Biology II (Block III)

Importance of Biotechnology

Diagnostic Activity (2.1).

What is biotechnology?What are transgenic organisms?Are they dangerous?

- Transgenic Animals- Transgenic Plants

Have you ate genes?Which are some ethical issues related to this topic?

Biotechnology

Bio: LifeTechnology: is the making, usage, and knowledge of several things in order to solve a problem or perform a specific function.

Biotechnology: usage of living organisms, its parts or its processes to carry out specific functions or solve problems.

Oldschool biotechnology

Agriculture

Oldschool biotechnology

Brewing beer

NAD+ ADP

NADH ATP

NAD+

NADH

2 ethyl alcohol 2 Lactic acid

Glycolisis

Alcohoic Fermentation

Lactic Acid Fermentation

glucose

2 2

22

2 2

2 2

2 pyruvic acidNADH

NAD+

2CO2

Oldschool biotechnology

Leavened bread

NAD+ ADP

NADH ATP

NAD+

NADH

2 ethyl alcohol 2 Lactic acid

Glycolisis

Alcohoic Fermentation

Lactic Acid Fermentation

glucose

2 2

22

2 2

2 2

2 pyruvic acidNADH

NAD+

2CO2

Oldschool biotechnology

It is unknown when does humanity started using it but we know that has been existing for a very long time.In most of the cases we were using it without even knowing what was happening.It was used mostly for human consumption. As food.

DNA

Identifying the substance of genes.

Griffith Experiment.Griffith was a british scientist trying to understand how bacteria make people sick, more specificallt he wanted to learn how certain types of bacteria produce the serious lung disease known as pneumonia.

Identifying the substance of genes.

Transformation

Griffith reasoned that somehow, the heat-killed bacteria passed the disesase-causing ability to the harmless bacteria. He called this process Transformation. And he concluded that the transforming factor must be the gene.

Avery Experiment.

A group of scientist led by Oswald Avery, wanted to determine which molecule in the heat killed bacteria was most important for the process of transformation.

Avery Experiment.

By observing bacterial transformation, Avery and other scientists discovered that the nucleic acid DNA stores and transmits the genetic information from one generation of bacteria to the other one.

The Role of DNAWhat is the role of DNA in heredity?

Storing information• Cellular respiration• Mitosis• Immune systemCopying information• Cell cycle– S phase

Transmitting information

The structure of DNA

The Components of DNA

Deoxyribonucleic Acid , or DNA, is a unique molecule indeed. DNA is a nucleic acid made up of nucleotides joined into long strands or chains by covalent bonds.

The Components of DNANucleic acids: Long acidic molecules originally identified in cell nuclei.Like most macromolecules, they are made up of smaller sub units linked together to form chains.This subunits are called nucleotides and are made up of 3 basic components.

The components of DNANucleotide:•5-carbon sugar called deoxyribose•Phosphate group•Nitrogenous Base

Components of DNANitrogenous Bases- Bases that contain Nitrogen-4 Kinds (A, G, C and T):

- Adenine- Guanine- Cytosine- Thymine

Components of DNA

- The nucleotides in a strand of DNA are joined by covalent bonds between the P group and the sugar.- The nucleotides can be joined together in any order AGCCCTTTAAGCATAGTTTAGA

Solving the Structure of DNAKnowing that DNA is made u of chains of nucleotides was just the begining of understranding the structure of this molecule. The next step is related to the understanding of this molecule´s structure in 3 dimensions.

Chargaff´s Rule:An Austrian-American Biochemist, Erwin Chargaff, discovered that the percentages of thymine and adenine bases where almost the same on any DNA sample. The same thing is true for Cytosine and Guanine. The observation that %A = %T and %G = %C is known as Chargaff´s rule

Solving the structure of DNAFranklin´s X-rays:The british scientist Rosalind Franklin was working with DNA and X rays, she was able to obtain an image of the DNA based on the diffraction of X rays.-The image showed that the DNA strands are twisted forming a helix-And also suggest that the nitrogen bases are located near the center of the DNA molecule.

Solving the structure of DNAThe work of Watson and Crick:-The clues in Franklin´s X-Ray pattern enabled Watson and Crick to build a model that explained the specific structure and properties of DNA

-Watson and Crick´s breakthrough model of DNA was a double helix, in which two strands of nucleotide sequences were wound around each other.

The Double Helix ModelThe model proposed by Watson and Crick explain many of the most important properties of DNA.

•The double helix model explains chargaff´s rule of base pairing and how the two strands of DNA are held together.•It also tell us how DNA can function as a carrier of genetic information.

Antiparallel strands:The 2 strands of DNA that make up the molecule run in opposite directions, they are antiparallel.

