biologia - government college university · biologia (pakistan) issn 0006-3096 ... s. s. i., jahan,...

BIOLOGIA (PAKISTAN) ISSN 0006-3096 (Print) ISSN 2313-206X (Online)

BIOLOGIA

(PAKISTAN) December, 2015 Vol. 61, No. 2

Editor-in-Chief AZIZULLAH

Editors

PAKISTAN FOREIGN

Nusrat Jahan (GCUL) Ashraf Muhammed Ahmed Ali (KSA)

Ghazala Yasmeen (GCUL) Athar Tariq (USA)

Khalid Pervaiz Lone (UHS) Ikhide Godwin Imumorin (USA)

Syed Shahid Ali (UOL) B. Faye (France)

Muhammad Saleem (PU) Salih Dogan (Turkey)

Aamir Ali (UOS) Wolfgang Von Engelhardt (Germany)

Hassan Sher (University of Swat) Qi Bin Zhang (China)

Managing Editor

Abdul Qayyum Khan Sulehria (GICCL)

Sub-editor

Naila Malkani (GCUL)

BIOLOGICAL SOCIETY OF PAKISTAN Biological Laboratories, GC University, Lahore, Pakistan

www.biosoc.pk


www.biosoc.pk

PRESIDENT

Muhammad Ramzan Mirza Department of Zoology,

GC University, Lahore, Pakistan

VICE PRESIDENTS

Athar Hussain Shah Department of Botany,


Anjum Perveen Department of Botany,

University of Karachi, Karachi, Pakistan

Rehana Asghar

Department of Biology

Mirpur, University, AJK

Nusrat Jahan

Department of Zoology


Syed Akram Shah Department of Zoology,

Peshawar University, Peshawar, Pakistan

Asmatulla Kakar Department of Zoology,

University of Balochistan, Quetta, Pakistan

GENERAL SECRETARY

Zaheer-ud-din Khan Department of Botany,


JOINT SECRETARY

Muhammad Afzal Department of Zoology & Fisheries

University of Agriculture, Faisalabad

Pakistan

EDITOR-IN-CHIEF

Azizullah Department of Zoology,


MANAGING EDITOR

Abdul Qayyum Khan Sulehria

Department of Zoology

Govt. Islamia College, Civil Lines Lahore. Pakistan.

Sub-Editor Naila Malkani (GCUL)

ADVISORY BOARD

Tasneem Farasat (LCWU, Lahore) Azhar Maqbool (UVAS, Lahore) Altaf Dasti (BZU, Multan) Wazir Ali Baloch (University of Sindh, Jamshoro) Muhammad Ayub (Punjab Fisheries) Sana Ullah Khan Khattak (University of Peshawar, Peshawar) Zahid Hussain Malik (University of AJK, Muzaffarabad) M. Shafiq Ahmed (PU, Lahore) Atta Muhammad (Univ. of Balochistan, Quetta) Aliya Rehman (Karachi University) Moin-ud-Din Ahmad (Urdu Uni., of Sci. Tech., Karachi)

Pei Sheng-Ji (China) Kazuo N. Watanabe (Japan) Jin Zou (UK) Mary Tatnar (UK) William Bill Radke (USA) David B. Wilson (USA) Lee A. Meserve (USA) Fabrizio Rueca (Italy) Silvana Diverio (Italy) Giorgia Della Rocca (Italy) R. Pabst (Germany)

ANNUAL MEMBERSHIP

PAKISTAN Life Fellow Rs. 10,000.00 Fellow Rs. 2000.00 (per annum) Student Member Rs. 800.00 (per annum)

FOREIGN Fellow US $ 60.00 (per annum)

JOURNAL SUBSCRIPTION Complete Volume Single Copy

PAKISTAN Rs. 1500.00 Rs. 750.00

FOREIGN

Surface mail US $ 200.00 US $ 120.00

Air Mail US $ 240.00 US $ 140.00

All correspondence relating to membership and publication should be addressed to:

MANAGING EDITOR

Abdul Qayyum Khan Sulehria

Department of Zoology Govt. Islamia College, Civil Lines Lahore. Pakistan.

E-mail: [email protected]


www.biosoc.pk

mailto:[email protected]

BIOLOGIA (PAKISTAN)

PK ISSN 0006-3096 (Print) eISSN 2313-206X (Online)

Volume 61, December 2015 Number 2

CONTENTS

Saeed, U., Shahzad, N., Irteza, S. M., Ahmad, S. R., Chaudhry, A. A., and Ashraf, I., Use of Aerial and Space Borne Data as the Paradigm Shift of Orthodox Forest Monitoring Techniques – 60 Year Forest Change Trend Analysis

203

Abbas, A. S., Sheikh, N., Manzoor, F., Aslam, S. and Farrukh, A., Effects of Nigella sativa Seeds & Plantago ovata Husk on Fat Rich Diet Induced Inflammatory Responses in Rattus norvegicus

211

Saddiqe, Z., Farooq, A., Khan, F., Khalid, H. and Javeria, S., Effect of Chromium (VI) on physical growth and biochemical parameters of Wheat (Triticum aestivum L.) seedlings

219

Iqtedar,M., Sarfraz, B., Abdullah, R., Kaleem, A. and Naz, S., Effect of γ-irradiation doses on the sensory and microbial quality of dates (Phoenix dactylifera)

227

Hayee, S., Sulehria, A. Q. K., Akhter, N., Nawaz, F. and Hussain, A., Study of Rotifers of Safari Zoo

Lake Lahore in Relation to Physico-chemical Parameters

235

Shafi, N., Iftikhar, L., Akhtar, T., and Ayub, J.,

Physico-Chemical characteristics and Fish Distribution in River Poonch at Kotli, Azad Kashmir

243

Bukhari, S. S. I., Jahan, N. and Batool, A.,Effect of Cinnamomum tamala and Aloe barbadensis on Kidney Functioning in Diabetic Mice

249

Malik, S. K., Khan, Z. D. and Khan, F., Investigation of in-vitro Anthelmintic Potential of Fruits of some Ethnobotanically Important Trees of Punjab, Pakistan

257

Sulehria, A. Q. K., Abrar, J., Shah, A. H. and

Malik, M. A., Effect of Algae and other Food Types on Population Growth of Rotifers

263

Ali, A., Akhtar, N., Bashir, U., Hafeez,R. and Haider, M. S. Morphological and Biochemical Characterization of Bacteria isolated from Milk Products

271

Ahsan, M. M., Tahir, H. M. and Naqi, J. A., First report of Scorpion Envenomization in District Sargodha, Punjab, Pakistan

279

Sharif, A., Roohi, N. and Ashraf, Y., Quantitative

Profiling of Plasma Protein Fractions in Preeclamptic and Normotensive Pregnant Women

287

Liaqat, I., Arshad, N. and Naseem, A., Bacterial

Colonization and Biofilm Formation in Minimally Processed Fruit of Olea europaea

293

Bukhari, S. S. I., Abbasi, M. H. and Khan, M. K. A., Dose optimization of Alloxan for diabetes in

albino mice

301

Ashraf, Y., Roohi, N., Sharif, A., Ashraf, S. and Ilyas, S., Elevated Levels of C - reactive protein in Preeclamptic Women Following 20

th Week of

Pregnancy

307

Ashfaq, M., Farooq, H. U., Sabar, M., Ali, A. and Ali, M., Molecular Screening of Aroma Genes in Indigenous and Exotic Rice Germplasm

313

Mehmood, R. and Sheikh, N., Effect of Metal Dust

on Workers of Cutlery Industry in Wazirabad, Pakistan

319

Ikram, T., Khan, M. A., Siddique, M. K., Babar, M. A., Mahmood, K., Aziz, S. and Akhtar, M.,

New

Equidae Remains from Dhok Pathan Formation of Siwaliks, Pakistan

325

Tahir, H. M., Naseem, S., Zahra, K., Akhatar, U., Mumtaz, R., Khalid, R. and Nouman, M., Autotomy: An Important Tool in Spiders to Avoid Life Threatening Situations

329

Ali, S. and Shamim, N., Optimization of Medium Volume and Temperature for Improved α-amylase Production by Saccharomyces cerevisiae GCB-20

335

Babar, M. A., Mazhar, S., Khan, M. A., Siddique, M. K., Mahmood,

K. and Akhtar, M., Fossils of

Gazella (Bovidae, Mammalia) from Dhok Bun Amir Khatoon Chinji Formation of Pakistan

339

Mirza, M. R. and Javed, M. N., A Note on the Status of Tariqilabeo (Pisces: Cyprinidae)

343

BIOLOGIA (PAKISTAN) PKISSN 0006 – 3096 (Print) December, 2015, 61 (2), 203-210- ISSN 2313 – 206X (On-line)

*Corresponding author: [email protected]

Use of Aerial and Space Borne Data as the Paradigm Shift of Orthodox Forest

Monitoring Techniques – 60 Year Forest Change Trend Analysis

*UROOJ SAEED

1,2, NAEEM SHAHZAD

1, 2, SYED MUHAMMAD IRTEZA

1, SAJID RASHID AHMAD

2,

ABDUL ALEEM CHAUDHRY3 & IRFAN ASHRAF

1

1GIS laboratory, WWF –P, P.O. Box. 5180, Lahore, Pakistan

2Geomatics Program, Institute of Geology, University of the Punjab, Lahore, Pakistan

3Chief Conservator of Forests Punjab (Retired)

ABSTRACT

The craving for spatial information of the subtropical forests and moist temperate coniferous forests is ever increasing, as such information provides a strong base for the resource management at local, regional and global level. Use of images at various time frames, makes it extremely interesting to develop monitoring systems capable of automatically producing and regularly updating forest-cover maps. This study evaluates the status of forest cover from 1952 to 2011 using high resolution scanned aerial photographs, Keyhole data and SPOT images of Murree Forest Division (MFD), Pakistan. The study area is one of the best examples of mapping the subtropical forest of the country. For the forest cover change assessments, an object oriented segmentation approach has been adopted at different modules and levels which were evaluated using aerial photographs and multi-temporal images. High resolution aerial photographs taken in 1952 were acquired due to non-availability of satellite images. The study shows a decreasing trend in the forested land of the MFD which comprises of both state managed forest and community managed forests. An overall decrease of 9% of the forest was observed. The maximum decrease was between 2005 and 2011 which is about 4%. Annual deforestation rate from 1952 to 2011 is about 84.4 ha (0.4 %) per year. An overall accuracy of 88.71% was achieved with a Kappa coefficient of 0.8751. The decrease in the forest cover is mainly due to encroachment and forest cutting in both the state managed and community managed forest land. Key words: Forest Monitoring, Remote Sensing, Change Analysis

_____________________________________________________________________________________________

INTRODUCTION

Urban growth, particularly the movement of

residential and commercial land use to rural areas

at the periphery of forested land, has long been

considered a sign of increasing threat for

ecosystems, including degradation of air and water

quality, loss of farmland and forests, and

socioeconomic effects of economic disparities,

social fragmentation and infrastructure costs

(Squires, 2002). The land changes, commonly

referred to as urban sprawl, associated with rapid

expansion of low-density suburbs into formerly rural

areas and creation of exurbs, urban or suburban

areas buffered from others by undeveloped land,

have ramifications for the environmental and

socioeconomic sustainability of communities. The

world's forest ecosystems are in a state of

permanent flux at a variety of spatial and temporal

scales. Monitoring techniques based on

multispectral satellite-acquired data have

demonstrated potential as a means to detect,

identify, and map changes in forest cover.

Natural forests of Pakistan are deteriorating

both qualitatively and quantitatively due to

anthropogenic factors and weak institutional

arrangements (IUCN, 2005). Increasing footprint

and changing climate is causing this impact on

natural systems. Its impact on biosphere can be

observed through the spatial and temporal

monitoring of land cover. Land cover changes can

be triggered by anthropogenic as well as natural

phenomena, such as climate induced changes,

forest degradation, forest-agriculture conversion and

sprawling urban areas. Ecologically, land cover

change analysis is necessary to provide inputs to

scientific models, to ensure sustainable forest

management and to monitor environmental

change/s. In addition, such studies can support the

accomplishment of political commitments made to

international agreements such as the Kyoto Protocol

and the Convention on Biological Diversity (Brang et

al., 2001).

According to FAO (2011), Pakistan has only

2% of its area under forest cover. Whereas the

204 U. SAEED ET AL BIOLOGIA (PAKISTAN)

forest assessments conducted by Pakistan Forest

Institute estimates forest cover of Pakistan as 4.8%

using 2007-2008 images (PFI, 2012). The difference

in areas by both studies is due to the difference is

image processing techniques, quality of satellite

images and the definition of forests incorporated as

Minimum Mapping Unit (MMU). However, among

the GIS community, the methods and techniques

adopted by FAO are considered more appropriate

due to their advanced image processing techniques.

The annual rate of deforestation in Pakistan

is 2.2 percent. During the past decade

anthropogenic activities has increased the threat of

further depleting the natural forest of MFD (IUCN,

2005). This study assesses to identify forest

sections of highly degraded areas and provides an

estimated forest cover so that it can be helpful for

forest department for decision making and

implementation of the rules more strictly in order to

overcome the encroachment pressure in the

peripheries of the forest. The data from remote

sensing satellites provide opportunities to acquire

information about land at varying resolutions and

have been widely used for change detection

studies. A large number of change detection

methodologies and techniques, utilizing remotely

sensed data, have been developed, and newer

techniques are still emerging. With the wide use of

very-high-resolution (VHR) remotely sensed

images, object-based methods and data mining

techniques may have more potential in change

detection. Multi resolution segmentation, as one of

the most popular approaches in object-oriented

image segmentation, has been greatly enabled by

the advent of the commercial software, eCognition.

The importance of accurate and timely information

describing the nature and extent of land resources

and changes over time is increasing, especially in

rapidly growing metropolitan areas.

In this paper, we designed and developed

new object-based change detection rule sets, which

are aimed at updating forest-cover maps by remote

sensing images. The forest-cover change detection

system includes several key modules: image

segmentation, difference images processing and

binary change detection model using threshold.

These modules are evaluated by multi-temporal air

and space borne remotely sensed data set: (i) In the

image segmentation module, multi-scale

segmentation algorithm was used to form the image

objects. (ii) In the difference image module, spectral

value and NDVI (Normalized Difference Vegetation

Index) were taken as input data. Correlation

coefficient and algorithms based rule set on objects

is used to develop difference thematic layers. (iii) In

the binary change detection module, change maps

obtained from spectral value and NDVI, NDWI,

SAVI are compared. Finally, experimental results

carried out on multi-temporal aerial imagery to

SPOT high resolution data set to develop forest

cover map.

This study focuses the forest cover change

assessment in MFD using high resolution scanned

black and white aerial photographs taken in 1952

and Key-hole (CORONA) imagery of 1962 with

SPOT imagery of medium resolution of 1986, 1992,

1997 and high resolution merged SPOT imagery of

2005 and 2011. For the analysis, the images were

analyzed at three different levels depending on the

comparable scales of the datasets.

MATERIALS AND METHODS

Study Area

Murree Forest Division (MFD) is an

important sub-watershed of the Indus River System.

It lies in the outer Himalayas of the sub-tropical

continental highlands. Himalayas were created by

collision of Indian plate with the Eurasian plate

during Eocene time along a suture zone known as

the Main Mantle Thrust (MMT) (Coward et al.,

1986). It is situated in two ecological zones i.e.

‘Moist Temperate Coniferous Forests’ (Blue pine

(Pinus wallichiana)) and the ‘Chir Pine (Pinus

roxburghii) Subtropical Forests’ and two sub

ecological zones of sub-tropical semi evergreen and

tropical deciduous forest. The study area is one of

the best examples of existing Subtropical and Moist

Temperate Himalayan forest in Pakistan. Its

landscape is composed of large number of

heterogeneous and complex elements exhibiting

multi-scale hierarchical classes. Study area (Fig., 1)

is a mountainous region with an elevation range of

550- 2,600 meters approximately. Topography is the

principal controlling factor in vegetation growth, the

type of soils and the amount of rainfall playing

secondary roles at the scale of hill slopes (Dawes &

Short, 1994).

VOL. 61 (2) AERIAL AND SPACE BORNE DATA AS FOREST VEGETATION MONITORING TECHNIQUE 205

Fig., 1: Location map of the study area Data Acquisition and Preprocessing

For land cover land use change analysis, temporal images of French satellite Système Pour l'Observation de la Terre (SPOT) from 1986 to 2011, historic scanned images of Keyhole (Corona) and aerial photographs of 1952 were acquired to assess and estimate the forest change trends. Due to inherent low contrast, satellite data require enhancement of specific features of interest using image enhancement techniques. Keeping in view the subjective land cover, Histogram Equalize and Standard Deviation Stretch were applied for the extraction of meaningful information regarding different land cover classes. These algorithms enhanced the low contrast of satellite images and resulted in more interpretable image for further processing (Demirel et al., 2008 & Gonzalez & Woods, 2007). Moreover, spectral and spatial enhancement has also been applied on the images. In order to sharpen the small features, the available pan-chromatic channels, 2005 and 2011 images were spatially enhanced with multispectral channels to estimate the crown canopy covers in order to classify each forest class separately using the image objects defined by spectral values of satellite images (Wulder et al., 2004).

Plot sampling

In the field, 299 sample plots (100 x 100 feet size) were selected (Fig., 2) using random stratified sampling technique, that covered approximately all the tonal variations within the landscape. A forest inventory was developed

against each plot that was further used for the accuracy assessment of the developed thematic layers.

Fig., 2: Field photographs Object based analysis approach and rule set development

Globally, Object Based Image Analysis (OBIA) has been extensively used in assessing the forest cover (Pekkarinen, 2002). As accuracy is greater in OBIA as compared to the pixel based analysis many studies are now implanting OBIA for the purpose of classification (Hay et al., 2003; Wulder & Seemann, 2003).

Object based image analysis approach has

been adopted to carry out this study. For this

commercially available software, ‘Definiens

Developer (formerly known as eCognition)’ (Zhou et

al., 2008) was used. Object based approach in

forestry application proves to be more accurate as

compared to pixel based approach. The object

based approach has been used for different levels

of forest classification since 2000 (Flanders et al.,

2003; Halounova, 2004; Mitri & Gitas, 2002). The

results of this approach show high accuracy in

mapping, monitoring and modeling specifically in the

forestry sector (Hay et al., 1996, Huang et al., 2001

& Pekkarinen, 2002). Image segments can be

roughly correlated with the real world objects and

further analyzed with shape and texture (Benz et al.,

2004; Flack, 1995). In OBIA single pixel does not

take part in classification. In this study, the

univariate statistics were applied on the group of


pixels having similar brightness values. These

values were combined together according to the

image segmentation rules and criteria. The merging

process was continued until a threshold derived

from the user-defined parameters was reached

(Baatz & Schäpe, 2000; Benz et al., 2004).

Decision tree algorithm proved to be very

useful as it further divides the group of homogenous

larger segments according to their spectral, textural,

shape and context information defined by the user

(Breiman et al., 1984). Keeping this in mind, Digital

Elevation Model (DEM), aspect, Soil Adjusted

Vegetation Index (SAVI), Normalized Difference

Vegetation Index (NDVI) and ground knowledge

were incorporated while defining the rule set

parameters and further purify the output result.

Further division of conifer and scrub forest species

into their respective subspecies were based on the

indices, elevation and aspect ranges.

𝑁𝐷𝑉𝐼 = (𝑁𝑒𝑎𝑟 𝐼𝑅𝑒𝑑 − 𝑅𝑒𝑑)

(𝑁𝑒𝑎𝑟 𝐼𝑅𝑒𝑑 + 𝑅𝑒𝑑)

𝑆𝐴𝑉𝐼 = (𝑁𝑒𝑎𝑟 𝐼𝑅𝑒𝑑 − 𝑅𝑒𝑑)

(𝑁𝑒𝑎𝑟 𝐼𝑅𝑒𝑑 + 𝑅𝑒𝑑 + 𝐿) (1 + 𝐿)

Land Cover Classification System (LCCS) based legend standardization

The LCCS has been developed by FAO and

UNEP to manage with the need for improved

access to reliable and standardized information on

land cover and land cover change. It enables a

comparison of land cover classes independent of

mapping scale, land cover type, data acquisition

method, or geographical location. The LCCS system

enhances the standardization process and

minimizes the problem of dealing with a very large

amount of pre-defined classes (Gregorio & Jansen,

1996). An LCCS legend has been standardized for

the assessment to carry out this study. Finally, the

developed rule set and classification schemes were

applied to generate the final thematic layers for

change assessment.

RESULTS

The acquired images used in this study are

of varying spatial and spectral resolution. These

images were used to define the study at different

levels. Aerial photos and keyhole data sets were

used for Level 1 and SPOT 1, SPOT 2 and SPOT 3

images were used for Level 2. SPOT 5 images

taken in 2005 and 2011 were used to define Level

3. Greater the level, better the resolution and more

is the detail in the land cover classes (Table I).

Segmentation level 1

In this segmentation level, about 41 aerial

photographs of Colombo Mission Plan of the area

and Corona (Keyhole) scanned imagery was

processed to classify the two major classes. The

segmentation was performed in a way that

differentiation could be made between the forested

and non-forested classes. From 1952 to 1962, a

total decrease of 1351 ha in the biomass classes

has been observed which includes; vegetated land,

agriculture land and shrubs/bushes/grasses.

Vegetated land includes coniferous forests and mix

forest (Table I & Fig. 4).


Under the medium resolution images of

1986, 1992 and 1999, the segmentation was done

precisely in comparison of level 1. Eight land cover

features were identified after careful study of the

segments and algorithms. The result shows a

decrease in the forested classes from 1986 to 1999.

Overall decrease of 695.66 ha in the coniferous

class and about 2704 ha increase in sub-tropical

semi evergreen and tropical deciduous forests has

been observed during this time period in MFD

(Table I, Fig. 3 & 4).

Fig., 3: Line graph showing the change pattern in classes from 1986 - 1999


Fig., 4: Thematic layers


This level has been designed on the

increased high resolution images of 2005 and 2011.

The classification accuracy has been increased to

twelve classes including both the urban as well as

forested land cover classes as it provides better

representative texture and shape measures. A

decrease of 1867 ha in chir pine (Pinus roxburghii)

and blue pine forests was observed. The decrease

might refer to the increase in anthropogenic

activities in the area. An increase of 185.30 ha was

observed in broadleaved forest, which might be due

to the use of imagery of two different seasons as

many broadleaved forest types in MFD appear

greener in spring. The reason is due to the

deciduous nature of broad leaved species trees are

leafless during winter. In this period, 672.59 ha

decrease in the sub-tropical semi evergreen and

tropical deciduous forest was also observed.

Exploitation of forest trees and grass cutting

increases the sparseness, hence, the increase in

the mixed forest cover depicts an increase in the

vegetation exploitation (Table I & Fig., 4).

Table I: Statistical details of Land Cover / Land Use classes for all the levels

The overall result when compared from 1952 to 2011, a tremendous decrease of 9% (50 Km

2) (278 Km

2 (58%) forest area in 1952 to 228

Km2 (49%) in 2011) was observed. The maximum

decrease (4%) was between 2005 and 2011 (246.6 Km

2 (53%) forest area in 2005 to 228 Km

2 (49%) in

2011)). The minimum decrease (1%) in the forest cover was observed between 1992 and 1999 (56% - 55%) (Table I & Fig., 4). The annual change pattern


in the forest cover classes was calculated from the developed thematic layers for that particular time span. The overall annual deforestation change rate from 1952 to 2011 is 84.4 ha/year (0.4 % per year) in the area [Fig. 5 & 6]. The annual deforestation rate during each of the six time spans from 1952 to 1962, 1962-1986, 1986-1992, 1992-1999, 1999-2005 and 2005-2011 was about 84.4 ha (0.4 %) per year (Fig., 5). The positive increase in annual change rate was observed during 1986-1992 time span that might be due to green felling ban by the CM Punjab in 1986 in Murree Hills forests. This might have resulted in reduced pressure on the forest leading to sustainability/enhancement of vegetation cover.

Fig., 5: Annual forest change rate (ha/yr) calculated from 1952 to 2011

Accuracy Assessment

For accuracy assessment, data collected from sample plots was used. An error matrix was generated that is a square array of numbers organized in rows and columns which expresses the number of sample units (i.e. pixels and clusters of pixels) assigned to a particular category relative to the actual category as indicated by reference data (Congalton, 1996; Story, 1986). An accuracy of 88.71% was assessed and a Kappa coefficient of 0.8751 determined.

Fig., 6: Graphical comparison of Vegetated and non-vegetated land from 1952 to 2011

Further analysis was performed on the processed land cover to calculate vegetation classes in different aspects with the help of ASTER 30 m DEM. The correlation of forest cover maps and DEM shows that blue pine exists throughout the northern aspect (N, NE & NW), Chir pine NW, North N, and W aspect and with some patch in SW region (Fig., 7). These results were very useful in the accuracy assessment.

Fig., 7: Radar graph diagram of distribution of forest classes

Elevation analysis was performed on the

processed land cover of MFD with the help of DEM.

Elevation values were derived from the ASTER

GDEM of the MFD. For the development of an

elevation map of MFD, four ranges were identified,

Low (500-1,000 m), low to medium (1,000-1,500 m),

medium (1,500-2,000 m) and medium to high

(2,000-2,500 m). After doing elevation analysis on

the processed land cover it was found that at the

lower elevations (Below 1,000 m) maximum

vegetation class was scrub Forest (sub-tropical

semi evergreen and tropical deciduous forest). Most

of the Chir pine patches were found in the medium

elevation range (1500, 2000 m). Blue pine was

found in medium (1,500-1,800 m) and medium to

high elevation (2,000-2,500 m) elevation ranges.


Mixing of Conifer with broad leaved forests was

observed up to 1300 m (Fig., 8).

Fig., 8: Elevation chart of distribution of forest classes

DISCUSSION

Object Based Image Analysis proved to be

an accurate classification tool to accurately classify

different forest species. Using Rule base decision

tree in identifying forest species proved to be more

useful. The area lies in western Himalayan eco-

region that is important in the context of biodiversity

and forest conservation, and contribution to climate

change. From 2005 to 2011, a decrease of 2598 ha

in the coniferous forest species i.e. Chir Pine (Pinus

roxburghii) and Blue Pine (Pinus wallichiana) and an

increase of 185.30 ha in broad leaved forest has

been highlighted. The decrease in the forest cover

is mainly due to encroachment and forest cutting in

both state managed and community managed forest

land. This is mainly due to ambiguous and un

demarcated forest boundary lines. Furthermore

there are no updated forest records. This lack of

management has opened the gates for local

communities to reach Protected and Reserved

Forests by taking benefit of Guzara land and

convert it into agriculture and housing schemes

(Hasan, 2001).

According to a recent joint venture, conducted by Punjab Forest Department, Survey of Pakistan, Punjab Revenue Department and WWF – in Pakistan, 1,158 ha (2,862 acres) of encroached land in state forest has been identified. The Punjab Forest Department has so far retrieved 517.68 ha (1,279.21 acres) of encroached land, however, remaining encroached land should also be retrieved. Any further decrease in the coniferous trees will lead to climate change. Concrete measures need to be defined in place to recover the encroached forest land, rehabilitate the retrieved forest.

Acknowledgements

The study was conducted as per the orders

of Lahore High Court under the Suo Moto Writ

Petition No. 1813/2010. The authors are highly

grateful to Mr. Javaid Gill, DFO Murree for his kind

guidance and support in the forest mapping activity.

He was of great help in the field surveys and during

the accuracy assessments. The authors are grateful

to Mr. Ali Hassan Habib (Director General, WWF –

Pakistan), Mr. Ghulam Sarwar (Director, Survey of

Pakistan) and Ms. Uzma Khan, (Director

Biodiversity, WWF – Pakistan) for their guidance

and support.

REFERENCES

Baatz, M. & Schäpe, A., 2000. ‘Multi-resolution

segmentation: An optimization approach for high quality multi-scale image segmentation’. Angewandte Geographische Information sverarbeitung, (12):12–23.

Benz, U., Hofmann, P., Willhauck, G., Lingenfelder, I. & Heynen, M., 2004. ‘Multi-resolution, object-oriented fuzzy analysis of remote sensing data for GIS-ready information’. ISPR’s J. Photogram. & Remote Sens., 58: 239–258.

Brang, P., Schönenberger, W., Ott E. & Gardner, R.H., 2001. ‘Forests as protection from natural hazards’. In: Evans, J. (Ed.), The Forests Handbook. Blackwell Science Ltd., Oxford, pp: 53-81.

Breiman, L., Friedman, J.H., Olshen, R.A. & Stone, C.J., 1984. ‘Classification and Regression Trees’ Chapman & Hall, CRC Press, New York.


Congalton, R., 1996. ‘Accuracy Assessment: A critical Component of Land Cover Mapping’. Am. Soc. Photogram. & Remote Sens., pp: 119-131.

Coward, M. P., Windley, B.F., Broughton, R.D., Luff, I.W., Petterson, M. G., Pudsey, C.J., Rex, D.C. & Khan, M.A., 1986. ‘Collision tectonics in the NW Himalayas’. In: (Coward, M.P. and Ries, A.C. edits) Collision Tectonics, Geol. Soc. London Spec. Publi. 19: 203-219.

Dawes, W. R. & Short, D., 1994. ‘The significance of topology for modelling the surface hydrology of fluvial landscapes’. Water Resor. Res., 30:1045-1055.

Demirel, H., Anbarjafari, G., & Jahromi, M. N. S., 2008. ‘Image Equalization Based On Singular Value Decomposition’, Proceeding of IEEE Conference on Computer and Information Sciences, pp: 1-5.

FAO., 2011. State of the World’s Forests 2011, Rome. www.fao.org/docrep/013/i2000e/i2000e00.htm.

Flack, J., 1995. ‘Interpretation of remotely sensed data using guided techniques’. Ph.D. Thesis, School of Computer Science, Curtin University of Technology, Western Australia.

Flanders, D., Hall-Beyer, M. & Pereverzoff, J., 2003. ‘Preliminary evaluation of eCognition object-based software for cut block delineation and feature extraction’, Can. J. Remote Sens., 29(4): 441-452.

Gonzalez, R. C. & Woods R. E., 2007. ‘Digital Image Processing’, Englewood Cliffs, NJ: Prentice-Hall.

Gregorio, D. A & Jansen, L.J.M., 1996. ‘The Africover Land Cover Classification System: A Dichotomous, Modular-Hierarchical Approach’. Working Paper with the Proposal for the International Working Group Meeting. Dakar, July, Rome.

Halounova, L., 2004. ‘Textural classification of B &W aerial photos for the forest classification’, Remote Sensing in Transition, Goossens (ed.), Millpress, Rotterdam.

