Assignment topic-

Submitted by – Jwalit

Biotechnological Applications in

Male sterility or Hybrid Breeding

Male sterility is defined as an absence or non-functioning of pollen grain in plant or incapability of plants to produce or release functional pollen grains.

The use of male sterility in hybrid seed production has a great importance as it eliminates the process of mechanical emasculation.

In 1763, Kolreuter observed anther abortion within species and species hybrids.

The first male sterility system(CGMS) was developed in onion in 1943(Jones,1943).

Induced CMS in pearl millet by Ethidium bromide (Burton and Hanna, 1976).

Causes of Male Sterility:

• Absence or malformation of male organs (stamens) in bisexual plants or no male flowers in dioecious plants.

• Failure to develop new anther.

• Abnormal pollen maturation; inability to germinate on incompatible stigma.

• Non- dehiscent anthers but viable pollens.

• Barriers other than incompatibility preventing pollen from reaching ovule.

(Kaul, 1988)

More prevalent than Female sterility:

Male sporophyte and gametophyte less protected from environment than ovule and embryo sac.

Easy to detect male sterility, due to large no.of pollen availability for study.

Easy to assay male sterility;1. Staining technique(caramine, lactophenol or iodine)2. female sterility requires crossing.

Male sterility has propagation potential in nature.

(Kaul, 1988)

Types of Male Sterility:

1) Genetic male sterility (GMS) or Genic or Nuclear or mendelian sterility : isusually caused by recessive alleles and follow Mendelian inheritance due tonuclear genes.

A) Temperature sensitive genetic male sterility (TGMS)B) Photoperiod sensitive genetic male sterility (PGMS)

The major drawback with GMS is the impossibility to create 100% malesterile populations. Thus in hybrid seed production, the fertile plants haveto be rouged out before anthesis (1:1 ratio).

2) Cytoplasmic male sterility (CMS) : is caused by sterile cytoplasm (S)• CMS occurs as a result of structural changes in the cytoplasmic organellar

genome and mutation in the mitochondrial genome.• It is maternally inherited.• This makes CMS extra valuable for producing hybrid seed since, crossing

with maintainer lines result in 100% sterile plants.

3) Cytoplasmic genetic male sterility (CGMS): CMS where a nucleargene for restoring fertility in the male sterile line is known. Fertility restorergene R is dominant in nature and found in certain strains of same species orcan be transferred form the related species.

4) Non genetic or chemically induced male sterility:Male sterility isinduced by Applied specific chemical.e.g. Gametocides (mitomycin and streptomycin) or Chemical Hybridizing

Agents (CHA).

5) Genetically engineered or transgenic male sterility : Transgenic malesterility is the production of male sterility by the help of transgene thatencodes protein which is responsible for the failure of pollen development.

Importance of Male sterility:

Hybrid seed production.

To improve physical stability.

Higher responsiveness to fertilizers.

Male sterility is used in recurrent selection breedingwhich is effective in breaking undesirable linkages andincrease desirable gene combinations especially in thosecrops where emasculation is difficult.

Increases the reproductive fitness of individual.

The male sterile genes are useful in genetic control ofmicrosporogenesis.

Biotechnological applications in Male Sterility and Hybrid Breeding

Targeting the Tapetum Tissue:

• A specialized anther tissue the tapetum, play an important part in pollen development.• The tapetum surrounds the pollen sac early in the anther development, degenerates during the later stages of development.

M, microsporocytes (microspore mother cells); DP, developing pollen; T, tapetalcell; and Tds, tetrads.

Barnase/Barstar System Engineered Male Sterility:

• Barnase is extracelluar Rnase; Barstar is inhibitor of barnase(both from bacterium Bacillus amyloliquefaciens which uses barnase for protection from microbial predators and barstar to protect itself from barnase.

•Fuse the barnase and barstar genes to TA29 promoter- TA29 is a plant gene that has tapetum specific expression.

•Both gene link to bar gene(Murakami et al., 1986) which confers resistance to the herbicide phosphinothricin.

•Brassica napus cv. Darkar containing the TA29- barnase construct are male sterile; those with TA29-barstar are not affected by the transgene( Male fertile).

•Cross male sterile(barnase) with male fertile(barstar) to get hybrid seed, which now has both barnase and barstar expressed in tapetum and, hence is fully fertile. Barstar is dominant over Barnase.

Hybrid Seed Production:

RNA interference for Male sterility:

“Development of male sterility by silencing Bcp1 gene of Arabidopsis through RNA interference”.

•Bcp1 is active in both diploid tapetum and haploid microspores. Three batches of explants (A. thaliana) were selected on herbicide glufosinate ammonium and putative transgenes were confirmed through PCR and Southern hybridization.

•Transgenic plants were phenotypically indistinguishable from nontransgenic plants and by crossing with non-transgenic fertile pollens successful seed set was observed.

How the procedure is carried out:

Total DNA was isolated from tobacco (Nicotiana tabacum cv. Samsun) by the CTAB method (Doyle and Doyle, 1990).

