biology and geology 4
TRANSCRIPT
Biology and Geology SE
CO
ND
AR
Y
4Biology and Geology 4 is a collective work, conceived, designed and created by the Secondary Education department at Santillana, under the supervision of Teresa Grence.
WRITERS Leonor Carrillo, Michele C. Guerrini, Antonio Delgado, Rebecca Hendry, Miguel Ángel Madrid, Claudia Mitchell, Heather Sutton, Alison Warner
EDITORS Belén Álvarez, Michele C. Guerrini, Beatriz G. Hipólito, Adela Martín, Daniel Masciarelli, Virginia R. Mitchell
CLIL CONSULTANTS Sebastián Bellón, Pablo Bustos, Christianne Ellison
EXECUTIVE EDITORS Begoña Barroso, Nuria Corredera, Sheila Tourle
PROJECT DIRECTOR Antonio Brandi
BILINGUAL PROJECT DIRECTOR Margarita España
Do not write in this book. Do all the activities in your notebook.
GEOLOGY 1. The structure and dynamics of the Earth 6
1. The origin of the solar system and the Earth2. The internal structure of the Earth3. The geodynamic model4. The internal engine of the Earth5. Vertical movements of the lithosphere6. Horizontal movements of the lithosphere7. Plate tectonics
2. Tectonics and relief 24
1. Convergent boundaries2. Divergent boundaries and transform boundaries3. Intraplate phenomena: hotspots4. Interaction between internal and external dynamics. The rock cycle5. Folds6. Joints and faults7. Representation of relief. Topographic maps
3. History of the Earth 42
1. Historical ideas about the age of the Earth2. Actualism and uniformitarianism3. What do fossils tell us?4. Measuring geological time5. Relative geochronology6. Historical geology7. The Precambrian: the most distant past8. The Palaeozoic Era: diversity of life9. The Mesozoic Era: the age of reptiles
10. The Cenozoic Era: the age of mammals
BIOLOGY 4. Structure and dynamics of ecosystems 64
1. The structure of an ecosystem2. Abiotic factors and adaptations3. Tolerance limits and limiting factors4. Habitat and ecological niche5. Biotic relationships6. Populations in ecosystems7. Feeding relationships8. Trophic pyramids9. Energy and matter in ecosystems
10. Biogeochemical cycles in ecosystems11. The carbon cycle12. The nitrogen cycle13. The phosphorus and sulphur cycles14. The evolution of ecosystems
5. Human activity and the environment 88
1. Natural resources2. Human activities and their impacts on ecosystems3. Negative impacts on the atmosphere4. Negative impacts on the hydrosphere5. Negative impacts on soil6. Negative impacts on the biosphere7. Overpopulation and its consequences8. Sustainable development9. Waste
10. Waste management11. Recycling12. Renewable energy sources
CONTENTS
6. The cellular organization of living things 110
1. Cell theory2. Cell types and their evolution3. Eukaryotic cells4. The cell nucleus5. The cell cycle6. Chromosomes7. Cell division8. Meiosis
7. Heredity and genetics 128
1. Mendel and the study of heredity2. The birth of genetics3. Mendel's laws4. Problem-solving in genetics5. Incomplete dominance and codominance6. Chromosome theory of inheritance 7. Human genetics 8. Genetic sex determination9. Genetic disorders
10. Preventing and diagnosing genetic disorders
8. Genetic information and manipulation 150
1. DNA and nucleic acids2. DNA replication3. From DNA to proteins4. Expression of genetic information5. Mutations6. Biotechnology and genetic engineering7. Genetic engineering techniques8. Applications of biotechnology9. Cloning and stem cells
10. The Human Genome Project11. Bioethics
9. The origin and evolution of life 172
1. The origin of life2. The origin of biodiversity3. Lamarck and the inheritance of acquired characteristics4. Darwin and Wallace. Natural selection5. The genetic basis of variability 6. The most common evolutionary mechanisms7. Evidence for evolution8. Adaptation and speciation9. Current evolutionary models
10. Hominization11. Human evolution
Cooperative projects 196
Scientific glossary 202
Classroom language 208
Lab experiments 214
National Parks of Spain 228
LET'S WORK TOGETHER
1 This book covers the curriculum in a clear, comprehensive and rigorous way.
3 The images will help you to understand the contents more easily.
You will be able to practice listening comprehension in some activities.
Listening
5 A series of final activities encourage and consolidate learning.
2 Each unit deals with one of the United Nations' Sustainable Development Goals. This knowledge can be a tool to improve the world around us.
4 Specific activities are designed to work on 21st century competences:
Competence in Mathematics, Science and Technology
Linguistic competence
Learning to learn
Social and civic competence
Digital competence
Initiative and entrepreneurship
Structure and dynamics of ecosystems4
FIND OUT ABOUT
• The structure of an ecosystem.
• Abiotic factors and adaptations.
• Tolerance limits and limiting factors.
• Habitat and ecological niche.
• Biotic relationships.
• Populations in ecosystems.
• Feeding relationships.
• Trophic pyramids.
• Energy and matter in ecosystems.
• Biogeochemical cycles in ecosystems.
• The carbon cycle.
• The nitrogen cycle.
• The phosphorus and sulphur cycles.
• The evolution of ecosystems.
KNOW HOW TO
• Measure abiotic factors in terrestrial and aquatic ecosystems.
• In which ecosystems can the lynx live?
• Why is the lynx in danger of extinction? Find information on the Internet.
HOW DO WE KNOW?
What is camera trapping?Camera trapping is used for carrying out research into fauna and controlling the species. It involves taking photos with concealed or camouflaged equipment. No human beings are involved.
Scientists use camera trapping to monitor populations of animals such as the Iberian lynx, an endangered feline. A camouflaged camera is positioned on the ground, facing some bait. The bait, which contains lynx urine, attracts other lynxes. A pressure pad is connected to the trigger mechanism on the camera. It is placed below the camera stand. When a lynx smells the bait, it approaches and steps onto the pad. This activates the trigger mechanism: a photo is taken instantaneously.
OPINION. Why do you think techniques like camera trapping are necessary to protect endangered species?
STARTING POINTS
• What is an ecosystem?
• What do you think habitat and ecological niche mean?
• Do you think ecosystems evolve? Why? / Why not?
• In your opinion, can a population grow indefinitely? Explain your answer.
Photos help scientists to calculate how many lynxes live in a given area. They are also used to identify individuals by examining the spots on each animal. Photos provide information on the sex and approximate age of the individuals, too.
Cameras can remain in position for weeks or months. They are checked periodically and the bait is replaced.
WORK WITH THE IMAGE
Protect, restore and promote sustainable use of ecosystems, and integrate ecosystems and biodiversity values into national and local planning.
64 65
1
2
3
4
5
6
7
8
ACTIVITY ROUND-UP
15 A double-stranded DNA molecule contains 35 % guanine (G). What percent is cytosine (C), adenine (A) and thymine (T)?
16 Laboratory analysis provided this sequence of nucleotides:
…AGCCAUGCCUCAAAAAAUGCACGGGACGUA…
a) What nucleic acid does it belong to?
b) According to the genetic code, could this sequence of nucleotides produce a protein? If so, how many amino acids would it have? What would they be?
17 State the sequence of amino acids that will be coded for by the following DNA fragment:
…AAA GAT AGA ATA ACA TCC CCA CCC CGA CGT…
a) Could the sequence of amino acids stay the same if a mutation changed the base that is indicated? Explain why or why not.
b) What is the smallest number of nucleotides that would have to change for the protein obtained to differ from the normal sequence by one amino acid?
18 A person developed skin cancer due to prolonged exposure to UV rays on a tanning bed.
a) What caused the mutation?
b) Will this person's children inherit this mutation?
19 A group of scientists used genetic engineering to produce transgenic plants that glow in the dark. To do this, they inserted a gene from fireflies that produces luciferase, a protein.
a) Describe the steps taken to obtain the transgenic plants.
b) What use could these plants have?