Hasan, L., 2001. ‘Analysing Institutional Set-up of Forest Management in Pakistan’ PIDE. Islamabad: Pakistan Institute of Development Economics.

Hay, G.J., Blaschke, T., Marceau, D.J & Bouchard A., 2003. ‘A Comparison of three image

object methods for the multiscale analysis of landscape structure’ ISPR’s J. Photogram. Remote Sens., 57: 327-345.

Hay, G.J., Niemann, K.O. & McLean, G.F., 1996. ‘An object-specific image-texture analysis of H-resolution forest imagery’. Remote Sens. Environ., 55 (2): 108 – 122.

Huang, C., Yang, L., Wylie, B & Homer, C., 2001. ‘A Strategy for estimating tree canopy density using landsat 7 ETM+ and High Resolution images over large areas’ Third International Conference on Geospatial Information in Agriculture & Forestry, Denver, Colorado.

IUCN., 2005. ‘Rapid Environmental Appraisal of Developments in and Around Murree Hills’, IUCN, Pakistan. Available at www.iucn.pk/pdf/new_murree_report.pdf

Mitri, G.H & Gitas, I.Z., 2002. ‘The development of an object-oriented classification model for operational burned area mapping on the Mediterranean island of Thasos using Landsat TM images’, Forest Fire Research & Wildlife Fire Safety, Viegas (ed.), Millpress, Rotterdam.

Pekkarinen, A., 2002. ‘Image segment-based spectral features in the estimation of timber volume’ Remote Sens. Environ., 82(2–3):349–359.

PFI., 2012. ‘Landcover Atlas of Pakistan’, Pakistan Forest Institute, Peshawar.

Squires, G. D., 2002. ‘Urban Sprawl and the Uneven Development of Metropolitan America’. In Gregory D. Squires (Ed.), Urban sprawl: Causes, consequences, and policy responses. Washington, D.C. Urban Institute Press. pp: 1–22

Story, M. A., 1986. ‘Accuracy Assessment: A user's Perspective’. Photogram. Engin. Remote Sens., pp: 397-399.

Wulder, M.A. & Seemann, D., 2003. ‘Forest inventory height update through the integration of lidar data with segmented Landsat imagery.’ Can. J. Remote Sens., 29 (5): 536-543.

Wulder, M.A., Hall, R.J., Coops, N.C. & Franklin, S.E., 2004. ‘High spatial resolution remotely sensed data for ecosystem characterization’, Bio. Sci., 54(6): 511–521.

Zhou, W., Troy, A. & Grove, M., 2008. ‘Object-based land cover classification and change analysis in the Baltimore metropolitan area using multi-temporal high resolution remote sensing data’. MDPI, Sensors, 8:1613-1636

Received: 24-5-2014 Revised: 15-10-2014 Accepted: 29-10-2015

http://www.fao.org/docrep/013/i2000e/i2000e00.htm

BIOLOGIA (PAKISTAN) PKISSN 0006 – 3096 (Print) December, 2015, 61 (2), 211-218 ISSN 2313 – 206X (On-line)


Effects of Nigella sativa Seeds & Plantago ovata Husk on Fat Rich Diet Induced

Inflammatory Responses in Rattus norvegicus

AFSHAN SYED ABBAS2, *NADEEM SHEIKH

1, FARKHANDA MANZOOR

2, SUMAIRA ASLAM

3, &

AFIA FARRUKH1

1Department of Zoology, University of the Punjab, Q-A Campus, Lahore, Pakistan.,

2Department of Zoology,

Lahore College for Women University, Lahore., 3Department of Zoology, Govt. College for Women University,

Faisalabad, Pakistan.

ABSTRACT

Consumption of herbal plants as a remedy to relieve the side effects of fat rich diets is on rise currently. The present study was conducted to scrutinize the impact of fat and fat reducing herbal agents on the serum proteins of Rattus norvegicus. Four groups of adult (A) & weaning (W) R. norvegicus one control and three experimental groups were designated as 0, I, II and III and were fed on rat chow, fat rich diet (FRD), FRD + 5% Nigella sativa seeds and FRD + 5% Plantago ovata husk respectively. The total serum protein concentrations in adult groups A-I & A-II were significantly elevated (P<0.01) while significantly lower concentrations were found in group A-III (P<0.001). The comparative serum profile of weaning groups revealed protein fractions of 201KDa in W-III while among the adult rat groups the protein fraction of 86 kDa in A-II group. The protein fractions of 295 KDa, 246 KDa, 133 KDa & 110 KDa were absent in group A-III as compared to other adult groups. It can be concluded that fat rich diets can alter the serum protein levels and seeds of N. sativa could preserve serum protein profile in adult R. norvegicus contrary to P. ovata husk which caused hypoproteinemia. Key words: Hypoproteinemia, High fat diet, P. ovata husk, N. ovata seeds, Protein profile, Rattus

norvegicus

INTRODUCTION Liver is a central player in the whole body

energy homeostasis by its ability to metabolize glucose and fatty acids. When consumption of energy far exceeds the combustion of calories, the unburnt energy is conserved in the form of TG (triglycerides) in adipose tissue, leading to obesity (Evans, et al., 2004; Hamaguchi, et al.,2005). Liver is inflamed and termed as fatty due to fat retention within hepatocytes. Clinically fatty liver disease (FLD) is now broadly categorized into two types, alcoholic FLD (AFLD) and non-alcoholic FLD (NAFLD) (Browning & Horton, 2004; Adams & Angulo, 2005). Inflammation is a part of the non-specific immune response that occurs in reaction to any type of injury. In some disorders this process, which under normal conditions is self-limiting, becomes continuous and chronic inflammatory diseases develop subsequently (Ferrero-Miliani et al., 2007).

The complex series of reactions initiated in response to infection, physical trauma, or malignancy is called the acute-phase response (APR) (Sheikh et al., 2007; Malik et al., 2011). APR is characterized by leukocytosis, fever, alterations in the metabolism of many organs as well as changes in the plasma concentrations of various acute-phase proteins (APPs) (Hack et al., 1997; Gabay &

Kushner, 1999). APPs have been defined as any protein whose plasma concentrations increases (positive acute-phase proteins; fibrinogen, serum amyloid A, albumin, C-reactive protein) or decreases (negative acute-phase proteins; albumin, transferrin, insulin growth factor - I) by at least 25 percent during an inflammatory disorder (Morley & Kushner, 1982). These inflammatory responses define the treatment directions. Various allopathic medicines are available to treat the FLD but due to the side effects associated with their long term usage, scientists are now studying the natural herbs for the potential capabilities of controlling diseases.

Nigella sativa (Kalonji), is a herb and distributed throughout India (CSIP, 1996; Rifat-Uz-Zaman, 2004). Avicenna referred N. sativa seeds as body energy stimulator and a potential helper against fatigue. It is also included in the list of naturally occurring drugs of Tibbe-Nabavi/ Medicines of the Prophet Muhammad (PBUH) owing to the traditional recommendation for healing all diseases (Bukhari, 1985). In “Unani medicines system”, N. sativa is also a preferred therapy against numerous diseases. Its therapeutic treatments include piles, jaundice, cough, ascites, hydrophobia, dyspepsia, fever, paralysis, skin diseases, flatulence, diarrhea, abdominal disorders, intrinsic hemorrhage, dysentery and amenorrhea. “N. sativa” seeds are used in a variety of

212 A. S ABBAS ET AL BIOLOGIA (PAKISTAN)

pharmacological and nutritional analysis. Laboratory and human subject studies conducted on its “seeds and oil” have reported their effectiveness to motivate immune response, cure diabetes, rheumatism, local anesthesia, inflammatory diseases and cancer (Haq, et al., 1999; (MHFS., 1989; Ramadan & Morsed, 2002; Khanam, M., 2007; Warrier et al., 2004).

Dietary fiber cuts down gastro-intestinal-transit time and augments stool weight (Devroede, 1993). The “husk” of “Plantago ovata” commonly called psyllium, which is extensively in use as a supplement dietary fiber to treat constipation. Its husk is acquired by refining the seeds to eliminate the hulls. Its husk has a high percentage of hemicellulose, rhamnose, made up of a “xylan backbone” connected with arabinose, & “galacturonic-acid units” (arabinoxylans). In some researches, seed is used as an alternative to the husk, and is commercially accessible. The seed comprises of “35% soluble” and “65% insoluble” polysaccharides (lignin, hemicellulose, and cellulose). Psyllium is categorized as a “mucilaginous fiber” owing to its potential of gel formation like compound in water because of being the endosperm of the seed, where it retains water to prevent the seed from desiccation. It also has “hypo-cholesterolemic” effects, even though the precise mechanism through which psyllium husk carries out a drop in cholesterol is not clear. (Matheson et al., 1995). Soluble fiber enhancement of the usual diet leads to reductions in “low density lipid cholesterol” (LDL-C) and triglycerides to “high density lipid cholesterol” (HDL-C) ratio (TG/HDL-C) compared to interventions focused on fat reduction (Reid et al., 2002).

Instead of numerous studies conducted on the fat reducing role of P. ovata husks and N. sativa seeds, there is no substantial work reported on fat induced inflammation and the role of these herbs against this inflammatory response. In the current study our main emphasis was on the inflammatory responses of the body after consumption of fat rich diet as well as the impact of the above mentioned fat reducing agents.

MATERIALS & METHODS

Colonies of Rattus norvegicus

Colonies of Rattus norvegicus (Wistar rats) were reared in the “Animal House” of Department of the Zoology, University of the Punjab, Lahore, Pakistan”. Animals were divided into two groups depending upon the body weight i.e., weaning (W) rats of 30±10g and adult (A) of 200±15g body

weight. Each group was sub-divided into four groups (n=10) designated as group 0, I, II and III on the basis of the different diet compositions (Abbas et al., 2014). The groups 0 and I served the negative and positive control, respectively.

Induction of Inflammation in Rattus norvegicus

Out of the four groups, the group 0 was selected as negative control and was fed on regular rat chow throughout the experimental study, group I served as positive control and received a fat rich diet (FRD) with composition of 33% tea whitener + 20% Sucrose +13% water + 34% ground rat chow (Abbas et al.,2014) . Groups II and III were treated groups and fed on FRD supplemented with 50g N. sativa seeds/P. ovata husk. Animals had ad libitum access to water and food for sixteen weeks, and were kept under 12 hour dark and light cycle.

Sacrificing & sample collection

After feeding for sixteen weeks the animals were fasted overnight and anesthetized by Intraperitoneal (IP) injection of Narcuron (1.5 ml/kg body weight). After dissection the blood was drawn through cardiac puncture and centrifuged to separate serum. To estimate the protein concentration an accurate and rapid Bradford Assay (Bradford, 1976) was performed. Bench Mark protein ladder (Cat.

# 10747012) by Life

technologies

was used for protein profiling employing Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS-PAGE). The densitometry analysis for electrophoretically resolved “protein fractions” was carried out by TotalLab Quant v11.5. It provided the data based on “molecular density” of each protein fraction.

RESULTS

Total Protein

The variations in total serum protein concentrations in weaning groups were observed to be non-significant (Figure 1a) while in adult groups A-I and A-II significantly elevated (P<0.01) serum total protein level was observed as compared to the negative control group rats (A-0). However, significantly lower protein concentrations were found in group A-III (P<0.001) in comparison with groups A-I and AII (Figure 1b).

Protein Profiling by SDS PAGE

The comparative study of the serum profile of weaning groups against protein ladder of range 10-220 KDa revealed the protein fractions from 54KDa to 280 KDa. The protein fractions of 280 KDa, 134 KDa, 110 KDa, were found in W-I, W-II

VOL. 61 (2) P. OVATA HUSK INDUCED HYPOPROTEINEMIA 213

and W-III as compared to the W-0. However, 201 KDa protein fraction was present only in W-III (Figure 2 and 4a). The serum protein fractions of adult rat groups resolved on the 8% SDS-PAGE scrutinized the protein bands from 54 KDa to 295 KDa against protein marker. The protein fractions of 295 KDa, 246 KDa, 133 KDa and 110 KDa were absents in group A-III, while, protein fraction of 86 kDa was present only in A-II group rat sera (Figure 3 and 4b).

Fig., 1: Total serum protein (g/dl) in the experimental (I, II

and III) rats as compared to the control (0) rats, W=weaning (a) and A=Adult (b). Group 0=negative control, Group I=positive control fed on FRD, Group

II=Experimental group given FRD + 5% N. sativa seeds, Group III=Experimental group fed on FRD+5% P. ovata husks. Results are Mean ± SEM, analyzed by one-way ANOVA (post-hoc Tukey’s test) with n=10. Significance

levels are *=P≤ 0.05, **=P≤ 0.01, ***=P≤ 0.001.

DISCUSSION

Inflammation performs a fundamental role in

host defense against insidious pathogens, wound and tissue repair. (Barton, 2008; Chen & Nunez, 2010). Liver has immediate access to dietary fat and its retention within hepatocytes induces inflammation of the liver resulting in inflammatory response in the form of acute phase proteins (Browning & Horton, 2004; Adams & Angulo, 2005; Galisteo et al., 2005).

The comparative study of the serum protein profile of weaning groups revealed the protein fractions of 54 to 280 KDa. The protein fractions of 280, 134 and 110 KDa, were found in weaning rat groups W-I, W-II and W-III as compared to the W-0. However, protein fraction of 201 KDa was present only in group W-III. The serum protein profile of adult groups scrutinized the protein bands from 54 to 295 KDa. The protein fractions of 295, 246, 133 and 110 KDa were absent in group A-III. However, protein fraction of 86 KDa was present only in group A-II. Haptoglobin (86 KDa) is a “positive acute-phase” protein, its plasma level elevates during inflammation, infections, trauma, malignant proliferation and tissue damage, but declines as a result of severe haemolysis. Thus, varied

concentrations of haptoglobin have clinical significance in the diagnosis (Javid, 1978; Bowman & Kurosky, 1982; Dobryszycka, 1997). Protein bands of 110KDa and 270KDa appeared in negative control group (A-0) disappeared in all adult groups except those treated with P.ovata husks

supplemented diet.

These results indicated the inhibitory effects of fatty diet on sortilin (110 KDa) but also the recovery effects of P. ovata husk supplementation, while this fat reducing herbal agent drastically affected a protein band of 310KDa which appeared in all adult groups otherwise. Sortilin (110 KDa) in hepatocytes have the role in degradation of nascent very low density lipids (Strong et al., 2012). Reelin (310KDa) is an extracellular matrix protein, largely secreted by the liver (Botella-Lopez et al., 2008). Fibrinogen is an inflammatory marker protein (Libby et al., 2002). Fibrinogen with high molecular weight (340 KDa) on partial degradation results in lower molecular weights 305 KDa or 270 KDa (Holm & Godal, 1984; Holm et al., 1985; Nieuwenhuizen, 1995). Elevated fibrinogen level in plasma is linked with increased risk of cardiovascular diseases, including ischaemic heart disease (Kamath & Lip, 2003; Shi et al., 2010).

Response of albumin to herbal

supplemented diets was more prominent in adult

experimental groups as compared to weaning

group. However, significantly higher levels of

albumin were observed under effects of N. sativa

seeds as compared to the P. ovata husks. The

albumin level increased not only under the effects of

N. sativa but was also found to be related to the age

of the animal as reported earlier in mammals

(Zanouny et al., 2013). Clinically, albumin (66KDa)

is an indicator of the existence and progression of

several diseases and is crucial regulator of colloidal

osmotic-balance in the blood (Moshage, 1997; Obal

et al., 1998;). Albumin is a “negative acute-phase”

(APP). Hypoalbuminemia is consequence of the

acute-phase conditions (Princen et al., 1981),

associated with many diseases such as liver

diseases, kidney diseases, cancer, severe burns,

infections and some genetic abnormalities

(Takeuchi & Takada, 1968; Grant et al., 1987). Liver

has first-pass access to dietary nutrients and have a

crucial role in their metabolism. During

hepatototxicity, this metabolism is perturbed and

cirrhotic liver may lead to hypoproteinemia due to

disrupted proteins (Schwrtz et al., 1974). In

accordance with this study the group provided with


HFD supplemented with the P. ovata husk exhibited

hypoproteinemia.

Fig., 2: Densitometric comparison of electrophoretically resolved serum proteins of weaning rats groups

against protein ladder. W=Weaning, Group 0=negative control, Group I=positive control fed on FRD, Group II=Experimental group given FRD+ 5% N. sativa seeds, Group III=Experimental group fed on FRD+5% P.

ovata


Fig., 3: Densitometric comparison of electrophoretically resolved serum proteins of adult rat groups against protein ladder. A=Adult, Group 0=negative control, Group I=positive control fed on FRD, Group

II=Experimental group given FRD+ 5% N. sativa seeds, Group III=Experimental group fed on FRD+5% P. ovata husks.


Fig., 4: Densitometric comparison of electrophoretically resolved serum proteins between weaning rat

groups (a) and adult rats (b) with molecular weight (KDa) on x-axis and volume (mm2) on y-axis. 1-9 are

the band positions.

It is reported that hepatic diseases are among the most prevalent diseases leading to death in spite of all the innovative research performed in this regard. As a consequence traditional medicinal herbs are being recommended to cure liver ailments (Anbarasu et al., 2012). Taking together all findings of our current research we conclude that among the two fat plummeting agents used in the present study to reverse inflammatory response induced by fat rich diet the therapeutic potential of N. sativa seeds was higher than P. ovata husk. Furthermore, the hypoproteinemic role of P. ovata husk is noticeable and there is need of further research in this regard. Acknowledgement The authors are thankful to Higher Education commission of Pakistan for providing Financial assistance (Grant number: 074-3594-BM4-217) for current study.

REFERENCES Abbas A. S., Abbasi M. H., ; Malik I. A. & Sheikh

N., 2014. Non-alcoholic fatty liver disease & associated changes in serum Hepcidin, iron, ferritin-r levels & total iron binding capacity in weaning wistar rats (Rattus

norvegicus). J. Anim. Plant Sci., 24(2):418-424.

Adams, L. A. & Angulo, P., 2005. Recent concepts in non-alcoholic fatty liver disease. Diabet. Med., 22: 1129-1133, doi:DME1748 [pii];10.1111/j.1464-5491.2005.01748.x [doi].

Anbarasu, C., Rajkapoor, B., Bhat, K., Giridharan, J., Amuthan, A.A., & Satish, K., 2012. Protective effect of Pisonia aculeata on thioacetamide induced hepatotoxicity in rats. Asian Pac. J. Trop. Biomed, 2: 511-515.

Barton, G. M., 2008. A calculated response: control of inflammation by the innate immune system. J. Clin. Invest, 118: 413-420, doi:10.1172/JCI34431 [doi].

Botella-Lopez, A., De, M. E., Jover, R., Bataller, R., Sancho-Bru, P., Candela, A., Compan, A., Perez-Mateo, M., Martinez, S. & Saez-Valero, J., 2008. Reelin is over expressed in the liver and plasma of bile duct ligated rats and its levels and glycosylation are altered in plasma of humans with cirrhosis. Int. J. Biochem. Cell Biol., 40: 766-775.

Bowman, B. H. & Kurosky, A., 1982. Haptoglobin: the evolutionary product of duplication, unequal crossing over, and point mutation. Adv. Hum. Genet., 12: 189-4.


Bradford, M. M., 1976. A Rapid & Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Ana biochem, 72: 248-254.

Browning, J. D. & Horton, J. D., 2004. Molecular mediators of hepatic steatosis and liver injury. J. Clin. Invest., 114: 147-152, doi:10.1172/JCI22422 [doi].

Bukhari, M. & Sahih Bukhari Sharif, 1985. Reprint. Lahore, Pakistan: Maktaba Rehmania Urdu Bazar; 3:312.

Chen, G. Y. & Nunez, G., 2010. Sterile inflammation: sensing and reacting to damage. Nat. Rev. Immunol., 10(12): 826-837.

CSIP, 1996. The Wealth of India-A Dictionary of Indian Raw Materials, New Delhi, Vol 7. pp: 63-65.

Devroede, G., 1993. Constipation. In: Sleisinger, M. H. & Fordtra n, J. S., eds. Gastrointestinal Disease: Pathophysiology, Diagnosis, Management. Philadelphia, PA: WB Saunders. 837-887.

Dobryszycka, W., 1997. Biological functions of haptoglobin--new pieces to an old puzzle. Eur. J. Clin. Chem. Clin. Biochem., 35: 647-654.

Evans, R. M., Barish, G. D. & Wang, Y. X., 2004. PPARs and the complex journey to obesity. Nat. Med., 10: 355-361.

Ferrero-Miliani, L., Nielsen, O. H., Andersen, P. S. & Girardin, S. E., 2007. Chronic inflammation: importance of NOD2 & NALP3 in interleukin-1beta generation. Clin. Exp. Immuno., 147: 227-235.

Gabay, C. & Kushner, I., 1999. Acute-phase proteins and other systemic responses to inflammation. N. Engl. J. Med., 340: 448-454.

Galisteo, M., Sanchez, M., Vera, R., Gonzalez, M., Anguera, A., Duarte, J. & Zarzuelo, A., 2005. A diet supplemented with husks of Plantago ovata reduces the development of endothelial dysfunction, hypertension, and obesity by affecting adiponectin and TNF-alpha in obese Zucker rats. J. Nutr., 135: 2399-2404, doi:135/10/2399 [pii].

Grant, G. H., Silverman, L. M. & Christenson, R. H., 1987. Amino acids and proteins. In Fundamentals of Clinical Chemistry, N. W. Tietz, ed., Philadelphia:WB Saunders, pp: 291-345.

Hack, W. W., ten, H. R., Breslau-Suderius, E. J. & Halley, D. J., 1997. [Prader-Willi syndrome in a young infant]. Ned. Tijdschr. Geneeskd, 141: 2025-2028.

Hamaguchi, M., Kojima, T., Takeda, N., Nakagawa, T., Taniguchi, H., Fujii, K., Omatsu, T., Nakajima, T., Sarui, H., Shimazaki, M., Kato, T., Okuda, J. & Ida, K., 2005. The metabolic syndrome as a predictor of nonalcoholic fatty liver disease. Ann. Intern. Med., 143: 722-728.

Haq, A., Lobo, P. I., Al-Tufail, M., Rama, N. R. &

Al-Sedairy, S. T., 1999.

Immunomodulatory effect of Nigella sativa

proteins fractionated by ion exchange

chromatography. Int. J.

Immunopharmacol., 21: 283-295,

doi:S0192-0561(99)00010-7 [pii].

Holm, B. & Godal, H. C., 1984. Quantitation of the

three normally-occurring plasma

fibrinogens in health &and during so-

called "acute phase" by SDS

electrophoresis of fibrin obtained from

EDTA-plasma. Thromb. Res., 35: 279-

290, doi:0049-3848(84)90359-1 [pii].

Holm, B., Nilsen, D. W., Kierulf, P. & Godal, H. C.,

1985. Purification and characterization of

3 fibrinogens with different molecular

weights obtained from normal human

plasma. Thromb. Res., 37: 165-176,

doi:0049-3848(85)90043-X [pii].

Javid, J., 1978; Human haptoglobins. Current

Topics Hematol., 1:151-92.

Kamath, S. & Lip, G. Y. H., 2003. Fibrinogen:

biochemistry, epidemiology and

determinants From the Haemostasis

Thrombosis & Vascular Biology Unit,

University Department of Medicine,City

Hospital, Birmingham, UK Q. J. Med.,

96:711–729.

Khanam, M., 2007. Effects of n-hexane extract of

Nigella sativa Linn. (kalajira) upon serum

glucose concentration of streptozotocin-

induced diabetic rats. Bangabandhu

Sheikh Mujib Medical University, Dhaka:

M.Phil. Thesis. 68 pp.

Libby, P., Ridker, P. M. & Maseri, A., 2002.

Inflammation and atherosclerosis.

Circulation. 105:1135-1143.

Malik, I. A., Naz, N., Sheikh, N., Khan, S.,

Moriconi, F., Blaschke, M. & Ramadori,

G., 2011. Comparison of changes in gene


expressio.n of transferrin receptor-1 and

other iron-regulatory proteins in rat liver

and brain during acute-phase response.

Cell Tissue Res., 344 (2): 299-312,

doi:10.1007/s00441-011-1152-3 [doi].

Matheson, H. B., Colon, I. S. & Story, J. A., 1995.

Cholesterol 7 alpha-hydroxylase activity is

increased by dietary modification with

psyllium hydrocolloid, pectin, cholesterol

and cholestyramine in rats. J. Nutr. 125:

454-458.

Ministry Of Health & Family Welfare, New Delhi,

1989. The Ayurvadic Pharmacopoeia of

India, 1: 119-120.

Morley, J. J. & Kushner, I., 1982. Serum C-

reactive protein levels in disease. Ann. N.

Y. Acad. Sci., 389: 406-418.

Moshage, H., 1997. Cytokines and the hepatic

acute phase response. J.Pathol., 181(3):

257-266.

Nieuwenhuizen, W., 1995. Biochemistry and

measurement of fibrinogen. Eur. Heart J.,

16 Suppl A: 6-10.

Obal, F., Jr., Kapas, L. & Krueger, J. M., 1998.

Albumin enhances sleep in the young rat.

Physiol Behav., 64: 261-266, doi:S0031-

9384(98)00074-2 [pii].

Princen, J. M., Nieuwenhuizen, W., Mol-Backx, G.

P. & Yap, S. H., 1981. Direct evidence of

transcriptional control of fibrinogen and

albumin synthesis in rat liver during the

acute phase response. Biochem. Biophys.

Res. Commun., 102: 717-723, doi:S0006-

291X(81)80191-X [pii].

Ramadan, M. F. & Morsel, J. T., 2002.

Characterization of phospholipid

composition of black cumin (Nigella sativa

L.) seed oil. Nahrung, 46: 240-244.

Reid, R., Fodor, G., Lydon-Hassen, K., D'angelo,

M. S., Mccrea, J., Bowlby, M. &

Difrancesco, L., 2002. Dietary counselling

for dyslipidemia in primary care: results of

a randomized trial. Can. J. Diet. Pract.

Res., 63: 169-175.

Rifat-Uz-Zaman, Akhter, M. S. & Khan, M. S.,

2004. Gastroprotective and anti-secretary

effect of Nigella sativa seed and its

extracts in indomethacin-treated rats. Pak

J. Biol. Sci., 7 (6): 995-1000.

Schwartz, W.L., Bay, W.W., Dollahite, J.W.,

Storts, R.W., & Russell, L.H., 1974.

Toxicity of Nerium oleander in the monkey

(Cebus apella). Vet. Pathol., 11: 259-277.

Sheikh, N., Dudas, J. & Ramadori, G., 2007.

Changes of gene expression of iron

regulatory proteins during turpentine oil-

induced acute-phase response in the rat.

Lab Invest., 87: 713-725, doi:3700553

[pii];10.1038/labinvest.3700553 [doi].

Shi, Y., Wu, Y., Bian, C., Zhang W., Yang J., &

Xu, G., 2010. Predictive Value of Plasma

Fibrinogen Levels in Patients Admitted for

Acute Coronary Syndrome. Tex Heart Inst

J., 37(2): 178–183.

Strong, A., Ding Q, & Andrew C., 2012. Hepatic

sortilin regulates both apolipoprotein B

secretion and LDL catabolism. J Clin

Invest., 122 (8):2807–2816.

doi:10.1172/JCI63563.

Takeuchi, J. & Takada, A., 1968.

Hypoproteinemia in Liver Diseases. Jap.

J. Med. 7(4): 306-308.Vergara-Jimenez,

M., Conde, K., Erickson, S. K. &

Fernandez, M. L., 1998. Hypolipidemic

mechanisms of pectin & psyllium in

guinea pigs fed high fat-sucrose diets:

alterations on hepatic cholesterol

metabolism. J. Lipid Res., 39: 1455-1465.

Warrier, P. K., Nambiar, V. P. K. & Ramankutty,

2004. Indian Medical Plants- A

Compendium of 500 species. Orient

Logman Pvt. Ltd. Chenni, 4:139-142

Zanouny A. I., Abd-Elmoty, A. K. I., El–Barody, M.

A. A., Sallam, M. T., & Abd El–Hakeam,

A. A., 2013. Effect of supplementation

with Nigella sativa seeds on some blood

metabolites and reproductive

performance of ossimi male lambs.

Egyptian J. Sheep Goat Sci., 8(1): 47-56

(Proceedings Book of 4th International

Scientific Conference on Small Ruminant

Development).


http://www.ncbi.nlm.nih.gov/pubmed/?term=Shi%20Y%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wu%20Y%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bian%20C%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zhang%20W%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20J%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Xu%20G%5Bauth%5D


Correspondence aouthor: [email protected]

Effect of Chromium (VI) on physical growth and biochemical parameters of

Wheat (Triticum aestivum L.) seedlings

*ZEB SADDIQE, AYESHA FAROOQ, FARAH KHAN, HAFSA KHALID & SANA JAVERIA

Department of Botany, Lahore College for Women University, Jail Road, Lahore, Pakistan

ABSTRACT

The effect of different concentrations of hexavalent Cr on growth and biochemical parameters of two T. aestivum cultivars (Punjab-11 and Sehar-06) was investigated. No significant inhibition of seed germination

was observed in both the cultivars at all the tested concentrations (P ˃ 0.05). A significant decrease in root length for both the cultivars was observed at all the Cr concentrations as compared with the control (P < 0.05). In case of shoot length the metal caused a significant decrease in shoot length in Saher-06 (P < 0.05) while in cv. Punjab-11 the shoot length was not significantly affected (P ˃ 0.05) by metal. A strong phyto-toxic effect of Cr on root growth was determined for both the cultivars with high phytotoxic effect in Saher-06. The phytotoxic effect of the metal on shoot growth was much higher in wheat variety Saher-06 than in the Punjab-11 at all the tested concentrations. Seedling vigor index of both the cultivars was found less than that of the control with Saher-06 showing a significant decrease in seedling vigor due to the presence of metal. Among the two cultivars Punjab-11 showed better tolerance towards metal stress as compared to Saher-06. Total soluble protein, catalase and peroxidase contents increased in cv. Punjab-11 and decreased in cv. Saher-06 under metal treatment. The study concluded that wheat variety Punjab-11 revealed more tolerance towards Cr stress as compared to Saher-06. Key words: Antioxidant enzymes, catalase, chromium stress, heavy metals, Triticum aestivum, peroxidase

_______________________________________________________________________________________

INTRODUCTION

Heavy metal pollution is a major problem of agro ecosystem in the present era of industrialization. Many heavy metals are micronutrients essential for plant growth and metabolism and are required in trace amounts. However, these metals are toxic at high concentrations (Ivanova et al., 2010). Heavy metals inhibit the plant growth by reacting with proteins and affecting the water relations and metabolism (Dukhovskis et al., 2003; Duchovskis et al., 2006; Singh et al., 2007; Gajewska & Sklodowska, 2008). The toxic effects of heavy metals in plants are due to the imbalance between productions of reactive oxygen species (ROS) and antioxidants in plant cells. Heavy metals are known to increase the production of ROS such as superoxide anion (O

2–),

hydroxyl radical (OH) and hydrogen peroxide (H2O2) (Devi & Prasad, 2005; Pradedova et al., 2011). These ROS are produced in cells under normal conditions too, but their amount is balanced by the antioxidative system. The antioxidant system of the plants includes the non-enzymatic antioxidants including ascorbate, amino acids, polyamines, carotenoids, glutathione, tocopherols, etc. and the enzymatic antioxidants including ascorbate peroxidase (APX), superoxide dismutase, glutathione peroxidase (GPX), guaiacol peroxidase (GPX), glutathione reductase (GR),

mono- and di-hydro ascorbate reductase and catalase (CAT), (Panda et al., 2003; Gajewska & Sklodowka, 2008; Pradedova et al., 2011). Chromium is used on a large-scale in many industries including production of paints, pigments, pulp, paper, electroplating cleaning agents, leather processing and finishing, catalytic manufacture, drilling muds and production of refractory steel (Shanker et al., 2005). These industries cause significant Cr pollution and result in adverse biological and ecological effects (Zayed & Terry, 2003; Yildiz et al., 2011; Shugaba et al., 2012). In Pakistan the toxic heavy metals from industries are entering in food chain and drinking water supplies ultimately posing serious illnesses in local population (Saif et al., 2005; Latif et al., 2008; Azeem, 2009). Leather and tanning industries in our country are the major source of Cr adding a huge amount of the toxic metal in both water and soil (through leaching) thus polluting both (Rafique et al., 2010). The current investigation aims to determine the effect of a range of different concentrations of Cr on the seed germination, seedling growth and peroxidase (POX) and CAT activity of two wheat (T. aestivum L.) cultivars (Punjab-11 and Saher-06).