The double Helix ModelHydrogen Bonding:•The two strands of DNA are held together by slight forces made between some nitrogenous bases, this forces are known as Hydrogen Bonds.•The forces that held this strands together should be “weak” enough so that they can be separated only when needed without using a lot of energy.

The Double Helix ModelBase Pairing:

A and T : 2 hydrogen bondsG and C : 3 hydrogen bonds

Waton and crick realized thatthis base pairing explainedChargaff´s rule

Activity II.31) List the chemical components of DNA.2) Why are hydrogen bonds so essential to the structure of

DNA?3) Describe the discoveries that led to the modeling of

DNA.4) Why dos scientists have to use other tools rather than

microscopes to solve the structure of DNA?5) Describe Watson and Crick´s model of the DNA

molecule.6) Did Watson and Crick´s model account for the equal

amounts of thymine and adenine? Explain.

DNA Replication

Copying the codeWhen Watson and Crick discovered the structure of DNA, they immediately recognized one genuinely surprising aspect of the structure. Base pairing in the double helix explains how DNA can be coied, or replicated, because each base on one strand pairs with one – and only one – base on the opposite strand

The replication processBefore cells divide they duplicate its DNA through a copying process called replication.

During this process the DNA molecule seperates into two strands and then produce two new complementary strands following the rules of base pairing.

Each strand of the double helix of DNA serves as a template or model for the new strand.

The Replication Process

The role of EnzymesThese process of DNA replication is carried out by a series of enzymes which first unzip a molecule of DNA by breaking the hydrogen bonds between base pairs and unwinding the two strands of the molecule.

*Enzymes are proteins with highly specific functions.

The principle enzyme involved in the DNA replication is called DNA polymerase which joins individual nucleotides to produce a new strand of DNA.-

The role of enzymesBesides producing the phosphate-sugar bond between the nucleotides, DNA polymerase also proofreads each new DNA strand, so that each molecule is a near-perfect copy of the original.

TelomeresDNA tips of chromosomes are known as telomeres, which is particularly difficult to replicate. Cells use a special enzyme called telomerase, to solve this problem by adding short repeated sequences of DNA to the telomeres

DNA replication in prokaryotes and eukaryotes

• Eukaryotes have more DNA, closely to 1000 times more.• In eukaryotes most is find on the nucleus packaged as

chromosomes.• In prokaryotes there´s only one origin of relication.• Eukaryotes have several origins of replication.

DNA replication mistakes

Although a number of proteins check the DNA for chemical damage or base pairing mis matches, prior to replication, the system is not foolproof.

Damaged regions of the DNA are sometimes replicated, resulting in changes to DNA base sequences that may alter certain genes and produce serious consequences.

Activity II.41) How is DNA replicated? Explain.2) What is the role of the DNA polymerase in DNA replication. 2

things.3) Where and in what form is prokaryotic DNA found? Where is

eukaryotic DNA found?4) What would be the result of damaged, and not fixed, DNA being

replicated. Remember mitosis and meiosis.5) Make a DNA template using all the As, Ts, Gs and Cs found in this

slide in the order that they appear. After this, write down which wolud be the complementary strand, as if you where the DNA polymerase, using base pairing.

The Role of RNAComparing RNA and DNA

1) RNA is also a nucleic acid and just as DNA is made up of nucleotides. But there are small differences between the nucleotides of RNA from the ones of DNA

2) Another difference between RNA and DNA is that RNA, in most cases, is single stranded.

DNA RNA

Sugar: Deoxiribose Sugar: Ribose

Bases: A, G, C and T Bases: A, G, C and U (uracil)

The Role of RNAComparing RNA and DNA

1) How else can we explain the difference between RNA and DNA?

The Role of RNAFunctions of RNA

1) You can think of RNA as a disposable copy of a segment of DNA. RHA has many functions, but most RNA molecules are involved in just one job – protein synthesis.

2) Protein synthesis requires of 3 different kinds of RNA1) Messenger RNA (mRNA)2) Ribosomal RNA (rRNA)3) Transfer RNA (tRNA)

The Role of RNAFunctions of RNA

1) Messenger RNA: as its name says these are molecules of RNA that carry the instructions to build proteins found in genes. They carry the information from DNA (indide the nucleus) to other parts of the cell.

2) Ribosomal RNA: proteins ar assembled on ribosomes, small organelles composed of two subunits. These subunits are made up of several ribosomal RNA molecules and as many as 80 different proteins.

The Role of RNAFunctions of RNA

3) Transfer RNA: when a protein is built, a third type of RNA molecule transfers each amino acid to the ribosome as it is specified by the coded messages in mRNA. These molecules are known as transfer RNA.