20 Prepare a digital presentation on biotechnology and genetic engineering. Give examples for these areas:
a) Medicine and pharmacology.
b) Environmental biotechnology.
1 Write a brief summary of each of the headings in the unit.
2 Match the pairs. Then write sentences.
• thymine
• ribose
• uracil
• deoxyribose
• adenine
• nitrogenous base
• carbohydrate
• found in DNA
• found in RNA
• contains five carbon atoms
3 Look at the diagram and answer the questions.
a) What type of molecule is shown? How do you know?
b) What does each number represent?
c) How are the nitrogenous bases in both strands joined?
d) How would you describe the two strands?
4 Copy and complete the table in your notebook.
5 DNA replication is called a semi-conservative process. What does this mean? In what part of the cell does DNA replication occur? And at what moment of the cell cycle?
6 Look at the diagram. The numbers in the diagram below indicate the molecules, organelles and processes involved in the expression of genetic information. Write a label for each number.
7 What is a codon? How is it related to the genetic code?
8 Describe the function of transfer RNA (tRNA).
9 Draw and complete a concept map of the different types of mutations.
10 What is biotechnology? How is current biotechnology related to genetic engineering?
11 Define these terms. • vector • genetically modified organism • DNA ligase • bioremediation • restriction enzyme
12 Using recombinant DNA technology, what steps must be taken to make a bacterium produce growth hormone?
13 Some diseases are now being treated with gene therapy. Explain this technique.
14 Copy the diagram. Label the structures and components. Explain the two processes.
CRITICAL THINKING. How are we protected from genetic discrimination?
Universal Declaration on the Human Genome and Human Rights
A. Human dignity and the human genome
Article 1. The human genome underlies the fundamental unity of all members of the human family, as well as the recognition of their inherent dignity and diversity. In a symbolic sense, it is the heritage of humanity.
Article 2.
a) Everyone has a right to respect for their dignity and for their rights regardless of their genetic characteristics.
b) That dignity makes it imperative not to reduce individuals to their genetic characteristics and to respect their uniqueness and diversity.
Article 3. The human genome, which by its nature evolves, is subject to mutations. It contains potentialities that are expressed differently according to each individual's natural and social environment, including the individual's state of health, living conditions, nutrition and education.
Article 4. The human genome in its natural state shall not give rise to financial gains [...]
UNESCO. 11th November, 1997.
21 What is UNESCO?
22 Why did UNESCO make a declaration about the Human Genome Project?
23 Summarize each article in your own words.
24 Should discrimination for genetic reasons be allowed? Give examples to explain your opinion.
25 This UNESCO declaration has 25 articles. Choose one article that is not presented here and summarize it briefly.
1
2
3 4 5
6 7
A B
Characteristics DNA RNA
Chemical composition
Carbohydrate
Nitrogenous bases
Structure
Function
168 169
Genetic information and manipulation 8
Lithosphere
The lithosphere consists of the crust and the uppermost part of the mantle. It is dragged along by the movement of the mantle underneath. As a result, it has been fractured into large blocks called lithospheric plates. These plates fit together like a jigsaw puzzle, and are subjected to two types of movement:
• Horizontal movements due to plate tectonics.• Vertical movements due to isostatic adjustment.
The geodynamic model of the internal structure of the Earth is based on:
• The physical state of the layers: plasticity, rigidity and density.
• The mechanical properties of the layers; that is, how they respond to changes in pressure and temperature.
According to the geodynamic model, the Earth is a heat engine. Within it, temperature changes cause atoms and molecules to be agitated. This agitation modifies the structure and composition of materials, generating movement and pressure. This pressure can be released slowly or quickly, transforming thermal energy into mechanical energy.
This model divides the Earth into layers. From the surface inwards, they are: the lithosphere, asthenosphere, mesosphere, D" layer and the core.
3The geodynamic model
• Understand the geodynamic model of the Earth.
LEARNING OBJECTIVES
Mesosphere
The mesosphere is the lower mantle. It extends from a depth of 670 km to the D" layer. Although it is solid, the mesosphere is not static. It flows, but very slowly: a few centimetres per year. Cold lithospheric plates from the subduction zones can descend into it and mantle plumes from the D" layer underneath can reach it.
The core
In both the geochemical and the geodynamic models, the core consists of two parts: inner and outer. The heat in the solid inner core spreads to the liquid outer core. This generates convection currents that push heat out of the core into the D" layer, where it accumulates.
These convection currents also generate the Earth's magnetic field.
The magnetic field consists of invisible dynamic lines of force. These lines cross the Earth between two magnetic poles. Unlike the geographical poles, the magnetic poles are not fixed. The distance between them varies over time.
The D" layer
The D" layer is one of the most dynamic layers of the Earth. Heat from the outer core accumulates here, and hot magma escapes from this layer as mantle plumes. The plumes break through the lithosphere, creating hotspots: areas of intense volcanic activity, such as the Hawaiian Islands.
Asthenosphere or sublithospheric upper mantle
This layer lies between the lithosphere and the mesosphere. Scientists believe it coincides with the lower part of the upper mantle. It is a plastic malleable layer with a tendency to flow as the lithosphere moves.
Continental lithosphere
Isostatic adjustment 75–100 670 2 900 5 100 6 378
Kilometres
Sublithospheric upper mantle or asthenosphere
Lower mantle or mesosphere
Axis of rotation
Magnetic field
1 Look at the diagrams. Listen and choose the correct answer.
WORK WITH THE IMAGE
Hotspot
D" layer
Mesosphere
AsthenosphereMantle plume
Eruption of the Kilauea volcano.
2 How is heat moved up from the core to the lithosphere?
3 Look for information about the asthenosphere and explain why its existence has been controversial in the history of geology.
ACTIVITIES
Oceanic
lithosphere
12 13
The structure and dynamics of the Earth 1
6 Critical thinking. You will be able to practice critical analysis of scientific texts, a valuable tool in today's information society.
7 Know how to. You will apply your knowledge and improve your scientific competence.
8 Cooperative project. These activities and tasks are designed to be done in groups or in pairs.
Great scientists. You will learn about the lives of great scientists and their contributions to science, as well as other interesting facts about them.
1 Agnodice
Biography
Agnodice was born in the 4th century BC into a wealthy Athenian family. She wanted to become a doctor, but women were not allowed to practise medicine at the time. In order to study Medicine, she cut her hair short, bandaged her breasts and dressed as a man.
She travelled to Egypt to take classes with Alexander the Great’s famous doctor at the School of Alexandria. She got the highest results in her exams and graduated in the discipline that we now call gynaecology.
She returned to Athens to work as a gynaecologist. Many women refused to be treated by a man, so Agnodice revealed her true identity so that they would let her help them. This was passed on from one woman to another and her number of patients increased. Male gynaecologists began losing patients. Driven by envy, they accused her of seducing married women.
Agnodice was taken to court, accused of raping two women. At the trial, she stripped in front of the jury to reveal her identity. The jury removed the rape charges, but charged her for practising gynaecology as a woman.
She was sentenced to death. However, her patients defended her and said they would not have children if Agnodice was not there to deliver them. The jury acquitted Agnodice and allowed her to continue working as a gynaecologist.
Scientific work
• Agnodice managed to save the lives of many women who refused to be treated by men during childbirth. As such, she is considered the first female doctor and gynaecologist.
• Agnodice fought to improve gender equality. She managed to change the law that prohibited women from practising medicine. One year after her acquittal, the law was modified to allow women to study and practise Medicine, although only to treat other women.
Interesting facts
• Hyginus, a first century Latin writer, wrote about Agnodice in his Fabulae 174. This suggests that she was really a mythical figure. Whether she actually existed or not, she is a role model for women in general, especially for those who work in medicine. For this reason, a medal that recalls her legacy is displayed at the Paris School of Medicine.
‘The wives of the leading men of Athens claimed: "You men are not spouses, but enemies, since you are condemning her who discovered health for us." Then the Athenians emended the law so that freeborn women could study Medicine.’
