DNA and Genes

Tapeshwar Yadav(Lecturer)BMLT, DNHE, M.Sc. Medical Biochemistry

Things to find out:

• What is DNA?• The Genetic Code• The Human Genome

Diversity of Life• All biological

systems are composed of the same types of molecules

• Similar organization principles are used at the cellular level

The Cell• Basic component of

life

• Two main categories, prokarytic and eukaryotic cells

• Differences in the nucleus

• Prokaryotes: no defined nucleus and a simplified internal structure

• Eukaryotes: membrane limited nucleus and complicated internal structure

• Three branches of life

• Genetic material is located in nucleus• The genetic information is stored in

Deoxyribonucleic acid, DNA • DNA contains the information needed to

build an individual

What is DNA needed for?

• Genetic information is transferred from DNA and converted to protein

•RNA molecules work as messengers

•Proteins are the biological workers

•Information of the DNA is copied to a RNA molecule in transcription •RNA directs the protein synthesis in a translation

•Protein’s 3D structure determines it’s function

•Information transfer only in one direction

‘’Central dogma’’ of LIFE

The biological information flows from DNA to RNA, and from there to proteins called central dogma of LIFE.It is ultimately the DNA that controls every function of the cell through protein synthesis.As the carrier of genetic information, DNA in a cell must be duplicated (replicated), maintained and passed dawn accurately to the daughter cells.

DNA (Deoxyribo Nucleic Acid)

•a polymer of nucleotide monomers

•2’-deoxyribose sugar

•Four bases:•Adenine, A•Guanine, G•Thymine, T•Cytosine, C

Sugar part

Base part

Four bases...Purine bases• Adenine and

guanine• Two carbon rings

Pyrimidine bases• Thymine and

cytosine• A single carbon

ring

DNA chains• Nucleotides are

joined with phosphodiester bond

• Sequence of bases vary genetic information

• Extremely long chains!

DNA Molecules

• Two polynucleotide chains are joined

• Double helix, twisted in right handed way

• Full circle in every 10 bases

•”ladder-structure”–Bases = steps–Sugars and phosphates = supporting pilars

•Two nucleotide chains run in opposite directions

chemical direction (5´-3´)

Complementary Pairing• Bases pair with other bases

• Space between the chains is limited Purines with two carbon rings pair only with single ring pyrimidines A + T G + C

• Complementary pairing is vital for the use and storage of the genetic information!

•Interaction is stabilized by hydrogen bonds

The Genetic Code• Describes how nucleotide sequence is

converted to protein sequence

• Unit of three nucleotides = a codon

• A codon codes for a specific amino acid (structural component of protein)

• The four bases can form 64 different codons

• 20 amino acids are found from the nature

• Regulatory codons

Frame 1Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q  Frame 2C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N  Frame 1G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H

•Right reading frame is obligatory!•Part of the sequence from psoriasis associated gene HCR

• Three different reading frames can be used, but only one is the right one

•Translate tools are found from the internet

atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc

The right one

DNA

chromatin

chromatin fibers

fibers connected to chromosome scaffold

Condenced scaffold

Chromosome

Genes

• A gene: DNA sequence that is needed to encode amino acid sequence of a protein

• Composed of exons, introns and different control elements

• Exon – protein coding sequence• Intron – intervening sequence

• Genes vary a lot in size:Humans: average 3000bplargest 2.4 million bp

•Genes are separated by sequences with unknown function

•Only one strand of the DNA carries biological information template strand

•Potential to store biological information is enormous

That’s all for this time!

The Human Genome and Inheritance

• 3 billion base pairs

• about 22 000 genes

• Only 2 % of the DNA encode proteins

• Genes include exons and introns

• Beside coding areas also additional secuences are found

• 50 % repeated sequences (”junk DNA”)

The Human genome...

The different types of sequences that make up the total DNA of a human cell

• 23 chromosome pairs 46 chromosomes

• 44 autosomes, 2 sex chromosomes

• X and Y –chromosomes

• XX female

• XY Male

Chromosomes carrying the same genes are called homologous

Passing on the genetic information:

• Information passed on in the sexual reproduction• Needed for new characteristics to develop• Offspring recieve genes by inheriting chromosomes

Two important terms...

Phenotype: The outlook of an organism

Genotype: The genetic information written in DNA

ATGTTTCCACCTTCAGGTTCCACTGGGCTGATTCCCCCCTCCCACTTTCAAGCTCGGCCCCTTTCAACTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCAG

GCCAAGAATGGCTCCCACCTGGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA

Genotype

Phenotypes

Genotype

All somatic cells• 23 chromosome pairs (46 chromosomes)• Diploid cells, 2n

Sperm cell• 23 chromosomes• Haploid cell, n

Egg cell• 23 chromosomes• Haploid cell, n

Fertilization:

n n

+

Fertilized egg • 2n• 46 chromosomes

A chromosome pare:

• A locus• An allele

Mitosis

• Division of somatic cells

• Products two daughter cells from one parent cell • The number of chromosomes does not change

• DNA duplicates before entering the mitosis

• Takes 1-2 hours

Meiosis

• Only in gamete formation

• One diploidic parent cell produces four haploid gametosytes

• Mature gametocytes have 23 chromosomes (n)