RNA synthesisTranscription

Most of the work of RNA takes place during transcription. In transcription, segments of DNA serve as templates to produce complementary RNA molecules.

In prokaryotes, RNA synthesis an protein synthesis take place in the cytoplasm. In eukaryotes, RNA is produced in the cell´s nucleus and then moves to the cytoplasm to play a role in the production of protein.

RNA synthesisTranscription

The enzyme related in the process of transcription is called RNA polymerase. Just as in DNA replication, in RNA a RNA polymerase attaches to a DNA template but instead of making a DNA copy, it transcripts the information from DNA to RNA.

Promoters: How does RNA polymerase know where to start and top making a strand of RNA?

RNA SynthesisPromoters

The RNA polymerase doesn´t attach randomly to the DNA, it attaches to a specific place on the DNA molecule known as the promoter

RNA EditingBefore the RNA molecule is ready to take the message from the DNA to the ribosomes, it needs to be edited, this RNA is known as pre-mRNA.

RNA SynthesisEditing

In order to be “edited” the RNA needs to remove some regions of this pre-mRNA molecule known as introns.

After these segments are removed only the regions of the RNA that are important for the protein synthesis remain. These regions are known as exons.

Activity 5

1. Describe 3 main differences between DNA and RNA.2. List the 3 types of RNA and explain what they do.3. Describe what happens during transcription.4. What do you think will happen if introns are not

removed from the pre-mRNA?

Ribosomes and Protein SynthesisThe Genetic Code

Polypeptide: long chains of amino acids joined together.As many as 20 different AA are found on polypeptides.What would determine the properties of different proteins?

- The specific AA present on the polypeptide- The order of the AA

Lys Lys Lys Met

Lys Lys Lys Met

Lys Met Lys Met

The Genetic CodeHow is the order of bases in DNA and RNA molecules translated into a particular order of AA in a polypeptide?

Theres a lenguage used by the cells in order to know how to make this. This lenguage use “4 letters” A, G, C and U to make “words” and it is called Genetic Code. The “words” will always be read in groups of 3 letters and any possible combination of this 4 letters, making words of 3 letters in any order, will be specific for a determined AA. These 3-letter “words” are called: codons.

The Genetic Code: ¿How to read the codons?- AA can be repeated for different codons.- AA can have only one codon- Start and stop codons?

The Genetic Code: ¿How to read the codons?

Translation

Ribosomes use the sequences of codons in mRNA to assemble AA into polypeptide chains. The decoding of an mRNA message into a protein is a process known as Translation.

Translation: Steps

Step 1:Translation begins when a ribosome attaches to a mRNA molecule in the cytoplasm. As each codon passes through the ribosome, tRNAs bring the propper AA into the ribosomes. One at a time the ribosomes then attaches these AAs to the growing chain.

Each tRNA molecule carries just oe kind of AA. In addition, each tRNA molecule has three unpaired bases, collectively called anticodon. Each tRNA anticodon is complementary to one mRNA codon.

Translation: Steps

Step 2: As the ribosome continues reading the message from the mRNA, the tRNA that are being called bring specific AAs depending on the information of the mRNA and the ribosomes start making chains of these.

Step 3: The polypeptide chain continues growing until the ribosome reaches a “stop” codon on the mRNA molecule. After this the ribosome releases both the mRNA and the polypeptide chain and disassembles.

Translation: Steps

Activity 6

What are codons and anticodons?What happens during translation?Why can cells produce DNA starting from a RNA template, but cannot synthetise a RNA or DNA molecule using the information of a template made of AAs?Use this molecule to obtain the RNA molecule and the polypeptide chain.DNA: GGGCCTACCCTACGGTTAGCCGGGTTGGGCCCTGCTACTGG

RNA:

Pro:

MutationsTypes of Mutations

Mutations: heritable changes in genetic information2 main types:

- gene mutations- chromosomal mutations

Gene mutationspoint mutations

1) Insertions and deletions are also called framshift mutations.

Chromosomal Mutations

Effects of mutations

1) Genetic material can be altered by natural means (mistakes made by the DNA/RNA polymerase) or by artificial means (caused by human activity). The resulting mutations may or may not affect the organism.

Many mutations are produced by errors in genetic processes.

- Point mutations: Replication/Transcription- Chromosomal mutations: ????????

Effects of mutations

1) Mutagens: Chemical or physical agents from the environment that cause mutations.

Chemical: Tobacco smoke, smog, etc.Physical: Radiation, UV rays, Gama rays, X rays, etc.

The effects of mutations on genes vary widely. Some have little or no effect; and some produce benefical variations. Some negatively disrupt gene function.

Effects of mutations

1) Benefical effects: Mutations often produce proteins with new or altered functions that can be useful to organisms in different or changing environments.