Fabulae, Hyginus, 1st century BC
School of Athens, Raphael
4
2 Alfred Nobel
Biography
Alfred Nobel was born in 1833 in Stockholm (Sweden). When he was nine years old, he moved to St Petersburg (Russia), where his father opened an arms factory. Alfred learned the basics of engineering from his father. Then he travelled to France to continue his technological studies. When Alfred returned to St Petersburg, the arms factory went bankrupt and his family returned to Sweden. In Sweden, Alfred set up a nitroglycerin factory. It was very successful thanks to the production of dynamite. Alfred expanded his business to other countries and made a huge fortune.
Alfred Nobel died in 1896. In his will he donated almost his entire fortune to create what is now known as the Nobel Prize.
Scientific work
• In 1864, Alfred Nobel’s brother was killed in a nitroglycerin explosion at one of his factories. As a result, Nobel worked to develop a safer explosive. He discovered that nitroglycerin could be mixed with a sand called diatomite to form a powder that could be transported without exploding. He shaped the new product into bars and created electric detonators. Nobel named the new product dynamite from the Greek word for power.
• Nobel created many other inventions. He patented an automatic brake and an anti-explosion boiler. He also invented a system for distilling oil and exploited Russian oilfields. He devised mechanisms to enable the refining of cast iron. One of Nobel’s last contributions was the creation of smokeless gunpowder.
• Nobel’s inventions were ground-breaking because they facilitated the work of mining, engineering and construction. However, these inventions were also used by the military industry. This made Nobel feel guilty for contributing to the destruction caused by war. This feeling and his concern for world peace led Alfred Nobel to donate his fortune to the creation of the Nobel Prize.
Interesting facts
• Alfred Nobel’s will states that: ‘All of my remaining realisable assets are to be disbursed as follows: the capital is to constitute a fund, the interest on which is to be distributed annually as prizes to those who, during the preceding year, have conferred the greatest benefit to humankind. […] It is my express wish that when awarding the prizes, no consideration be given to nationality, but that the prize be awarded to the worthiest person.’
• The Nobel Foundation is responsible for awarding these prizes, which are the most prestigious international prizes. They have been awarded since 1901.
‘Self-respect without the respect of others is like a jewel which will not stand the daylight.’
Alfred Nobel
Nobel Prize medal
5
SE
CO
ND
AR
Y
SE
CO
ND
AR
Y
The best of both worldsclil.santillana.es
Biology and GeologyGreat scientists
Biology and Geology Great scientists 44
ES0000000122404 136491_EVA_Bio_Geol_4_106039
ES0000000122404 136491_EVA_Bio_Geol_4_106039.indd 1 21/12/2020 11:51:45
KNOW HOW TO Scientific competence
Interpret karyotypes
Each eukaryotic species possesses a characteristic set of chromosomes. The chromosomes are of different shapes and sizes. When stained, they display different coloured bands.
The arrangement of homologous pairs of chromosomes by size and shape is called a karyotype. The karyotype is used to count the number of chromosomes and detect chromosome abnormalities.
Preparing a human karyotype involves many steps. First, images of the chromosomes to be studied are required.
1. Somatic cells are obtained, for example:
– Lymphocytes from the blood of an adult.
– Foetal cells from amniotic fluid.
2. The cells are cultured for several days. The culture medium contains substances to stimulate cell division.
3. A chemical is added to stop cell division in metaphase.
4. The chromosomes are isolated and stained. Most techniques used today produce different bands on the chromosomes. Each homologous pair of chromosomes can be compared band by band to detect structural changes.
5. The stained chromosomes are observed under a microscope fitted with a digital camera and photographs are taken.
Next, the chromosomes are arranged by size and centromere position, in descending order of size.
The procedure is as follows:
1. Enlarged photos are made and the chromosomes are cut out. The number of chromosomes is counted and recorded.
2. Similar chromosomes are identified. In the human karyotype, the chromosomes are classified into seven groups by shape and size.
By convention, the sex chromosomes are not placed in these groups. The X and Y chromosomes are placed separately at the end of the karyotype.
3. If there are more than 46 chromosomes, the extra one is identified and placed in its group. The syndrome produced by this abnormality is stated.
Group Chromosomes Shape and size
A 1, 2 and 3Large meta- and submetacentric
B 4 and 5 Large submetacentric
C 6–12 and X Medium submetacentric
D 13, 14 and 15 Medium acrocentric
E 16, 17 and 18Small meta- and submetacentric
F 19 and 20 Small metacentric
G 21, 22 and Y Small acrocentric
Laboratories describe the karyotype using universal nomenclature: the total number of chromosomes is indicated, followed by a comma and the sex genotype.
If there is one chromosome too many or too few, a + or – sign is added, then the number of the affected chromosome. For example:
• 46,XX: female.
• 47,XX,+21: female with three copies of chromosome 21.
• 46,XY: male.
• 47,XXY: person with three sex chromosomes.
17 Why should you use dividing cells to prepare a karyotype?
18 You have to differentiate one chromosome from another. What characteristics would you use? Why?
19 Look at the karyotype on the previous page.
a) Does it correspond to a man or a woman?
b) Are there any anomalies? Explain your answer.
20 Make an enlarged copy of this image. Then do the activities.
a) Make a karyotype. Group the chromosomes using their size and the bands on each arm.
b) How many autosomes does it have? And sex chromosomes? Write the karyotype using universal nomenclature.
c) Are there any anomalies? If so, describe them.
• Remember to differentiate between plant and animal cells.
• Share your slideshow with the class.
COOPERATIVE PROJECT
The cellular organization of living things 6
Stained human chromosomes. Karyotype of a human being.
A digital slide show on mitosis
Work in groups of four. Assign these tasks:
• Find a video on the Internet about cell reproduction that shows cells dividing. Edit it into five parts. Insert each part in a slide.
• Draw a simple diagram of each phase. Label the components, structures and organelles shown in the video. Scan the diagram and insert it into the slide.
• Write a brief explanation of each slide. Try to be precise and concise: do not overload each slide with too much information.
• If you wish, you can record an audio file for every slide to explain what happens in each phase.
126 127
9 At the end of the book you will find:
– Scientific glossary
– Lab experiments
– National Parks of Spain
1. The structure and dynamics of the Earth
geochemical model the internal structure of the Earth is based on the chemical composition of its internal layers.
geodynamic model the internal structure of the Earth is based on the physical state and mechanical properties of its layers.
geothermal gradient the increase in temperature towards the interior of the Earth.
hotspot area of intense volcanic activity where mantle plumes break through the lithosphere.
isostasy the equilibrium between the weight of parts of the Earth's crust and the upward force of the mantle.
isotopes atoms that have an equal number of protons and electrons, but a different number of neutrons. Due to this, their atomic masses are different.
planetesimal a small, solid body formed during planetesimal accretion. Combined with many others, and under gravitation, they formed the planets. Not used to refer to objects in the current solar system.
seismic discontinuity the boundary between two layers of materials that can be detected by reflection or refraction of seismic waves.
subsidence the slow sinking of an area of land.
2. Tectonics and relief
anticline a fold in which younger layers of rock surround the older ones.
diagenesis the process in which sediments are compacted. Compaction is caused by increased pressure and temperature.
fault a crack in the surface of the Earth. Displacement of the blocks or fault walls occurs.
fold an irreversible ductile deformation of rock.
joint a fracture in rocks where the fragments remain in their initial position.
magma rocky materials of any type that melt at a certain depth of the Earth.
metamorphism the process of transformation of sedimentary rocks. It occurs in deep layers of the Earth due to increased pressure and temperature.
orogen an extensive belt of rocks that form mountain ranges of volcanic or tectonic origin. Formed by volcanic activity or the folding or accumulation of materials.
overlying plate a continental or oceanic lithospheric plate that remains on the surface while another plate subducts.
rift a long, deep crack where the lithosphere is being pushed apart. It results from tensional stress in the crust of the Earth.
subducting plate an oceanic lithospheric plate that sinks sideways and downwards into the mantle, generating a subduction zone.
syncline a U-shaped fold in which older layers of rock surround younger ones.
weathering a set of processes caused by geological agents like wind and water that leads to the fragmentation of rocks.