220 Z. SADDIQE ET AL BIOLOGIA (PAKISTAN)


Plant Material

Certified seeds of wheat (cv. Punjab-11 and Sehar-06) were obtained from Punjab Seed Corporation and were stored in air tight packets at room temperature.

Assay for heavy metal toxicity

To assess the effect of Cr on wheat seedlings the method of Datta et al. (2011) was followed. Seeds were sterilized by soaking in 2% mercuric chloride solution for 10 min and washed several times with tap water followed by sterilized distilled water. The seeds were then blotted on sterile filter paper. The working concentrations of chromium were prepared at 0.25, 0.5, 1.0, 1.5, 2.0 mM using water as solvent. Potassium dichromate (K2Cr2O7) was used as source of chromium. Ten healthy and uniform sized seeds were placed in sterilized petri dishes at equal distance from each other. The seeds were allowed to germinate using double layer of Whatmann filter paper moistened with 10 ml of each metal solution. Distilled water served as control. The petri dishes were regularly supplied with 5 ml of respective test solution to keep

them moist and incubated at 25 ± 2C. The experiment was performed in triplicates.

Growth parameters

The growth parameters viz., percentage germination and root and shoot length of seedlings were selected for the study following the standard procedure. Seeds were considered germinated when the lengths of radicles were more than 2 mm. Germination rate was calculated by counting the number of germinated seeds at 24 h intervals for three days. After three days of germination, the seeds were transferred to plastic containers containing soil and were sown at a depth of 0.5 cm. The pots were maintained moistened daily to keep the soil moist using metal solution of respective concentration. The seedling growth was monitored at weekly intervals for two weeks. The root and shoot length were measured by using a centimeter scale.

Percentage phytotoxicity

The phytotoxic effect of the metal on root and shoot growth in terms of % phytotoxicity was calculated after 15 days of growth using the formula given by Chou & Lin (1976):

Seedling vigor index (SVI)

SVI was calculated by using the following formula (Iqbal & Rahmati, 1992): VI = (mean root length + mean shoot length) × % germination

Tolerance index

The tolerance of wheat seedlings to various concentrations of Cr was determined by Wilkinson tolerance index (WTI) and was calculated by the following formula (Koornneef et al., 1997):

It = (Ime/Ic) × 100 Where Ime = increase in root length in metal ion solution and Ic = the increase in root length in the control after 15 days.

Biochemical parameters

The seedlings of the two cultivars in each case were evaluated for biochemical changes after weekly intervals for two weeks. The biochemical parameters selected for the study were total soluble protein content and activity of two antioxidant enzymes, peroxidase and catalase.

Extraction of plant material

For extraction, five seeds of wheat were grinded with 0.1 M phosphate buffer (pH 7.2) (1:5) in the presence of 0.1 g of PVP. The grinded material was centrifuged at 12,000 rpm for 20 min at 4°C in centrifuge. The supernatant thus obtained was filtered and used to estimate total protein contents and activity of the two selected enzymes.

Determination of total soluble protein content

The Biuret method (Racusen & Johnstone, 1961) was adopted for the estimation of soluble protein contents. The reaction mixture consisted of 0.1 mL of supernatant and 1.0 mL of Biuret reagent. The control set up contained 0.1 mL of distilled water instead of supernatant. Optical density of the reaction mixture was measured at 545 nm with spectrophotometer (UV-6000, England). The protein content (mg g

−1 of tissue) was calculated from the

standard curve for protein prepared from bovine serum albumin (Fig., 1).

Estimation of peroxidase (POD) activity

POD activity (mg g−1

of tissue) was determined as revealed by Racusen & Foote (1965). The reaction mixture for peroxidase contained 0.1 mL of crude enzyme extract, 0.2 mL of 1% guaiacol solution, 2.5 mL of 0.1 M phosphate buffer (pH 7.2) and 0.2 mL of 0.3% H2O2 solution, while the assay mixture for peroxidase in control contained 0.2 mL of distilled water instead of

VOL. 61 (2) HEAVY METAL TOXICITY IN WHEAT SEEDLINGS 221

guaiacol solution. The activity was estimated by measuring the absorbance of above mixture at 470 nm.

Estimation of catalase (CAT) activity

CAT activity was measured by following the method of Aebi (1974). The reaction mixture consisted of 25 mM potassium phosphate buffer (pH 7.0), 10 mM H2O2 and enzyme extract. The enzyme activity was determined by measuring the decrease in absorbance of H2O2 in the reaction mixture at 240 nm.

Statistical analysis

The experiments were conducted in triplicates and the data was presented as mean ± standard deviation (SD). Statistical analysis was done using Microsoft Excel 2007 and the difference between means was calculated by the Student’s t-test at P = 0.05.

RESULTS AND DISCUSSION

Effect on seed germination

Seed germination is the first visible indicator

of plant growth and is regulated by a number of

physical and physiological processes. In the present

study Cr differently affected seed germination in

both the wheat varieties. In cv. Punjab-11 seed

germination was stimulated by Cr application

indicated by an increase in % seed germination in

seeds supplemented with metal solution as

compared to control (81.8%) with maximum

germination at 0.25 mM (96.4%) beyond which

germination decreased in a dose dependent manner

(86.3% germination at 2 mM). In cv. Saher-06

maximum seed germination was in control (100%)

while in Cr treated seeds germination decreased

with increase in metal concentration with minimum

germination at 1.5 mM (86.3%).

The difference in % seed germination

between control and experimental in both the

cultivars was not significant (P ˃ 0.05) (Fig., 2). In a

number of studies the effect of Cr on seed

germination of crop plants was found to be non

significant. Jamal et al. (2006) found that seed

germination in wheat remained unaffected by Cr

application. Gang et al. (2013) reported that Cr did

not affect the germination of wheat seeds at

concentrations as high as 500 ppm. Similarly in a

study by Shaikh et al. (2013) the effect of Cr on

seed germination in wheat was lowest among the

tested heavy metals including Cd, Mn and Zn. The

decrease in seed germination by Cr is related to the

inhibitory effect of metal on activity of α and β-

amylase which hydrolyze starch to sugar required

by developing embryos (Zeid, 2001).

Fig., 1: Standard protein curve

Fig., 2: Effect of Cr on seed germination of two

wheat cultivars


Fig., 3: Effect of Cr on root and shoot length of two wheat cultivars

Fig., 4: Phytotoxicity (%) of different Cr concentrations on root and shoot growth in T. aestivum cultivars


Fig., 5: Effect of different concentrations of

chromium on seedling vigor index of two wheat cultivars

Fig., 6: Tolerance indices of two wheat cultivars at

different concentrations of chromium

Fig., 7: Effect of Cr concentration on protein content

in seedlings of two wheat cultivars

Fig., 8: Effect of Cr concentration on POX content in

seedlings of two wheat cultivars

Fig., 9: Effect of Cr concentration on CAT content in

seedlings of two wheat cultivars

Effect on root and shoot length

A significant reduction in root growth (P < 0.05) was observed in both the cultivars growing under Cr stress condition indicated by a decrease in root length in the presence of metal in a dose dependent manner (Fig., 3). In Punjab-11, Cr caused 80% reduction in root length at 2 mM concentration while in Sehar-06 the root length was decreased by 92% at 1.5 mM. Similar results have been reported previously (Jamal et al., 2006; Dey et al. 2009; Datta et al. 2011; Gang et al., 2013) where high Cr concentration significantly reduced root growth in crop plants. The reduction in root growth due to Cr might be due to inhibition of cell division and/or elongation in root cells which results from tissue collapse thus affecting absorption of water and nutrients by the roots (Barcelo et al., 1986). The effect of Cr on root growth was similar at all the tested concentrations indicating that Cr concentration as low as 0.25 mM was toxic for root growth in both the wheat varieties.

The results for shoot length showed a similar trend as in case of root length. The results clearly indicated the inhibitory effect of the metal on shoot growth in terms of reduction in shoot length in both the cultivars (Fig., 3). The decrease in shoot length in cv. Punjab-11 was not significant as compared to control (P ˃ 0.05) with 48% reduction


in shoot length at 2 mM Cr. In cv. Saher-06 reduction in shoot length in Cr treated seedlings was statistically significant as compared to control (P < 0.05) where the shoot length decreased by 92% at 1 mM Cr. Decrease in shoot length is obvious since destruction of root cells by Cr may cause decrease in nutrient and water mobility from root to shoot. Dey et al. (2009) reported a 44% decrease in shoot length in wheat seedlings at 100 mg/L of Cr. The reduction in root and shoot length under Cr stress may be due to accumulation of Cr in roots or absence of translocation of Cr from roots to other tissues further causing increase in Cr concentration in roots inhibiting root development (Lu et al., 2004; Diwan et al., 2010).

Phytotoxicity

A strong phytotoxic effect of the metal was observed against root growth of both the cultivars in a dose dependant manner (Fig., 4). Phytotoxicity of root in cv. Punjab-11 was minimum at 0.5 mM (73%) and maximum at 2.0 mM (88.7%). For Saher-06 phytotoxicity of Cr on root growth was higher than in Punjab-11 with minimum phytotoxicity at 0.25 mM (84.1%) and maximum at 2 mM (93.3%). The results indicated that Cr at concentration as low as 0.25 mM can significantly affect root growth in wheat. The phytotoxic effect of Cr on shoot growth was much significant in Saher-06 (79.29% at 0.25 mM to 92.96% at 0.5 mM) than Punjab-11 (10.36% at 1.5 mM to 47.64% at 2 mM). At 1.0 mM Cr shoot growth was stimulated (4.5% stimulation) in Punjab-11 (Fig., 4).

Effect of chromium on seedling vigor index

Seedling vigor index in cv. Punjab-11 was higher in control (914.5) than in metal treated seedlings. In experimental groups vigor index increased from 516.1 at 0.25 mM to 715.5 at 1.5 mM and then decreased at 2.0 mM chromium concentration (382.5). In case of Saher-06 the seedling vigor was highest in control (2345) and significantly decreased under metal stress condition (362.4 at 0.25 mM - 152.9 at 1 mM) indicating a high sensitivity of this cultivar for the metal (Fig., 5).

Effect of chromium on tolerance index

The tolerance index in both the cultivars was negatively correlated with the metal concentration and was dose dependant. Among the two cultivars cv. Punjab-11 showed high tolerance against the metal as compared to cv. Saher-06 at all the tested concentrations which was evident by high shoot length and low % phytotoxicity of the Punjab-11 as compared to Saher-06. Among the two cultivars Punjab-11 showed better tolerance

towards metal stress as compared to Saher-06. These results are in accordance with the results regarding root and shoot length and seedling vigor index which are less affected by Cr in Punjab-11 as compared to Saher-06 (Fig., 6).

Effect of chromium on total soluble protein content

In cv. Punjab-11 a decrease in total protein content (25%) was observed at 0.25 mM Cr followed by an increase of 12.5%, 29% and 44% over control at 0.5, 1.0 and 2.0 mM Cr. In cv. Saher-06 a significant increase in total protein content (136%) was observed at 0.25 mM while at high concentrations the protein content decreased with 11%, 36% and 49% at 1.0, 1.5 and 2.0 mM Cr (Fig., 7).

Effect of Cr on antioxidant enzyme activity

The activities of POX and CAT are induced by oxidative stress produced as a result of heavy metal contamination (Wu et al., 2003). In the present study seedlings of cv. Punjab-11 showed an initial decrease in POX content at 0.25 and 0.5 mM metal concentration followed by an increase of 493% and 633% over control at 1.0 and 1.5mM. Increase in POX content was not significant in case of Saher-06 which also showed decreased physical growth in terms of low tolerance index and low seedling vigor index (Fig., 8).

CAT is an important antioxidant enzyme in plants used to detoxify the effect of hydrogen peroxide. No significant change in catalase content was observed in Punjab-11 under Cr stress as compared to control group indicating a low production of hydrogen peroxide under Cr stress in this wheat variety. In Saher-06 the enzyme activity increased significantly at 0.5 mM as compared to control group followed by a decrease up to 1.5 mM and then an increase at 2 mM thus indicating a high production of hydrogen peroxide in the presence of high concentrations of Cr (Fig., 9). This shows that the physiological response of the crop varieties to metal stress varies and depends upon the genetic makeup of the plant that controls the tolerance mechanism of the plant. In a number of studies increase in catalase activity at high Cr concentration has been observed in wheat seedlings (Murzaeva, 2004; Dey et al., 2009) while others have indicated a decrease in the enzyme activity due to heavy metal stress (Subrahmanyam, 2008; Sazanova et al., 2012) indicating a difference in physiological response of different cultivars towards heavy metal stress.


Conclusion

The results indicated that Cr did not affect seed germination in the two cultivars, however, significant inhibitory effect was observed on both root and shoot growth. The phytotoxic effect of the metal was significant at higher concentrations indicated by low seedling vigor index and low tolerance index at high metal concentration. Among the two cultivars, Punjab-11 showed better germination, seedling growth, high vigor index and high tolerance index at tested Cr concentrations as compared to cv. Saher-06 indicating a high potential of Punjab-11 to grow in soils with high Cr concentration as compared to Saher-06. Further studies are suggested in this regard to evaluate the effect of different Cr concentrations on growth of these cultivars under field conditions and to find out the differences among the different cultivars at molecular level.

REFERENCES

Aebi, H., 1974. Catalase. In: Bergmeyer H. V. edition, Methods in enzymatic analysis. Volume 2, New York, Academic Press. pp: 674-684.

Azeem, H. A., 2009. Analysis of industrial waste water from Kot Lakhpat area (Lahore, Pakistan) by atomic absorption spectrometer. Biologia (Pakistan), 55: 35-41.

Barcelo, J., Poschenrieder, C. & Gunse, B., 1986. Water relations of chromium VI treated bush bean plants (Phaseolus vulgaris L. cv Contender) under both normal and water stress conditions. J. Exp. Bot., 37: 178-187.

Chou, C. H. & Lin, H. J., 1976. Autointoxication mechanism of Oryza sativa L. Phytotoxic effects of decomposing rice residues in soil. J. Chem. Ecol., 2: 353-367.

Datta, J. K., Bandhyopadhyay, A., Banerjee, A. & Mondal, N. K., 2011. Phytotoxic effect of chromium on the germination, seedling growth of some wheat (Triticum aestivum L.) cultivars under laboratory condition. Journal of Agricultural Technology, 7: 395-402.

Devi, S. R. & Prasad, M. N. V., 2005. Antioxidant capacity of Brassica juncea plants exposed to elevated levels of copper. Russ. J. Plant Physl., 52: 205–208.

Dey, S. K., Jena, P. P. & Kundu, S., 2009. Antioxidative efficiency of Triticum aestivum L. exposed to chromium stress. J. Environ. Biol., 30: 539-544.

Diwan, H., Khan, I., Ahmad, A. & Iqbal, M., 2010. Induction of phytochelatins and antioxidant defence system in Brassica juncea and Vigna radiata in response to chromium treatments. Plant Growth Regul., 61: 97-107.

Duchovskis, P., Brazaitytė, A., Juknys, R., Januškaitienė, I., Sliesaravičius, A., Ramaškevičienė, A., Burbulis, N., Šikšnianienė, J. B., Baranauskis, K., Duchovskienė, L., Stanys, V. & Bobinas, Č., 2006. Changes of physiological and genetic indices of Lycopersicon esculentum Mill. by cadmium under different acidity and nutrition. Pol. J. Environ. Stud., 15: 235–242.

Dukhovskis, P., Juknys, R., Brazaityte, A. & Zukauskaite, I., 2003. Plant response to integrated impact of natural and anthropogenic stress factors. Russ. J. Plant Physl., 50: 147–154.

Gajewska, E. & Sklodowska, M., 2008. Differential biochemical responses of wheat shoots and roots to nickel stress: antioxidative reactions and proline accumulation. Plant Growth Regul., 54: 179–188.

Gang, A., Vyas, A. & Vyas, H., 2013. Toxic effect of heavy metals on germination and seedling growth of wheat. Journal of Environmental Research and Development, 8: 206-213.

Iqbal, M. Z. & Rahmati, K., 1992. Tolerance of Albizia lebbeck to Cu and Fe application. Ekologia (CSFR), 11: 427-430.

Ivanova, E. M., Kholodova, V. P. & Kuznetsov, V. V., 2010. Biological effects of high copper and zinc concentrations and their interaction in rapeseed plants. Russ. J. Plant Physl., 57: 806–814.

Jamal, S. N., Iqbal, M. Z. & Athar, M., 2006. Phytotoxic effect of aluminum and chromium on the germination and early growth of wheat (Triticum aestivum) varieties Anmol and Kiran. Int. J. Environ. Sci. Tech., 3: 411-416.

Koornneef, M., Alonso-Blanco, C. & Peeters, A. J. M., 1997. Genetic approaches in plant physiology. New Phytologist, 137: 1-8.

Latif, M. I., Lone, M. I. & Khan, K. S., 2008. Heavy metals contamination of different water sources, soils and vegetables in Rawalpindi area. Soil & Environ., 27(1): 29-35.

Lu, X., Kruatrachue, M., Pokethitiyook, P. & Homyok, K., 2004. Removal of cadmium and zinc by water hyacinth, Eichhornia crassipes. Sci. Asia, 30: 93-103.


Murzaeva, S. V., 2004. Effect of heavy metals on wheat seedlings: activation of antioxidant enzyme. Appl. Biochem. Micro., 1: 98–103.

Panda, S. K., Chaudhury, I. & Khan, M. N., 2003. Heavy metals induce lipid peroxidation and antioxidants in wheat leaves. Biol. Plantarum, 46: 289–294.

Pradedova, E. V., Isheeva, O. D. & Salyaev, R. K., 2011. Antioxidant defense enzymes in cell vacuoles of red beet roots. Russ. J. Plant Physl., 58: 36–44.

Prasad, M.N.V., Greger, M. & Landberg, T., 2001. Acacia nilotica L. bark removes toxic elements from solution: corroboration from toxicity bioassay using Salix viminalis L in hydroponic system. Int. J. Phytoremed., 3: 289-300.

Racusen, D. & Foote, M., 1965. Protein synthesis in dark grown bean leaves. Can. J. Bot., 43: 817-824.

Racusen, D. & Johnstone, D. B., 1961. Estimation of protein in cellular material. Nature, 191: 492-493.

Rafique, U., Ashraf, A., Khan, A. K., Nasreen, S., Rashid, R. & Mahmood, Q., 2010. Toxic chromium from tanneries pollutes water resources and soils of Pakistan. J. Chem. Soc. Pak, 32: 644-649.

Saif, M. S., Midrar-ul-Haq & Memon, K. S., 2005. Heavy metals contamination through industrial effluent to irrigation water and soil in Korangi area of Karachi (Pakistan). Int. J. Agri. Biol., 7(4): 646-648.

Sazanova, K. A., Bashmakov, D. I., Brazaityte, A., Bobinas, C., Duchovskis, P. & Lukatkin, A. S., 2012. The effect of heavy metals and thidiazuron on winter wheat (Triticum aestivum L.) seedlings. Žemdirbystė = Agriculture, 99: 273–278.

Shaikh, I. R., Shaikh, P. R., Shaikh, R. A. & Shaikh, A. A., 2013. Phytotoxic effects of heavy

metals (Cr, Cd, Mn and Zn) on wheat (Triticum aestivum L.) seed germination and seedlings growth in black cotton soil of Nanded, India. Research Journal of Chemical Sciences, 3: 14-23.

Shanker, A. K., Cervantes, C., Loza-Tavera, H. & Avudainayagam, S., 2005. Adsorption of Cr(VI) and speciation of Cr(VI) and Cr(III) in aqueous solutions using chemically modified chitosan. Environ. Int., 31: 739-753.

Shugaba, A., Buba, F., Kolo, B. G., Nok, A. J., Ameh, D. A. & Lori, J. A., 2012. Uptake and reduction of hexavalent chromium by Aspergillus niger and Aspergillus parasiticus, J. Pet. Environ. Biotechnol., 3: 119.

Singh, D., Nath, K. & Sharma, Y. K., 2007. Response of wheat seed germination and seedling growth under copper stress. J. Environ. Bio., 28: 409-414.

Subrahmanyam, D., 2008. Effects of chromium toxicity on leaf photosynthetic characteristics and oxidative changes in wheat (Triticum aestivum L.). Photosynthetica, 46: 339-345.

Wu, F. B., Zhang, G. & Dominy, P., 2003. Four barley genotypes respond differently to cadmium, lipid peroxidation and activities of antioxidant capacity. Environ. Exp. Bot., 50: 67–78.

Yildiz, M., Terzi, H. & Urusak, B., 2011. Chromium toxicity and cellular responses in plants. Erciyes University Journal of the Institute of Science and Technology, 27(3): 163-176.

Zayed, A. M. & Terry, N., 2003. Chromium in the environment: factors affecting biological remediation, Plant and Soil, 249: 139–156.

Zeid, I. M., 2001. Responses of Phaseolus vulgaris to chromium and cobalt treatment. Biol. Plant, 44: 111-115.


http://link.springer.com/search?facet-author=%22D.+Subrahmanyam%22

http://link.springer.com/journal/11099



Effect of γ-irradiation doses on the sensory and microbial quality of dates

(Phoenix dactylifera)

*MEHWISH IQTEDAR, BEENISH SARFRAZ, ROHEENA ABDULLAH, AFSHAN KALEEM &

SHAGUFTA NAZ.

Department of Biotechnology, Lahore College for Women University, Lahore, Pakistan.

ABSTRACT

The present work was carried out to improve the quality and shelflife of local date fruit variety of Pakistan “Aseel” by using different gamma irradiation doses and to examine influence of irradiation treatment on total

microbial load for a period of 30 days storage time at refrigerated temperature (4C). “Aseel” dates were collected from local market (Mandi) of Lahore. These samples were irradiated with Gamma radiation doses of 1.5, 2.5 and 3.5 kGy, respectively at PARAS (Pakistan Radiation Services). Dates exposed to 3.5 kGy had highest reduction in bacterial count i.e. upto 77.7% on nutrient agar whereas fungal load was reduced upto 89.3% on PDA. Dates were found to be contaminated with aerobic mesophilic bacteria, yeast and molds. The microbial levels gradually decreased with increasing storage time and dose. Different fungal species were detected in irradiated sample but found in the acceptable range 10

2-10

3 C.F.U /g. E.coli was only detected in

control and 1.5 kGy irradiated samples. Both doses 2.5 and 3.5 kGy were effective in reducing microbial load but 3.5 kGy was more effective not only in reducing bacterial count but also in inhibiting the growth of major date fruit contaminating fungi Aspergillus niger. These results suggest that the irradiation of Aseel dates at 1.5-3.5 kGy could be effective instead of high doses for improving the stored fruit quality as well as prolonging the marketable shelf life however prior hygienic postharvest measures should be taken to make the process more effective.

Key words: Gamma irradiation, shelf life, Dates, Pakistan, bioburden.

INTRODUCTION

Date palm (Phoenix dactylifera ) one of the

oldest growing fruit tree in the world is distributed in 34 countries (Ahmed et al., 2012). It grows in hot, arid mostly tropical and subtropical regions of Africa and Southern Asia (Chao & Kruger, 2007). Worldwide dates production was estimated 7.3 million metric tons in 2009 and Pakistan is the fifth largest producer and exporter of dates ( PHDEB, 2008; STAT, 2012).

The fruit of date palm (Phoenix dactilyfera) plays an important role in the nutrition of human being. Dates are a copious source of carbohydrates, macro elements particularly potassium, phosphorous, calcium, chloride, magnesium, and have considerable quantities of microelements like iron, manganese, copper and zinc (Kader & Hussein, 2009). Nearly all cultivars of dates have high levels of total sugars (62.60-83.32%), proteins (2.3-3.85%), ash (2.15-3.46%) and fat (0.1-0.46) on the basis of dry matter (Abul-Soad, 2011).

Dates are commonly contaminated by diverse microbial population which includes bacteria, yeast, mold and some potential pathogens like Staphylococcus aureus, E. coli, and A. flavus/parasiticus (El-Sherbeeny et al., 1985; Aidoo

et al., 1996 ; Kader & Hussein, 2009; Hamad et al., 2012). Aspergillus niger is declared the most abundant fungi in dates (Tafti & Fooladi, 2005; Ibrahim et al., 2013; Al Hazzani et al., 2014). However other dates contaminating fungal species such A. flavus, P. chrysogenum and R. stolonifer have also been reported (Ragab, et al., 2001; Colman, et al., 2012). These bacterial and fungal contamination leads to spoilage at ripening and post-harvest losses.

Various postharvest operations are performed to preserve dates such as drying, rehydration, microwave drying, fumigation and irradiation (Ahmed, 2012). The main purpose of all these processes is to maintain quality standard according to World export\import criteria and reduce spoilage by pathogenic microorganisms and pests (Ahmed, 2012).

Use of methyl bromide (MB) as fumigant to preserve dates is a common practice (Molins, 2001). However the emission of its fumes to atmosphere are extremely poisonous to human health. Various alternatives for MB are present like phosphine gas treatment, modified atmosphere packaging (MAP) with high carbon dioxide (CO2)

heat, cold treatment and irradiation (Kader & Hussein, 2009).

228 M. IQTEDAR. ET AL BIOLOGIA (PAKISTAN)

Irradiation, one of the physical methods also

referred to as cold sterilization because it does not

heat up the treated product and is therefore

generally used to lower the bioburden in most food

products (Manickavasagan et al., 2012). Gamma

rays treatment is frequently used for dates

disinfection in many countries (Manickavasagan et

al., 2012). Food irradiation has shown growing

interest because of continuous increase in food

losses from insect infestation, microbial

contamination and spoilage (Arvanitoyannis, 2010).

With increased concerns over food-borne diseases

and improving International trade in food products

strict import/export standards of quality and

quarantine should be imposed. The irradiation has

proven beneficial for safe handling and distribution

of food (Thomas & Diehl, 1988; Molins, 2001).

The present study is intended towards

increasing the shelf life of dates using optimum

irradiation dose, which eventually reduces the

product loss and increases export value.


Sampling

Semi dry Aseel (Phoenix dactilyfera) dates originated from Khairpur region of Sindh were collected from the local fruit market (Mandi) of Lahore, Pakistan. Surface dirt was removed with muslin cloth sterilized in autoclave at 121°C for 15 minutes, and then packed (25-29 g) in sealed

polythene bags. Dates were kept at 4C for further studies.

Irradiation

Packed dates in polythene bags were labelled with doses (1.5, 2.5 and 3.5 kGy) which are to be given then date samples were sent to PARAS (Pakistan Radiation Services) Lahore, for Cobalt (Co60) gamma irradiation. Each treatment group was run with control group.

Physical Evaluation of Dates:

Physical evaluation was conducted on irradiated and controlled (non-irradiated) samples. Quality was assessed through texture, color, odor and overall acceptability by a panel comprising of 15 members. For assessment of dates quality attributes 9 point hedonic scale was used (Lawless et al., 2010). Effect of radiation on insect infestation was done for each group. Infestation was checked by opening the dates with knife for the presence of insect egg or larvae and any internal damage.

Microbiological analysis

Samples for the microbial analysis were processed under sterilized conditions. Each sample was rinsed in 50ml of sterilized distilled water in 100 ml capacity sterilized beaker. The sample was constantly shaked for 5 minutes and then serial dilutions of 10

-1 , 10

-2,and 10

-3 were prepared

according to ISO standard 68871:1999 recommendations (ISO, 1999). Aliquots of 0.1ml from each dilution were inoculated, spread onto prepared media plates by spread plate method and incubated at 37°C for bacterial and at 28-30°C for fungal count. Results of each dilution were recorded in C.F.U /g.

Bacteriological Analysis

Total microbial load on irradiated and non-irradiated samples were carried out at 0 day of storage time and after every 15 days of interval for upto 30 days. For the enumeration and identification of bacteria associated with dates three growth media were selected. Nutrient agar was used to find out total bacterial load, MacConkey agar a deferential media was used for the isolation of Gram-negative enteric bacteria whereas, Salmonella-Shigella Agar was used for enumeration of Salmonella and Shigella spp. (Leboffe & Pierce, 2010).

Yeast and Mold count

Yeast and molds associated with dates were enumerated using Potato dextrose agar and prepared according to manufacturer’s instruction (Leboffe & Pierce, 2010).

Identification of bacterial isolates

Bacterial isolates were pure cultured

through repeated streaking on their respective

growth media. Grams staining, motility test and

endospore staining of the isolates were performed

for determination of bacterial cell morphology,

mobility and endospore presence respectively.

Gram negative bacterial isolates were identified on

biochemical basis using API 20E strips (bioMerieux,

Inc.) as described in Bergey’s manual (Holt et al.,

1994).