Primers used for amplification of Bcp1 were BCp1sf (5’-CTTTCTCGA GTTTCTGAGGTGTTGTATTTT-3’) and Bcp1sr (5’-ACTACCATGGTATTGCTAAGGAAAGTTTAA-3’) for the sense orientation and Bcp1af (5’- CTTTGGATCCTATTGCTAAGGAAA GTTTAA-3’) and Bcp1ar (5’-ACTATCTAGATT TCTGAGGTGT TGTATTTT-3’) for the anti-sense orientation.

Restriction endonuclease recognition sequences were included in the primers to allow cloning of the amplified fragments into appropriately digested vector.

Purified amplification products were ligated into pTZ57R/ T (Fermentas) and the complete sequence of the ‘‘sense’’ clone was determined. Subsequently, the separate sense and anti-sense fragments were transferred into the RNAi vector pFGC5941,

Agrobacterium -mediated plant transformation:

The gene construct Bcp1/pFGC was transformed in Agrobacterium tumefaciensstrain LBA4404 by electroporation.

The transformants were confirmed through PCR using forward and reverse primers.

The constructs was transformed in Arabidopsis using leaf disc method.Three batches of explants were selected on herbicide glufosinate ammonium.

The putative transgenic plants were confirmed through PCR using bar gene specific primers and Southern hybridization, which gives amplification along with positive and negative controls.

It was deduced that transcribed mRNA of RNAi construct will result into adsRNA with a hairpin loop and the resultant dsRNA triggered on theRNAi machinery. It was found that the dsRNA interfere the Bcp1 genefunction in the transgenic Arabidopsis plants and consequently male sterileplants were obtained.

Inducible Sterility:

•Male sterility is induced only when inducible chemical is applied.

N-acetyl-L-

phosphinothricin

selfing

Plants of male sterile line were transformed by a gene, argE, which codesfor N-acetyl-L-ornithine deacetylase, fused to TA29 promoter.

Induction of male sterility can occur only when non-toxic compound N-acetyl-L-phosphinothricin is applied.

Plant Transformed by TA29-argE

fertile

Plant Transformed by TA29-argE

fertile

Sterile plant Fertile plant

Fertile plant

Inducible Fertility:

If sterility was induced by inhibition of metabolite (amino acids, biotin, flavonols, jasmonic acid) supply, fertility can be restored by application of restricted metabolite and male sterile plant can be propagate by selfing.

Sterile Plant Restorer

Sterile Plant

Fertile Plant Fertile F1 Plant

Addition of restricted metabolite

selfing

Two-Component System:

Male sterility is generated by the combined action of two genes brought together into the same plant by crossing two different grandparental lines each expressing one of the genes.

Two proteins which are parts of barnase.

Two proteins can form stable barnase.

Each grandparent has each part of Barnase

Two-Component System

Xfertilefertile

sterile

Xfertilefertile

X

sterile

selfing selfing

Bn3 : 3’ portion of barnase gene

Bn5 : 5’ portion of barnase gene

A1 (Bn5/Bn5)

A (Bn5/Bn3)

A1 (Bn5/Bn5) A2 (Bn3/Bn3)

A2 (Bn3/Bn3)

B (- -)A (Bn5/Bn3)

F1 (Bn3/-)

F1 (Bn5/-)

fertile

fertile

fertile

Cytoplasmic Male Sterility via Chloroplast Genome:

CMS is induced by the expression of phaA gene in chloroplast in which the role of β-Ketothiolase governs the sterility.

Male sterility is observed due to hyper-expression ofβ-ketothiolase in leaves and anthers, with proportionately high levels of enzyme activity.

Reversibility of the male-sterile phenotype was observed under continuous illumination, resulting in viable pollen and copious amount of seeds.

Non-transgenic plants are used as the maintainer for the propagation of male sterile plants.

Reversibility in Male Fertility:

•Acetyl-CoA is the major component involved in the biosynthesis of fatty acid which results into male fertility provided with continuous illumination of light for 8 to 10 days.

•With the conversion of Acetyl-CoA into Acetoacetyl-CoA leads to the male-sterile phenotype.

•But, due to continuous illumination of light the process is reverted and it gets converted into Acetyl-CoA carboxylase which in the presence of constant light gets converted into malonyl-CoA because acetyl-CoA is not imported into plastids from the cytoplasm, it should be synthesized in this organelle.

•Based on the lack of increase in β-ketothiolase activity but increased Acetyl-CoA carboxylase activity during continuous illumination , de novo fatty acid biosynthesis enhanced in transgenic lines and this reversed male sterility.

Acetyl-CoA

β-ketothiolaseAcetoacetyl-CoA

Acetyl-CoA carboxylase

malonyl-CoADe novo

Fatty acid synthesis

Male Fertility

Male Sterility

Continuous illumination for upto 8 to 10 days

References:

a. Plant Breeding principles and methods, B.D.Singh; page no-86.

b. Research Papers;

1. Transgenic Male Sterlity For Hybrid Seed Production In Vegetables -A Review; M.Ananthi, P.Selvaraju And P.Srimathi

2. Cytoplasmic Male Sterility in Plants- A molecular perspective ; K.K.Vinod

3. Development of male sterility by silencing Bcp1 gene of Arabidopsis through RNA interference; Muhammad Tehseen,Muhammad Imran, Mazhar Hussain, Shazia Irum, Shahid Ali, Shahid Mansoor and Yusuf Zafar.

c. Wikipedia.

Thank you…