3. History of the Earth
actualism a principle that says the geological processes observed today are the same as those that occurred in the past.
Scientific glossary
202
National Parks of Spain
Ordesa y Monte Perdido
Designation date: 16th August 1918Area: 15 608 hectaresAutonomous Community: Aragón
Valle de Ordesa was the first National Park of Spain. The park's most remarkable feature is the massif of Monte Perdido (3 355 m). From there, the valleys of Ordesa, Añisclo, Pineta and Escuaín branch off. There are constrasting landscapes, arid high-altitude areas and green valleys full of forests and meadows where water flows in abundance. The park is a Biosphere Reserve (1977), UNESCO World Heritage Site (1997) and a ZEPA zone (1988).Fauna: vertebrates include the bearded vulture, the chamois, the golden eagle, the griffon vulture, the Eurasian eagle-owl, the great spotted woodpecker, the peregrine falcon, etc.Flora: it is very diverse, with hollies, snowdrops, heather, blackthorns, gentians, violets, rowans, beech trees, etc.
Teide
Designation date: 22nd January 1954Area: 18 990 hectaresAutonomous Community: Canarias
Located on the island of Tenerife, this was the first and is the largest National Park in Canarias. The volcanic cones and lava flows form an extraordinary geological site of global importance. It contains a rich biodiversity, with 58 endemic plant species and a high number of invertebrate species. It was declared a World Heritage Site in 2007. Fauna: there are wild canaries, common kestrels, Eurasian blue tits, Tenerife blue chaffinches, rock doves, wall geckos, Canary big-eared bats, Tenerife speckled lizards, etc.Flora: endemic plants found here include the red bugloss, the Teide burnet, the Cañadas rockrose, and the Teide violet, which grows at high altitudes.
232
3 Study of a limiting factor of plants
A factor that can limit the growth or development of a living thing is called a limiting factor. For example, a limiting factor for a plant living in a very humid environment could be the lack of light or nutrients. On the other hand, for a plant living in a dry environment, water is likely to be a limiting factor.
There is an optimal value for every factor. This optimal value enables the living thing to perform its vital functions successfully. The tolerance limits are the lowest and highest values of a factor that a living thing can survive.
In this experiment you will study one of the limiting factors of plants: the salinity of water.
Objectives
▶ Study how water salinity affects a plant's growth.
▶ Analyze data after representing it in a graph.
▶ Carry out experimental designs to study the different factors that influence the growth of plants.
Materials
– Seeds that germinate easily; for example chickpeas
– Five plastic bottles
– Five plastic cups
– Distilled water
– Sodium chloride (table salt)
– 250 mL graduated cylinder
– Digital scales
– Permanent marker
– Cotton
1 Prepare the bottles with water and salt
First, label the bottles from 1 to 5, and fill each one with 250 mL of distilled water.
Bottle 1 will have distilled water, with no salt.
Add 0.25 g of salt to bottle 2. This is approximately the salinity of fresh water.
Add 1 g of salt to bottle 3.
Add 4 g of salt to bottle 4. This is the salinity of brackish water.
Add 8 g of salt to bottle 5. This is the salinity of seawater.
Steps
220
5
The structure and dynamics of the Earth1
FIND OUT ABOUT
• The origin of the solar system and the Earth.
• The internal structure of the Earth.
• The geodynamic model.
• The internal engine of the Earth.
• Vertical movements of the lithosphere.
• Horizontal movements of the lithosphere.
• Plate tectonics.
KNOW HOW TO
• Interpret remanent magnetism.
• Interpret bathymetric charts.
• Does the photo show oceanic crust or continental crust?
• Describe the types of rocks you can see in the foreground.
• Are there any indications of life on the island?
WORK WITH THE IMAGE
Surtsey is an open-air laboratory. Scientists use the island to study how living things colonize new environments.
For this reason, UNESCO declared the island a World Heritage Site in 2008.
The eruption began at a depth of more than 100 m below sea level. A volcanic cone formed, which took several months to reach the surface.
The island continued to grow for three and a half years. It reached a maximum surface area of almost 3 square kilometres (km2). Its maximum height was 150 m above sea level. However, the island was quickly eroded and is now smaller.
Respect the natural dynamics of our planet and adopt urgent measures to fight the effects of climate change.
6
HOW DO WE KNOW?
Is it possible to watch an island form?In mid-November 1963, a rarely witnessed event took place: a new land mass formed.
It occurred 32 km to the south of Iceland. On 14th November, the crew of a fishing boat saw something strange: bubbles and black smoke coming out of the sea. The fishermen notified the authorities. Soon after, groups of scientists travelled to the area to study the phenomenon first-hand.
A few days later, lava from an underwater volcano began to reach the surface. The lava quickly cooled, forming a new island, which was named Surtsey. The island continued to grow.
The volcanic eruption ended in July 1967.
GIVE YOUR OPINION. Why do you think a phenomenon such as this is so interesting to the scientific community?
STARTING POINTS
• What are lithospheric or tectonic plates?
• In some places on the planet, there is a good deal of both volcanic and seismic activity. Is there a relation between these two types of phenomena?
• Do tectonic plates move? If so, explain briefly what it is that causes them to move.
Life forms on Surtsey are varied. More than thirty species of plants are well established. There is a stable colony of seagulls. Grey seals regularly use the island as a breeding ground. Furthermore, a large number of echinoderms and algae have been found in the water.
7
Astronomers calculate that the solar system began to form about 5 billion (5 000 000 000) years ago. It began to form deep inside a nebula located at the end of one arm of our galaxy, the Milky Way. The nebula was a large cold cloud of cosmic dust and gases, mainly hydrogen and helium. The most widely accepted hypothesis about the formation of the solar system is planetesimal accretion.
1The origin of the solar system and the Earth
• Explain the origin of the solar system and the planets.
• Describe the systems of the Earth and their origin.
LEARNING OBJECTIVES
Over the course of 400–450 million years, the planets formed from the remains of the nebula:
• Four rocky planets: Mercury, Venus, the Earth and Mars.
• Four gas giants: Jupiter, Saturn, Uranus and Neptune.
The Asteroid belt lies between the two groups of planets. Most meteorites that collide with the Moon, the Earth and other planets come from this belt.
Large quantities of solid particles began to revolve around the primitive Sun. These particles were primarily elements like iron and silicon.
Gravity caused a huge mass of hydrogen and helium to accumulate in the centre of the disc. The temperature of these gases increased until thermonuclear fusion reactions occurred, creating the Sun.
As the nebula rotated around its axis, it began to contract and flatten. It became disc-shaped.
Neptune
Jupiter
Venus
Mars
MercuryThe Earth
Asteroid belt
Saturn
Uranus
These particles collided with each other due to the effects of gravity. The collision led to the formation of structures called planetesimals, which gradually increased in size.
8
3 What caused the geosphere to be made up of layers? Briefly describe the process that took place: First, next, then, later, finally, etc.
4 Why are the planets closest to the Sun denser than those that are farther away?
5 Does the amount of water that makes up the hydrosphere remain constant, or does it tend to increase over time?
ACTIVITIES
The Earth and its systems
The Earth can be divided into four systems or spheres: geosphere, atmosphere, hydrosphere and biosphere. Although each system is separate, they all interact very closely with each other. Matter and energy are constantly being exchanged between the four systems.
• Geosphere. Scientists theorize that about 4.5 billion (4 500 000 000) years ago the Earth was a large ball of molten rock. The molten state was due to three processes that generated heat:
– The continuous impacts of planetesimals during accretion.
– The decay of radioactive isotopes such as potassium-40 and uranium-235.
– The differentiation of materials, due to gravity (gravitational differentiation), into three layers of increasing density:
Crust: a thin top layer formed of aluminium silicates.
Mantle: a layer of iron and magnesium silicates, floating on the core.
Core: a metallic centre formed of the heaviest elements, primarily iron.
