H. Konno, K. Nakano, S. Mottagui-Tabar, P. Arner, A.Chesi, S. Gustincich, F. Persichetti, H. Suzuki, S. M. Grimmond, C. A.Wells, V. Orlando, C. Wahlestedt, E. T. Liu, M. Harbers, J. Kawai, V. B.Bajic, D. A. Hume, and Y. Hayashizaki. 2006. Genome-wide analysis ofmammalian promoter architecture and evolution. Nat. Genet. 38:626–635.

9. Chang, D. H., C. Angelin-Duclos, and K. Calame. 2000. BLIMP-1: trigger fordifferentiation of myeloid lineage. Nat. Immunol. 1:169–176.

10. Chang, D. H., G. Cattoretti, and K. L. Calame. 2002. The dynamic expres-sion pattern of B lymphocyte induced maturation protein-1 (Blimp-1) duringmouse embryonic development. Mech. Dev. 117:305–309.

11. Chen, L. F., and W. C. Greene. 2004. Shaping the nuclear action of NF-�B.Nat. Rev. Mol. Cell Biol. 5:392–401.

12. Cobaleda, C., A. Schebesta, A. Delogu, and M. Busslinger. 2007. Pax5: theguardian of B cell identity and function. Nat. Immunol. 8:463–470.

13. Davuluri, R. V., Y. Suzuki, S. Sugano, C. Plass, and T. H. Huang. 2008. Thefunctional consequences of alternative promoter use in mammalian ge-nomes. Trends Genet. 24:167–177.

14. de Souza, F. S., V. Gawantka, A. P. Gomez, H. Delius, S. L. Ang, and C.Niehrs. 1999. The zinc finger gene Xblimp1 controls anterior endomesoder-mal cell fate in Spemann’s organizer. EMBO J. 18:6062–6072.

15. Diehl, S. A., H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakken-bos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits. 2008. STAT3-mediated up-regulation of BLIMP1 is coordinated with BCL6 down-regula-tion to control human plasma cell differentiation. J. Immunol. 180:4805–4815.

16. Doody, G. M., S. Stephenson, and R. M. Tooze. 2006. BLIMP-1 is a target ofcellular stress and downstream of the unfolded protein response. Eur. J. Im-munol. 36:1572–1582.

17. Fumasoni, I., N. Meani, D. Rambaldi, G. Scafetta, M. Alcalay, and F. D.Ciccarelli. 2007. Family expansion and gene rearrangements contributed tothe functional specialization of PRDM genes in vertebrates. BMC Evol. Biol.7:187.

18. Genestier, L., M. Taillardet, P. Mondiere, H. Gheit, C. Bella, and T. De-france. 2007. TLR agonists selectively promote terminal plasma cell differ-entiation of B cell subsets specialized in thymus-independent responses.J. Immunol. 178:7779–7786.

19. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins:evolutionarily conserved mediators of immune responses. Annu. Rev. Im-munol. 16:225–260.

20. Gong, D., and T. R. Malek. 2007. Cytokine-dependent Blimp-1 expression inactivated T cells inhibits IL-2 production. J. Immunol. 178:242–252.

21. Gyory, I., G. Fejer, N. Ghosh, E. Seto, and K. L. Wright. 2003. Identificationof a functionally impaired positive regulatory domain I binding factor 1transcription repressor in myeloma cell lines. J. Immunol. 170:3125–3133.

22. Horsley, V., D. O’Carroll, R. Tooze, Y. Ohinata, M. Saitou, T. Obukhanych,M. Nussenzweig, A. Tarakhovsky, and E. Fuchs. 2006. Blimp1 defines aprogenitor population that governs cellular input to the sebaceous gland.Cell 126:597–609.

23. Huang, S. 1994. Blimp-1 is the murine homolog of the human transcriptionalrepressor PRDI-BF1. Cell 78:9.

24. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Mura-matsu, and R. M. Steinman. 1992. Generation of large numbers of dendriticcells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693–1702.

25. Johnson, K., C. Angelin-Duclos, S. Park, and K. L. Calame. 2003. Changesin histone acetylation are associated with differences in accessibility of V(H)gene segments to V-DJ recombination during B-cell ontogeny and develop-ment. Mol. Cell. Biol. 23:2438–2450.

26. Kallies, A., J. Hasbold, K. Fairfax, C. Pridans, D. Emslie, B. S. McKenzie,A. M. Lew, L. M. Corcoran, P. D. Hodgkin, D. M. Tarlinton, and S. L. Nutt.2007. Initiation of plasma-cell differentiation is independent of the transcrip-tion factor Blimp-1. Immunity 26:555–566.