Identification of Fungi

Mold identification was performed according

to identification key and method described by Kim

(2003). Molds were identified on the basis of

macroscopic morphology of the colony grown on

PDA plates and microscopic morphology of the

VOL. 61 (2) GAMMA IRRADIATION EFFECT ON DATES MICROFLORA 229

mold isolates using methylene blue staining. Yeast

isolates were also observed by simple slide

technique according to their cell morphology and

arrangement at 40 and 100x microscopic resolution.

Statistical Analysis

Costat program (version 6.4) was used for

the statistical analysis of data. The mean for each

treatment was compared by two way ANOVA

followed by Duncan’s multiple range test using

complete randomized block design (significance

level 0.05) to assess the effect of the applied doses

and duration of storage on the dates (McDonald,

2009). The standard deviation and mean square

error of replicates from mean value were also

calculated.


Sensory Evaluation of the Dates

Significance test for consumer acceptance

was carried out to evaluate the physical attributes of

both irradiated and non-irradiated samples. The

quality characteristics such as color, texture, odor

and overall acceptability were more acceptable for

irradiated samples and hence consumer acceptance

for irradiated dates was found to be more as

compared to un-irradiated dates. Dates from control

group became soft after 30 days whereas irradiated

dates remained firm even after 30 days. Aseel dates

are reported to be insensitive towards radiation and

that is because of low water content (Grecz et al.,

1988). Both irradiated and non-irradiated dates were

free from any insect infestation throughout the

storage period of 30 days at 4C. Color of irradiated

dates remained attractive throughout the storage

period. One month post-irradiation storage of dates

at 4°C did not affect the physical properties (Fig., 1).

Dates under these treatment and conditions can be

stored upto 6 months as reported by (Grecz, et al.,

1988 & Al-Kahtania, et al., 1998).

Effect of Irradiation treatments on the Microbial counts of Aseel Date fruit

Control samples had significantly high microbial load as compared to irradiated samples. Bacterial load on control samples was present in the

range of 13.5 105

C.F.U/g to 3.4105

C.F.U/g during 30 days of storage. All irradiation doses

proved effective in controlling Total Bacterial Count (TBC)

(a)

(b)

Fig.,1 : Sensory evaluation for qualities like color, taste, odor and overall acceptance (a) irradiated samples (b) unirradiated samples using 9 point

hedonic scale where *1= extremely like, 9= extremely dislike. (trained panel members, n=15)

(Fig., 2 ; Table I). Samples irradiated at 1.5 kGy and 2.5 kGy showed lower TBC on nutrient agar i.e.

9.1105 and 6.910

5 C.F.U/g, respectively as

compared to control samples after one month of storage. Dates exposed to 3.5 kGy showed the

most reduction (6104

C.F.U/g) in TBC (Table I). Therefore 3.5 kGy dose had caused significant (p≤0.05) reduction in bactrial load as well as maintaining the quality and mean life of dates as compared to rest of the treatments (Table I)

Dates were examined for the presence of gram negative bacterial load using differential media like MacConkey and Salmonella Shigella agar.

Bacterial count on MacConkey agar was 3.5103


C.F.U /g and 2.7103 C.F.U /g on control and 1.5

kGy irradiated samples, respectively on zero day of analysis (Table 1). Bacterial isolate was identified as

E. coli. Bacterial population was completely inhibited on 2.5 and 3.5 kGy as shown in (Fig., 4; Table I).

Table I: Effect of Different Gamma irradiation doses on microbial count during different intervals of

storage period.

Growth Media Doses (kGy)

Colony count C.F.U /g

Storage Days

0 15 30

Nutrient Agar

0 13.5 105 0.56

aA* 10.6 10

5 1.44

aB 3.4 10

5 1.35

aC

1.5 9.1 105 1.69

bA 6.2 10

5 1.69

bB 2.2 10

5 1.9

bC

2.5 6.9 105 1.41

cA 4.2 10

5 1.78

cB 1.2 10

5 0.63

cC

3.5 3.7 105 1.6

dA 2.3 10

5 0.84

dB 06 10

4 1.1

dC

MacConkey Agar

0 3.5 103 0.94

a Abs Abs

1.5 2.7 103 1.57

b Abs Abs

2.5 Abs Abs Abs

3.5 Abs Abs Abs

SS Agar*

0 Abs Abs Abs

1.5 Abs Abs Abs

2.5 Abs Abs Abs

3.5 Abs Abs Abs

PDA** 0 4.5103±1.49

aA 3.710

3±0.28

aB 2.010

3±1.52

aC

1.5 4.5103±1.41

aA 3.010

3±1.26

bB 1.210

3±1.01

bC

2.5 3.0103±1.64

bA 1.310

3±1.64

cB 810

2±1.65

cC

3.5 5102±0.75

cA 410

2±0.56

dB 210

2±1.13

dC

Values are mean of C.F.U /g, whereas SE is standard error. *SS Agar: Salmonella Shigella agar. ** PDA : Potato dextrose agar. Means with small letters (a, b, c and d) show they are significantly different at (p ≤

0.05) at doses whereas capital letters (A, B and C) show they are significantly different at (p ≤ 0.05) at different storage days.

Later intervals analysis revealed no Gram negative bacteria from any date samples i.e. neither radiated nor non-irradiated samples. Salmonella and Shigella spp. presence were nill in irradiated as well as in non-irradiated samples.

The halting effect of gamma radiation on microbial growth might be due to the reason that gamma radiation induces direct cell damage by having deleterious effects on the chromosomal DNA along


with protein coagulation of living cells (Kaferstein, 1997 & Min et al., 2000). Higher doses like 3.5kGy were capable of producing good results in terms of microbial load reduction as examined by previous researches (Emam et al., 1994 ; Zahoor et al., 2011; Farag et al., 2013).

Fig., 2: Influence of different gamma radiation doses on total bacterial growth on nutrient agar.

Duncan Multiple range test was applied. *Superscripts a, b, c and d show they are

significantly different (p ≤ 0.05) at different doses whereas A, B and C shows the values are

significantly different (p ≤ 0.05) at different time periods.

Effectiveness of 3.5 kGy dose for reducing microbial load in dates was also reported by (Darbre, 1986). The mentioned microbial contamination is probably related to exposure of dates to unhygienic environment of picking, transportation and storage as also reported by (Yassin & Almouqatea, 2010). In the present work low microbial count for the irradiated samples during progressive days was due to combination of factors such as irradiation treatment along with low temperature and oxygen level in packages as previously reported by Al-Hooti et al. (1997). Fruits like dates are mostly contaminated through contact of outer surface with dust or unhygienic handling during postharvest, storing and packaging leading to bacterial as well as fungal attack (Al-Turki & Magid, 2004). To further increase the effectiveness of radiation treatment samples should be washed and dried before radiation and dates should be processed hygienically.

Most of the spoilage in date fruits is reported to be caused by fungal pathogens (Siddiq, 2012). It is therefore of utmost importance to control these pathogenic fungi for the prevention of postharvest losses. The total fungal count for control

samples ranged from 103

to 102

C.F.U /g during the

experiment as shown in (Fig., 3). This range lies in the acceptable range which fulfills International date export standards (Saudi Standards, 1999 ; Abul-Soad, 2011). Maximum fungal reduction was seen upon 3.5 kGy irradiation which prevailed throughout the storage period as described in (Table I).

Aspergillus niger, A. flavus, Alternaria spp., Rhizopus spp. and different yeast species were identified on the basis of microscopic and macroscopic characteristics. Their presence were also reported in other studies too (Shenasi et al., 2002; Ibrahim & Rahma, 2009; Colman et al., 2012; Hamad, 2012). Aspergillus niger prevailed throughout the experiment however controlled by dose of 3.5 kGy. Aspergillus has been reported to be the predominant genus in date fruit (Darbre, 1986; Emam et al., 1994; Colman et al., 2012; Hamad et al., 2012; Ibrahim & Rahma, 2013). These results showed that fungal flora is sensitive towards gamma irradiation and it was controlled completely by using 3.5 kGy dose.

Absence of insect infestation was one of the major reasons of low fungal count as also stated by (Djerbi, 1981). Higher doses have caused complete inhibition of fungal growth as also reported in other studies (Farag et al., 2013). Aspergillus flavus was present only in control samples but higher doses caused complete inhibition of it, where irradiation at 3.0 kGy caused complete inhibition of fungus as reported by Grecz et al., (1988). Irradiation proved helpful in complete removal of aflatoxigenic strain.

Fig., 3: Influence of different gamma radiation doses on total fungal growth on potato agar.


Fig., 4: Influence of different gamma radiation doses on total bacterial count on MacConkey agar.

Conclusively, if the dates are hygienically

processed prior to storage and kept in zip locked plastic bags at 4°C their shelf life could be enhanced thereby resulting into less post-harvest losses and increased export value. Hence irradiation doses (0.5-3.5 KGy) below recommended doses (4-6 kGy) can be used safely.

REFRENCES

Abul-Soad, A. A., 2011. Date Palm in Pakistan, Current Status and Prospective. USAID.

Ahmed, J., Lobo M. G., Ozadali F. & Siddiq M., 2012. Tropical and Subtropical Fruits: Postharvest Physiology, Processing and Packaging. 2

nd ed. John Wiley & Sons. pp:

85 - 94. Aidoo, K. E., Tester R. F., Morrison J. E. &

MacFarlane D., 1996. The composition and

microbial quality of pre‐packed dates purchased in Greater Glasgow. Int. J. Food Sci. Technol. 31(5): 433-438.

Al-Hooti, S., Sidhu J. & Qabazard H., 1997. Physicochemical characteristics of five date fruit cultivars grown in the United Arab Emirates. Plant Food Hum Nutr. 50(2): 101 - 113.

Al-Turki, A. I. & Magid H. M. A., 2004. Bacterial contamination of date fruits during postharvest handling. Pak. J. Biol. Sci. 7(4): 611 - 614.

Al Hazzani, A. A., Shehata A. I., Rizwana H., Moubayed N. M., Alshatwi A. A., Munshi A. & Elgaaly G., 2014. Postharvest fruit spoilage bacteria and fungi associated with

date palm (Phoenix dactylifera L) from Saudi Arabia. Afr. J. Microbiol. Res. 8(11): 1228 - 1236.

Al-Kahtania H. A., Abu-Tarbousha H. M., Al-Dryhimb Y. N., Ahmeda M. A., Bajabera A. S., Adamb E.E, El-Mojaddidi M.A., 1998. Irradiation of dates: insect disinfestation, microbial and chemical assessments, and use of thermoluminescence technique. Radiat. Phys. Chem. 53 (2):181–187

Arvanitoyannis, I. S., 2010. Irradiation of food commodities: techniques, applications, detection, legislation, safety and consumer opinion. 1

st ed. Academic Press. pp:45-23.

Chao, C. C. T., Krueger, R. R., 2007. The date palm (Phoenix dactylifera L.): overview of biology, uses, and cultivation. HortScience, 42(5): 1077-1082

Colman, S., Spencer T., Ghamba P. & Colman E., 2012. Isolation and identification of fungal species from dried date palm (Phoenix dactylifera) fruits sold in Maiduguri metropolis. Afr. J Biotechnol. 11(57):12063-12066.

Darbre, A., 1986. Practical protein chemistry: a handbook .1

st ed. John Wiley & Sons Inc.

Djerbi, M., 1981.Three years research report on date palm diseases with a special emphasis on Bayoud (Fusarium oxysporum).[Near East and North Africa].

El-Sherbeeny, M., Saddik M. F. & Bryan F. L., 1985. Microbiological profiles of foods served by street vendors in Egypt. Int J Food Microbiol. 2(6):355-364.

Emam, O., Farag S. & Hammad A., 1994. Comparative studies between fumigation

and irradiation of semi‐dry date fruits. Food/Nahrung. 38(6):612-620.

Farag, S., Shaltoot A., Emam M., El Nawawey M. & El Dien A., 2013. Physicochemical-Microbiological Studies on Irradiated Date Fruits with Studying Migration Monomers of Packages Materials. J Microb Biochem Technol. 5: 006-012.

Grecz, N., Al-Harithy R., Jaw R., Al-Suwaine A., El-Mojaddidi M. & Rahma S., 1988. Radiation processing of dates grown in Saudi Arabia. Int. J . Radiat. Appl. Instrum. . 31(1): 161 - 184.

Hamad, S. H., 2012. The microbial quality of processed date fruits collected from a factory in Al-Hofuf City, Kingdom of Saudi Arabia. Emir. J. Food Agric. 24(2): 105-112.

Hamad, S. H., Saleh F. A. & Al-Otaibi M. M., 2012. Microbial Contamination of Date Rutab Collected from the Markets of Al-Hofuf City


in Saudi Arabia. Scientific World J. 2012: 1-4.

Holt, J. G., Krieg, N. R., Sneath, P. H. A., Staley, J. T. & Williams, S. T., 1994. Bergey’s Manual of Determinative Bacteriology, 9th edn. Baltimore: Williams & Wilkins.

Ibrahim, M. I., Ali H. S., Sahab A. F. & Al-khalifa A. R. S., 2013. Co-occurrence of fungi, aflatoxins, ochratoxins A and fumonsins in date palm fruits of Saudi Arabia. J. Appl. Sci. Res. 9(3): 1449-1456.

Ibrahim, S. & Rahma M., 2009. Isolation and indentification of fungi associated with date fruits (Phoenix dactylifera, Linn) sold at Bayero University, Kano, Nigeria. Bajopas. 2(2): 127 - 130.

International Organization for Standardization, 1999. ISO 6887-1:1999. Microbiology of food and animal feeding stuffs. Preparation of test samples initial suspensions and decimal dilutions for microbiological examination-Part 1. General rules for the preparation of the initial suspension and decimal dilutions. Geneva ISO.

Kader, A. A. & Hussein A. M., 2009. Harvesting and postharvest handling of dates. International Center for Agricultural Research in the Dry Areas (ICARDA).

Kaferstein, F., 1997. Wholesomeness of food irradiated with doses above 10 kGy. Seminario National de Irradiacion de Alimento .

Kim, S. O., 2003. Molds identification. Kor. J. Med. Mycol. 8:97–102.

Lawless, H. T., Popper R. & Kroll B. J., 2010. A comparison of the labeled magnitude (LAM) scale, an 11-point category scale and the traditional 9-point hedonic scale. Food. Qual Prefer. 21(1): 4-12.

Leboffe, M. J. & Pierce B. E., 2010. Microbiology: Laboratory theory and application. 3rd ed. Morton Publishing Company. Colorado,U.S.A. pp: 35- 176.

Manickavasagan, A., Essa M. M. & Sukumar E., 2012. Dates: production, processing, food, and medicinal values. 1

st ed. CRC

Press.NW,U.S.A. pp:27-145. McDonald, J. H., 2009. Handbook of biological

statistics. 2nd

ed. Sparky House Publishing Baltimore, MD. 173-182pp.

Min, J., Lee C. W., Moon S.-H., LaRossa R. A. & Gu M. B., 2000. Detection of radiation effects using recombinant bioluminescent Escherichia coli strains. Radiat. Environ Biophys. 39(1): 41-45.

Molins, R. A., 2001. Food irradiation: principles and applications . 1

st ed. Wiley-Interscience.

pp:234-387. PHDEB. 2008. Dates marketing strategy. Pakistan

Horticulture Development &Export Board. Ragab, W., Ramadan B. & Abdel-Sater M., 2001.

Mycoflora and aflatoxins associated with saidy date as affected by technological processes. III International Date Palm Conference, UAE University, Abu Dhabi. pp:19 - 21.

Saudi Standards, Metrology and Quality Organization (SASO), 1998. Microbial Limits for Food Stuffs (in Arabic), Part 1, Saudi Arabia Standards Organization, , 26 pp.

Shenasi, M., Aidoo K. & Candlish A., 2002. Microflora of date fruits and production of aflatoxins at various stages of maturation. Int J Food Microbiol. 79(1): 113-119.

Siddiq, M., 2012. Tropical and Subtropical Fruits: Postharvest Physiology, Processing and Packaging. 1 ed. John Wiley & Sons. New Dehli,India. pp:63-267.

STAT, F., 2012. FAOSTAT-Statistical Database, 2012.

Tafti, A. & Fooladi M., 2005. Microbial contamination on date fruits. First International Symposium on Date Palm. pp:02-09.

Thomas, P. & Diehl, J., 1988. Radiation preservation of foods of plant origin. Part VI. Mushrooms, tomatoes, minor fruits and vegetables, dried fruits, and nuts. Crit Rev Food Sci Nutr. 26(4): 313-358.

Yassin, M. & Almouqatea S., 2010. Assessment of airborne bacteria and fungi in an indoor and outdoor environment. Int. J. Environ. Sci. Tech. 7(3): 535-544.

Zahoor, U. D., Shah, H.S., Ihsanullah., Ahmad, A.Z. & Khan, S. A., 2011. Estimation of physico-chemicals and microbiological levels during storage of irradiated fresh date sample. I.J.S.N. 2(1): 16-21.



*Correspondence author: [email protected]

Study of Rotifers of Safari Zoo Lake Lahore in Relation to Physico-chemical

Parameters

*SARA HAYEE, ABDUL QAYYUM KHAN SULEHRIA, NAVEED AKHTER, FAHEEM NAWAZ

& ALTAF HUSSAIN

Department of Zoology, GC University, Lahore, Pakistan.

ABSTRACT

A survey was conducted from September 2013 to June 2014 in Safari Zoo Lake to investigate rotifer population and their relationship with physico-chemical parameters. In total, 23 species were identified. Nine physico-chemical parameters were studied including salinity, turbidity, electrical conductivity, air and water temperature, transparency, oxygen saturation, dissolved oxygen and pH. Oxygen saturation, dissolved oxygen and pH were statistically non-significant whereas rest of the parameters were statistically significant. Pearson correlation indicated that dissolved oxygen, oxygen saturation and salinity were positively correlated with rotifer density and diversity, whereas, rest of the parameters were negatively correlated.

Key word: rotifers, physic-chemical parameters, lake, zooplankton,

INTRODUCTION

Rotifers (rota means wheel and fera means to bear) derive their name from a specific structure called corona. It is a ciliated organ. Due to beating of cilia, it gives apperance of a rotating wheel (Hickman et al., 2006). Corona helps in locomotion. Moreover, beating cilia sweep food into mouth of rotifer. Rotifers are pseudocoelomate, bilateral, triploblastic and eutelic. They range in size from 200 to 500 µm (Kenneth et al., 2011). They have three main body parts, head, trunk and foot. Most species live in fresh water. Some marine, terrestrial and parasitic species are also found. They are cosmopolitan in distribution and many of them are highly adapted to a wide range of fresh water conditions. Zooplanktons like rotifers are very important for aquatic ecosystem like lakes. They transfer energy from primary producers like bacteria and algae to consumers like crustacean, insects and small fish (Baloch et al., 2008).

Water quality of any water reservoir includes many physical, chemical and biological characteristics. The biological characteristics are linked with density and diversity of living organisms present in them. Diversity of organisms can give a clear indication of human interferences on any natural ecosystem (Chughtai et al., 2011). Some factors affecting the succession of rotifers have been extensively studied which include physico-chemical parameters, food resources, competitors and predators (Wang & Geng, 2013).

AIMS AND OBJECTIVES

The purpose of this research work was: to collect and identify the rotifers up to species level; to find

physico-chemical parameters of water and their effects on rotifer population.


Study Area

Lahore Zoo Safari known as Woodland Wildlife Park with latitude of 31°22'57"N and 74°12'51"E is located on Raiwind Road, District Lahore Punjab, Pakistan. It is a famous wildlife and safari park established in 1982 for public recreation having an area of 242 acres. The study area included an artificial lake having an area of 5 acres with five islands. Four of these islands are large and one is small (Fig., 1).

Sampling Period and Sites

Sampling was done for 10 months from September, 2013 to June, 2014. Rotifer and water samples were collected on monthly basis from 10 am to12 pm in the mid of each month from the Lake. The whole lake was divided into four sites, Eastern Site (ES-1), Western Site (WS-2), Northern Site (NS-3) and Southern Site (SS-4). Each site was sub-divided into four sub-sites A-D.

Water Sampling and Analysis

Water samples were collected just below the water surface from lake in pre-cleaned sample bottles to study the physico-chemical parameters. Temperature (air & water) was measured with thermometer (HANNA HI-8053). Dissolved oxygen and oxygen saturation were measured with DO meter (YSI-Eco Sense DO 200). Salinity and pH were determined with YSI – Eco sense EC 300 and

236 S. HAYEE ET AL BIOLOGIA (PAKISTAN)

YSI – Eco sense pH 100 respectively. Electrical conductivity was determined by (YSI – Eco sense EC 300).

Rotifer Sampling

Rotifer samples were collected from the water with the help of a conical zooplankton net having a mesh size of 37µm and volume capacity of about 599.12 m

3. The base of zooplankton net had

a diameter of 30cm and length of 85cm. The samples were collected by towing the net horizontally for 5 minutes to a depth of about 20-25 cm. In 5 minutes 100 liters of water can pass through it. The contents were preserved in 4 % Formalin in 50 ml plastic bottles on the spot (Koste, 1978; Sulehria & Malik, 2012). Rotifer samples of one bottle from each site were kept alive (i.e., without formalin) for studying live organisms.

Counting and Identification

The numerical estimation of the rotifers was done by using Sedgewick-Rafter Counting chamber (APHA, 2005) and inverted Olympus microscope at 60-100 X. Photographs of rotifers were taken with the help of LEICA HC 50/50 microscope on which a 5.0 megapixel Cannon camera was fitted. To study the internal features, rotifers were stained with vital stain i.e., 1% neutral red. By observing morphology and body shape, rotifers were identified up to

species level (Hyman, 1951; Ward and Whipple, 1959; Pennak, 1978 and Segers, 2007).


ANOVA was applied to study the significant differences in rotifers. Pearson’s correlation test was applied to find out the relationships between the observed environmental parameters and rotifer species. The software used for ANOVA and Pearson’s correlation was Minitab 13 for Windows.

Fig., 1: Map of study area


In total, 23 species were identified belonging to 8 genera (Table I). Rotifer population was high in November (4.31 ± 2.46) and lowest in June (0.56 ± 0.55). The relative (%) representation of genera indicated that dominant genera were in

order Brachionus > Synchaeta > Polyarthra. The relative (%) representation of abundant rotifer species and their mean population density were in order Brachionus calyciflorus (38.25%), Brachionus quadridentatus (13.3%), Brachionus bidentatus (8%), Synchaeta pectinata (6.5%), Polyarthra minor (5.25%) (Fig., 2).

Table I: List of Rotifers recorded from Safari Zoo Lake

Brachionus angularis Gosse Keratella cochlearis Gosse

Brachionus bidentatus Anderson Keratella valga Ehrenberg

Brachionus calyciflorus Pallas Lecane luna O.F. Muller

Brachionus diversicornis Daday Polyarthra dolicoptera Idelson

Brachionus forficula Wierzejski Polyarthra minor Voigt

Brachionus quadridentatus Hermann Pleurotrocha petromyzon Ehrenberg

Brachionus sericus Rousselet Polyarthra remata Skorikow

Brachionus urceus Linneaus Polyarthra trigala Ehrenberg

Cephalodella exigua Gosse Synchaeta pectinata Ehrenberg

Cephalodella gibba Ehrenberg Synchaeta oblonga Ehrenberg

Filinia longiseta Ehrenberg Synchaeta stylata Wierzejski

Filinia terminalis Plate

VOL. 61 (2) ROTIFERS IN RELATION TO PHYSICO-CHEMICAL PARAMETERS 237

Fig., 2: Relative precentage of abundant rotifer species with exponential trend line and percentage error bars. Analysis of Variance (ANOVA)

Analysis of variance (ANOVA) showed that salinity (F=17.14, P=0.001), turbidity (F=43.31, P=0.000), electrical conductivity (F=8977.43 E, P=0.000), water temperature (F=29.44, P=0.000), transparency (F=9.71, P=0.006), and air

temperature (F=46.28, P=0.000) were significantly different. Oxygen saturation (F=1.19, P=0.289), dissolved oxygen (F=4.41, P=0.05) and pH (F=0.50, P=0.490) were statistically non-significant (Table II and Table III).

TABLE II: ANALYSIS OF VARIANCE FOR WATER TEMPERATURE

Source DF SS MS F P

Factor 1 1365.5 1365.5 29.44 0.000

Error 18 834.8 46.4

Total 19 2200.3

DF = Degree of Freedom; SS = Sum of Square; MS = Mean of Square; F = f- Distribution; P = Probability

TABLE III: ANALYSIS OF VARIANCE FOR OXYGEN SATURATION

Source DF SS MS F P

Factor 1 33.1 33.1 1.19 0.289

Error 18 498.5 27.7

Total 19 531.6

DF = Degree of Freedom; SS = Sum of Square; MS = Mean of Square; F = f- Distribution; P = Probability Physico-chemical Parameters

During study period rotifer population diversity and density was either positively or negatively correlated with physico-chemical

parameters (Table IV; Fig., 3 & 4). Monthly variations in physico-chemical parameters are shown in figure 5 and 6.


TABLE IV: CORRELATIONS (PEARSON) OF ROTIFERS AND PHYSICO-CHEMICAL PARAMETERS

Rotifer A.T. W.T. O.S.. D.O. Cond. Trans. pH Salin.

A.T. -0.676 W.T. -0.679 0.957 O.S.. 0.487 0.009 0.000 D.O. 0.132 0.025 -0.122 -0.035 Cond. -0.577 0.534 0.598 -0.409 0.037 Trans. -0.073 -0.081 -0.024 0.363 -0.318 -0.270 pH -0.085 0.160 0.152 -0.385 -0.320 0.484 -0.375 Salin. 0.368 -0.482 0.345 -0.166 -0.524 0.122 0.031 0.611 Turbid. -0.209 0.546 0.387 0.080 0.495 -0.065 -0.509 -0.178 -0.790

A.T. = air temperature; W.T. = water temperature; D.O. = dissolved oxygen; O.S. = oxygen saturation; Cond. = Electrical conductivity; Trans. = transparency; Salin. = salinity; Turbid. = turbidity

Fig., 3: Negative correlation between Rotifers and Air Temperature

Fig., 4: Positive correlation between Rotifers and Oxygen Saturation


Oxygen saturation and dissolved oxygen affected rotifer population. Oxygen saturation (mg/l) was high in October (8.73 mg/l) and low in April (0.55 mg/l). Dissolved oxygen (mg/l) in water was found high in September (14.6 mg/l) and low in March (5.2 mg/l). Rotifers showed positive correlation with dissolved oxygen of water. Similar results were also reported from studies on River Ravi and Jallo Lake (Sulehria et al., 2009a & 2009b). Salinity was also positively correlated with rotifer density and diversity. It corresponds to the work done by Clarke et al. (2013).

pH values fluctuated during study period and ranged between 6.81 to 8.5.. Measured values showed that lake water was alkaline. The rotifers prefer pH value in the range of 6.5 to 8.5 (Chergui et al., 2013). It was close to the recorded preference. Presence of Brachionus calyciflorus throughout study period showed wide range of pH tolerance of this species. Similar results were also found by Abbai & Sunkad (2013). pH showed negative correlation with rotifers. A similar finding was reported by Sulehria et al. (2009b).

Fig., 5: Monthly Variation of Physico-chemical parameters (with error bars) of air and water of Safari Zoo Lake Lahore. (AT=Air temperature; WT=Water Temperature; DO=Dissolved Oxygen; OS=Oxygen Saturation;

SA=Salinity; TR=Transparency)

Fig., 6: Monthly Variation of Electrical Conductivity (EC) and Turbidity (TU) of water of Safari Zoo Lake Lahore.


Turbidity ranged 64 to 447 FTU. The highest value of turbidity was observed in October. Water of lake was turbid during most part of study period. During winter a gradual decrease in turbidity was observed. But it started increasing from spring. It showed negative correlation with rotifers. The results were comparable to those reported by Sivalingam et al., 2013.

Temperature is an important factor to control population density and diversity of rotifers. Rotifers showed wide range of tolerance for temperature. In the present study, lowest air temperature (18.4

oC) and water temperature (14.06

oC) were observed in December. Highest air (36.1

oC) and water temperature (34.73

oC) were

observed in May. Air and water temperatures showed parallel relationship. Changes in temperature showed regional climatic variation. A negative correlation was observed between air temperature, water temperature and rotifers. A similar observation has been reported by Ahmed et al. (2012) and Clarke et al. (2013).

There was no sudden rise or fall in the values. Electrical conductivity (µS/cm) was highest in May (570.8 µS/cm) and lowest in September (520.9 µS/cm). In warm months, electrical conductivity was higher because water evaporation increased which resulted in decreased total quantity of water. Similar results were reported by Hussain et al. (2013). Electrical conductivity showed negative correlation with rotifers. The same relationship had been reported by Dutta & Patra (2013).

Transparency is an important physical parameter. It directly affects the productivity. Its highest value (3.75) was recorded in January when turbidity value was also found lowest (64 FTU). The lowest value of transparency was recorded (1.82) in November. It showed negative correlation with rotifers. The same relation had been reported by Farshad & Venkataramana (2012) and Clarke et al. (2013).

Conclusion

Replacement of water is slow and turbidity is high in Safari Zoo Lake. Species diversity of rotifers was low during study period. The present study showed the eutrophic state of lake water. There was a prominent effect of physico-chemical parameters on the density and diversity of rotifers.

REFERENCES

Abbai, S.S. & Sunkad, B.N., 2013. Effect of

anthropogenic activities on zooplankton

population of Sogal pond, Belgaum District, Karnataka, India. Res. J. Rec Sci., 2(7): 81-83

Ahmad, U., Parveen, S., Mola, H.R., Kabir, H.A., & Ganai, A.H. 2012. Zooplankton population in relation to physicochemical parameters of Lal Diggi pond in Aligarh, India. J. Environ. Biol., 33: 1015- 1019.

APHA (American Public Health Association), 2005. Standard Methods for the Examination of Water and Wastewater. 21

st ed. Washington

D.C. 1368 pp. Baloch, W. A., Soomro, A. N. & Buledi, G. H., 2008.

Zooplankton, especially Rotifer and Cladoceran Communities of the spring and rainwater streams Nai in Kirthar range, Sindh, Pakistan. Sindh Univ. Res. J. (Science Series) 40(1):17-22.

Chergui, H. F., Hamaidi, M.S., Errahmani, M.B. & Benouaklil, F., 2013. Studies on biodiversity of rotifer in five artificial lakes in Algeria: Systematical and Zoogeographical remarks. Kragujevac J. Sci., 35: 115-138.