• Atmosphere. During the gravitational differentiation process, large quantities of gas were emitted. The lighter gases, hydrogen and helium, escaped into space. Others, such as carbon dioxide and water vapour, were trapped in the crust. From there, they escaped through fissures. A primitive atmosphere was formed from intense volcanic activity.
• Hydrosphere. Later, the water in the atmosphere condensed. Heavy rainfall flooded the depressions on the solid surface, forming the hydrosphere.
• Biosphere. Life on the Earth was made possible by two factors:
– The distance between the Earth and the Sun.
– The physical and chemical conditions on the Earth, such as temperature and the presence of liquid water.
Biological activity on the Earth has influenced many processes, including:
– The oxygenation of the atmosphere.
– The formation of soil.
– The creation of thick bands of rock such as limestone. Limestone is formed by the accumulation of calcium carbonate from shells, corals and skeletons.
Atmosphere Geosphere
Hydrosphere Biosphere
1 Find examples of the exchange of matter and energy between these systems. Biosphere / geosphere; atmosphere / biosphere; hydrosphere / geosphere.
2 What does the eruption of the Eyjafjalla volcano in Iceland tell you about the process of degassing the Earth?
WORK WITH THE IMAGE
9
The structure and dynamics of the Earth 1
• Explain how seismic waves are used to understand the interior of the Earth.
• Understand the geochemical model of the Earth.
LEARNING OBJECTIVES
Geologists study earthquakes to understand the interior of the Earth.
Earthquakes are violent shaking events caused by sudden movements of the crust. They occur when large masses of rock located at fault lines suddenly slip past one another, releasing energy.
The hypocentre is the point within the Earth where an earthquake originates. From here, oscillations (vibrations) travel through the inner layers of the Earth as seismic waves: P-waves and S-waves. These waves form spherical wavefronts.
The layers of the Earth vary in chemical composition and mechanical behaviour. As seismic waves travel through each layer, they can be reflected or refracted. This causes the waves to change speed or direction.
Seismologists analyze seismic waves to deduce the physical state of each layer: rigid, malleable or fluid. They also detect the depth of seismic discontinuities, which are boundaries between layers.
2 The internal structure of the Earth
The point on the surface that the waves reach first is called the epicentre. It is directly above the hypocentre. Surface waves spread from the epicentre, sometimes with catastrophic effects.
Fault scarp
Wavefronts
Epicentre
Hypocentre Fault
ExpansionCompression
Direction the wave travels in
S-waves shadow zone
S-wavesP-waves Hypocentre
Shadow zone: This is an area that does not receive certain waves.
Primary waves (P-waves)
• These are the fastest waves and therefore the first to reach the seismograph, a machine that records seismic waves.
• The particles oscillate in the same direction as the wave through compression and expansion.
• Waves can travel through solid and liquid materials. However, they travel through liquids more slowly.
Secondary waves (S-waves)
• These are slower, so they are detected by seismographs after the P-waves.
• The particles oscillate perpendicularly to the direction of the wave.
• They travel through solids, but not liquids.
Path of the S-waves and P-waves through the interior of the Earth:
10
Geochemical model of the internal structure of the Earth
Seismologists have defined two models of the internal structure of the Earth: the geochemical model and the geodynamic model. Although both are based on the behaviour of P-waves and S-waves, there are important differences.
The geochemical model is based on the chemical composition of the internal layers of the Earth. It divides the Earth into three layers: crust, mantle and core. Within these layers are three seismic discontinuities, each one named after its discoverer.
ACTIVITY
2 Draw a graph in proportion showing the P- and S-waves travelling through the interior of an imaginary planet that has the following characteristics in its layers:
• 0 −700 km: solid layer with a progressively increasing density and rigidity.
• 700 −1 500 km: solid and homogenous layer.
• 1 500 −3 000 km: fluid layer.
Mantle. This layer is made up of igneous rocks rich in iron and magnesium silicates. One is peridotite, which consists primarily of the mineral olivine.
It is divided into the upper mantle and lower mantle, which are separated by the transition zone. Here, the physical properties of the rocks of the upper mantle are changed due to the increase in pressure and temperature, resulting in denser materials.
Core. This consists of almost pure iron mixed with a small percentage of iron sulphides and nickel.
It is divided into two parts, each in a different physical state: • The outer core is liquid. It has a
consistency similar to water. Violent convection currents here generate the Earth's magnetic field or magnetosphere.
• The inner core is solid.
Crust. This layer consists primarily of aluminium silicates. There are two types: continental crust and oceanic crust.
Upper mantle
35 480 1 000 2 000 4 000 6 000 6 378
14
Lower mantle Outer core
Sei
smic
wav
e sp
eed
(km
/s)
Kilometres
Inner core
Gutenberg discontinuity
Wiechert–Lehmann discontinuity
1 How does the graph help you to know there is a discontinuity?
WORK WITH THE IMAGE
2 900 5 100670
P-waves
S-waves
12
10
8
6
4
2
Mohorovicic discontinuity
ˇ ´
11
The structure and dynamics of the Earth 1
Lithosphere
The lithosphere consists of the crust and the uppermost part of the mantle. It is dragged along by the movement of the mantle underneath. As a result, it has been fractured into large blocks called lithospheric plates. These plates fit together like a jigsaw puzzle, and are subjected to two types of movement:
• Horizontal movements due to plate tectonics.• Vertical movements due to isostatic adjustment.
The geodynamic model of the internal structure of the Earth is based on:
• The physical state of the layers: plasticity, rigidity and density.
• The mechanical properties of the layers; that is, how they respond to changes in pressure and temperature.
According to the geodynamic model, the Earth is a heat engine. Within it, temperature changes cause atoms and molecules to be agitated. This agitation modifies the structure and composition of materials, generating movement and pressure. This pressure can be released slowly or quickly, transforming thermal energy into mechanical energy.
This model divides the Earth into layers. From the surface inwards, they are: the lithosphere, asthenosphere, mesosphere, D" layer and the core.
3The geodynamic model
• Understand the geodynamic model of the Earth.
LEARNING OBJECTIVES
Mesosphere
The mesosphere is the lower mantle. It extends from a depth of 670 km to the D" layer. Although it is solid, the mesosphere is not static. It flows, but very slowly: a few centimetres per year. Cold lithospheric plates from the subduction zones can descend into it and mantle plumes from the D" layer underneath can reach it.
Asthenosphere or sublithospheric upper mantle
This layer lies between the lithosphere and the mesosphere. Scientists believe it coincides with the lower part of the upper mantle. It is a plastic malleable layer with a tendency to flow as the lithosphere moves.
Continental lithosphere
Isostatic adjustment 75–100 670
Sublithospheric upper mantle or asthenosphere
Lower mantle or mesosphere
1 Look at the diagrams. Listen and choose the correct answer.
WORK WITH THE IMAGE
Oceanic
lithosphere
12
The core
In both the geochemical and the geodynamic models, the core consists of two parts: inner and outer. The heat in the solid inner core spreads to the liquid outer core. This generates convection currents that push heat out of the core into the D" layer, where it accumulates.
These convection currents also generate the Earth's magnetic field.
The magnetic field consists of invisible dynamic lines of force. These lines cross the Earth between two magnetic poles. Unlike the geographical poles, the magnetic poles are not fixed. The distance between them varies over time.
The D" layer
The D" layer is one of the most dynamic layers of the Earth. Heat from the outer core accumulates here, and hot magma escapes from this layer as mantle plumes. The plumes break through the lithosphere, creating hotspots: areas of intense volcanic activity, such as the Hawaiian Islands.
2 900 5 100 6 378Kilometres
Axis of rotation
Magnetic field
Hotspot
D" layer
Mesosphere
AsthenosphereMantle plume
Eruption of the Kilauea volcano.
2 How is heat moved up from the core to the lithosphere?
3 Look for information about the asthenosphere and explain why its existence has been controversial in the history of geology.
ACTIVITIES
13
The structure and dynamics of the Earth 1
The internal dynamics of the Earth depend on two factors: internal energy in the form of heat, and the force of gravity.