Activity 7

1) Describe the 2 main types of mutations2) What is a frameshift mutation?3) List three effects mutations can have on genes.4) What is the significance of mutations to living things?

Activity 8

Make a summary of a page long including all the topics and keyconcepts that we have seen until now. Be sure to highlight or underline the keyconcepts and topics.

From molecule to phenotype

How do small changes in DNA molecules affect human traits?We know that genes are made up of DNA and that they interact with the environment to produce an individual organsim´s characteristics, or phenotype. However when a gene fails to work or works improperly, serious problems can result.

From molecule to phenotype

There´s a direct link between genotype and phenotype, for example:Ear wax

Wet earwax

Dry earwax

From molecule to phenotype

A simple base change from guanine (G) to adenine (A) causes this protein to produce dry earwax instead of wet earwax.

The conection between molecule and trait, and often between genotype and phenotype, is often that simple, and just as direct. Changes in a gene´s DNA sequence can change proteins by altering their aminoacid sequences, which may directly affect one´s phenotype.

Disorders caused by individual genes

Sickle cell diseaseThis disorder is caused by a defective allele for beta globin, one of the two polypeptides in hemoglobin, the oxygen-carrying protein in red blood cells. The defective protein makes hemoglobin a little bit less soluble causing hemoglobin molecules to stick together when blood´s oxygen level decreases. The molecule clump into long fibers, forcing cells into a distinctive sickle shape, which gives the disroder its name

Disorders caused by individual genes

Disorders caused by individual genes

Cystic fibrosisIs caused by a genetic change. In most cases it results from the deletion of just three bases in the gene for a protein called cystic fibrosis transmembrane regulator (CFTR). CFTR normally allows chloride ions (Cl-) to pass across cell membranes. The loss of the three bases remove a single aminoacid (Phe) from CFTR, causing the protein to fold improperly and thus being destroyed. With the cell membranes unable to transport chloride ions, tissue throughout the body malfunction.

Disorders caused by individual genes

Children with CF have serious digestive problems and produce thick, heavy mucus that clogs their lungs and breathing passageways

Huntington´s disease

It is caused by a dominant allele for a protein found in brain cells. The allele for this disease contains a long string of bases in which the codon CAG-coding for the aminoacid glutamine – repeats over and over again more tha 40 times.

This disease causes mental deterioration and uncontrollable movements, ussually do not appear until middle age, the greater the number of codons the earlier the disease appears, and the more severe are its symptoms.

Huntington´s disease

Chromosomal disorders

What are the effects of errors in meiosis?

The most common error in meiosis occurs when homologous chromosomes fail to seperate. This mistake is known as nondisjunction.

If nondisjunction occurs during meiosis, gametes with abnormal # of chromosomes may result, leading to a disorder of chromosome number.

Chromosomal disorders

Trismoy 21 (Down´s Syndrome)

Chromosomal disorders

Non disjunction of the X chromosome can lead to a disorder known as Turner´s syndrome. A female with this syndrome usually inherits only one X chromosome, which means they would be sterile. Their sex organs do not develope during pubery.

In the case of men, the nondisjunction of chromosome X causes the Klinefelter´s syndrome which means that this people have 3 X chomosomes interfering with meiosis and preventing these individuals from reproducing.

Activity 9

1) How can a small change on a person´s DNA cause a genetic disorder?

2) Describe 2 sexual chromosomal disorders.3) How does nondisjunction causes a chromosomal

disorder?4) What causes Cystic Fibrosis?5) What causes Sickle Cell disease?

Crops(maize)

Also known as “corn”, maize constitutse a staple food in many regions of the world. Introduced into Africa by the Portuguese in the 16th century, maize has become Africa's most important staple food crop.

Maize is used world wide in many ways, being as food one of the most important uses of mankind.

Crops(maize)

Other uses:

Crops(maize)Plagues:

•Insects•Corn earworm (Helicoverpa zea)•Fall armyworm (Spodoptera frugiperda)•Common armyworm (Pseudaletia unipuncta)•Stalk borer (Papaipema nebris)•Corn leaf aphid (Rhopalosiphum maidis)•European corn borer (Ostrinia nubilalis) (ECB)•Corn silkfly (Euxesta stigmatis)•Lesser cornstalk borer (Elasmopalpus lignosellus)•Corn delphacid (Peregrinus maidis)•Western corn rootworm (Diabrotica virgifera virgifera LeConte)•Southwestern corn borer (Diatraea grandiosella)•Maize weevil (Sitophilus zeamais)

Oil spills

An oil spill is the release of a liquid petroleum hydrocarbon into the environment, especially marine areas, due to human activity, and is a form of pollution. The term is mostly used to describe marine oil spills, where oil is released into the ocean or coastal waters.