Chughtai, M.I., Mahmood, K. & Awan, A.R., 2011. Asseesment of planktonic diversity in River Chenab as affected by sewage of Multan city. Pak. J. Bot., 43(5): 2551-2555.

Clarke, E.O., Aderinola, O.J. & Adeboyejo, O.A., 2013. Dynamics of rotifer population in a lagoon bordered by heavy industry in Lagos, Nigeria. Am. J. Res. Comm., I (4): 172-192.

Dutta, T.K. & Patra, B.C., 2013. Biodiversity and seasonal abundance of zooplanktons and its relation to physic-chemical parameters of Jamunabundh, Bishnupur, India. Int. J. Sci. Res. Publ., 3(8):1-7.

Farshad, H & Venkataramana, G.V., 2012. Impact of Physico-Chemical Parameters of Water on Zooplankton Diversity in Nanjangud Industrial Area, India. Int. Res. J. Environ. Sci., 1(4): 37-42

Hickman, C.P., Roberts, L.S., Larson, A., Anson, H. & Eisenhour, D.J., 2006. Integrated Principles of Zoology. 13

th ed. McGraw-Hill,

New York. 315 pp. Hussain, A., Sulehria, A.Q.K., Ejaz, M. & Maqbool,

A., 2013. Monthly variation in physicochemical parameters of a flood plain reservoir on River Ravi near Balloki Headworks (Pakistan). Biologia (Pakistan). 59(2):371-375.

Hyman, L. H., 1951. The Invertebrates. Vol. III. Acanthocephala, Aschelminthes and Entroprocta. McGraw-Hill, New York. 55 pp.


Kenneth, A. Mason, Jonathan B. Losos & Susan R. Singer., 2011. Biology. 9

th Ed. The McGraw-

Hill Companies. 663 pp. Koste, W., 1978. Rotatoria. Die

RadertiereMitteleuropas, begrudet von Max Voigot. Uberordnung Monogonota. Gebruder, Borntraeger, Berlin, Stuttgart. I. Text U. II. Tafelbed. (T. 234), 673 pp.

Pennak, R. W., 1978. Fresh water Invertebrates of the United States. 2nd Ed. Wiley, New York. 803 pp.

Segers, H., 2007. Annotated checklist of the rotifers (Phylum Rotifera), with notes on nomenclature, taxonomy and distribution. Zootaxa. 1564:1-104.

Sivalingam, P, Swamy, M. & Ravinder R., T., 2013. Zooplankton Diversity with Reference to the Physico-Chemical Parameters of Kajjarla Lake, Adilabad District, AP, India. Int. Res. J. Biol. Sci., 2(11): 24-28.

Sulehria, A.Q.K. & Malik, M. A., 2012. Population Dynamics of Planktonic Rotifers in Balloki Headworks. Pakistan J. Zool., 44(3): 663-669.

Sulehria, A.Q.K., Qamar, M. F., Anjum, R. F., Ejaz, M., & Hussain, A., 2009a. Seasonal fluctuations of rotifers in a fish pond at district Bahawalnagar, Pakistan. Biologia (Pakistan). 55 (1&2): 21-28.

Sulehria, A.Q.K., Qamar, M. F., Haider, S., Ejaz, M. & Hussain, A., 2009b. Water quality and Rotifer diversity in the fish pond at District Mianwali Pakistan. Biologia (Pakistan). 55(1&2): 79-85.

Wang, S. B. & Geng, H., 2013. Forces driving the seasonal changes of a rotifer community in a eutrophic Chinese lake. 22(3): 343-351.

Ward, H. B. & Whipple, G. C., 1959. W. T. Edmondson 2nd Ed. Fresh Water Biology. John Wiley and Sons. New York. 1248 pp.




Physico-Chemical characteristics and Fish Distribution in River Poonch at

Kotli, Azad Kashmir

*NUZHAT SHAFI1, LUBNA IFTIKHAR

2, TASLEEM AKHTAR

3 & JAVAID AYUB

4

1, 2, 3 Department of Zoology, University of Azad Jammu and Kashmir (AJK) Muzaffarabad

4Director Fisheries and Wildlife GO AJ&K, Muzaffarabad

ABSTRACT

This study was designed to assess the status of water through physico-chemical characteristics and fish distribution in River Poonch at Kotli Azad Kashmir. Certain changes in physico-chemical factors such as temperature, pH, overall hardness, chloride ions, dissolved oxygen and total alkalinity were analyzed every month for a period from June, 2008 to January, 2009, and observed values were compared with standard values recommended by APHA. The air temperature and water temperature were found to be 28.1

°C±2.03

and 26.2°C±1.91, respectively. The mean calculated values of pH, dissolved oxygen, total alkalinity, total

hardness and chloride ions, were found to be 7.6±0.2, 7.5±0.19, 83±1.67ppm, 178.4±6.61 ppm and 6.4±0.28 ppm, respectively. The physico-chemical parameters were found to be suitable for the cultivation of warm water fishes and some semi cold water fishes. Six fish species collected from the study area were: Garra gotyla, Clupisoma naziri, Tor putitora, Labeo dero, Labeo dyocheilus and Glyptothorax kashmirensis. Key words: Physico-chemical parameters, River Poonch, Distribution of Fish species.

INTRODUCTION

Water is one of the most important components of life. For natural ecosystems, water resources have vital role. The water quality reveals significant information about an ecosystem (Sarkar et al., 2010). The aquatic life entirely relies on the physico-chemical characteristics of water. Owing to increasing anthropogenic activities and because of some usual progressions the quality of water is continuously deteriorating and poses enormous threat to aquatic life including river dependent human beings. To ensure the desired aquatic environment and consequently healthy aquatic life, regular screening of water characteristics and monitoring the degree and impact of pollution is compulsory. Water quality is the most important element of aquatic environment that demonstrates the best possible growth of aquatic life/ organisms (Raja et al., 2008; Shahnawaz et al., 2009 & Damotharan et al., 2010) and thus classify the habitat of living organisms and propose proper conservation and managing strategies (Donohue et al., 2006).

A River and its tributaries, carry the load of sediment and dissolved matter from both natural and manmade sources that destroy its properties (Shrestha & Kazama, 2007; Rani et al., 2004) which may be responsible for declining the aquatic (fish) growth (Rajasekar et al., 2005 ).

River Poonch is a small warm water river, where temperature reaches up to 30

oC during

summer season. It passes from dist. Poonch , kotli and finally drains into Mangla lake. The River stretch serves as important breeding grounds for fish fauna it abodes and of Mangla reservoir. Kotli district of Azad Jammu and Kashmir is a populated town situated on River Poonch therefore, most of sewage is directly thrown in to the River Poonch. The present study was designed to evaluate the water characteristics based on physico-chemical parameters of River Poonch at Kotli and to determine the status of fish fauna.


Study area

For the estimation of water quality, an effort was made to assess the water in Poonch River of Kotli, Azad Kashmir. The River Poonch originates from Neel Kunth and Jamia Gali of Pir Panjal. It passes from city Poonch Sehra, Tatta Pani and fall downward to the Kotli city which falls into Mangla Dam near Chomak. It is a small river that flows throughout the year, but its water level become high in rainy season. Some of most important tributaries of River Poonch are Nallah Baytar and Nallah Swan.

Sample (water & fishes) collection

The water samples were collected for their physico-chemical analysis from River Poonch at

244 N. SHAFI ET AL BIOLOGIA (PAKISTAN)

Kotli (Thalair site) colony from June, 2008 to January, 2009. The water samples were collected on monthly basis and were analyzed for the concentration of inorganic substances following the standard methods (APHA, 2005). To analyze the water quality, a 1000 ml of water was collected in plastic bottles with double stoppers from sampling station. Samples were collected each month between 9:00 am-1:00 pm from the surface of the river. Before sampling, the bottles were cleaned and washed with detergent solution. The bottles were finally rinsed with deionized water and dried. After sampling, the bottles were screwed carefully and marked with the respective identification number.

Through the proper netting, fishes were collected from River Poonch at Kotli (Thalair site) AJ&K.

Water analysis

Temperature was recorded by using a mercury filled thermometer. The thermometer was shaded from the direct sun light while taking the readings and the results were expressed as

oC. pH

of the water was determined by electrometric method using a laboratory pH meter (Eutech 54506, Singapore), before taking the readings, the pH meter was calibrated by using buffer solution containing pH 7.0. Alkalinity was measured by titration method and the EDTA method was used to determine the hardness of water. Chloride was also estimated by titration method in the form of silver chloride. Dissolved oxygen was determined by digital DO meter (Ox 96 W.W Germany) (Stirling, 1985).


The collected data were analyzed by using MS Excel. The mean, standard deviation, standard error, etc. were calculated by Minitab.

RESULTS The analysis of water samples of river

Poonch revealed the fluctuation in different parameters shown in table I. The obtained values reflected the mean value of water samples collected during the study period. The results manifested that there was no significant pollution or worsening of parameters like, temperature, pH, alkalinity, dissolved Oxygen (DO) and hardness. Therefore water quality of the river is healthy for better growth and survival of its fish fauna.

The mean value of air temperature was 29.6±1.28°C, ranged from 23 to 35°C and maximum

water temperature was recorded in July (33.3°C) and lower (17.3°C) was recorded in the January. There was great difference in atmospheric temperature of day and night.

The values of pH ranged between7.3 to 8.2. The highest pH value (8.2) was recorded in the January and lowest (7.3) in the month of June. In addition, the alkalinity was documented as a maximum of 90 ppm (June) and a minimum of 75 ppm (October).

The DO values range from a minimum of 6.6 ppm (July) to maximum of 8.4 ppm (January). Lower DO values throughout summer may be due to the elevated temperature and its expenditure due to rapid growth of micro-organisms. The mean value of DO of river Poonch at Kotli was ideal for the production of fish fauna.

The chloride ions showed variation and ranged from 5.0 ppm (January) to 7.5 ppm (June) The mean value of chloride ion of river Poonch at Kotli was 6.4 ppm.

Total hardness

The value of hardness fluctuated from 141.5 ppm to 205.8 ppm. The highest value (205.8 ppm) was recorded in the winter and lowest value (141.5 ppm) in the summer. The mean value of total hardness in River Poonch at Kotli was 178.4 ppm which was suitable for fish growth and development.

Fish Fauna

Six different fish species; viz., Garra gotyla, Clupisoma naziri, Tor putitora, Labeo dero, Labeo dyocheilus and Glyptothorax kashmirensis were found from River Poonch at Kotli (Thalair site). These fish species were also collected by Rafique & Qureshi, (1988- 1995); and Mirza & Alam, (1994).

DISCUSSION

River Poonch has the healthy habitat for

different fish species and serves as their breeding grounds. All physical and chemical properties of river Poonch were within the enviable limits.

In summer, the water temperature increases due to elevation of atmospheric temperature through sunlit and falls down in winter (Salve & Hiware, 2008). Water temperature is a significant feature of water body that maneuvers all chemical and biological distinctiveness and makes the aquatic system tolerable.

VOL. 61 (2) PHYSICO-CHEMICAL CHARACTERISTICS AND FISH DISTRIBUTION 245

Tables I: Monthwise variation of Physico-chemical properties of River Poonch

Months Air temp °C

Water temp °C

pH DO (ppm) Total

alkalinity

(ppm)

Total

hardness

Chlorides

ions (ppm)

June 32.4 30.2 7.3 7.1 90 141.5 7.5

July 35.0 33.3 7.4 6.6 89 167.2 6.9

August 32.8 30.0 7.3 7.4 85 167.0 7.3

September 30.0 27.0 7.5 7.1 79 180.0 6.8

October 29.5 28.4 7.6 7.4 75 192.9 6.4

November 26.5 25.0 7.8 7.8 83 180.0 6.0

December 20.0 18.0 8.0 8.1 82 192.9 5.5

January 18.0 17.3 8.2 8.4 80 205.8 5.0

Mean

28.1

26.2

7.6

7.5

83

178.4

6.4

SEM ±2.03 ±1.91 ±0.2 ±0.19 ±1.67 ±6.61 ±0.28

The temperature also affects the pH of

water, which in turn influences most of chemical and bio-chemical reactions. The undesirable consequence of acids appears under pH 5 and of alkalis beyond the pH 9.5 (Stirling, 1985). Reduced rate of photosynthesis decreases the incorporation of carbon dioxide and bicarbonates, which eventually augment the pH as observed in our result that it rose in winter. The alkalinity of River Poonch ranged between 50 to 200 ppm and it is considered to be very suitable for a good production of fishes (Moss, 1998) also supported by Pathak et al. (2012)

In any aquatic body, Dissolved Oxygen (DO) plays an important role for aquatic life. DO is directly depends on temperature. The lower oxygen values associate with higher temperature and turbidity (Kamble et al., 2009) as recorded higher (6.6 ppm) in July and maximum (8.4 ppm) in January during this study. The rate of respiration and decay of organic matter lessen the DO values to significant level whereas increase in the rate of

photosynthesis causes an increase in DO values. (Emerson & Abell, 2001; Agrawal et al 2009).

The chloride concentration was lower in winter (5.0 ppm) and higher (7.5 ppm) in summer. Lower concentration of chlorides ions caused the partial mortality of fish.

The hardness was observed on higher side during the winter season possibly due to dearth in water quantity because of less precipitation and a

reduced amount of Snow melting. On the contrary highest total hardness was estimated by Hujare (2008) during summer than monsoon and winter.

From present investigations it can be therefore concluded that water of River Poonch and its tributaries at Kotli district is not polluted. It has a great potential to produce different fish species. It is hoped that this work would help in planning and managing the strategy for fish propagation in future.

VOL. 61 (2) PHYSICO-CHEMICAL CHARACTERISTICS AND FISH DISTRIBUTION 247


REFERENCES

Agrawal, N., Dhirendra M. J. & Kumar, A., 2009 . Studies on physico-chemical parameters to assess the water quality of River Ganga for drinking purpose in Haridwar District. Rasayan J. Chem., 2(1): 195-203

APHA (American Public Health Association), 2005. Standard Methods for the Examination of Water and Wastewater. 21

st ed. Washington

D.C. 1368 pp. Donohue, I., McGarrigle, M. L. & Mills, P., 2006.

Linking catchment characteristics and water chemistry with the ecological status of Irish rivers. Water Res., 40: 91-98.

Damotharan, P., Permal, N. V. & Perumal, P., 2010. Seasonal variation of physic-chemical characteristics of Point Calimere coastal waters (South east coast of India). Middle-East J. Sci. Res., 6(4): 333-339.

Emerson, S. & Abell, J., 2001. “The Biological Pump in the Subtropical North Pacific Ocean.” Pretence Inc., Chicago.

Hujare, M. S., 2008. Seasonal variation of physico-chemical parameters in the perennial tank of Talsande, Maharashtra. Ecotoxicol. Environ. Monitor., 18(3): 233-242.

Kamble, S. M., Kamble, A. H. & Narke, S. Y., 2009. Study of physico-chemical parameters of Ruti dam, Tq. Ashti, dist. Beed, Maharashtra. J. Aqua. Biol. 24(2): 86-89.

Mirza, M. R. & Alam, 1994. Geographical distribution of freshwater fishes in Pakistan: (A Review). Punjab Univ. J. Zool., 9: 93-108.

Moss, B., 1998. Ecology of Freshwater: Man and Medium, Past to Future. Oxford: Blackwell Science Ltd. 144 pp.

Pathak, H., Pathak, D. & Limaye S. N., 2012. Studies on the physico-chemical status of two water bodies at Sagar city under anthropogenic influences. Adv. Appl. Sci. Res., 3(1):31-44.

Rafique, M. & Qureshi, M.Y., 1988-1995. Biodiversity of Pakistan. Pakistan Museum of Natural History, Islamabad and Florida Meuseum of Natural history, Gainesville. pp: 335-341.

Raja, P., Amarnath, A. M., Elangovan, R. & Palanivel, M., 2008. Evaluation of physical and chemical parameters of River Kaveri, Tiruchirappalli, Tamil Nadu, India, J. Environ. Biol., 29(5): 765-768.

Rajasekar, K. T., Peramal, P. & Santhanam, P., 2005. Phytoplankton diversity in the coleroon estuary, southeast coast of India. J. Mar. Biol. Assoc. India., 47:127-132.

Rani, R., Gupta, B. K. & Srivastava, K. B. L., 2004. Studies on water quality assessment in Satna city (M.P): Seasonal Parametric Variations. Nat. Env. Poll. Tech., 3(4): 563-565.

Salve, V. B. & Hiware C. J., 2008. Study on water quality of Wanparakalpa reservoir Nagpur, Near Parli Vaijnath, District Beed. Marathwada region, J. Aqua. Biol., 21(2): 113-117.

Sarkar, U. K., Gupta, B.K. & Lakra, W.S., 2010. Biodiversity, ecohydrology, threat status and conservation priority of the fresh water fishes of river Gomti, a tributary of river Ganga (India). Environmentalist., 30: 3-17.

Shahnawaz, M., Venkateshwarlu, M., Somashekar, D. S. & Santosh, K., 2009. Fish diversity with relation to water quality of Bhadra River of Western Ghat (INDIA). Env. Monitor. Assess. 161(1-4): 83-91.

Shrestha, S. & Kazama, F., 2007. Assessment of surface water quality using multivariate statistical techniques: A case study of Fuji river basin, Japan. Environ. Model. Soft. 22(4): 464-475.

Stirling, H. P., 1985. Chemical and Biological Methods of Water Analysis for Aquaculturists. Institute of Aquaculture University of Stirling. Stirling. Scotland. 119 pp.




Effect of Cinnamomum tamala and Aloe barbadensis on Kidney Functioning in

Diabetic Mice

*SYED SHAHID IMRAN BUKHARI1, NUSRAT JAHAN

1 & ANDLEEB BATOOL

1

1Department of Zoology Government College University Lahore, Lahore

ABSTRACT

Diabetes causes almost 5% deaths all over the world and affecting the major organs of the body like heart and kidneys. A number of the treatments are available to cure the diabetes complications but most of them are out of reach of maximum patients especially in the third world countries. Herbal medication is a low cost treatment and considered to be safer. The current study was designed to evaluate medicinal efficacy of Cinnamon tamala (C. tamala) and Aloe barbadensis (A. barbadensis) in diabetes induced mice. Alloxan monohydrate (200mg/kg) was used to induce diabetes. Blood glucose levels were measured to confirm hyperglycemia after 10-12 hours fasting. Overall 36 mice were included in the study and divided into four groups; Negative control (non diabetic), positive control (diabetic), diabetic treated with C. tamala and A. barbadensis. C. tamala at 50mg/kg was effective to reduce fasting blood glucose from 222.00±6.24 mg/dl to 85.33±3.53 mg/dl and A. barbadensis at 400mg/kg dose appeared highly effective in reducing blood sugar from 284.00±4.5 mg/dl to 41.00±1.00 mg/dl. The same doses of C. tamala and A. barbadensis were effective in the reduction of serum creatinine and serum urea level in the diabetes induced mice. Histology of kidney from diabetic mice showed marked degeneration of the glomeruli with glomerular atrophies and severe vacuolations. Extracts of C. tamala and A. barbadensis showed improved functioning with normal appearance of the glomeruli and kidney after 14 days exposure. In conclusion, C. tamala and A. barbadensis are potentially efficient to treat diabetes and kidney malfunctioning at recommended oral doses of 50 mg/kg and 400mg/kg of body weight in mice, respectively. Key words: Diabetes, Alloxan monohydrate, Cinnamomum tamala, Aloe barbadensis.

INTRODUCTION

Reactive oxygen species (ROS) are

generated during diabetes which causes damage to various tissues especially pancreatic β-cells, hepatocytes and kidney tissues (Kosta & Tiwari, 2009; Seshasai et al., 2011). Nephrotoxicity is one of the major complications associated with diabetes. Renal disease causes an increase of 10–30% cost of treatment of diabetics. There is 11-fold increase in the treatment cost with dialysis (Brandle et al., 2003). Herbal treatment has proved as an alternate due to easy administration, low cost and no side-effects (Helal et al., 2003; Mentreddy, 2007). It has been reported that 60% of world’s population is using traditional herbal medicines (Modak, et al., 2007; Manzoor et al., 2013). Plant extracts possess antioxidant, anti-inflammatory and anti-diabetic effects along with large number of bioactive compounds against various diseases (Kosta & Tiwari, 2009). Different commercial sectors use bioactive components from plant materials for pharmaceutical and chemical purposes (Azmir et al., 2013).

In the current study the two plants extracts Cinnamomum tamala and Aloe barbadensis were selected to evaluate the potential efficacy for the

treatment of diabetes. Cinnamon has been known as a spice since long and it has gained attention of researchers due to its potential efficacy in the treatment of T2D (Howard & White, 2012). Cinnamon extract plays regulatory role in lowering the level of blood glucose and lipids by lowering the carbohydrates absorption in small intestine (Kim et al., 2006). Various species of cinnamon like Cinnamomum zeylanicum contain cinnamaldehyde (CA) which is an active gradient against diabetes being used on large scale as alternative medicine for diabetes (Anand et al., 2010). Similarly Cinnamomum tamala has significant antidiabetic, antioxidant and hypolipidemic activity (Kumar et al., 2012). Aloe vera extract is used to evaluate the anti-diabetic, anti-hyperlipidemic and anti-oxidative activity in control of diabetes. Due to presence of appreciable amount of (Cr, Mn and Zn) in Aloe vera gel it is best antioxidant agent (Mohamed, 2011; Subramanian et al., 2006), so can be used as alternative treatment for complicated situations related with T2D (Vanitha et al., 2013).

This study was designed to determine the efficacy of herbal extracts i.e. C. tamala and A. barbadensis in various concentrations against diabetes and renal impairment.

250 S. S. I. BUKHARI ET AL BIOLOGIA (PAKISTAN)

MATERIALS AND METHODS Animals modeling and experimental design

Thirty six Albino mice weighing (25–30 grams) of four weeks were reared at 26±4˚C, relative humidity 55-60% and light dark cycle 12h:12h in animal house department of Zoology GCU Lahore. Mice were reared and acclimatized for a period of 07 days before each set of experiment. Mice were kept in the standard cages (8

″X18

″X10

″)

in the group of three to prevent from cannibalism. Pellet diet was used containing 18% proteins, 4.9% fats and 3.2% fibers.

Induction of diabetes

Diabetes was induced by single intraperitoneal injection (200mg/kg) with alloxan monohydrate obtained from Sigma Chemical Company (Luka et al., 2013). Mice were starved overnight before injection of alloxan.

Thirty six mice were divided into four groups and duration of experiment was 21 days. The detail of mice group is given as follows; Group 1: Healthy mice fed on pellet diet served as – ve control. Group 2: Diabetic mice fed on pellet diet served as +ve control. Group 3: Diabetic mice fed on pellet diet plus Cinnamomum tamala for 14 days with 17 mg/kg (low dose), 50 mg/kg (medium dose) and 100 mg/kg (high dose). Group 4: Diabetic mice fed on pellet diet plus Aloe barbadensis for 14 days with 200 mg/kg (low dose), 300 mg/kg (medium dose) and 400 mg/kg (high dose).

After 07 and 14 days mice were sacrificed by terminal anesthesia using Ketamine mixed with sterilized injection water in the ratio of 1:2 and 0.1 ml was given to each animal intraperitoneally before collection of blood by heart puncture. Each time blood glucose level was recorded by glucometer.

Plant material and preparation

Bark of C. tamala was purchased from commercial source while A. barbadensis sample was collected in December, 2013 from Government College University garden, Lawrence Road Lahore, Pakistan. C. tamala and A. barbadensis were identified with voucher specimen G.C.Herb.Bot\2286 and G.C.Herb.Bot\2285 deposited in the Department of Botany Government College University Lahore.

Preparation of Extract of Cinnamomum tamala: Cinnamomum tamala bark was rinsed with tap water and dried by spreading under the shade until

a constant weight was obtained. Then the bark was ground into powder. Fifty grams of this powder was soaked in 100 ml of boiled distilled water and agitated intermittently for 24 hours. Then, it was filtered using fine sieve to obtain the filtrate as aqueous extract. The extract was dried in an oven at 50°C to get the crude form of extract. The extract

was stored in an air tight container at 20C and latter on, reconstituted in distilled water when required to use.

Preparation of Extract of Aloe barbadensis: Three years old Aloe barbadensis was washed, weighed, peeled and the leaf pulp (gel together with pulp) was scratched with a spoon. The pulp was homogenized with glass homogenizer having an equal volume of phosphate buffered saline (0.1 M, PH=7). Homogenized material was stored at 4°C overnight then it was filtered through muslin cloth. Clear filtrate was kept at 20°C in 1 ml aliquots until use. The yield of fresh Aloe barbadensis pulp was about 35% v/w in terms of starting fresh leaf extract.

Fasting blood glucose level

Fasting blood glucose level was measured from the first day of extract supplementation to diabetic mice. Fasting blood glucose level was measured at the interval of seven days. Blood was collected from tail vein and FBG level was measured by single touch glucosure plus glucometer from Apex Bio (Taiwan). Mice with more than 150mg/dl of blood sugar level were considered as diabetic.

Biochemical assay

Renal function tests were performed to observe the changes during the study. Serum creatinine was performed according to kinetic method without deproteinisation- Jaffe reaction (Cat. No. CS604) made by crescent diagnostics. Serum Urea was tested according to enzymatic- Berthelot method (Cat. No. CS612) made by crescent diagnostics.

Histology of kidney

Kidney from each animal was excised and cut into small pieces. These pieces were preserved immediately with 10% formalin solution. Fixation was carried out to prevent autolysis and microbial degradation.


The data was presented as Mean ± S.E.M. One way analysis of variance (ANOVA) was performed on means to determine whether there was significant (p < 0.05) difference among the

VOL. 61 (2) EFFECT OF CINNAMOMUM TAMALA AND ALOE BARBADENSIS IN DIABETIC MICE 251

groups. When ANOVA indicated statistical significance, Tukey’s multiple comparison test as post hoc was applied for inter group comparison.

RESULTS

Evaluation of the nephropathy activity of extracts of C. tamala and A. barbadensis was observed in Swiss albino mice. It was found that single intraperitoneal injection of 0.1 ml of Alloxan monohydrate at the dose of 200 mg/kg b.w. produced symptoms of diabetes in mice (group II) along with rise of fasting blood glucose level more than 150 mg/dl from day 0 to 21 days post induction which served as +ve control group (Table I). During the experiment behavioral and morphological changes were also observed i.e., thinning of body hairs, sluggish body movements, sometime shivering, timed eyes and khyphosis.

The effect of C. tamala and A. barbadensis on fasting blood glucose of diabetic mice

The results in table I revealed that alloxan induction led to significant increase in fasting blood glucose level in the untreated diabetic group compared with normal group (p<0.05). The result indicated that there was highly significant increase in fasting blood glucose in diabetic mice group II as compared to group I (normal). Three doses of C. tamala which were given to group III, IV and V indicated that there is significant decrease in fasting blood glucose level in low dose (17 mg/kg) and medium dose (50 mg/kg) as compared to high dose (100 mg/kg). Three doses of A. barbadensis were given to group III, IV and V indicated that there is significant decrease in fasting blood glucose level in medium (300 mg/kg) and high dose (400 mg/kg) as compared to high dose (100 mg/kg).

Effect of C. tamala and A. barbadensis on Renal Function Tests of Diabetic Mice

Table II & III showed the results obtained for serum creatinine and serum urea that depicted a significant increase (p<0.05) in serum creatinine and serum urea concentration of diabetic group . A significant decrease (p˂0.05) was observed kidney function when treated with C. tamala aqueous extract. Mice treated with three doses of C. tamala which were given to group III, IV and V indicated that there is significant reduction in serum creatinine and serum urea level with the medium dose (50 mg/kg) post 14 – 21 days treatment as compared to diabetic mice (+ve control) indicating this dose was effective in reducing the level of serum creatinine and serum urea in diabetic mice.

Results obtained for serum creatinine and serum urea showed that there is significant increase (p<0.05) in serum creatinine and serum urea concentration of diabetic group after alloxan induction and a significant decrease (p<0.05) in their concentrations when treated with A. barbadensis extract. Mice treated with three doses of A. barbadensis which were given to group III, IV and V indicated that there is significant reduction in serum creatinine and serum urea level with the medium dose (300 mg/kg) post 14 – 21 days treatment as compared to diabetic mice (+ve control) indicating this dose was effective in reducing the level of serum creatinine and serum urea in diabetic mice (Table II & III).

Histological results of kidney

In normal mice group, kidney was without any pathological abnormality with normal appearance of the glomeruli. Kidney of alloxan induced diabetic mice showed marked degeneration of the glomeruli with glomerular atrophies and severe vacuolations. In mice treated with medium dose of C. tamala (group IV) kidney showed improvement with normal appearance of the glomeruli in comparison to low and high dose (Fig., 1). Kidney section from Kidney of diabetic mice treated with high dose of A. barbadensis (group V) showed pathological normality with normal appearance of the glomeruli in comparison to low and medium dose (Fig., 2).

DISCUSSION

Medicinal plants with antidiabetic compound and antioxidant properties are used to treat hypoglycemic and hyperglycemic conditions in different parts of the world (Modak et al., 2007). More than 1200 plants are used around the world to control the diabetes and approximately 30% of the traditionally used antidiabetic plants are pharmacologically and chemically investigated (Mallick et al., 2007; Kosta & Tiwari, 2009; Manzoor et al., 2013). The present study evaluated the antihyperglycemic activity of local plants (C. tamala and A. barbadensis) found in Pakistan. C. tamala and A. barbadensis reduce blood glucose level at random and at fasting to normal and is found comparable to the studies reported by many other (Gosh & Suryawanshi, 2001; Sarasa et al., 2012; Chigozie et al., 2013 and Akuodor et al., 2014). C. tamala (50 mg/kg) significantly reduce the blood sugar at random and fasting post treatment. A similar study conducted by Chen et al. (2013) also depict decrease of fasting blood glucose after


Table I: Effect of C. tamala and A. barbadensis on Fasting blood glucose level (mg/dl) in control and

treated Albino mice

Groups Day 0 Day 07 Day 14 Day 21

Normal

89.67±3.48

89.67±3.48

a,b,c,d

66.00±2.65

a,b,c,d

65.33±2.03

a,b,c,d

Diabetic

91.00±2.65

223.00±7.57

a,e,,g

230.00±2.89

a,e,f,g

231.67±2.91

a,e,f,g

Diabetic + C. tamala (17mg/kg) treated

87.00±6.08

308.33±10.14

b,e,f

96.00±3.46

b,e,h

86.67±2.60

b,e,h

Diabetic + C. tamala

(50mg/kg) treated

77.33±3.53

222.00±6.24c,f

98.33±4.10c,f,i

85.33±3.53c,f,i


90.67±4.37

189.33±5.49

d,g,f

163.67±1.86

d,g,h,i

135.00±3.61

d,g,h,i

Diabetic + A.barbadensis (200mg/kg) treated

66.00±2.52

340.00±27.5

a,b,e

66.00±2.5

b,c

59.00±1.53

c,f


68.33±1.20

243.33±16.91

c,e

60.33±0.88

c

56.67±2.19

d,g

Diabetic + A. barbadensis (400mg/kg) treated

65.33±2.85

284.00±4.51

d

54.33±3.84

d

41.00±1.00

b,e,f,g

Means with the same superscript differ significantly at p < 0.05. Similar alphabets represent statistically significant values. ± S.E.M.