The internal temperature of the Earth increases as the distance from the surface increases; that is, the greater the depth, the higher the temperature. This is called the geothermal gradient.
In the crust, the average geothermal gradient is 3 °C per 100 m. In volcanic areas, it can be as high as 10 °C per 100 m. In the deeper layers, these values change and the distribution of temperatures is estimated according to extrapolations based on lab experiments and on seismic data.
Heat flow in the geosphere
Heat travels from the hot interior of the Earth up to the surface. The amount of heat energy that reaches the surface is called the heat flow. This heat may be transmitted by conduction, but rocks have low conductivity. As a result, transmission takes place very slowly.
The real engines driving the internal dynamics of the Earth are convection currents. Hot materials, which are less dense and therefore lighter, ascend to the surface. As they cool, these materials become denser and sink again. This continuous flow is generated by high temperature variations between the lithosphere and the D" layer.
4The internal engine of the Earth
• Describe the mechanisms responsible for the internal dynamics of the Earth.
• Identify what causes the vertical movements of the crust.
LEARNING OBJECTIVES
1 Test a classmate on the graph above. What's the temperature at a depth of ...?
2 If the geothermal gradient were constant from the surface to the core, what would the temperature of the core be? Compare the value that you have calculated with that of the graph above. What do you think causes this difference?
WORK WITH THE IMAGE
3 Define convection current.
4 Is heat flow the same as geothermal gradient? Explain your answer.
ACTIVITIES
Geothermal gradient: correlation
between depth and temperature.
Asthenosphere
Lithosphere
Core
D" layer
0
1 000
2 000
3 000
4 000
5 000
6 000
Depth (km)
0 3 000 6 000
Descending current
Convection currents in the core
Ascending current
In the mantle, hot magma plumes generate an ascending current.
Gravity acting on the lithospheric plates generates a descending current.
If the layers have different densities, like the metallic core and the rocky mantle, they cannot mix. As a result, independent convection currents are generated.
Asthenosphere
Mesosphere
D" layer
Temperature (ºC)
14
6 Image A represents a cross-section of a glacier tongue. Image B represents the same area years after the tongue has disappeared. Explain what happened.
ACTIVITY
The rigid lithosphere 'floats' on top of the asthenosphere. The state of gravitational equilibrium between the two layers is called isostasy.
This equilibrium is altered by dynamics of internal and external origin. Blocks or sections of the lithosphere move up or down to re-establish isostasy. This is similar to the vertical movements of boats being loaded and unloaded.
An increase in weight on top of the lithosphere can cause it to sink. This is called subsidence. Ice accumulation during glaciation or sediment accumulation in sedimentary basins can cause subsidence.
In contrast, both ice thaw and erosion reduce the weight on top of the blocks. This results in uplift, which means the lithosphere rises.
5Vertical movements of the lithosphere
The weight of the materials forming the
mountain causes the crust below to sink.
Erosion reduces the weight of the mountain.
Internal dynamics cause it to rise.
Subsidence
Subsidence
Uplift
Erosion
Sediment
An ice cap once covered the Scandinavian Peninsula. It melted 10 000 years ago. Since then, the peninsula has risen. Uplift occurs at a rate of 1–10 mm/year depending on the area.
Can you think of a way to measure this yearly uplift? How would you do it?
THINK ABOUT IT
A B
A
B
C
Simply put, isostasy can be explained
using Archimedes' principle. In a group
of blocks submerged in a fluid, each one
will sink more or less according to its
volume and density.
5 What happens to the sediment produced by the erosion of the mountain?
WORK WITH THE IMAGE
15
The structure and dynamics of the Earth 1
Until the beginning of the 20th century, most scientists believed that the continents had always been fixed in the same positions.
Wegener and the continental drift theory
Various theories about the horizontal movements of the continents were developed. However, the most complete and significant was proposed by Alfred Wegener in 1912: the theory of continental drift. It explained numerous phenomena observed in fields such as palaeontology, palaeoclimatology, petrology, geodesy and geography.
Wegener believed that the continents could move. He theorized that 300 million years ago they were joined together in a single supercontinent he called Pangea. Then the supercontinent gradually began to break up. The different parts moved horizontally across the seabed like icebergs in water. Eventually they formed the current continents.
Wegener presented considerable evidence to support his theory. However, he was unable to name a force strong enough to move the continents. He suggested that the rotation of the Earth could have been responsible.
Wegener's theory was not re-evaluated until the mid-20th century.
• Summarize the two main hypotheses regarding the movement of plates.
LEARNING OBJECTIVES 6Horizontal movements of the lithosphere
Palaeontological evidence
Fossils of very similar animals and plants were found on different continents. The only explanation was that those continents had been very close to each other in the past.
Palaeoclimatic evidence
Examples include traces of glaciation that occurred 300 million years ago.
The red arrows indicate the direction in which the ice eroded the land.
Geographical evidence
Several people realized that some continents, like Africa and South America, seemed to fit together. Benjamin Franklin in the 18th century and Alexander von Humboldt in the 19th century were among them.
Glossopteris
Mesosaurus
Evidence of Wegener's continental drift theory
3 Role-play. Wegener supporters and fixism theory supporters. Use facts from the images: ... observed that ... demonstrated / suggested that ...
WORK WITH THE IMAGE
1 What was Pangea and what happened to it?
2 Find biogeographic and palaeomagnetic proof of continental drift. For example, research theropods. Make a map.
ACTIVITIES
16
Symmetrical bands of remanent magnetism in the rocks provide important evidence.
This symmetry shows that new lithosphere is created at mid-ocean ridges. The new
lithosphere is pushed to the sides as new material emerges from the mid-ocean ridge.
Seafloor spreading hypothesis
After the Second World War, an intense period of ocean exploration began. Sonar (SOund NAvigation and Ranging) technology made it possible to create detailed maps of the seabed. Researchers perfected new methods by studying radioactivity and the remanent magnetism of rocks. The development of computers also led to more efficient data processing.
Geological and geophysical discoveries relating to the seabed led to a new theory. The seafloor spreading hypothesis was proposed by Harry Hess in 1962.
According to Hess's theory, the seafloor is pushed to the sides at mid-ocean ridges and new oceanic crust is formed by volcanic activity and the gradual movement of the seabed away from the ridge.
KNOW HOW TO
Interpret remanent magnetism
Magnetite is a mineral that forms in lava. As it cools, magnetite crystals align with the Earth's magnetic field.
However, the polarity of the Earth reverses periodically due to the instability of the magnetic field. These reversals in polarity are recorded in rocks in a phenomenon called remanent magnetism. The last magnetic field reversal occurred about 780 000 years ago.
Magnetite crystals act like compasses. To show their orientation, geologists use red and blue like a compass needle. Red points towards the north magnetic pole at the time the crystals cooled.
Geologists use remanent magnetism to identify rocks that formed in periods when the Earth had the same or the opposite polarity.
ACTIVITIES
8 What do the red and blue lines in images A and B indicate?
9 Samples A and B were found near an oceanic ridge. Which one is the most recent? How do you know?
A B
Rocks with Earth's current magnetic polarity.
Rocks with a reversed magnetic polarity.
Mid-ocean ridge
4 Describe Hess's hypothesis. Hess argued that ...
5 Do all the rocks on the seafloor have the same magnetic polarity? Explain.
6 Look at the diagram. Which rocks are the oldest? And the youngest?
7 Make a dynamic paper model to show seafloor spreading. Get instructions on the Internet.
ACTIVITIES
17
The structure and dynamics of the Earth 1
Hess's seafloor spreading hypothesis led to a new theory: plate tectonics. It is a comprehensive theory of geological processes. The concept of plates was developed by Canadian geologist, John Tuzo Wilson, in 1965. It was based on his study of the global distribution of earthquakes and volcanoes. There are two main types of plates:
• Oceanic plates, which consist entirely of oceanic lithosphere.
• Mixed plates, which consist of a mixture of continental lithosphere and oceanic lithosphere.
Principles of plate tectonics
• The lithosphere is divided into plates. These plates are separated by unstable boundaries characterized by intense seismic and volcanic activity. All the plates fit together like pieces of a giant jigsaw puzzle.
