BioSc 231 General Genetics Exam 3 Name __________________________________

Multiple Choice. (2 points each)

_____The base thymine is always paired with ___.

A. AdenineB. GuanineC. CytosineD. Thymine

_____The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be

A. 5’ AGCTAG 3’B. 5’ TCGATC 3’C. 5’ CTAGCT 3’D. 5’ GCTAGC 3’E. 5’ GATCGA 3

_____ DNA polymerase III is thought to add nucleotides

A. to the 5' end of the RNA primerB. to the 3' end of the RNA primerC. in the place of the primer RNA after it is removedD. on single stranded templates without need for an RNA primerE. in the 3' to 5' direction

_____ DNA replication in vivo is discontinuous due to

A. polymerase slippageB. trinucleotide repeatsC. being restricted to synthesis in the 5' to 3' directionD. topoisomerases cutting the DNA in a random fashionE. sister chromatid exchange

_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?

A. ionicB. covalentC. Van der WaalsD. hydrogenE. hydrophobic and hydrophilic

_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA polymerase is able to initiate chains.

A. origin of replicationB. restriction endonucleaseC. palindromeD. primerE. promoter

_____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.

A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase

_____ ___ is an enzyme that catalyzes the formation of a covalent bond between adjacent 5'-P and 3'-OH termini of separate fragments of DNA.

A. origin of replicationB. convertaseC. primaseD. ligaseE. topoisomerase

_____ __ are enzymes that introduce single strand breaks, change the relationship of the strands and then seal the break to remove underwinding or overwinding of the DNA helix.

A. helicasesB. twistasesC. shoutasesD. topoisomerasesE. ligases

_____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds.

A. phosphodiester B. hydrogenC. hydrophobicD. hydrophilicE. ionic

_____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material?

A. It must carry all of the information needed to direct the specific organization and metabolic activities of the cellB. It must replicate accurately so that the information it contains is precisely inherited by the daughter cellsC. It must be capable of undergoing occasional mutations, such that the information it carries is altered in a heritable wayD. It must have highly repetitive DNA sequences.E. All are essential attributes of useful genetic material.

_____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called

A. NucleosomesB. EuchromatinC. ChromatidsD. HeterochromatinE. 30 nm chromatin

_____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNA

A. Has a single centromereB. Has telomeresC. Is circularD. Does not undergo supercoiling

_____ A chromosome with its centromere in the terminal end is a

A. Submetacentric chromosomeB. Metacentric chromosomeC. Acrocentric chromosomeD. Telocentric chromosome

_____ Which of the following is true regarding RNA processing?

A. Spliceosomes are present in organelles and nucleiB. Involves removal of exonsC. Involves removal of one or more introns.D. Occurs in prokaryotesE. None of the above

_____ Which of the following features is common to both DNA replication and transcription?

A. Nucleotides are added to the 5' end of the newly synthesized strandB. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphateC. Deoxyribonucleotides are incorporated into the growing sequenceD. Both RNA and DNA polymerase require oligonucleotide primingE. Both RNA and DNA polymerase initiate at promoter sequences

_____ Normal self-termination of transcription occurs due to the presence of

A. stem-loop sequences in mRNAB. Termination proteinsC. Multiple RNA polymerase moleculesD. Polyribosome formation

_____ The four ribonucleotide triphosphates incorporated into mRNA are

A. Inosine, Guanine, Uracil, ThymineB. Adenine, Guanine, Cytosine, ThymineC. Cytosine, Uracil, Adenine, GuanineD. Thymine, Uracil, Guanine, CytosineE. Inosine, Guanine, Adenine, Cytosine

_____ To describe the genetic code as degenerate indicates that

A. mRNA is rapidly degradedB. The code is not universal among organismsC. Some amino acids have more than one codonD. Frameshift mutations are toleratedE. Stop codons may have corresponding tRNA molecules