Table II: Effect of C. tamala and A. barbadensis on Serum creatinine level (mg/dl) in control and

treated Albino mice


Control (receiving normal diet)

1.03±0.09

1.03±0.09

a,b,c,d

1.03±0.09

a,b,c,d

1.10±0.06

a,b,c

Diabetic (receiving normal diet)

1.03±0.09

3.43±0.12

a

3.43±0.12

a,e,f

3.70±0.15

a,d,e,f


1.03±0.09

3.43±0.12

b

3.43±0.12

b,g,h

2.70±0.15

b,d,h


1.03±0.09

3.43±0.12

c

2.43±0.09

c,e,g

1.26±0.09

e,h,i


1.03±0.09

3.43±0.12

d

2.60±0.06

d,f,h

2.30±0.15

c,f,i


0.70±0.12

3.60±0.15

b

2.60±0.15

b,e,h 2.20±0.06

b,d,g


0.70±0.12

3.60±0.15

c

2.00±0.00

c,f,e

0.80±0.06

e,g,h

Diabetic + A. barbadensis (400mg/kg) treated

0.70±0.12

3.60±0.15

d

1.67±0.15

d,g,h

0.90±0.06

c,f,h

Means with the same superscript differ significantly at p < 0.05. Similar alphabets represent statistically significant values. ± S.E.M.


Table III: Effect of C. tamala and A. barbadensis on Serum urea level (mg/dl) in control and treated Albino mice


Control (receiving normal diet)

31.33±0.88

31.33±0.88

a,b,c,d

31.33±0.88

a

30.33±0.88

a,b,c

Diabetic (receiving normal diet)

31.33±0.88

104.00±1.73

a

104.00±1.73

a

106.33±1.45

a,d,e,f


31.33±0.88

104.00±1.73

b

75.67±2.03

a

64.67±1.86

b,d,g


31.33±0.88

104.00±1.73

c

39.33±0.88

a

32.67±0.33

e,g,h


31.33±0.88

104.00±1.73

d

94.00±2.08

a

64.67±1.86

c,f,h


24.33±1.20

107.00±2.08

b

92.67±1.76

a

93.00±0.58

b,d,g,h


24.33±1.20

107.00±2.08

c

37.67±1.20

a

23.00±0.58

e,g,i


24.33±1.20

107.00±2.08

d 71.00±7.77

a

22.00±2.08

c,f,h,i

Means with the same superscript differ significantly at p < 0.05. Similar alphabets represent statistically

significant values. ± S.E.M.

Fig., 1: Hematoxylin–eosin staining of kidney sections of diabetic 1(B), low dose 1(C) and

medium dose of C. tamala 1(D) treated mice after

14 days treatment compared with control 1(A).

Fig., 2: Sections of diabetic 2(B), low dose 2(C) and high dose of A.barbadensis Hematoxylin–

eosin staining of kidney 2(D) treated mice after 14 days treatment compared with control 2(A).

treatment with 200 mg/kg of bark extract of C. tamala and C. cassia. Another study conducted by Luka et al. (2013) reveal the decrease with 150 mg/kg of Ocimum grtissimum extract after 14 days treatment. Regeneration of pancreatic cells may be considered an underlying process for the increased production of insulin to decrease hyperglycemia.

C. tamala (50 mg/kg) and A. barbadensis (300 mg/kg) significantly reduce the creatinine to normal levels after 21 days of treatment. A similar study conducted by Neto et al. (2013) show decrease in serum creatinine level in diabetic wistar rats after 14 days of treatment with Calotropis procera leaves extract. Toxicity to kidney affect biochemical function so, generally


the effects are used clinically to diagnose the kidney damage and are the reflective of excretory damage by increase in blood urea and plasma Creatinine (Akuodor et al., 2014).

The 3 fold increase in serum urea in diabetes induced group after 07 days of diabetes induction. Protective effect of C. tamala (50 mg/kg) and A. barbadensis (300 mg/kg) significantly reduced the serum urea level to normal. A study conducted by Vasconcelos et al. (2011) depicted the decrease of Serum urea level in wistar rats treated with Caesalpinia ferrea extract after two weeks treatment. Hyperuricemia and uremia has direct relationship with protein catabolism. Toxicity to kidney affect biochemical function so, generally the effects are used clinically to diagnose the kidney damage and are the reflective of excretory damage such as increase in blood urea and increase in plasma Creatinine (Akuodor et al., 2014). Histological examination of the kidney showed the distorted nephrons in diabetic mice (Fig no. ?). In present study C. tamala and A. barbadensis treatments have prevented the destruction of nephrons and preserved the architecture of kidney cells (Fig no. ?). Gosh & Suryawanshi (2001) reported that administration of 10 ml/kg of Vinca rosea extract for six days regenerated the kidney cells. In conclusion C. tamala and A. barbadensis are potentially efficient to treat diabetes and kidney malfunctioning at recommended oral doses of 50 mg/kg and 400mg/kg of body weight in mice respectively. This study also suggested that C. tamala and A. barbadensis treatment has protective effect against kidney damage in diabetic mice.

REFERENCES

Akuodor, G.C., Udia, P.M., Bassay, A., Chilaka, K.C. & Okezie, O.A., 2014. Antihyperglycemic and antihyperlipidemic properties of aqueous root extract of Icacina senegalensis in alloxan induced diabetic rats. J. Acute Dis. 99-103.

Anand, P., Murali, K.Y., Tandon, V., Murthy, P.S. & Chandra, R., 2010. Insulinotropic effect of cinnamaldehyde on transcriptional regulation of pyruvate kinase, phosphoenol pyruvate carboxy kinase, and GLUT4 translocation in experimental diabetic rats. Chem. Biol. Interact. 186(1): 72-81.

Azmir, J., Zaidul, I.S.M., Rahman, M.M., Sharif, K.M., Mohamed, A., Sahena, F. & Jahurul, M.H.A., 2013. Techniques for

extraction of bioactive compounds from plant materials. J. Food Eng. 117: 426-436.

Brandle, M., Zhou, H., Smith, B.R.K., Marriott, D., Burke, R., Tabaei, B.P., Brown, M.B. & Herman, W.H., 2003. The direct medical cost of type 2 diabetes. Diabetes Care. 26(8): 2300-2305.

Chen, L., Sun, P., Wang, T., Chen, K., Jia, Q., Wang, H. & Li, Y., 2012. Diverse mechanisms of antidiabetic effects of different procyanidin oligomer types of two different cinnamon species on db/db mice. J. Agric. Food chem. 60: 9144-9150.

Chigozie, I. J. & Chidinma, I. C., 2013. Positive moderation of the hematology, plasma biochemistry and ocular indices of oxidative stress in alloxan-induced diabetic rats, by an aqueous extract of leaves of Sansevieria liberica Gerom and labroy. Asian Pac. J. Trop. Med. 27-36.

Gosh, S. & Suryawanshi, S. A., 2001. Effects of Vinca rosea extracts in treatment of alloxan diabetes in albino rats. Indian J. Exp. Biol. 39: 748-759.

Helal, E.G.E., Hassan, M.H.A., Mustafa, A.M. & Al-Kamel, A., 2003. Effect of Aloe vera extract on some physiological parameters in diabetic albino rats. Egypt. J. Hosp. Med. 12: 53-61.

Howard, M.E. & White, N.D., 2013. Potential benefits of cinnamon in type 2 diabetes. Am. J. Lifestyle Med. 7(1): 23-26.

Kim, H.S., Hyun, S.H. & Choung, S.Y., 2006. Antidiabetic effects of cinnamon extract on blood glucose in db/db mice. J. Ethnopharmacol. 104(1-2): 119-123.

Kosta, S. & Tiwari, A., 2009. Screening and assessment of anti diabetic and reactive oxygen scavenging effects of herbs in streptozotocin induced mice. Pharmacology. 3: 695-704.

Kumar, S., Vasudeva, N. & Sharma, S., 2012. GC-MS analysis and screening of antidiabetic, antioxidant and hypolipidemic potential of Cinnamomum tamala oil in streptozotocin induced diabetes mellitus in rats. Cardiovasc. Diabetol. 10(11): 138-144.

Luka, C.D. & Habibu, T., 2013. Comparative Studies of the Aqueous Extracts of Ocimum gratissimum, Aloe vera, Brassica

http://www.ncbi.nlm.nih.gov/pubmed?term=Anand%20P%5BAuthor%5D&cauthor=true&cauthor_uid=20363216

http://www.ncbi.nlm.nih.gov/pubmed?term=Murali%20KY%5BAuthor%5D&cauthor=true&cauthor_uid=20363216

http://www.ncbi.nlm.nih.gov/pubmed?term=Tandon%20V%5BAuthor%5D&cauthor=true&cauthor_uid=20363216

http://www.ncbi.nlm.nih.gov/pubmed?term=Murthy%20PS%5BAuthor%5D&cauthor=true&cauthor_uid=20363216

http://www.ncbi.nlm.nih.gov/pubmed?term=Chandra%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20363216

http://www.ncbi.nlm.nih.gov/pubmed/20363216



http://www.ncbi.nlm.nih.gov/pubmed?term=Kumar%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22882757

http://www.ncbi.nlm.nih.gov/pubmed?term=Vasudeva%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22882757

http://www.ncbi.nlm.nih.gov/pubmed?term=Sharma%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22882757


oleracea and Ipomoea batatas on Some Biochemical Parameters in Diabetic Rats. J. Pharm. Biol. Sci. 6(3): 23-29.

Mallick, C., Chatterjee, K., GuhaBiswas, M. & Ghosh, D., 2007. Antihyperglycemic effect of separate and composite extract of root of Musa paradisiaca and leaf of Coccinia indica in streptozotocin-induced diabetic male albino rat. Afr. J. Trad. CAM. 4(3): 362-371.

Manzoor, M., Durrani, M.J. & Ayesha., 2013. Uses of fruits, vegetables and herbs for the treatment of diabetes by the people of Quetta city. Sci. Tech. Dev. 32(1): 24-27.

Mentreddy, S.R., 2007. Medicinal plant species with potential antidiabetic properties. J. Sci. Food Agric. 87(5): 743-750.

Modak, M., Dixit, P., Londhe, J., Ghaskadbi, S., Paul A.T. & Devasagayam., 2007. Indian Herbs and Herbal Drugs Used for the Treatment of Diabetes. J. Clin. Biochem. Nutr. 40: 163-173.

Mohamed, E.A.K., 2011. Antidiabetic, Antihypercholestermic and Antioxidative Effect of Aloe Vera Gel Extract in Alloxan Induced Diabetic Rats. Aust. J. Basic. Appl. Sci. 5(11): 1321-1327.

Neto, M. C. L., Vasconcelos, C. F. B., Thijan, V. N., Caldas, G. F. R., Araujo, A. V., Costa-Silva, J. H., Amorim, E. L. C., Ferreira, F., Oliveira, A. F. M. & Wanderley, A. G., 2013. Evaluation of antihyperglycemic activity of Calotropis procera leaves extract on streptozotocin-induced diabetes in Wistar rats. Bras. J. Farmacogn. 23: 913-919.

Sarasa, D., Sridhar, S. & Prabakaran, E., 2012. Effect Of An Antidiabetic Extract Of Trigonella Foenum - Graecum On Normal And Alloxan Induced Diabetic Mice. Int. J. Pharm. Pharm. Sci. 4(1): 211.

Seshasai, S.R., Kaptoge, S., Thompson, A., Di Angelantonio, E., Gao, P., Sarwar, N., Whincup, P.H., Mukamal, K.J., Gillum, R.F., Holme, I., Njolstad, I., Fletcher, A., Nilsson, P., Lewington, S., Collins, R., Gudnason, V., Thompson, S.G., Sattar, N., Selvin, E., Hu, F.B. & Danesh, J., 2011. Diabetes mellitus, fasting glucose, and risk of cause-specific death. N. Engl. J. Med. 364(9): 829-41.

Subramanian, S., Kumar, D. S. & Arulselvan, P., 2006. Wound healing potential of Aloe vera leaf gel studies in experimental rabbits. Asian J. Biochem. 1(2): 178-185.

Vanitha, M., Pandian, R.S. & Karthikeyan, J., 2013. Evaluation of Aloe vera Gel for its Anti Inflammatory activity in Diabetes Mellitus using Animal Model System. Int. J. Drug Dev. Res. 5(1): 305-309.

Vasconcelos, C. F. B. Maranhao, H. M. L., Batista, T. M. Carnero, E. M. Ferreira, F Costa, J., Soares, L. A. L., Sat, P., Souza, T.P. & Wanderly, A. G., 2011. Hypoglycemic activity and molecular mechanism of Caesalpinia ferrea martis bark extract on streptozotocin-induced diabetes in wistar rats. J. Ethnopharmacol. 137: 1533-1541.


http://onlinelibrary.wiley.com/doi/10.1002/jsfa.v87:5/issuetoc

http://www.ncbi.nlm.nih.gov/pubmed?term=Seshasai%20SR%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaptoge%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Thompson%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Di%20Angelantonio%20E%5BAuthor%5D&cauthor=true&cauthor_uid=21366474



http://www.ncbi.nlm.nih.gov/pubmed?term=Gao%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Sarwar%20N%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Whincup%20PH%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Mukamal%20KJ%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Gillum%20RF%5BAuthor%5D&cauthor=true&cauthor_uid=21366474



http://www.ncbi.nlm.nih.gov/pubmed?term=Holme%20I%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Nj%C3%B8lstad%20I%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Fletcher%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Nilsson%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Lewington%20S%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Collins%20R%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Gudnason%20V%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Thompson%20SG%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Sattar%20N%5BAuthor%5D&cauthor=true&cauthor_uid=21366474



http://www.ncbi.nlm.nih.gov/pubmed?term=Selvin%20E%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Hu%20FB%5BAuthor%5D&cauthor=true&cauthor_uid=21366474

http://www.ncbi.nlm.nih.gov/pubmed?term=Danesh%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21366474



Investigation of in-vitro Anthelmintic Potential of Fruits of some

Ethnobotanically Important Trees of Punjab, Pakistan

*SHAZIA KANWAL MALIK¹, ZAHEER-UD-DIN KHAN² & FARAH KHAN³

1,3,

Department of Botany, LCW University, Lahore, Pakistan, 2 Department of Botany, GC University, Lahore, Pakistan.

ABSTRACT

The current research is the investigation of an ethnopharmacological impact i.e., anthelmintic action of fruits of three traditionally used trees, i.e. Pterospermum acerifolium Linn. Diospyros malabarica Kostel and Putranjiva roxburghii Wall. The crude extracts of fruits were obtained in polar and non-polar solvents i.e., petroleum ether, chloroform, methanol and water and evaluated for their in vitro anthelmintic activity and compared with standard medicine i.e. Levamisole (positive control). The criterion was the apparent mortality of a worm Haemonchus contortus on the visual basis. The aqueous and chloroform fruit extracts of P.acerifolium and petroleum ether extract of D.malabarica demonstrated most noteworthy wormicidal activity (2:00hrs) against H. contortus, while different extract exhibited fluctuated level of potency (3:00 to 4:00 hrs), approximately equal to the standard drug, i.e. Levamisole. Key words: Anthelmintic activity, Haemoncus contortus, Putranjiva roxburghii Wall, Diospyros malabarica

Kostel, Pterospermum acerifolium Linn.

INTRODUCTION

Plants have been a wealth of medications

for human and animal diseases for centuries. Today, 80% of the world population depends on the natural medication. Helminthiasis is a parasitic group causing diseases in animals (Lateef et al., 2006). Use of anthelmintics result into the resistance in helminthes, against anthelmintic compounds and chemical residues. Lateef et al. (2003) has provoked the use of anthelmintic medicinal plants instead of chemicals in present clinical practices. So research in this area is necessary for the search of medicinal plants. The natural compounds of these plants and the right selection for the anthelmintic experiments may open ways for controlling parasitic diseases.

Parasitic nematodes, particularly H. contortus (Rudolphi), is among the most widely recognized reasons for anemia and weight loss in ruminants. Anthelmintic drugs are used to control these parasites. Plant based medication are generally used for the treatment of ruminants. Ademola & Eloff (2010) determined the anthelmintic activity of leaf extract and parts of Combretum molle against H. contortus. Eguale et al.(2007); Fall et al. (2008); Nery et al. (2010); and Ademola & Eloff (2010) investigated anthelmintic activity of various plants like Croton zehntneri, Lippia sidoides, Eucalyptus staigeriana, Allium sativum, and Ficus religiosa against all H. contortus and proved that these plants had anthelmintic activity.

The objective of the present study was to investigate the in vitro anthelmintic activity of

ethnobotanically important angiosperms (P. roxburghii, D. malabarica, P. acerifolium) in comparison with the synthetic anthelmintic drug i.e. Levamisole against, H. contortus.

MATERIAL AND METHODS Fruits of P. roxburghii, D. malabarica, and P. acerifolium were procured from GC University Botanic Garden, Lahore during March to May (2010) and validated by Dr. Zaheer-ud-Khan, GC University, Lahore.

Preparation of Plant extracts

The parts of plants including (fruit, branches, leaves and bark) were dehydrated (21°C) and were pounded to powder, 150g of dehydrated powder was extracted by soaking for 3 days in petroleum ether (40 to 60°C)/chloroform/methanol/distilled water as per Inmaculada et al. (2005). Physical characteristics of dehydrated powder are given in Table I.

Powder, 5 g was dissolved in 0.1 ml of Dimethylsulfoxide according to Rabel et al. (1994) and afterward 9.9 ml Phosphate-buffered saline was added and mixed to get homogenous solution.

In vitro anthelmintic activity (Adult motility assay)

In lab experiments were performed by using extracts on H. contortus, According to Sharma et al. (1971). The worms were picked up with forceps from goat abomasal, washed in Phosphate-

258 S. K. MALIK ET AL BIOLOGIA (PAKISTAN)

buffered saline. 10 worms were taken in petri plates and run in triplicates.

Plant extract = 0.5 mg/ml Levamisole = 0.5 mg/ml (standard prescription) Phosphate-buffered saline + 1 % Dimethylsulfoxide solution = (control)

The movement of worms was observed in the prepared plant extracts. The worms in petri plates were soaked in extracts. Worms with high absorption of extracts became less motile and finally static. Duration of time taken by worms for complete death was determined. These worms were checked for restoration of life by keeping them in Phosphate-buffered saline (37ºC) for 30 minutes.

Data analysis

One-way ANOVA, LSD tests were used, using SPSS 13.0 (statistical software).


Physicochemical examination of fruit extracts (Table I) showed variation in colour, texture and amount of dried compounds. Proteins, Sugars, Lipids, Fiber and Vitamins, Saponins and herbal oils have different solubility rates in different solvents according to thier polarity ratios. Hence they show variations in physicochemical analysis (Gulfraz et al., 2006; Wilfred et al., 2010). These studies will help us in screening of plants and plant parts of natural profitable compounds to be used in preparation of medicines.

Table I: Yield and physical characteristics of fruit extracts of P. acerifolium, D. malabarica and P. roxburghii

The comparative analysis (Table 1, Figs. 1-

6) of in vitro anthelmintic activity of fruits of P.acerifolium, D.malabarica, and P.roxburghii, with reference to Levamisole and control revealed significantly different results. The aqueous and chloroform fruit of P.acerifolium and petroleum ether extract of D.malabarica exhibited high potency i.e.

mortality of worms in 2 hr against H. contortus, while other extracts presented varied degree of potency (3:00 to 4:00 hrs) as that of Levamisole. These results showed that extracts of fruits of trees contained anthelmintic compounds in them (Lateef et al., 2003; Gblolade and Adeyemi, 2008; and Maphosa et al., 2010). These bioactive compounds

Plant name Solvent name Yield (%) Color Physical state

P. acerifolium Petroleum Ether 1.461 Olive Colour Powder

Chloroform 1.492 Green Solid mass

Methanol 1.474 Maroon Oily resinous

Distilled water 1.470 Maroon Solid mass

D. malabarica Petroleum Ether 1.490 Yellowish green Powdery mass

Chloroform 1.494 Olive Colour Gummy resinous

Methanol 0.955 Maroon Resinous

Distilled water 1.360 Maroon Powdery mass

P. roxburghii Petroleum Ether 1.417 Olive Colour Oily resinous

Chloroform 1.470 Yellowish green Powdery mass

Methanol 1.448 Maroon Resinous

Distilled water 1.447 Maroon Gummy resinous

VOL. 61 (2) ANTHELMINTIC POTENTIAL OF FRUITS 259

may have affected the blood circulatory system as vasoconstriction was observed in worms of experimental plates with substantial decrease in reddish pink color to pale yellow that may have finally resulted in the death of worms (Plates 1 & 2). Change in the color of worms (dead) was a sign parameter that showed extracts disseminate transcutaneously into the body of the worms hence

harmed the circulatory system by vasoconstriction. This may be due to the production of free radicals (Cumming et al., 1997) or may be blockage of the transmittance of electrical activity in nerves and muscle cells (Bloomquist, 1996; Bloomquist 2003), or through binding to G-protein coupled receptors called latrophilins (Weinbach & Garbus 1969; Willson et al., 2004).

Plate 1: Living H. contortus Plate 2: Effect of fruit extract on H. contortus

Variations in the anthelmintic movement under the influence of the extracts of fruits of diverse trees, may be because of the distinction in the objectives on the parasites for activity of the compounds, presence of secondary metabolites, qualitative and/or quantitative contrasts in the dynamic standards showed in extracts. Diverse compounds/dynamic standards of extracts may exasperate the ordinary biochemical and physiological procedures prompting starvation,

basic changes, neuromuscular intrusions, and different impacts on helminthes (Kohler, 2001; Mottier et al. 2006).

The result of ANOVA for anthelemintic activity of petroleum ether, chloroform, methanol and aqueous fruit extract of P. acerifolium, D. malabarica and P. roxburghii showed no significant difference at P>0.05 but significant difference was observed during time taken to kill worms (Figs 1 to 6)

Fig., 2: In vitro anthelmintic activity of Levamisole (taken as positive control). From pink color to pale yellow.


Fig., 3: Comparative analysis of in vitro anthelmintic activity of fruit.


VOL. 61 (2) ANTHELMINTIC POTENTIAL OF FRUITS 261



Conclusion and Recommendations

The study not only supports the folk uses of

the crude drugs but also justifies the ethnopharmacological approach in the search for novel bioactive compounds. Nevertheless, this study has exhibited in vitro anthelmintic movement of ethnobotanically important trees. Nonetheless, because of the significant variation in conditions experienced in vivo, as metabolic biotransformation, connection with food material and assimilation, the outcomes acquired by the in vitro technique couldn't

be extrapolated for in vivo action. There is henceforth required that these outcomes ought to be explored by in vivo assessment. Besides there is requirement for institutionalization of dosages and lethality.

REFERENCES

Ademola, I.O. & Eloff, J. N., 2010. In vitro anthelmintic activity of Combretum molle (R. Br. ex G. Don) (Combretaceae) against Haemonchus contortus ova and larvae. Vet. Parasitol., 169(1-2):198-203.


Bloomquist, J.R., 1996. Ion Channels as Targets for Insecticides. Annu. Rev. Entomol., 41:163-190.

Bloomquist, J.R., 2003. Chloride Channels as Tools for Developing Selective Insecticides. Arch Insect Biochem Physiology., 54:145-146.

Cumming, J.N., Ploypradith, P. & Posner, G.H.,

1997. Antimalarial activity of artemisinin

(qinghaosu) and related trioxanes:

mechanism(s) of action. Adv. Pharmacol.,

37:253-297.

Eguale, T., Tilahun, G., Debella, A., Feleke, A. &

Makonnen, E., 2007. In vitro and in vivo

anthelmintic activity of crude extracts of

Coriandrum sativum against Haemonchus

contortus. J. Ethnopharmacol., 110(3):428-

433.

Fall, D., Sambou, B., Seck, M., Wélé, A., Ndoye, I.,

Gleye, C. & Laurens, A., 2008. Enhancing

the anthelminthic activity roots of Annona

sengalensis. Dakar Med., 53(1):61-67.

Gbolade, A. A. & Adeyemi, A.A., 2008. Anthelmintic

activities of three medicinal plants from

Nigeria. Fitoterapia, 79(3): 223-225.

Gulfraz, M., Waheed, A., Mehmood, S. & Ihtisham,

M., 2006. Extraction and Purification of

Various Organic Compounds in Selected

Medicinal Plants of Kotli Sattian, District

Rawalpindi, Pakistan. Ethnobot. Leaflets.,

10:13-23.

Inmaculada, J., De la Rosa, O., Navas-Cortes, J. A.,

Jimenez-Diaz, R. M., and Tena, M. (2005).

“Extracellular xylanases from two

pathogenic races of Fusarium oxysporum f.

sp. Ciceris: Enzyme production in culture

and purification and characterization of

major isoforma as an alkaline endo-β-(1,4)-

xylanase of low molecular weight,” A van

Leeuw. J. Microb. 88(1):48-59.

Kohler, P., 2001. The biochemical basis of

anthelmintic action and resistance. Int. J.

Parasitol., 31:336-345.

Lateef, M., Akhtar, M.S., Ghayur, M.N. & Gilani,

A.H., 2006. In vivo anthelmintic activity of

ginger against gastrointestinal nematodes

of sheep. J. Ethnopharmacol., 106(2):285-

287.

Lateef, M., Zafer, I., Khan, M.N., Akhtar,

M.S. & Jabbar, A., 2003. Anthelmintic

activity of Adhatoda vesica roots. Int. J.

Agri. Biol., 5(1): 86-90.

Maphosa, V., Masika, P.J., Bizimenyera, E.S. &

Eloff, J.N., 2010. In vitro anthelminthic

activity of crude aqueous extracts of Aloe

ferox, Leonotis leonurus and

Elephantorrhiza elephantina against

Haemonchus contortus.Trop. Anim. Health

Prod., 42(2):301-307.

Mottier, L., Alvarez, L., Ceballos, L. & Lanusse, C.,

2006. Drug transport mechanisms in

helminth parasites: Passive diffusion of

benzimidazole anthelmintics. Exp.

Parasitol., 113:49-57.

Nery, P.S., Nogueira, F.A., Martins, E.R. & Duarte,

E.R., 2010. Effects of Anacardium humile

leaf extracts on the development of

gastrointestinal nematode larvae of sheep.

Vet. Parasitol., 171(3-4):361-364.

Rabel, B., Gregor, M.C.R. & Douch, P.G.C., 1994.

Improved bioassay for estimation of

inhibitory effects of ovine gastrointestinal

mucus and anthelmintics on nematode

larval migration. ij for parasitol., 24:671-676.

Sharma, L.D., Bhagra, H.S. & Srivastava,

P.S.,1971. In vitro anthelmintic screening of

indigenous plants against Haemonchus

contortus of sheep and goat. Ind. J. Anim.

Res., 5(1): 33-38.

Weinbach, E.C. & Garbus, J., 1969. Mechanism of

action of reagents that uncouple oxidative

phosphorylation. Nature. 221(5185):1016-

1018.

Wilfred, S., Adubofuor, J. & Oldham, J.H., 2010.

Optimum conditions for expression of oil

from Allanblackia floribunda seeds and

assessing the quality and stability of

pressed and solvent extracted oil. A. J.

Food Sci., 4(9):563–570.

Willson, J., Amliwala, K. & Davis, A., 2004.

Latrotoxin receptor signaling engages the

UNC-13-dependent vesicle-priming

pathway in C. elegans. Curr. Biol.,

14(15):1374-1379.


http://www.sciencedirect.com/science/journal/03788741

../../AppData/Local/Temp/Temp2_biologia.zip/106(2



Effect of Algae and other Food Types on Population Growth of Rotifers

*ABDUL QAYYUM KHAN SULEHRIA1, JOINDA ABRAR

2, ATHAR HUSSAIN SHAH

2

& MUHAMMAD ANWAR MALIK1

1Department of Zoology, GC University, Kachery Road, Lahore, Pakistan. 2Department of Botany, GC University, Kachery Road, Lahore, Pakistan.

ABSTRACT

In the study at hand, two rotifer species namely Brachionus calyciflorus (Pallas) and B. angularis (Gosse) were cultured in the laboratory. Effects of algae (mixed culture) and other foods (Chlorella and bread yeast;

bread yeast and vitamin B12) were investigated on the population growth of these rotifers. The rotifers under study were collected from Balloki Headworks. They were cultured in the laboratory in two culture stations; each having 10 bottles (1/2 litre capacity). Three samples of 1 ml were taken from each bottle in order to estimate the rotifer density. The best growth was depicted by the rotifers reared on mixed algae, on the other hand, lowest population density as well as daily rate of population multiplication was seen with bread yeast and vitamin B12. Positive correlation was found among the three food types in relation to the population densities (Ind/ml) of both species. A similar trend of correlation was observed among the three food types and the rate of population increase of both species. The results of ANOVA showed that there was a statistically significant difference in the population densities of both species, however, there was a non-significant difference in the rate of increase of population of both species. Key words: Rotifer culture; Rotifer growth; Brachionus calyciflorous; B. angularis

INTRODUCTION

Different types of foods have been tried to increase dietary value of rotifers for fish. The purpose of present study was to explore a cheaper and easier source of food for rotifers in order to enhance their dietary value. This is why three food types i.e., i) mixed algae, ii) Chlorella and bread yeast; and iii) bread yeast and vitamin B12 were tried. Rotifers are consumed by fish larvae, crustaceans and certain other animals as first sentient food organism. It is because they are small in size, move slowly and contain all required nutrients (Lubzens et al. 1989, 2001; Arimoro, 2006). Freshwater ornamental fish larvae like brown discus (Symphysodon aequifaciatus axelrodi) and dwarf gourami (Colisa lalia), adequately, use Brachionus calyciflorus as food supply (Lima et al. 2003; Sales & Janssens, 2003).