27. Kallies, A., J. Hasbold, D. M. Tarlinton, W. Dietrich, L. M. Corcoran, P. D.Hodgkin, and S. L. Nutt. 2004. Plasma cell ontogeny defined by quantitativechanges in blimp-1 expression. J. Exp. Med. 200:967–977.

28. Kallies, A., E. D. Hawkins, G. T. Belz, D. Metcalf, M. Hommel, L. M.Corcoran, P. D. Hodgkin, and S. L. Nutt. 2006. Transcriptional repressorBlimp-1 is essential for T cell homeostasis and self-tolerance. Nat. Immunol.7:466–474.

29. Kawai, J., A. Shinagawa, K. Shibata, M. Yoshino, M. Itoh, Y. Ishii, T.Arakawa, A. Hara, Y. Fukunishi, H. Konno, J. Adachi, S. Fukuda, K. Aizawa,M. Izawa, K. Nishi, H. Kiyosawa, S. Kondo, I. Yamanaka, T. Saito, Y.Okazaki, T. Gojobori, H. Bono, T. Kasukawa, R. Saito, K. Kadota, H.Matsuda, M. Ashburner, S. Batalov, T. Casavant, W. Fleischmann, T. Gaas-terland, C. Gissi, B. King, H. Kochiwa, P. Kuehl, S. Lewis, Y. Matsuo, I.Nikaido, G. Pesole, J. Quackenbush, L. M. Schriml, F. Staubli, R. Suzuki,M. Tomita, L. Wagner, T. Washio, K. Sakai, T. Okido, M. Furuno, H. Aono,R. Baldarelli, G. Barsh, J. Blake, D. Boffelli, N. Bojunga, P. Carninci, M. F.de Bonaldo, M. J. Brownstein, C. Bult, C. Fletcher, M. Fujita, M. Gariboldi,S. Gustincich, D. Hill, M. Hofmann, D. A. Hume, M. Kamiya, N. H. Lee, P.Lyons, L. Marchionni, J. Mashima, J. Mazzarelli, P. Mombaerts, P. Nor-done, B. Ring, M. Ringwald, I. Rodriguez, N. Sakamoto, H. Sasaki, K. Sato,C. Schonbach, T. Seya, Y. Shibata, K. F. Storch, H. Suzuki, K. Toyo-oka,K. H. Wang, C. Weitz, C. Whittaker, L. Wilming, A. Wynshaw-Boris, K.Yoshida, Y. Hasegawa, H. Kawaji, S. Kohtsuki, and Y. Hayashizaki. 2001.Functional annotation of a full-length mouse cDNA collection. Nature 409:685–690.

30. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of anovel repressor of beta-interferon gene expression. Genes Dev. 5:868–879.

31. Kent, W. J. 2002. BLAT—the BLAST-like alignment tool. Genome Res.12:656–664.

32. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, and R.Asofsky. 1979. Establishment and characterization of BALB/c lymphomalines with B cell properties. J. Immunol. 122:549–554.

33. Kim, T. H., Z. K. Abdullaev, A. D. Smith, K. A. Ching, D. I. Loukinov, R. D.Green, M. Q. Zhang, V. V. Lobanenkov, and B. Ren. 2007. Analysis of thevertebrate insulator protein CTCF-binding sites in the human genome. Cell128:1231–1245.

34. Kimura, K., A. Wakamatsu, Y. Suzuki, T. Ota, T. Nishikawa, R. Yamashita,J. Yamamoto, M. Sekine, K. Tsuritani, H. Wakaguri, S. Ishii, T. Sugiyama,K. Saito, Y. Isono, R. Irie, N. Kushida, T. Yoneyama, R. Otsuka, K. Kanda,T. Yokoi, H. Kondo, M. Wagatsuma, K. Murakawa, S. Ishida, T. Ishibashi,A. Takahashi-Fujii, T. Tanase, K. Nagai, H. Kikuchi, K. Nakai, T. Isogai,and S. Sugano. 2006. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters ofhuman genes. Genome Res. 16:55–65.

35. Kodzius, R., M. Kojima, H. Nishiyori, M. Nakamura, S. Fukuda, M. Tagami,D. Sasaki, K. Imamura, C. Kai, M. Harbers, Y. Hayashizaki, and P. Carn-inci. 2006. CAGE: cap analysis of gene expression. Nat. Methods 3:211–222.