• Oceanic lithosphere is thinner and denser than continental lithosphere. It is generated continuously at mid-ocean ridges. When oceanic lithosphere is generated, an equal amount is destroyed in oceanic trenches or subduction zones. As a result, the diameter of the Earth is always the same.
• Gravity and the internal heat of the Earth generate convection currents. These currents move the tectonic plates with respect to one another, changing the position of the continents.
• Tectonic plates interact. This interaction creates large relief features and related phenomena, such as earthquakes and tsunamis.
7Plate tectonics
• Explain the basic principles of plate tectonics.
LEARNING OBJECTIVES
• Maps of the seafloor show mid-ocean ridges, oceanic trenches and large underwater faults.
• Direct measurements have demonstrated that the plates are moving. They also indicate the direction of plate movement.
• Sediment deposits are thicker at continental margins, but almost non-existent at mid-ocean ridges.
• The newest crust is found at the centre of mid-ocean ridges. The age of the crust increases with distance from the ridge towards the continents. No rocks older than 185 million years old have been found on the seafloor.
0 km
50 km
100 km
Subduction zone
Subduction zone
Mid-ocean ridge
Kilo
met
res
Hotspot
1 Why do you think sediment deposits are so thin at mid-ocean ridges?
WORK WITH THE IMAGE
Some evidence of plate tectonics
The joint activity of the trenches, ridges
and hotspots enables the Earth's size
to remain constant.
TimeTime
18
2.3
1.8
7.26.0
5.5
1.1
3.0
3.0
7.4
6.2
7.3
7.2
2.5
2.0
2.0COCOS PLATE
PACIFIC PLATE CARIBBEAN
PLATE
NAZCA PLATE
ANTARCTIC PLATE
JUAN DE FUCAPLATE
NORTH AMERICAN PLATE
SOUTH AMERICAN PLATE
SCOTIA PLATE
EURASIAN PLATE
IRANIAN PLATE
ARABIAN PLATE
AFRICAN PLATE
INDO-AUSTRALIAN PLATE
PACIFIC PLATE
PHILIPPINE PLATE
NORTH AMERICAN PLATE
Plate boundaryOceanic trenchOrigin and direction of plate movementPlate collision zone
3.0 Speed of plate movement (cm/year)Earthquake zoneMajor active volcano
Relative movements of plates
The place where two plates meet is called a boundary. Each type of plate boundary moves and interacts differently, and each creates specific geological structures. Various geological phenomena occur at these boundaries. For example, lithosphere can be created, destroyed or conserved. Other intense phenomena, such as earthquakes, volcanic activity and subsidence also occur.
The type of boundary depends on the relative movements of the plates and how they interact with each other. There are three types:
ACTIVITIES
3 What relationship is there between convection currents in the mantle and lithospheric plates? What role do trenches and oceanic ridges play in the theory of plate tectonics?
4 Complete the table with examples of each type of boundary.
5 Are there any plates that are made up entirely of continental crust? In which type of plates can we find them?
6 Complete the sentences.
• According to the theory of plate tectonics, ... • The boundaries of a tectonic plate can be ...
2 Make a tectonic plates list. Indicate which are oceanic and which are mixed.
Boundary type Events Geological structures generated
ConvergentPlates collide. Orogens / orogenic belts: mountain ranges, etc.
Oceanic lithosphere is destroyed. Subduction zones
Divergent Oceanic lithosphere is created. Mid-ocean ridges
Transform Plates slide past each other. Transform faults
WORK WITH THE IMAGE
Movement, direction and boundaries of tectonic plates.
19
ACTIVITY ROUND-UP
1 Copy and complete the key concepts.
• The hypothesis of planetesimal accretion is the .
• The main differences between P–waves and S–waves are .
• The geochemical model states that the Earth .
• The geodynamic model states that the Earth .
• Convection currents are .
• Isostasy is .
• Continental drift and seafloor expansion are .
• The principles of plate tectonics say that .
• Plate boundaries can be .
2 Define geothermal gradient.
3 Compare the layers of the Earth with respect to temperature and depth. Use forms of hot and dense. For example: The inner core is hotter and denser than the outer core.
4 Look at the diagrams on pages 11,12 and 13. What differences do you see between the geochemical and the geodynamic models?
5 Make large copies of these diagrams. Then follow the instructions below.
a) Label each diagram with the name of the model that it represents. Label the parts of the structure of the Earth in each one.
b) Label the discontinuities and the depth at which each is located.
6 This graph compares P- and S-waves in the geosphere. Copy the graph and include the following labels:
a) The Mohorovicic, Gutenberg and Wiechert–Lehmann discontinuities.
b) The crust, the mantle and the inner and outer cores.
7 Copy and complete the table about the structure of the Earth according to the geodynamic model.
8 Describe Wegener's theory of continental drift and Hess's theory of seafloor spreading. Use words like: argued / demonstrated / proposed / hypothesized that ... Relate their theories to the plate tectonics theory.
9 What evidence was Wegener missing to prove his theory of continental drift? What subsequent discoveries proved his theory?
10 How do bands of magnetic polarity prove Hess's theory?
11 Copy and complete the table in your notebook.
12 Make a three-slide presentation about a hotspot. Work in a group. Include this information: location of the hotspot, name of the tectonic plate it is on; speed, name and ages of islands, etc.
670 2 900 5 100
14
12
10
8
6
4
2
0
P-waves
S-waves
Spee
d (k
m/s
)
Kilometres
ˇ ´
Boundary type Events Examples
Convergent
Oceanic lithosphere is
created.
Layer Thickness Composition / phenomena
A B
20
13 These graphs show the geothermal gradient of two different planets. Which planet would be the best for exploiting geothermal energy? Which of these could be Earth? Why?
15 Make the model below in order to carry out this experiment. Put two identical pieces of cork, A and B, in water. Put some sand on piece A. Then use a spoon or scoop to remove sand from piece A and place it on piece B. Observe what happens and answer these questions:
a) What happens to piece A as you remove weight?
b) What happens to piece B as you add weight?
c) Which geological processes are being shown?
d) Which areas of the surface of the Earth does each piece of cork represent? Hint: think about erosion and sedimentation.
e) Summarize your work. Use words like observe, hypothesize, demonstrate, although, in contrast.
CRITICAL THINKING. Is presenting clear evidence important in proving a scientific theory?
The Pacific 'Ring of Fire'
The 'Ring of Fire' is an area of intense seismic and volcanic activity. It is located around the edges of the Pacific Ocean. The intense activity is due to the movement of tectonic plates.
The eastern section is the result of subduction. The Nazca and Cocos Plates are sliding under the South American Plate. Subduction also occurs where the Pacific Plate collides with the North American, Philippine and Indo-Australian Plates.
This enormous, complex system is an important piece of evidence confirming the theory of plate tectonics.
16 Which geological phenomena related to plate boundaries are mentioned in the text?
17 Is the Pacific Ocean getting bigger?
18 Volcanoes are not located randomly across the surface of the Earth. Why not?
19 Explain how the 'Ring of Fire' can be used as proof of plate tectonics.
1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000
Spee
d (k
m/s
)
1 000 2 000 3 000 4 000 5 000 6 000
5 000
4 000
3 000
2 000
1 000Tem
pera
ture
(°C
)
Kilometres
Kilometres
141210
86420
P-waves
S-waves
Planet A
Planet B
NORTH AMERICAN PLATE
EURASIAN PLATE
JUAN DE FUCA PLATE
COCOSPLATE
PHILIPPINE PLATE
INDO-AUSTRALIAN PLATE
ANTARCTIC PLATE
SOUTH AMERICAN PLATE
PACIFIC PLATE
NAZCAPLATE
CARIBBEAN PLATE
PACIFIC
OCEAN
749806_p21_cinturon_paci�co
Ring of FireTectonic plateboundaryEarthquakeVolcano
A B
14 This graph shows P- and S-waves on an imaginary planet. Find and label the discontinuities. Then examine each layer. Describe the most important characteristics of each one.