B. calyciflorus could be utilized proficiently as initial food for burbot, Lota lota (Shiri et al., 2003). This is an excellent piece of information for aquaculturists, who are interested in inland freshwaters (Arimoro & Ofojekwu, 2004). In spite of, modern techniques available for the production of rotifers in bulk (Dhert et al., 2001; Hagiwara et al., 2001), certain difficulties are still faced such as unforeseen inert growth and surprising failure of rotifer culture (Yoshinaga et al. 2001). Rotifers may exhibit cryptic speciation (Schröder & Walsh 2007; Walsh et al., 2009) which means specimens from nearby sites or very far away may look very much

like each other, but they are genetically very different. On the other hand, food supply and its amount is also a vital thing that can affect the rotifer culture (Yoshinaga et al. 2001; Lucia-Pavon-Meza et al. 2005).

A wide range of phytoplankton such as Chlorella, Dunaliella, Isochrysis, Monochrysis, Nannochloropsis, Rhodomonas, and Tetraselmis had been used successfully for culturing rotifers, (Fukusho, 1989; Wilkerson, 2001). Microalgae are used to culture large amounts of rotifers and other zooplankton (Agh and Sorgeloos, 2005).

Microalgae have high concentrations of omega-3 fatty acids which marine fish are unable to synthesize in large quantities (Kanazawa et al., 1979). The rotifers reared either on algae having high levels of EFA (Rainuzzo et al., 1997) or artificial diets having all the essential substances (Park et al., 2006) will be the best initial food for fish fry. Caric et al., (1996) reported that, at the exponential growth phase, the maximum lipid concentration was observed in rotifers fed on Dunaliella tertiolecta, Paeodactylum tricornutum, Nannochloropsis sp., etc.

Freshwater Chlorella vulgaris and Nannochloropsis oculata are now commercially offered in condensed and refrigerated form (Yoshimura, et al., 1996b) as the rotifer cultures are highly stable in large quantities (Fu et al., 1997, Yoshimura et al., 1997a). The most commonly used formulated diet in rotifer cultures is Culture Selco®

264 A. Q. K. SULEHRIA ET AL BIOLOGIA (PAKISTAN)

(CS) (INVE N.V., Belgium) available in a dry form (Agh & Sorgeloos, 2005).

Brachionus calyciflorus and B. patulus (now called Plationus patulus) were reared on either, green alga Chlorella vulgaris, or baker’s yeast (Saccharomyces cerevisiae) or both to study a comparison of their population growth (Sarma et al., 2001). Both rotifer species had higher population growth on algal food. Lucia-Pavon et al., (2001) studied the effect of live and dead Chlorella vulgaris on the population growth of B. calyciflorus and B. patulus. The live algal food proved to be better choice.

The aim of the present study was to compare the growth and survival of two rotifer species B. calyciflorus and B. angularis reared on three different types of foods. Both species were abundantly present in Camp Balloki Lake, at Balloki Head Works, about 65 km from Lahore. These rotifer species were collected and brought to laboratory.


Culture stations of different capacities were devised in order to maintain algae and rotifer cultures in the laboratory (Wilkerson, 1998; Hoff & Snell, 1999).

Tap water was used to culture the algae as it contained phosphates, nitrates and other metals required for the growth of algae. The culture water was sterilized by heating it up to boiling for a few minutes. The pH of algae and rotifer culture was kept in the range of 7.8 – 8.5. In the rotifer cultures, ammonia concentration was maintained below 5 mg/l by replacing water. Temperature was

maintained in the range of 24-28C by using automatic heating system. Water was regularly changed once a week, simply by filtering half of the water through a sieve (30µ mesh size), then replenishing the water with fresh water. Contents of the sieve were washed back into the rotifer container.

Setup for algae culture

A culture station consisting of four 1 gallon bottles (round bottom) was set up to meet out the algal food needs of rotifers. A mixed culture of algae (collected from Balloki Headworks) was established using Micro Algae Grow prepared by Florida Aqua Farms Inc. USA. It is a modified, premeasured, dry Guillard's f/2 (f/2 = 1/2 full strength, full strength is listed as f) fertilizer formula originally described by Guillard & Ryther, (1962); and Guillard, (1975). Water was added to Micro Algae Grow to prepare it.

The culture bottles were marked A, B, C and D. Three ml of Micro Algae Grow was added to each bottle containing tap water. When the colour of water in the bottles became nearly deep green, 2/3 solution of bottle A was harvested and refilled with 2/3 new culture media, next day 2/3 solution of bottle B was harvested and refilled with same amount of new culture media. Similarly 2/3 solution of bottle C and D was removed and refilled on the 3

rd and 4

th days, respectively. Thus 2/3 solution of a

bottle was available to supply the rotifers daily and the remaining 1/3 solution was sufficient to restart the new algal culture and maintain the harvesting cycle.

Similarly a culture station consisting of four 2L bottles (round bottom) was prepared to culture Chlorella only.

Culturing selected rotifers

Two rotifer species, Brachionus calyciflorus and B. angularis were collected from Balloki Head Works and were maintained in lake water for two days. Two culture stations, each, consisting of 10 bottles (1/2 litre capacity) were made to culture rotifer species. Separate setups were arranged for each rotifer species. A set of three bottles was used for each type of food i.e., i) mixed algae; ii) Chlorella and bread yeast; iii) bread yeast and vitamin B12. The 10

th bottle was meant to maintain the balance

of the culture station. Rotifers were introduced in each bottle at a rate of 10 individuals / ml using finely drawn Pasteur pipette. Rotifers of set 1 were fed on mixed culture of algae mainly Nannochloropsis, Chlorella, Tetraselmis. The rotifers of set 2 were fed on Chlorella and bread yeast. The rotifers of set 3 were fed on bread yeast and vitamin B12. Experiment was continued for 15 days for B. calyciflorus and 25 days for B. angularis. Following inoculation, the density of rotifers was estimated daily taking 3 samples of 1 ml from each bottle.

Rotifers were fed at a rate of about 100 cells of algae per individual rotifer for Set 1; about 50 cells of Chlorella and 50 cells of bread yeast per individual rotifer for Set 2 and 100 cells of bread yeast per individual rotifer; and 0.25 g/ml vitamin B12 for Set 3.

Rotifers were fed twice a day, morning and evening. When using algae to feed rotifers it was made sure to use only a medium tint of green in the culture water. Algal cells were counted with the help of an OLYMPUS microscope and haemocytometer (Taylor et al., 1997). The number of rotifers / ml was

VOL. 61 (2) EFFECT OF FOOD TYPES ON GROWTH OF ROTIFERS 265

counted with the help of an OLYMPUS microscope and a Sedgewick-Rafter chamber (APHA, 2005).

Increase in the rate of population (r), was determined on the basis of available data. For this purpose the exponential growth equation was used (Krebs, 1985):

r = (ln Nt- ln No)/t

where, No = initial population density of rotifers, Nt = population density of rotifers after time t (days), r was obtained from a mean of 3 values during the exponential phase of the population growth for each species.

RESULTS

Population growth curves of Brachionus calyciflorus and B. angularis, cultured on three food types are shown in Figs., 1 and 2 while rates of population increase per day of both species are presented in Figs., 3 and 4.

Brachionus calyciflorus

The population density of B. calyciflorus, reared on mixed algae, showed continuous increase for 11 days and then it exhibited fluctuations, being highest on day 13. Rate of population increase per day of B. calyciflorus was high from day 2-7 being the highest (r=0.614) on day 6, then it continuously decreased till the end of experiment (Figs., 1 & 3).

The population density of B. calyciflorus, cultured on Chlorella and bread yeast, continuously increased for first 9 days, being the highest on day 9. Then a decreasing trend was observed up to the end of the experiment. Rate of population increase per day of B. calyciflorus was high from day 3-6 being the highest (r=0.599) on day 3. The rate decreased slightly on day 4 and 5 but again increased on day 6, and then it continuously decreased till the termination of experiment (Figs., 1 & 3).

The population density of B. calyciflorus, cultured on bread yeast and vitamin B12, also continuously increased for first 9 days, being highest on day 9. Then there was a drastic decrease in population density up to the end of the experiment. Rate of population increase per day of B. calyciflorus was the highest (r=0.5) on day 6 and then there was a continuous decrease up to the end of experiment (Figs., 1 & 3).

The best growth was depicted by B. calyciflorus reared on mixed algae, on the other hand, lowest population density as well as daily rate of population multiplication was seen with bread yeast and vitamin B12. Positive correlation was

found among the three food types in relation to the population densities (Ind/ml) of B. calyciflorus. A similar trend of correlation was observed among the three food types and the rate of population increase of B. calyciflorus (Tables I and II). The results of ANOVA showed that there was a statistically significant difference (Table III) in the population densities of B. calyciflorus, however, there was a non-significant difference (Table IV) in the rate of increase of population of B. calyciflorus.

Brachionus angularis

Peak population densities of B. angularis, developed on mixed algae, were observed from day 16 to 19, being the highest on day 18. Rate of population increase per day of B. angularis was high from day 3-5, being the highest (r=0.599) on day 5, then it continuously decreased till the end of experiment (Figs., 2 & 4).

The population density of B. angularis, cultured on Chlorella and bread yeast, continuously increased for 20 days and then it began to decrease continuously. It was maximum on day 20. Rate of population increase per day of B. angularis was high from day 2-4 being the highest (r=0.555) on day 2 and then it continuously decreased till the termination of experiment (Figs., 2 & 4).

The population density of B. angularis, reared on bread yeast and vitamin B12, continuously increased for the first 19 days, being the highest on day 19. Then there was a decrease in population density up to the end of the experiment. Rate of population increase per day of B. angularis was the highest (r=0.519) on day 4 and then there was a continuous decrease till the end of experiment (Figs., 2 & 4).

B. angularis cultured on mixed algae also revealed excellent results while lowest population density and daily rate of population increase was seen with bread yeast as well as vitamin B12. Positive correlation was found among the three food types in relation to the population densities (Ind/ml) of B. angularis. Similarly, positive correlation was observed also among the three food types and the rate of population increase of B. angularis (Tables I and II). The results of ANOVA showed that there was a statistically significant difference (Table V) in the population densities of B. angularis, however, there was a non-significant difference (Table VI) in the rate of increase of population of B. angularis.

http://www.scielo.sa.cr/scielo.php?script=sci_arttext&pid=S0034-77442001000300009&lng=es&nrm=iso#kr85


MA = Mixed algae, CB = Chlorella and Bread yeast, BV = Bread yeast and Vitamin B12 Note: The mean values of population density (Ind./ml) based on three replicate

recordings have been used in the graph.

MA = Mixed algae, CB = Chlorella and Bread yeast, BV = Bread yeast and Vitamin B12

TABLE I: CORRELATION AMONG POPULATION DENSITIES (IND./ML) IN RELATION TO THREE

FOODS Brachionus calyciflorus

Mixed algae

Chlorella & Bread yeast

Chlorella & Bread yeast 0.903626

Bread yeast & Vitamin B12 0.723937 0.941941


Mixed algae





TABLE II: CORRELATION AMONG RATE OF POPULATION INCREASE (R) IN RELATION TO THREE FOODS

Brachionus calyciflorus

Mixed algae





Mixed algae




Table III: Analysis of Variance for population density of Branchionus calyciflorus in relation to three

food types

Source DF SS MS F P

Treatments 2 624803 312401 6.44 0.004 Error 42 2038137 48527 Total 44 2662940

DF=Degree of freedom, SS=Sum of squares, MS=Mean square, F=F-distribution, P=Probability Table IV: Analysis of variance for rate of population increase of Branchionus calyciflorus in relation to

three food types

Source DF SS MS F P

Treatments 2 0.0844 0.0422 1.70 0.194 Error 42 1.0401 0.0248 Total 44 1.1244

DF=Degree of freedom, SS=Sum of squares, MS=Mean square, F=F-distribution, P=Probability Table V: Analysis of variance for population density of Branchionus angularis in relation to three food

types

Source DF SS MS F P

Treatments 2 1958661 979331 10.13 0.000 Error 72 6961762 96691 Total 74 8920423

DF=Degree of freedom, SS=Sum of squares, MS=Mean square, F=F-distribution, P=Probability

Table VI: Analysis of variance for rate of population increase of Branchionus angularis in relation to three food types

Source DF SS MS F P

Treatments 2 0.0293 0.0146 0.73 0.488 Error 72 1.4535 0.0202 Total 74 1.4828

DF=Degree of freedom, SS=Sum of squares, MS=Mean square, F=F-distribution, P=Probability


DISCUSSION

The effect of food types and density on the population growth of zooplankton has been expressed in different studies (Edmondson, 1960; Halbach and Halbach-Keup, 1974). Rotifers are opportunists which respond very quickly to any change in the food types and levels (Nogrady et al., 1993). Rotifers exhibit nearly linear numerical increase with rise in food levels and it has been observed in many rotifer genera of family Brachionidae such as Anuraeopsis (Dumont et al., 1995), Brachionus (Halbach and Halbach-Keup, 1974; Lucia-Pavon, 2001; Sarma, et al., 2001; Peredo-Alvarez, et al., 2003), Keratella (Walz, 1983), and Notholca (May, 1980).

In present the work, both Brachionus calyciflorus and B. angularis reared on mixed algae (mainly Nannochloropsis, Chlorella, Tetraselmis) showed the best results while minimum population densities and rates of population increase per day were observed with bread yeast and vitamin B12. Both the species showed positive correlation among the population densities as well as among the rates of increase of population per day on the three types of foods. Mixed algae are one of the natural and preferred foods of rotifers available in ponds, lakes, rivers etc. There is an increase in reproduction and growth of Brachionus calicyflorus when reared on mixed algae and algivorous ciliates (Agh & Sorgeloos, 2005). Among planktonic rotifers, B. calyciflorus shows maximum growth rates (Bennett & Boraas, 1989). This is also supported by the present work in which B. calyciflorus had shown higher rates of population increase than B. angularis cultured under comparable food types.

The mean maximal population density attained by a particular species of rotifer seems to be related to its body-size. Usually, smaller rotifer species have higher numerical population density per unit volume of medium than larger ones (Sarma, et al., 1999; Lucia-Pavon, et al. 2001). For example, the rotifer Anuraeopsis fissa having body length of nearly 70 µm attained population density more than 9500 ind/ml while under comparable food types, B. calyciflorus having body length of nearly 255 µm attained only 1/10 of this density (Sarma, et al., 1996). Similar results were shown by Lucia-Pavon, et al. (2001) when B. patullus being smaller attained higher population density than B. calyciflorus. The present work was also in accordance with these findings. B. angularis being smaller than B. calicyflorus attained much higher population densities under comparable food types. The r values observed in present work are comparable to

those found in a review of growth rates of specific rotifer species by Sarma et al. (2001).

This study indicated that mixed algae are a better food than the other two foods for these rotifer species.

REFERENCES

Agh, N. & Sorgeloos, P., 2005. Handbook of Protocols and Guidelines for Culture and Enrichment of live food for use in Larviculture. Artemia & Aquatic Animals Research Center, Urmia University, Urmia – Iran. pp:25-41.

APHA (American Public Health Association), 2005. Eaton, A.D., Clesceri, L.S., Rice, E.W., & Greenberg, A.E., (eds). Standard Methods for the Examination of Water and Wastewater. 21

st ed. American Water

Works Association. Water Pollution Control Federation. Washington, D.C. 1368pp.

Arimoro, F.O., 2006. Culture of the freshwater rotifer, Brachionus calyciflorus, and its application in fish larviculture technology. Afr. J. Biotechnol. 5:536-541.

Arimoro, F.O. & Ofojekwu, P.C., 2004. Some aspects of the culture, population dynamics and reproductive rates of the freshwater rotifer, Brachionus calyciflorus fed selected diets. J. Aquat. Sci. 19:95-98.

Bennett, W. N. & Boraas, M. E., 1989. A demographic profile of the fastest growing metazoan: a strain of Brachionus calyciflorus (Rotifera). Oikos. 55:356–369.

Caric, M., Kestemont, P. & Micha, J. C., 1996. Fatty acid profiles of two freshwater fish larvae (gudgeon and perch) reared with Brachionus calyciflorus pallas (rotifer) and /or dry diet. Aquaculture. 110: 141-150.

Dhert, P., Rombaut, G., Suantika, G. & Sorgeloos P., 2001. Advancement of rotifer culture and manipulation techniques in Europe. Aquaculture. 200:129-146.

Dumont, H. J., Sarma, S. S. S. & Ali, A. J. 1995. Laboratory studies on the population dynamics of Anuraeopsis fissa (Rotifera) in relation to food density. Freshwater Biol. 33: 39-46.

Edmondson, W. T., 1960. Reproductive rates of rotifers in natural populations. Mem. Ist. Ital. Idrobiol. 12:21-77.

Fu, Y., Hada, H., Yamashita, T., Yoshida, Y. & Hino,

A., 1997. Development of continuous

culture system for stable mass production of


the marine rotifer Brachionus.

Hydrobiologia. 358: 145-151.

Fukusho, K., 1989. Biology and Mass production of

the rotifer, Brachionus plicatilis for fry

production of marine fishes in Japan.

Symposium International De Aquacultura,

Coquimbo, Chile. pp:361-374.

Guillard, R. R. L., 1975. Culture of phytoplankton for

feeding marine invertebrates. in "Culture of

Marine Invertebrate Animals." (eds: Smith

W. L. and Chanley M. H.) Plenum Press,

New York, USA. pp:26-60.

Guillard, R. R. L. & Ryther, J. H., 1962. Studies of

marine planktonic diatoms. I. Cyclotella

nana Hustedt and Detonula Confervacea

Cleve. Can. J. Microbiol. 8: 229-239.

Hagiwara, A., Gallardo, W.G., Assavaaree, M.,

Kotani, T. & Araujo, A. B., 2001. Live food

production in Japan: recent progress and

future aspects. Aquaculture. 200:111-127.

Halbach, U. & Halbach-Keup, G., 1974. Quantitative

beziehungen zwischen phytoplankton und

der Populationsdynamik des rotators

Brachionus calyciflorus Pallas. Befunde aus

Laboratoriumsexperimenten und

Freilanduntersuchungen. Arch. Hydrobiol.

73: 273-309.

Hoff, F. H. & Snell, T. W., 1999. Plankton Culture

Manual. 5th Rev. Ed. Florida Aqua Farms

Inc. ISBN: 0966296001.

Kanazawa, A., Teshima, S. & Kazuo, O., 1979.

Relationship Between Essential Fatty Acid

Requirements of Aquatic animals and the

Capacity for Bioconversion of Linolenic Acid

to Highly Unsaturated Fatty Acids. Comp.

Biochem. Physiol. 63:295-298.

Krebs, C. J., 1985. Ecology. The experimental

analysis of distribution and abundance.

Harper and Row, New York. 789 p.

Lima, L.C., Dhert, P. & Sorgeloos, P., 2003. Recent

developments in the application of live

feeds in the freshwater ornamental fish

culture. Aquaculture. 227:319-331.

Lubzens, E., Tandler, A. & Minkoff, G., 1989.

Rotifers as food in aquaculture. Hydrobiol.

186/187: 387-400.

Lubzens, E., Zmora, O. & Barr, Y., 2001.

Biotechnology and aquaculture of rotifers.

Hydrobiol. 446/447: 337-353.

Lucia-Pavon, E., Sarma, S. S. S. & Nandini, S.,

2001. Effect of different densities of live and

dead Chlorella vulgaris on the population

growth of rotifers Brachionus calyciflorus

and Brachionus patulus (Rotifera). Rev.

Biol. Trop, Dic. 49(3-4): 895-902.

Lucia-Pavon-Meza, E., Sarma, S.S.S. & Nandini, S.,

2005. Combined effects of algal (Chlorella

vulgaris) food level and temperature on the

demography of Brachionus havanaensis

(Rotifera): a life table study. Hydrobiol.

546:353-360.

May, L., 1980. Studies on the grazing rate of

Notholca squamula Müller on Asterionella

formosa Hass at different temperatures.

Hydrobiologia. 73:79-81

Nogrady, T., Wallace, R. L. & Snell, T. W., 1993.

Rotifera. Vol. 1. Biology, ecology and

systematics. SBP Academic Pub. The

Hague. pp:142.

Park, H. G., Puvanendran, V., Kellett, A., Parrish, C.

C. & Brown, J. A., 2006. Effect of enriched

rotifers on growth, survival and composition

of larval Atlantic cod (Gadus morhua). ICES

Journal of Marine Science: Journal du

Conseil. 63(2):285-295.

Peredo-Alvarez, M., Víctor, Sarma, S. S. S. &

Nandini, S., 2003. Combined effect of

concentrations of algal food (Chlorella

vulgaris) and salt (sodium chloride) on the

population growth of Brachionus calyciflorus

and Brachionus patulus (Rotifera). Rev.

Biol. Trop. 51(2): 399-408.

Rainuzzo J. R., Reitan, K. I. & Olsen, Y., 1997. The

significance of lipids at early stages of

marine fish: a review. Aquaculture.

155:103–115.

Sales, J. & Janssens, G.P.J., 2003. Nutrient

requirements of ornamental fish. Aquat.

Living Resour. 16:533-540.

Sarma, S. S. S., Fernández-Araiza, M.A. & Nandini,

S. 1999. Competition between Brachionus

calyciflorus Pallas and Brachionus patullus

(Müller) (Rotifera) in relation to algal food

concentration and initial population density.

Aquat. Ecol. 33:339-345.

Sarma, S. S. S., Lyer, N. & Dumont, H. J. 1996.

Competitive interactions between

herbivorous rotifers: Importance of food

concentration and initial population density.

Hydrobiologia. 331: 1-7.

Sarma, S. S. S., Susana, Jurado, L. & Nandini, S.,

2001. Effect of three food types on the


population growth of Brachionus calyciflorus

and Brachionus patulus (Rotifera:

Brachionidae). Rev. Biol. Trop. 49(1):77-84.

Schröder, T. & Walsh, E.J. 2007. Cryptic speciation

in the cosmopolitan Ephanes senta complex

(Monogononta: Rotifera) with the

description of new species. Hydrobiologia.

593:129-140.

Shiri, H.A., Charleroy, D.D., Auwerx, J., Vught, I.,

Van Slycken, J., Dhert, P. & Sorgeloos, P.,

2003. Larval rearing of burbot (Lota lota L.)

using Brachionus calyciflorus rotifer as

starter food. J. Appl. Ichthyol. 19:84-87.

Taylor, D. J., Green, N. P. O. & Stout, G. W., 1997.

(Reprinted 2008). Biological Science

(Cambridge low price editions). 3rd

Ed.

Printed in India at Replika Press Pvt. Ltd.,

Kundli 131 028. pp: 387-388.

Walsh, E.J., Schröder, T. Wallacce, R.L. & Rico-

Martinez, R. 2009. Cryptic speciation in

Lecane bulla (Monogononta: Rotifera) in

Chihuanhuan Desert waters.

Verhandlungen Internationale Vereiningung

Limnologie. 30:1046-1050.

Walz, N., 1983. Individual culture and experimental

population dynamics of Keratella cochlearis

(Rotatoria). Hydrobiologia, 107(1):35-45.

DOI: 10.1007/BF00126701.

Wilkerson, J. D., 1998. Clownfishes, Microcosm

Limited; ISBN: 1890087041.

Wilkerson, J. D., 2001. Clownfishes: A Guide to

Their Captive Care, Breeding & Natural

History. Microcosm, T.F.H. Publications

Professional Series, Neptune City, NJ.

Yoshimura, K., Hagiwara, A., Yoshimatsu, T. &

Kitajima, C., 1996b. Culture technology of

marine rotifers and the implication for

intensive culture of marine fish in Japan.

Mar. Freshwater Res. 47:217-222.

Yoshimura, K., Usuki., K., Yoshimatsu, T., Kitajima,

C. & Hagiwara, A., 1997a. Recent

development of a high density mass culture

system for the rotifer Brachionus

rotundiformis Tschugunoff. Hydrobiologia.

358:139-144.

Yoshinaga, T., Hagiwara, A. & Tsukamoto, K., 2001.

Effect of periodical starvation on the survival

of offspring in the rotifer Brachionus

plicatilis. Fisheries Sci., 67:373-374.


https://www.researchgate.net/journal/0018-8158_Hydrobiologia



Morphological and Biochemical Characterization of Bacteria isolated from Milk

Products

*AMNA ALI, NAUREEN AKHTAR, UZMA BASHIR, RAHILA HAFEEZ, & MUHAMMAD SALEEM

HAIDER

Institute of Agricultural Sciences, University of the Punjab, Quaid-e-Azam Campus, Lahore, Pakistan

ABSTRACT

Microorganisms have been handed down from one generation to the next for use in fermented dairy products. In addition some harmful bacteria are also present in dairy products which have detrimental effect on human nature. The diversity of bacterial communities in dairy milk, dry milk, butter and yogurt samples collected from different markets of Lahore Pakistan was evaluated in present study. Lactobacillus sp. was isolated from dairy milk and yogurt while other isolates were identified as Citrobacter freundii, Ralstonia pickettii, Salmonella typhii, Klebsiella pneumoniae, Salmonella gallinarum, Pasteurella sp. (hemolytical type T and A), Shewanella putrefaciens, Acinetobacter jansani and Pantoea sp. and these are possible pathogens of humans that cause infections. All strains were identified on the basis of morphological features and metabolic processes. Maximum numbers of bacterial species were isolated from dry milk (brand A). The results demonstrate that traditional fermented dairy products have diverse range of bacterial species which are harmful for humans. Key words: Identification, dairy products, gram negative, rods

INTRODUCTION

Milk is the basic dairy product and people use it as basic supplement in food stuff. Liquid fresh milk can be utilized in drinking purpose while after processing cheese, cream, butter, yogurt, buttermilk and other products are also used. It is truly an amazing food when it is non-contaminated with any other microorganisms. Conversely, it is a main source for dispersal of food-borne pathogens especially gram-negative bacteria in human life and environment. Moreover, most of the dairy products are unhygienic due to improper processing conditions. Bacteria are ubiquitous in nature and have the ability to colonize a wide variety of substrates (Cleenwerck & Paul, 2008). Identification of bacterial strains is not only valuable for microbiologists but also for people associated with medicines, as control and treatment of the pathogenic bacteria is possible for properly identified strains (Hasibe & Dilek, 2011). In the absence of molecular data, morphological features combined with certain biochemical studies provide sufficient data required to identify the bacterial unknowns (Ali & Naseem, 2012). The goal of present work is to isolate and identify bacteria from different products of dairy sold in Lahore markets and to show the level of prevalence of pathogenic bacteria in dairy products.


Samples Collection

A range of dairy products: dairy milk

(pasteurized specifically in tetra packs or a milk processing by plant), liquid milk (non- pasteurized obtained from milk men), dry milk - brand A (manufactured by local company), dry milk - brand B (product of international company), loose packed butter and yogurt were purchased randomly from selected markets of Lahore. Properly labeled samples, with sample type, collection site, date of collection etc., were transported to the laboratory.

Isolation of bacterial species

Isolations were carried out using the freshly collected samples by pour-plate technique on Luria Bertani Agar (LBA) and Nutrient Agar (NA) media (Ali & Naseem, 2011). The dry samples (butter, yogurt, dry milk) 0.5 gm and liquid sample (liquid milk) 0.5 ml were inoculated on prepared media plates and incubated at 37°C for 3 days under aerobic conditions. Purification was done by streak plate technique, transferred the emerging colonies on fresh media Petriplates under aseptic conditions (Beishir, 1991). Pure bacterial cultures were stored in 20% sterile glycerol at -20°C until further analysis.

Identification of bacterial species

First morphological and cultural features of the bacterial colony/cells were recorded then certain biochemical tests were performed as the routine steps of bacterial identification. Morphological Features: Morphological parameters recorded for identification were cell shape, Gram type, capsule stain, motility and pigmentation. Growth on osmotic medium i.e., containing 2% NaCl

272 A. ALI ET AL BIOLOGIA (PAKISTAN)

was also observed. Finally the ability of bacteria to grow at 25

oC and 40

oC was also studied (Konem et

al., 1997).

Biochemical Analysis

Using the commercially available bacteria identification kit, Microgen-TM GnA+B-ID Identification System (Microgen Bioproducts Ltd, Surrey, UK), pure colonies was differentiated by biochemical test. Initially preference of carbon source of isolated bacteria was analyzed by providing a wide range of carbohydrate sources that include glucose, lactose, sucrose, inositol, sorbitol, mannitol and xylose while sterile water was used as control. Other biochemical analysis included study of enzymatically catalyzed metabolic reactions such as citrate, Indole, Methyl red, nitrate reductase, oxidase, catalase, urease, malonate and gelatinase, hydrogen sulphide, arginine and lysine (Holt et al., 2000; Benson, 1996). Bacteria were identified by providing the results of all above mentioned biochemical tests to Microgen Identification System software.


In nutrition balancing science, dairy products can play a definite and important role. Therefore dairy products should be raw and preferably certified. This cross-sectional study of Gram-negative and Gram-positive staining bacterial contamination of milk meant for human consumption was carried out in some areas of Lahore, Pakistan. Milk sampling points included smallholder’s milk producers, dairy co-operatives, a milk processing plant, and supermarkets. The hygienic procedures applied during milking, milk collection, transportation, pasteurization, and post-pasteurization storage conditions in these specified dairy products were evaluated. Standard bacteriological cultivation and biochemical assays were used to isolate and identify bacterial pathogens in the milk samples. During present study, a total of thirteen different bacterial species were isolated from various sources of dairy products (Table I). Percentage occurrence of each species was calculated. However maximum percentage of bacterial species was obtained, six from dry milk (brand A), two species from dry milk (brand B) and butter whereas one species was isolated from dairy milk, liquid milk and yogurt each (Figure 1). Thirteen bacterial were isolated; 2 Gram-positive bacteria

and 11 Gram negative. Each isolate was given a reference number (DP1 - DP13) that was used throughout this study to represent the results of that particular bacterium.

Table I: Detail of the substrates used to isolate

the bacterial strains.

Sample No. Substrate

S1 Dairy milk S2 Dry milk (Brand A) S3 Dry milk (Brand B) S4 Liquid milk

S5 Butter

S6 Yogurt

All the strains studied for this present work were rod-shaped except DP1 and DP13 Gram negative bacteria, likewise all strains were unable to produce pigment except DP12. Furthermore only DP12 managed to grow at 25°C although all strains showed similar pattern of growth at 37°C. Only DP6 and DP7 were capsulated. Data recorded while studying the morphology of bacteria is presented in Table II. Naturally different bacterial strains have different metabolic path ways (Sathishkumar et al., 2008). Result demonstrated that all isolates gave positive results with the carbohydrates (glucose) except DP3 and DP7. In addition, DP1, DP2 and DP13 had the ability to ferment lactose also while others did not. Isolate DP2 exhibited positive result with inositol among all species. Bacteria are referred to as individuals or groups based on their patterns of growth under various chemical (nutritional) or physical conditions. Like all other living organisms, different groups of bacteria utilize different sources of energy to generate ATP, required for their maintenance and reproduction. Most of the bacteria use monosaccharides, for example glucose, as energy source while few prefer disaccharides or polysaccharides (Richard et al., 2011). Furthermore, Fish (2002) reported that bacteria frequently secrete chemicals into their environment in order to modify it favorably and these secretions are often proteins and may act as enzymes that digest some form of food in the environment. Therefore, each species of pathogen has a characteristic spectrum of interactions with its human hosts. Capacity of different bacterial strains to use various carbon compounds as energy source is summarized in Table III.

http://en.wikipedia.org/wiki/Secretion

http://en.wikipedia.org/wiki/Host_(biology)

VOL. 61 (2) BACTERIA FROM MILK PRODUCTS 273

Table II: Morphological and cultural features of bacteria studied.