36. Ku, M., R. P. Koche, E. Rheinbay, E. M. Mendenhall, M. Endoh, T. S.Mikkelsen, A. Presser, C. Nusbaum, X. Xie, A. S. Chi, M. Adli, S. Kasif,L. M. Ptaszek, C. A. Cowan, E. S. Lander, H. Koseki, and B. E. Bernstein.2008. Genomewide analysis of PRC1 and PRC2 occupancy identifies twoclasses of bivalent domains. PLoS Genet. 4:e1000242.

37. Kuhn, R. M., D. Karolchik, A. S. Zweig, T. Wang, K. E. Smith, K. R.Rosenbloom, B. Rhead, B. J. Raney, A. Pohl, M. Pheasant, L. Meyer, F. Hsu,A. S. Hinrichs, R. A. Harte, B. Giardine, P. Fujita, M. Diekhans, T. Dreszer,H. Clawson, G. P. Barber, D. Haussler, and W. J. Kent. 2009. The UCSC



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Genome Browser Database: update 2009. Nucleic Acids Res. 37:D755–D761.

38. Landry, J. R., D. L. Mager, and B. T. Wilhelm. 2003. Complex controls: therole of alternative promoters in mammalian genomes. Trends Genet. 19:640–648.

39. Lawson, K. A., N. R. Dunn, B. A. Roelen, L. M. Zeinstra, A. M. Davis, C. V.Wright, J. P. Korving, and B. L. Hogan. 1999. Bmp4 is required for thegeneration of primordial germ cells in the mouse embryo. Genes Dev.13:424–436.

40. Lee, B. C., and S. Roy. 2006. Blimp-1 is an essential component of the geneticprogram controlling development of the pectoral limb bud. Dev. Biol. 300:623–634.

41. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, and K. Calame. 2002. Blimp-1-dependent repression of Pax-5 is required for differentiation of B cells toimmunoglobulin M-secreting plasma cells. Mol. Cell. Biol. 22:4771–4780.

42. Lin, K. I., Y. Y. Kao, H. K. Kuo, W. B. Yang, A. Chou, H. H. Lin, A. L. Yu,and C. H. Wong. 2006. Reishi polysaccharides induce immunoglobulin pro-duction through the TLR4/TLR2-mediated induction of transcription factorBlimp-1. J. Biol. Chem. 281:24111–24123.

43. Lin, Y., K. Wong, and K. Calame. 1997. Repression of c-myc transcription byBlimp-1, an inducer of terminal B cell differentiation. Science 276:596–599.

44. Livi, C. B., and E. H. Davidson. 2006. Expression and function of blimp1/krox, an alternatively transcribed regulatory gene of the sea urchin endome-soderm network. Dev. Biol. 293:513–525.

45. Livi, C. B., and E. H. Davidson. 2007. Regulation of spblimp1/krox1a, analternatively transcribed isoform expressed in midgut and hindgut of the seaurchin gastrula. Gene Expr. Patterns 7:1–7.

46. Lyss, G., A. Knorre, T. J. Schmidt, H. L. Pahl, and I. Merfort. 1998. Theanti-inflammatory sesquiterpene lactone helenalin inhibits the transcriptionfactor NF-�B by directly targeting p65. J. Biol. Chem. 273:33508–33516.

47. Macian, F. 2005. NFAT proteins: key regulators of T-cell development andfunction. Nat. Rev. Immunol. 5:472–484.

48. Magnusdottir, E., S. Kalachikov, K. Mizukoshi, D. Savitsky, A. Ishida-Yamamoto, A. A. Panteleyev, and K. Calame. 2007. Epidermal terminaldifferentiation depends on B lymphocyte-induced maturation protein-1.Proc. Natl. Acad. Sci. USA 104:14988–14993.

49. Martins, G. A., L. Cimmino, M. Shapiro-Shelef, M. Szabolcs, A. Herron, E.Magnusdottir, and K. Calame. 2006. Transcriptional repressor Blimp-1 reg-ulates T cell homeostasis and function. Nat. Immunol. 7:457–465.

50. Mikkelsen, T. S., M. Ku, D. B. Jaffe, B. Issac, E. Lieberman, G. Giannoukos,P. Alvarez, W. Brockman, T. K. Kim, R. P. Koche, W. Lee, E. Mendenhall,A. O’Donovan, A. Presser, C. Russ, X. Xie, A. Meissner, M. Wernig, R.Jaenisch, C. Nusbaum, E. S. Lander, and B. E. Bernstein. 2007. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells.Nature 448:553–560.