21
The structure and dynamics of the Earth 1
KNOW HOW TO Scientific competence
Interpret bathymetric charts
In the 1940s, researchers developed sonar (SOund NAvigation and Ranging). This technology made it possible to map the seafloor.
Sonar has provided important information about how the continents formed. It has helped geologists to develop the theory of plate tectonics.
Using the data collected, bathymetric charts can be drawn. These charts are similar to topographic maps: they use a range of colours to show different depths.
GPS technology and modern computer systems can create very precise 3-D digital bathymetric charts. These charts are accurate to about 1 cm.
Sonar is based on radar: it emits acoustic signals. When the signals hit an object, such as a rock on the seafloor, they bounce back to the emitter.
Operators know the speed at which sound travels through water. So they record the time it takes for sound waves to return to the emitter. This enables them to calculate the distance from the emitter to a given point or object.
2 800
2 600
2 400
2 200
2 000
1 800
1 600
1 400
1 200
1 000
Isobaths every 50 m
800
600
400
2000
1 000 500 0 2500 21 000 21 500 22 000 22 500
22
20 Use the bathymetric chart below to do the activities.
a) Use the scale to put in order points A, B, C, D and E from shallowest to deepest.
b) Is there any land emerging from the water? How can you tell?
c) Where is the steepest slope located?
21 Use the drawing below to make a bathymetric chart. To represent depth, create a colour scale.
22 Do research on sonar. Create a timeline using the most significant events in the history of its development.
A video on tectonic plates
Use a mobile phone camera to create a 1–2 minute video on tectonic plates.
You can use card or modelling clay to make the model.
Work in a group of four or five. Assign roles to each member. Coordinate your contributions. Agree on distribution techniques.
• Writers do research on the content that will be explained in the video. They write the script.
• Producers ensure that all material (mobile phone, card, etc.) is in place when filming begins.
• Image, sound and special effects technicians are in charge of lighting, recording of voice(s) for narration, music, etc.
• Directors coordinate everything else. They choose camera angles, decide how much time each scene lasts and do the final edit.
• Distributors present the video. They use distribution techniques to make the video available to the class and other audiences.
COOPERATIVE PROJECT
The structure and dynamics of the Earth 1
10
0
–10
–20
–30
–40
200
150
100
50
0
–50
–100
–150
–200
metres
A
B
C
E
D
metres
23
Annex
• Lab experiments
• National Parks of Spain
213
Contents
Lab experiments
Laboratory equipment
Safety rules
1. Mantle plume formation
2. Make models of faults and folds
3. Study of a limiting factor of plants
4. Building a thermal collector
5. Extracting your DNA
6. Making fossil replicas
National Parks of Spain
• Introduction
• Ordesa y Monte Perdido - Teide
• Caldera de Taburiente - Aigüestortes i Estany de Sant Maurici
• Doñana - Tablas de Daimiel
• Timanfaya - Garajonay
• Archipiélago de Cabrera - Picos de Europa
• Cabañeros - Sierra Nevada
• Marítimo-Terrestre de las Islas Atlánticas de Galicia - Monfragüe
• Sierra de Guadarrama
Laboratory equipment
glass slides
glass coverslips
stereoscopic microscope
watch glasses
Bunsen burner optical microscope
test tubes
filter paper
digital scale
graduated cylinder
tweezers
scalpel
crystallizer
beaker
spatula
dropper
214
Safety rules
Safety labels on
chemical products
Environmentally hazardous
Oxidizer Explosive
Flammable Corrosive
Highly toxic Harmful or irritant
It is important to follow some basic safety rules when you do experiments in the laboratory:
• Before you start an experiment, read the instructions carefully and check you have everything you are going to need. Don't start working until you understand exactly what you have to do.
• Work carefully. Don't play with the equipment or chemical products. Don't run or push anyone.
• Keep your workspace clean and tidy. Clear away any books, clothes or bags.
• Stereoscopic and optical microscopes are fragile, so handle them with care and don't force any parts. If something doesn't work correctly, ask for help.
• Hold glass coverslips and glass slides at the edges or use tweezers to avoid getting grease on them and contaminating them.
• Solid waste such as used containers, paper filters or broken glass should be put in the appropriate bins.
• Never heat a completely sealed container. To heat a test tube, hold it with tweezers, never with your hands. Always point the mouth of a test tube away from yourself and other students.
• Chemical products can be dangerous. Before using them, read the safety labels carefully to understand the risks and the precautions you need to take.
• Never pour a liquid quickly into a test tube. Pour it slowly down the wall of the tube. Put test tube stoppers you aren't using on the table facing upwards. Replace them as soon as you finish using the test tubes.
• Carry bottles containing reagents by holding the base, never the lid.
• Never transfer products to other bottles that are not labelled correctly.
• Handle corrosive products with care to avoid contact with your skin or clothes.
• Never use the same dropper for different reagents as this can cause contamination or provoke dangerous reactions.
• Never tip leftover liquids down the sink without checking with your teacher first. Some products can be harmful to the environment and must be processed in a special way.
• At the end of an experiment, each group is responsible for clearing up, cleaning and tidying their desks. Always wash your hands after using chemical products and before leaving the laboratory.
• Always clean the equipment thoroughly after use and wipe up any spillages immediately. Turn off taps and switch off Bunsen burners.
215
1 Mantle plume formation
Convection currents in the mantle are similar to those that can form inside a liquid that is heated from below. However, the high degree of viscosity of the mantle means that these rising currents, the mantle plumes, take millions of years to cross the mantle and reach the base of the lithosphere.
When the mantle plumes reach the surface, they create an area of intense volcanic activity, called a hotspot. Hotspots in the oceanic lithosphere form volcanic archipelagos, such as the Azores.
In this experiment, you are going to make a model of convection currents and mantle plumes.
Objectives
▶ Create a model in the lab that simulates the formation of a mantle plume.
▶ Observe convection currents.
▶ Assess the usefulness of models to understand geological processes.
Materials
– Two glasses
– Plastic tray
– Two semirigid plastic sheets
– Water
– Ice
– Salt
– Tempera or red watercolour paint
– Bunsen burner
– Pencil shavings
Steps
1 Preparation
Boil some water and add a touch of red paint to give it colour.
Separately, prepare water with ice and add two spoonfuls of salt. Now you have boiling hot, red-coloured water and very cold salt water.
Make two holes in one of the plastic sheets.
Crush the pencil shavings.
216
2 Construct the mantle plumes model
Place a glass on the plastic tray and fill it all the way up with the hot, red-coloured water. Put the plastic sheet with two holes on top of the glass.
Fill the other glass all the way up with cold salt water. Add some of the finely crushed pencil shavings to help you to observe the movement of the water.
Place the other plastic sheet over the glass with cold salt water, making sure there is no air between the surface of the water and the sheet.
3 Make the model work
Carefully turn over the glass with cold water and place it on top of the other glass, so that the two plastic sheets are lined up.
Hold the sheet with the holes in it and carefully remove the other one. Now the two glasses are separated only by the sheet with holes.
Results and conclusions
1 Describe what happened in the model.
2 Interpret the results by comparing them to the movements in a real mantle plume.
3 Why do we put salt in the cold water? Why do we use hot water in one glass, and cold water in the other?
4 In the top glass, apart from the column-shaped ascending flow you observe, there is also a descending flow that is less defined and more chaotic. Answer the following questions:
a) Does a similar phenomenon occur in the Earth's crust?
b) What can we compare the ascending current of hot water to?
c) And the descending flow?
5 Observe the pencil shavings. You can see that the ascending flow changes when it reaches the top, scattering the pencil shavings in all directions. These shavings generally float. What does the movement of shavings simulate?
6 In this experiment, there is a transformation from thermal energy to mechanical energy. What does this tell us?
What role does gravity play in this transformation?
7 Look for information about the current location of the main hotspots on Earth. Locate them on a relief map of the ocean floor.
Do you think their location changes over time? Why?The Islas Canarias may have originated from a hotspot.
217