_____ Which of the following is unique to eukaryotic mRNA synthesis?

A. Polycistronic mRNAB. Coupled transcription-translationC. Removal of intronsD. Polysomes

_____ Which of the following is unique to prokaryotic mRNA synthesis?

A. Coupled transcription-translationB. Exon processingC. 3' polyadenylationD. mRNA cappingE. Promoter sequences

_____ Which of the following is true regarding the machinery of translation?

A. Initiation usually begins at an AUG codonB. Eukaryotes have nuclear ribosomesC. Polycistronic mRNA usually has a single ribosome binding siteD. tRNAs released from the ribosome are degradedE. Termination is at inverted repeats

_____ Nutritional mutants

A. Grow on minimal mediumB. Lack an essential metabolic proteinC. Are also called prototrophsD. Are the same as carbon-source mutantsE. Are usually antibiotic resistant

_____ The process of producing a RNA polymer from a DNA template is called __.

A. replicationB. transcriptionC. translationD. duplication

_____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __.

A. replicationB. transcriptionC. translationD. duplication

_____ Which of the following is not true for histones?

A. They are rich in basic amino acidsB. They are associated with the nucleosome.C. H1, H2, H3 and H4 form the nucleosome core.D. They are found in the nucleus.E. H1 functions as a monomer.

_____ Which of the following is not true about chromosome structure?

A. A telomere is always on the end of a eukaryotic chromosome.B. A centromere is always in the middle of a eukaryotic chromosomeC. A chromatid is a chromosome that has been replicated but has not yet separated from its sister chromatid.D. The kinetichore is the site of attachment of the centromere to the nuclear spindle apparatus.E. Heterochromatin are primarily associated with the centromere and telomere regions.

Short Answer. (variable points)

The table to the right shows the results of a series of experimentsto determine the sequence of intermediates in a biochemical pathway. 5 independent auxotrophic mutants which all require compound G (an amino acid) as a nutritional supplement were analyzed with 5 compounds that are precursors in the synthesis ofcompound G. Each mutant was grown on a minimal medium supplemented with each of the indicated compounds. + indicates growth that is supported by the indicated precursor. What is theorder of the intermediates in the pathway and indicate which step in the pathway is catalyzed by each mutant.

+-++++5+-+++-4+-----3+-+-+-2+-+---1GEDCBAM

u t a n t

Compound tested

The following 5 questions refer to the numbers on this figure.

A. What end (5' or 3') of the molecule is indicated by arrow number 1?

B. What end (5' or 3') of the molecule is indicated by arrow number 8?

C. What kind of nucleic acid is indicated by arrow number 4?

D. What do you call the short DNA fragments indicated by arrow number 5?

E. What enzyme functions to join the short fragments indicated by arrow number 6?

F. Which enzyme is indicated by arrow number 2?

Translate the following mRNA

5’ GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU

GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’

Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication. Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form. The bacteria were then transferred to a medium that only contained the light form of nitrogen. At different time points, DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the experiment, after 1 generation, after 2 generations and after 4 generations.

Starting DNA.

1 Generation

2 Generations

4 Generations

Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group.

Short Essay (6pts). Answer one of the following three questions.

1. List the enzymes and proteins involved in DNA replication. Describe the function of each.

2. Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells. Include all proteins involved in forming the structure and all intermediate structures

3. Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a prokaryote).

A) Promoter -10 and -35B) AUGC) Ribosome binding siteD) Coding sequenceE) Transcriptional terminatorF) Amino and carboxyl ends of the resulting protein.

Bonus question. (4 pts)

One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. A nucleotide analog has a structure and function similar to a nucleotide. Some of the nucleotide analogs being used to treat HIV infections are called dideoxy nucleotides. Dideoxy nucleotides include a ribose sugar that lacks both a 2’ and 3’ hydroxyl group. Based on what you know about nucleic acid synthesis, what effect do you think these analogs have on viral nucleic acid synthesis.