51. Mora-Lopez, F., N. Pedreno-Horrillo, L. Delgado-Perez, J. A. Brieva, and A.Campos-Caro. 2008. Transcription of PRDM1, the master regulator forplasma cell differentiation, depends on an SP1/SP3/EGR-1 GC-box. Eur.J. Immunol. 38:2316–2324.

52. Mora-Lopez, F., E. Reales, J. A. Brieva, and A. Campos-Caro. 2007. HumanBSAP and BLIMP1 conform an autoregulatory feedback loop. Blood 110:3150–3157.

53. Nagy, A., M. Gertenstein, K. Vinterstein, and R. Behringer. 2003. Manipu-lating the mouse embryo: a laboratory manual, 3rd ed. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

54. Natoli, G., S. Saccani, D. Bosisio, and I. Marazzi. 2005. Interactions ofNF-�B with chromatin: the art of being at the right place at the right time.Nat. Immunol. 6:439–445.

55. Ng, T., F. Yu, and S. Roy. 2006. A homologue of the vertebrate SET domainand zinc finger protein Blimp-1 regulates terminal differentiation of thetracheal system in the Drosophila embryo. Dev. Genes Evol. 216:243–252.

56. Niwa, H., K. Yamamura, and J. Miyazaki. 1991. Efficient selection forhigh-expression transfectants with a novel eukaryotic vector. Gene 108:193–199.

57. Nobrega, M. A., I. Ovcharenko, V. Afzal, and E. M. Rubin. 2003. Scanninghuman gene deserts for long-range enhancers. Science 302:413.

58. Nutt, S. L., B. Heavey, A. G. Rolink, and M. Busslinger. 1999. Commitmentto the B-lymphoid lineage depends on the transcription factor Pax5. Nature401:556–562.

59. Ochiai, K., Y. Katoh, T. Ikura, Y. Hoshikawa, T. Noda, H. Karasuyama, S.Tashiro, A. Muto, and K. Igarashi. 2006. Plasmacytic transcription factorBlimp-1 is repressed by Bach2 in B cells. J. Biol. Chem. 281:38226–38234.

60. Ohinata, Y., B. Payer, D. O’Carroll, K. Ancelin, Y. Ono, M. Sano, S. C.Barton, T. Obukhanych, M. Nussenzweig, A. Tarakhovsky, M. Saitou, andM. A. Surani. 2005. Blimp1 is a critical determinant of the germ cell lineagein mice. Nature 436:207–213.

61. Ohinata, Y., M. Sano, M. Shigeta, K. Yamanaka, and M. Saitou. 2008. Acomprehensive, non-invasive visualization of primordial germ cell develop-ment in mice by the Prdm1-mVenus and Dppa3-ECFP double transgenicreporter. Reproduction 136:503–514.

62. Ohkubo, Y., M. Arima, E. Arguni, S. Okada, K. Yamashita, S. Asari, S.Obata, A. Sakamoto, M. Hatano, J. O-Wang, M. Ebara, H. Saisho, and T.Tokuhisa. 2005. A role for c-fos/activator protein 1 in B lymphocyte terminaldifferentiation. J. Immunol. 174:7703–7710.

63. Ouaaz, F., J. Arron, Y. Zheng, Y. Choi, and A. A. Beg. 2002. Dendritic celldevelopment and survival require distinct NF-�B subunits. Immunity 16:257–270.

64. Pahl, H. L. 1999. Activators and target genes of Rel/NF-�B transcriptionfactors. Oncogene 18:6853–6866.

65. Perkins, N. D. 2007. Integrating cell-signalling pathways with NF-�B andIKK function. Nat. Rev. Mol. Cell Biol. 8:49–62.

66. Phillips, J. E., and V. G. Corces. 2009. CTCF: master weaver of the genome.Cell 137:1194–1211.

67. Robertson, E. J., I. Charatsi, C. J. Joyner, C. H. Koonce, M. Morgan, A.Islam, C. Paterson, E. Lejsek, S. J. Arnold, A. Kallies, S. L. Nutt, and E. K.Bikoff. 2007. Blimp1 regulates development of the posterior forelimb, caudalpharyngeal arches, heart and sensory vibrissae in mice. Development 134:4335–4345.

68. Roy, S., C. Wolff, and P. W. Ingham. 2001. The u-boot mutation identifies aHedgehog-regulated myogenic switch for fiber-type diversification in thezebrafish embryo. Genes Dev. 15:1563–1576.

69. Sandelin, A., P. Carninci, B. Lenhard, J. Ponjavic, Y. Hayashizaki, and D. A.Hume. 2007. Mammalian RNA polymerase II core promoters: insights fromgenome-wide studies. Nat. Rev. Genet. 8:424–436.

70. Santner-Nanan, B., F. Berberich-Siebelt, Z. Xiao, N. Poser, H. Seennefelder,S. Rauthe, D. S. Vallabhapurapu, I. Berberich, A. Schimpl, and H. W. Kreth.2006. Blimp-1 is expressed in human and mouse T cell subsets and leads toloss of IL-2 production and to defective proliferation. Signal Transduct.6:268–279.

71. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M.Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1orchestrates plasma cell differentiation by extinguishing the mature B cellgene expression program. Immunity 17:51–62.

72. Shaffer, A. L., A. Peng, and M. S. Schlissel. 1997. In vivo occupancy of thekappa light chain enhancers in primary pro- and pre-B cells: a model forkappa locus activation. Immunity 6:131–143.

73. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000.BCL-6 represses genes that function in lymphocyte differentiation, inflam-mation, and cell cycle control. Immunity 13:199–212.

74. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G.McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the for-mation of immunoglobulin secreting plasma cells and pre-plasma memory Bcells. Immunity 19:607–620.

75. Shiraki, T., S. Kondo, S. Katayama, K. Waki, T. Kasukawa, H. Kawaji, R.Kodzius, A. Watahiki, M. Nakamura, T. Arakawa, S. Fukuda, D. Sasaki, A.Podhajska, M. Harbers, J. Kawai, P. Carninci, and Y. Hayashizaki. 2003.Cap analysis gene expression for high-throughput analysis of transcriptionalstarting point and identification of promoter usage. Proc. Natl. Acad. Sci.USA 100:15776–15781.

76. Soriano, P. 1997. The PDGF alpha receptor is required for neural crest celldevelopment and for normal patterning of the somites. Development 124:2691–2700.

77. Tunyaplin, C., A. L. Shaffer, C. D. Angelin-Duclos, X. Yu, L. M. Staudt, andK. L. Calame. 2004. Direct repression of prdm1 by Bcl-6 inhibits plasmacyticdifferentiation. J. Immunol. 173:1158–1165.

78. Tunyaplin, C., M. A. Shapiro, and K. L. Calame. 2000. Characterization ofthe B lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNAisoforms and basal promoter. Nucleic Acids Res. 28:4846–4855.

79. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zincfinger-containing protein that can drive the maturation of B lymphocytesinto immunoglobulin-secreting cells. Cell 77:297–306.

80. Venkatesh, B., E. F. Kirkness, Y. H. Loh, A. L. Halpern, A. P. Lee, J.Johnson, N. Dandona, L. D. Viswanathan, A. Tay, J. C. Venter, R. L. Straus-berg, and S. Brenner. 2006. Ancient noncoding elements conserved in thehuman genome. Science 314:1892.

81. Vincent, S. D., N. R. Dunn, R. Sciammas, M. Shapiro-Shalef, M. M. Davis,K. Calame, E. K. Bikoff, and E. J. Robertson. 2005. The zinc finger tran-scriptional repressor Blimp1/Prdm1 is dispensable for early axis formationbut is required for specification of primordial germ cells in the mouse.Development 132:1315–1325.

82. Vokes, S. A., H. Ji, W. H. Wong, and A. P. McMahon. 2008. A genome-scaleanalysis of the cis-regulatory circuitry underlying sonic hedgehog-mediatedpatterning of the mammalian limb. Genes Dev. 22:2651–2663.

83. Wang, D., L. Zhuang, B. Gao, C. X. Shi, J. Cheung, M. Liu, T. Jin, and X. Y.Wen. 2008. The Blimp-1 gene regulatory region directs EGFP expression inmultiple hematopoietic lineages and testis in mice. Transgenic Res. 17:193–203.

84. Yamaji, M., Y. Seki, K. Kurimoto, Y. Yabuta, M. Yuasa, M. Shigeta, K.Yamanaka, Y. Ohinata, and M. Saitou. 2008. Critical function of Prdm14 forthe establishment of the germ cell lineage in mice. Nat. Genet. 40:1016–1022.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

blimp-1/prdm1 alternative promoter usage during mouse

Documents