Strain No.

Gram type

Capsule stain

Motility Pigment Growth on 2% NaCl

Growth at 25

oC

Growth at 40

oC

DP1 + - + - - - + DP2 - - + - - - + DP3 - - + - - - - DP4 - - - - - - + DP5 - - + - - - + DP6 - + - - + - + DP7 - + - - - - + DP8 - - - - - - + DP9 - - - - - - + DP10 - - + - + - + DP11 - - - - + - + DP12 - - + + + + - DP13 + - + - - - +

Table III: Carbohydrate source preference analysis of bacterial isolates.

Strain No. Glucose Lactose Sucrose Inositol Sorbitol Mannitol Xylose

DP1 + + + - - - + DP2 + + + + + + + DP3 - - - - - - - DP4 + - - - - - - DP5 + - + - + + + DP6 + - - - - - - DP7 - - - - - - - DP8 + - + - - + + DP9 + - - - - - - DP10 + - - - + - - DP11 + - - - - - + DP12 + - + - - + + DP13 + + + - - - +

Biochemical tests actually exhibit the ability of an enzyme to utilize different substrates. Such ability can be assessed by the presence of products in a biochemical reaction. Results of these tests help in

identification of bacteria (Harley, 2008). Enzymatic activities of bacterial isolates are tabulated in Table IV.

Table IV: Enzymatic activities of bacterial isolates.

Biochemical test

Reference Strain No.

DP1 DP2 DP3 DP4 DP5 DP6 DP7 DP8 DP9 DP10 DP11 DP12 DP13

Citrate - + - - + - - + - - - + - Indole - - - - - - - - - - - - - Methyl red + - - - + - - + - - - - + Nitrate reductase

- + - + + + - + + + + - -

Oxidase - - - + - - + - + + - - - Catalase - + + + + + - + + + + + - Urease - - - - - + - - - - - - - Malonate - - - - - - - + - - - + - Gelatinase - - - - - - - - - - - - H2S - - - - + - + + - - - - - Lysine - - - - + + - + - - - - - Arginine - - - - - - - - - - - - -


Fig., 1: Percentage of Bacterial Strains Isolated from each Sample of Dairy products The identification of bacteria is essential in

microbiology by various aspects (Nitesh et al., 2011). Identification was made by using the Microgen Identification System software. Cultural and biochemical data recorded for the isolates (Table I-IV) was entered in the software to key out the unknown bacteria. Lactobacillus sp. (n=2), Citrobacter freundii (n=1), Ralstonia pickettii (n=1), Salmonella typhii (n=1), Klebsiella pneumonia (n=1), Salmonella gallinarum (n=1), Pasteurella sp.

(hemolytical type T) (n=2), Pasteurella sp. (hemolytical type A ) (n=1), Shewanella putrefaciens (n=1), Acinetobacter jansani (n=1) and Pantoea sp. (n=1) were the identified species. Identified bacterial species were deposited in First Fungal Culture Bank of Pakistan (FCBP). All species versus their reference no as well as their FCBP accession numbers are given in Table V. Occurrence of each bacterial strain in each sample is also shown in Figure 2.

Table V: Bacterial species identified from dairy products

Sr. No. Substrate Ref. No. of Strain Species Identified FCBP accession No.

S1 Dairy milk DP1 Lactobacillus sp. FCBP004

S2 Dry milk (Brand A)

DP2 C. freundii FCBP063

DP3 R. pickettii FCBP065 DP5 S. typhii FCBP067 DP6 K. pneumoniae FCBP068 DP8 S. gallinarum FCBP073

DP9 Pasteurella sp. (hemolytical type T)

FCBP078

S3 Dry milk (Brand B)

DP4 Pasteurella sp. (hemolytical type T)

FCBP066

DP10 Pasteurella sp. (hemolytical type A)

FCBP079

S4 Liquid milk DP7 S. putrefaciens FCBP071 S5 Butter DP11 A. jansani FCBP090

DP12 Pantoea sp. FCBP100 S6 Yogurt DP13 Lactobacillus sp. FCBP139

0

10

20

30

40

50

Dairy milk Dry milk

(Brand A)

Dry milk

(Brand B),

Butter Yogurt Liquid milk

Dairy Products

% o

f B

acte

ria

l sp

ecie

s


Fig., 2: Occurrence of Bacterial Strains in various Sample of Dairy products

Ranadheera et al. (2012) revealed that some beneficial bacteria were used in multiple sectors i.e., industry (Lactobacillus sp. in food, plant and dairy fermentation) and agriculture (Lactobacillus spp. as probiotic microorganism, Azotobacter sp. as nitrifying agent, Pseudomonas sp. as phosphate solubilizing agent). Results of Wang et al. (2008) and Duskoval et al. (2012) studies were similar to recent findings of bacterial isolation from dairy product. Furthermore, it shows that it is possible for dairy products to be contaminated with pathogenic bacteria. This implies that attention should be given to sanitary behavior of food handlers. These pathogenic organisms release toxins, which are the agents responsible for illnesses such as diarrhea, dysentery, nausea and vomiting, caused by these organisms upon consumption of the contaminated foods (Okolie et al., 2012). Unfortunately, even quite small numbers of microbes can grow quickly into dangerous hordes when products are not properly stored. The findings of this study have confirmed that pathogenic bacteria can exist in dairy products even though they may physically appear to be quite wholesome; thus, proper steps should be taken to ensure that the occurrence of such organisms in products is kept within limits (Okolie et al., 2012).

In addition present results also highlighted that most of the sampled dairy milk was collected

under unclean environmental conditions and poor preparation. Therefore, early study of Connor & Charles (Connor & Charles, 1995) was also focused on contamination in raw milk from soil, manure and soiled bedding as well as direct contact with fecal material during milking. Milk contains important nutritional components for bacterial growth, and, therefore, it is also an ideal medium for the growth of many different bacteria. Temperature plays an important role in bacterial growth. Many bacteria prefer to grow at high temperature. As we know dry milk is usually stored at room temperature while liquid milk at cold temperature that’s why highest percentage of bacteria was isolated from dry milk (brand A) as compared to liquid milk. Further findings of Champagne et al. (1994) and Jayaroo & Wang (1999) about untreated water used in equipment cleaning process, hands of milk producer or improper udder preparation before milking were main source of bacterial contamination in milk and that might hold true in this study. Moreover, it is necessary that the equipment be washed using detergents then with cold water to remove as much previous milk and dirt as possible followed by washing with warm water to remove fatty deposits. Afterwards, the equipment has to be washed again with warm water and stored in a clean, dry and dust free area (Robinson, 2002). Different bacterial species isolated from the Dry milk (brand A) were coliform bacteria including, K. pneumoniae, S.

Lactobacillus sp.

C. freundii

R. pickettii

S. typhii

K. pneumoniae

S. putrefaciens

S.gallinarum

Pasteurella sp.

(type A)

A. jansani

Pantoea sp.

Pasteurella sp.

(type T)


gallinarum and S. typhii with frequency of 7.69%. It has previously reported that dominant Gram-negative staining bacteria isolated from raw milk of bulk tank milk were Escherichia coli and Pseudomonas aeruginosa species (Khan et al., 2008). Therefore these findings are similar to our results. Additionally frequencies of bacterial isolation observed in present investigation are also in agreement with the studies performed to assess bacteriological quality of raw milk in Ethiopia (Tassew & Seifu, 2011). On the contrary, the additional bacterial species isolated as Acinetobacter sp., Pantoea sp. and Citrobacter sp. which were not isolated previously might be attributed to higher environmental contamination during transportation and/or contamination during waiting along the roadside. Such kind of results indicates that there are weaknesses in milk transportation and processing. Ashenafi & Beyene (1994) indicated that all microorganisms are not killed by pasteurization especially when their number is very high in raw milk. Therefore, it is suggested that pasteurized milk should not be kept at room temperature for days.

Recommendations

It is hereby recommended that routine microbial analysis of dairy products sold at public places be carried out to prevent outbreak of human diseases. Also appropriate handling and hygienic practices should be ensured by product vendors in markets. Furthermore, product handlers should be educated on appropriate storage temperature for processed products. This kind of study should also be conducted in other areas of Pakistan so as to provide a comprehensive data for the local government public health section.

REFERENCES

Ali, A. & Naseem, F., 2011. Isolation, cultivation,

purification and identification of bacterial species from microfauna of soil. Ital. J. Public Health, 8(1): 34-39.

Ali, A. & Naseem, F., 2012. Frequency distribution of bacteria isolated from different industrial effluents. Daffodil Int. Uni. J. Sci. Technol., 7(1): 28-33.

Ashenafi, M. & Beyene, F., 1994. Microbial Load, Microflora and Keeping Quality of Raw and Pasteurized Milk from Dairy Farm. Bull. Animal Health Product. Africa, 42: 55-59.

Beishir, L., 1991. Microbiology in Practice: A Self-Instructional Laboratory Course, Fifth Edition. (Harper Collins: New York). 1991. pp: 123-345.

Benson, H.J., 1996. Microbiological applications, laboratory manual in general microbiology. W. M.C. Brown Publishers, Dubuque, U.S.A.

Champagne, C.P., Laing, R.R., Roy, D., Maffu A.A. & Griffiths, M.W., 1994. Psychrotrphs in Dairy Products, and Their Effect and Their Control in Chocolate Milk. J. Food Sci., 34: 1-30.

Cleenwerck, I. & Paul, D.V., 2008. Polyphasic taxonomy of acetic acid bacteria: An overview of the currently applied methodology. Int. J. Food Microbiol., 125(1): 2-14.

Connor, O. & Charles, B., 1995. Rural Dairy Technology, Training Manual 1. Addis Ababa, Ethiopia: International Livestock Research Institute (ILRI). pp: 56-80.

Duskoval, M., Katerina, O.S., Zbynek Z. & Renata, K., 2012. Identification of lactobacilli isolated from food by genotypic methods and MALDI-TOF MS. Int. J. Food Microbiol., 159: 107-114.

Fish, D., 2002. Optimal antimicrobial therapy for sepsis. American J. Health Sys. Pharm., 59(11): 13-9.

Harley, J.P., 2008. Laboratory Exercises in Microbiology (7th ed.). New York, New York, United States of America: McGraw-Hill Companies. pp: 345-789.

Hasibe, C.V. & Dilek, O., 2011. An improving DNA isolation method for identification of anaerobic bacteria in human colostrum and faeces samples. J. Medical Gene. Genomics, 3(5): 95-100.

Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley J.T. & Stanley, T.W., 2000. Bergey’s manual of determinative bacteriology. 9

th ed.,

Lippincott Williams and Wilkins, New York, USA.

Jayaroo, B.M. & Wang, L., 1999. A Study on the Prevalence of Gram-negative Bacteria in Buck Tank Milk, South Dakota Agriculture Experimental Station. J. Dairy Sci., 82: 21-27.

Khan, M.T., Zinnah, M.A., Siddique, M.P., Rashid, M.H., Islam, M.A. & Choudhury, K.A., 2008. Physical and Microbial Qualities of Raw milk Collected from Bangladesh Agricultural University, Dairy Farm and the Surrounding Villages. Bangladesh J. Veter. Medicine, 6: 217-221.

Konem, E.W., Allen, S.D., Janda, W.M, Schreckenberger P.C. & Winn, W.C., 1997. Atlas and textbook of diagonistic microbiology. 5th ed. Lippincott Williams

http://dx.doi.org/10.1016/j.ijfoodmicro.2007.04.017







and Wilkins, 530 Walnut street, Philadelphia, PA 19106-3621 USA. pp: 56-78.

Nitesh, R.A.I., Ludwig, W. & Schleifer, K.H., 2011. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev., 59(1): 143-169.

Okolie, N.P., Omonigbehin, E., Badru, O.A. & Akande, I.S., 2012. Isolation of pathogenic bacteria from some foods sold at selected private schools in Akoka area of Yaba–Lagos, Nigeria. African J. Food Sci., 6(3): 65-69.

Ranadheera, C.C.S., Evans, C.A., Adams, M.C. & Baines, S.K., 2012. Probiotic viability and physico-chemical and sensory properties of plain and stirred fruit yogurts made from goat's milk. Food Chem., 135(3): 1411-8.

Richard, J.D., Bovi, A., Smits M. & Harry, S., 2011. Rapid Method for the Determination of Total Monosaccharide in Enterobacter Cloacae Strains Using Fourier Transform Infrared Spectroscopy. American J. Analytical Chem., 2: 212-216.

Robinson, R.K., 2002. Dairy Microbiology

Handbook: The Microbiology of Milk and Milk Products. 3rd edition. USA: John Wiley and Sons, Inc. pp: 51-305.

Sathishkumar, M., Raj, B., Sang, B. & Sei-Eok, Y., 2008. Biodegradation of Crude Oil by Individual Bacterial Strains and a Mixed Bacterial Consortium Isolated from Hydrocarbon Contaminated Areas. Cleaning, 36(1): 92-96.

Tassew, A. & Seifu, E., 2011. Microbial Quality of Raw Cow’s Milk Collected from Farmers and Dairy Cooperatives in Bahir Dar Zuria and Mecha District, Ethiopia. Agri. Bio. J. America, 2(1): 29-33.

Wang, J., Chen, X., Liu, W., Yang M. & Zhang, H., 2008. Identification of Lactobacillus from koumiss by conventional and molecular methods. Europ. Food Res. Technol., 227: 1555-1561.




First report of Scorpion Envenomization in District Sargodha, Punjab, Pakistan

MUHAMMAD MOHSIN AHSAN, *HAFIZ MUHAMMAD TAHIR & JAFAR AQEEL NAQI

Department of Zoology, University of Sargodha, Sargodha, Pakistan.

ABSTRACT

Scorpion envenomization is a worldwide problem and causes a broad range of clinical manifestations. Present study was planned to record the epidemiology of scorpion bites in urban and rural areas of District Sargodha, Punjab, Pakistan. Data were collected during February, 2013 to March, 2015. Information, such as age of victim, gender, stinging time, stinging sites in the body, symptoms after scorpion sting, number of victims receiving treatment and number of deaths (if any) was recorded. Results of the study revealed that scorpion envenomization is common in the age groups ranging from 16 - 45 years. Female victims (52%) were slightly more than males (48%). Most (57.39%) of the incidents of scorpion bites occurred between 7 PM and 2 AM. On the body of the studied victims, hands (41.10%) and feet (48.28%) were more prone to scorpion stings. Scorpion sting cases were higher (77%) in rural areas than in urban (23%) areas. The common symptoms recorded after scorpion bites included pain, restlessness, hypertension, sweating, tachycardia, vomiting or nausea, pallor, dehydration, semi-consciousness, face shock and allergy. Only 56.05% of the total victims received treatment either from the doctors or traditional healers. Scorpion envenomization was found to be positively correlated with high temperature, humidity and rain fall. These environmental conditions are predicted to be conducive for population growth of scorpions and their abundance.

Key words: scorpions, envenomization, stings, scorpionism.

INTRODUCTION

Scorpions are the most venomous

arachnids (Gomes et al., 2010). There are approximately 2000 described species of scorpions (Rein, 2012) including 50 species that are dangerous due to their neurotoxic venoms (Chowel et al., 2006; Shirmardi et al., 2010). Scorpion bites cause high lethality throughout the world, especially in tropical and sub-tropical countries (Bawaskar & Bawaskar, 2012; Kassiri et al., 2012; Rafizadeh et al., 2013). More than one million scorpion stings and approximately 3250 deaths have been reported worldwide in one year (Ozkan et al., 2006). Risk of scorpion bite is more in semi-desert areas due to high scorpion population (Dehghani & Fathi, 2012). Scorpion sting is universally characterized by severe pain, with or without local tissue damage; severity is also dependent on the scorpion species that introduce the neurotoxic venom into the victim (Luca & Meier, 1995). Symptoms of scorpion bite also depend upon the amount of venom that is delivered by scorpion, size and age of the victims and the season in which scorpion bites (Gueron & Yaron, 1970).

Most of the incidents of scorpion bites occur at night due to their nocturnal feeding habit. Mostly the victims do not require hospitalization or extensive medical care (Otero et al., 2004, Forrester & Stanely, 2004). Climatic conditions, such as

humidity, heat and dryness are the risk factors of scorpion bites (Chowell et al., 2005). At present, epidemiology of scorpion bites is poorly studied in the world (Ismial, 1995).

Scorpion envenomization is a real threat to humans in many parts of the world, but fragmented studies have been conducted in countries like Tunisia (Goyffon et al., 1982), Iran (Radmanesh, 1990), Morocco (Touloun et al., 2001), Brazil (Lourenço & Cuellar, 1995) and Mexico (Velasco-castegon, 1976). In tropical and subtropical countries incidents of scorpion sting are more common compared to other part of the world and lethality is higher in children than in adults (Ismial, 1995).

Although scorpion bites are common in Pakistan, especially in dry and sandy areas, so far no recorded data on scorpion bites (published or unpublished) are available. Most victims do not seek proper medical treatment and rely mostly on spiritual treatment from holy persons or contact traditional healers. In view of the above facts, the present study was designed to provide first documentary record of specific epidemiological aspects of scorpionism in District Sargodha,Punjab, Pakistan.


The study was conducted in District Sargodha, (Latitude 32.05°; Longitude

280 M. M. AHSAN ET AL BIOLOGIA (PAKISTAN)

72.67°; Elevation, 187 m) Punjab, Pakistan. Epidemiological survey for scorpion stings was conducted from February, 2013 to March, 2015. During the survey data were collected from rural health centers, rural dispensaries and directly from the victims. For the data collection, Sargodha city and 14 nearby villages (i.e., Bhagtanwala (Chowki bhagat), Chak # 34 SB, Chak # 76 SB, Mateela, Chak # 58 SB, Chak # 48 NB, Chak # 81 SB, Chak # 75 SB, Dodha, Chak # 88 SB, Chak # 46 SB, Mangnee, Chak # 69SB and Chak # 40SB) were randomly selected. Victims were divided into four age categories, i.e., category I (1 - 15 years), category II (16 - 30 years), category III (31 - 45 years) and category IV (46 and above). A questionnaire was prepared to record the information regarding the age of victim, gender, stinging time, stinging location on the body, symptoms after scorpion sting (i.e., severity of pain, vomiting, allergy, skin colour change, restlessness, tachycardia, dehydration and hypertension), number of victims who received treatments, number of deaths (if any) and the month of scorpion sting. Histograms of the collected data were prepared using MS-Excel (2003). Chi-square test and Pearson’s correlation was performed to analyse the collected data and Minitab (version14) was used for the statistical analyses.

RESULTS

In total, data of 669 victims were collected

during the study period of 26 months. Of the total victims, 322 (48%) were male and 347(52%) were female (Fig., 1). Figure 2 depicts that most of the victims were in the age range of 16 - 45 years. It is evident from Figure 3 that most of the scorpion sting (57.39%) incidents occurred from 7 PM to 2 AM. It was also recorded during the study that most of the people suffered from scorpion bites on hands (41.10%) and feet (48.28%) (Fig., 4), while other parts of their body were less prone to scorpion bites (10.46%). People of rural areas were more affected from scorpion bites (77%) than those inhabiting urban areas (23%) (Fig., 5).

All victims reported pain after scorpion sting that ranged from mild to severe (Fig., 6). Other common symptoms were restlessness (37.81%), hypertension (26.30%), sweating (21.22%), tachycardia (18.83%), vomiting or nausea (17.63%), pallor (15.24%), dehydration (15.09%), semi-consciousness (11.21%), face shock (10.31%) and allergy (9.26%), Out of the total victims, 56.05% contacted the doctors or traditional healers for the treatment. However, the remaining (43.94%) got

healed without any treatment. No case of death was recoded during the study period due to scorpion bites. Incidence of scorpion stings was higher between the months of May to September (Fig., 7). Only few cases of scorpion stings were recoded from October to March. Number of scorpion bites were positively correlated with the prevailing air temperature (Pearson’s correlation = 0.77; P = 0.003), rainfall (Pearson’s correlation = 0.75; P = 0.005) and relative humidity (Pearson’s correlation = 0.72; P = 0.003).

Fig., 1: Number of males and female victims recorded from February, 2013 to March, 2015.

Note: Similar alphabets on the bars are indicating non-significant difference

Fig., 2: Incidences of scorpion’s envenomization among different age groups.

Note: Different alphabets on the bars are indicating significant difference.

DISCUSSION

Scorpion envenomization is a serious but

neglected issue in many parts of the world particularly in the Middle East, Africa, Mexico, South America and the Indian sub-continent (WHO, 2007). Exact information about scorpion envenomization is poor because most of the victims do not seek medical treatment, however, millions of people face

VOL. 61 (2) SCORPION ENVENOMIZATION IN DISTRICT SARGODHA 281

Fig., 3: Scorpions biting during different time periods. Note: Different alphabets on the bars are indicating significant difference.

Fig., 4: Human body parts vulnerable to scorpion bites.

Note: Different alphabets on the bars are indicating significant difference.

Fig., 5: Comparison of scorpion envenomization in urban and rural areas. Note: Different alphabets on the bars are indicating significant difference.


Fig., 6: Profile of common symptoms in patients after scorpion bite(s).

Fig., 7: Seasonal dynamics of scorpion envenomization (February 2013 to March 2015).

scorpion sting every year. Approximately 250,000 victims face scorpion sting in Mexico annually. About 400,000 victims are reported in Tunisia annually, with 1000 admissions in hospitals and 100 deaths every year. Likewise, high numbers of scorpion sting accidents are reported each year from other part of the world including the Middle East, Latin America, and the Indian subcontinent (WHO, 2007).

Our results showed gender based difference in frequency of scorpion bites. Females encountered scorpion bites more frequently (52%) than males (48%). In rural areas of district Sargodha, females are at greater risk of scorpion stings as they are more exposed as compared to the males while working in the fields. Results are in accordance with the findings of Karami et al. (2013) and Vazirianzadeh et al. (2008). They also reported higher incidents of scorpion stings in females. But our results are contradictory to the findings of Al-sadoon and Jarrar (2003) and Jarrar and Al-rowaily, (2008). They worked in Saudi Arabia and reported that the victims of scorpion bites were more males than females. Higher incidents of scorpion bites

reported among females in rural areas during our study might be due to their more involvement in indoors domestic activities. Our results of greater rates of scorpion bites among the people in the age ranging between 16 - 45 years, is in accordance to conclusion of Karami et al. (2013), Dehghani et al. (2010), Emam et al. (2008) and Ghaderi et al. (2006). These workers had also reported that most of victims of scorpion bites were more than 15 years old.

Our study showed that most of scorpion stings were on hands (41.10%) and feet (48.28%). This finding was not unusual as feet and hands are the body parts which are more exposed than the rest of the body and are mostly used in activities. Results of our study are in agreement with findings of many other researchers (Kassiri et al., 2014, Isbister et al., 2003, Ozkan et al., 2006). These authors also reported more scorpion bites on hand and foot areas.

The frequency of scorpion stings showed that most of the victims (77%) were from rural areas. This might be due to the reason that the scorpion genus Mesobuthus dominates in the area


(unpublished data) and is perhaps more involved in biting humans. The most preferable habitats of scorpions are wood logs, rocks, stone cracks, or in burrows dug beneath the loose layer of substrates (Polis, 1990). Similarly, cracks or crevices of old muddy houses in rural areas are also favourable habitat for scorpion of the genus Mesobuthus. Our results are in agreement with those of Pourrezai et al. (2010) and Karami et al. (2013); however, the results of Vazirianzadeh et al. (2008) are contradictory to our results as these authors had reported that scorpion envenomization is an urban problem in Khuzestan, Iran. This could be due to the type of scorpion species perhaps inhabiting primarily urban settings.

No death was recorded during the present study due to scorpion bite before or after the bite and subsequent treatment. Similar results were reported by Vaziriznzadeh et al. (2012) and Kassiri et al. (2012) in the scorpion bite victims in Khuzistan, Iran, but Karami et al. (2013) reported seven death cases due to scorpion bites in Ramhormoz, South-West of Iran. Similarly, about 10 deaths occur in Tunisia every year due to scorpion bites (Abroug et al., 1999, Bahloul et al., 2004). These results are contradictory to present study and the reasons for this could be species difference of biting scorpions, age of victims, body size of victims, and time of the year of scorpion bite in the particular area where deaths occurred. In present study different types of symptoms, such as pain, vomiting, allergy, pallor, restlessness, dehydration, and cardiovascular effects like tachycardia, and hypertension were observed among the patients of scorpion bites Bawaskar and Bawaskar, (2012), Bahloul et al. (2010), Ismial, (1995) and Khattabi et al. (2011) also reported similar symptoms among patients of scorpion bites in their studies.

Although 56.05% of the total victims received medical treatment from the local hospitals or dispensaries, no specific treatment for scorpion bites was available for the patients in the study area. Some types of anti-inflammatory (Pheniramine maleate, Dexamethasone) and analgesic (Paracetamol) drugs were administered to victims as first aid. In a similar study in Morocco, Touloun et al. (2001) reported that only 28% of the total victims were treated with modern medicines alone. They further elaborated that most of the patients were treated exclusively with the traditional medicines and 7% victims did not received any treatment.

In the present study, most incidences of scorpion bites were observed during warmer months, i.e., May to September. Similar results were

noted by Cesaretli and Ozkan, (2010), Chowell et al. (2005), Kassiri et al. (2012), Kassiri et al. (2013), Ozkan and Kat, (2005), Ozkan et al. (2006). Scorpions remain active during summer season under high relative humidity and air temperature (Kassiri et al., 2013). Furthermore, populations of scorpions were also higher during these months which might be the possible explanation of higher scorpion stung in these months. Conclusions

It is concluded from this study that scorpion envenomization is a common problem in the study area. Although no death related to scorpion bite was recorded, scorpion sting is highly painful and can cause a variety of clinical manifestations that may lead to serious complications. It is, therefore, suggested that detailed survey of scorpion envenomization should be conducted. Furthermore, scorpion bite awareness programmes from pre-school to higher level, especially in rural areas be introduced to minimize the cases of scorpion bites.

REFERENCES

Abroug, F., Elatrous, S., Nouira, S., Haguiga, H.,

Touzi, N. & Bouchoucha, S., 1999.

Serotherapy in scorpion envenomation: a

randomized controlled trial. Lancet., 354:

906-909.

Al-sadoon, M.K. & Jarrar, B.M., 2003.

Epidemiological study of scorpion stings in

Saudi Arabia between 1993 and 1997. J.

Venom. Anim. Toxins include. trop. Dis., 9:

54-64.

Bahloul, M., Ben-hamida, C., Chtourou, K., Ksibi,

H., Dammak, H., Kallel, H., Chaari,

A., Chelly, H., Guermazi, F., Rekik, N.

& Bouaziz, M., 2004. Evidence of

myocardial ischemia in severe scorpion

envenomation: ‘‘myocardial perfusion

scintigraphy study’’. Intensive Care Med.,

30: 461-467.

Bahloul, M., Chabchoub, .I, Chaari, A., Chatara, K.,

Jallel, H., Dammak, H., Ksibi, H., Chelly, H.,

Rekik, N., Ben-hamida, C. & Bouaziz, M.,

2010. Scorpion envenomation among

children: clinical manifestations and

outcome (analysis of 685 cases). Am. J.

Trop. Med. Hyg., 83: 1084-1092.


Bawaskar, H. S. & Bawaskar, P.H., 2012. Scorpion

sting: update. J. Assoc. Physicians India.,

60: 46-55.

Cesaretli, Y. & Ozkan, O., 2010. Scorpion stings in

Turkey: epidemiological and clinical aspects

between the years 1995 and 2004. Rev.

Inst. Med. Trop. Sao. Paulo., 52(4): 215-

220.

Chowell, G., Hyman, J. M., Diaz-duenas, P. &

Hengartner, N. W., 2006. Epidemiological

and clinical characteristics of scorpionism in

Colima, Mexico (2000-2001). Toxico., 20: 1-

6.

Chowell, G., Hyman, J.M., Diaz-duenas, P. &

Hengartner, N.W., 2005. Predicting

scorpion sting incidence in an endemic

region using climatological variables. Int. J.

Environ. Health. Res., 15: 425-435.

Dehghani, R. & Fathi, B., 2012. Scorpion sting in

Iran: a review. Toxicon, 60: 919-933.

Dehghni, R., Vazirianzadeh, B., Nasrabadi, M. R. &

Moravvej, S.A., 2010. Study of scorpionism

in Kashan in central of Iran. Pak. J. Med.

Sci., 26: 955-958.

Emam, S.J., Khosravi, A.D. & Alemohammad, A.,

2008. Evaluation of hematological and urine

parameters in Hemiscorpius lepturus

(Gadim) victims referred to Razi Hospital,

Ahwaz, Iran. J. Medi Sci., 8(3): 306-309.

Forrester, M.B. & Stanley S.K., 2004. Epidemiology

of scorpion envenomations in Texas. Vet.

Hum. Toxicol ., 46: 219-221.

Ghaderi, H., Shariat, Z., Ghodoosi, A. & Ziyaee, M.,

2006. Scorpion bites in the north-western of

Khuzestan province from May 2002 to

December 2003. Hayat, 12(2): 73-78.

Gomes, A., Bhattacharjee, P., Mishra, R., Biswas,

A. K., Dasgupta, S. C. & Giri, B., 2010.

Anticancer potential of animal venoms and

toxins. Indian, J. Exp. Biol., 48: 93-103.

Goyffon, M., Vachon, M. & Broglio, N., 1982.

Epidemiological and clinical characteristics

of the scorpion envenomation in Tunisia.

Toxicon, 20(1): 337-344.

Gueron, M. & Yaron, R., 1970. Cardiovascular

manifestations of severe scorpion sting.

Clinicopathologic correlations. Chest,

57:156-162.

Isbister., G.K., Volschenk, E.S., Balit, C.R. &

Harvey, M.S., 2003. Australian scorpion

stings: a prospective study of definite stings.

Toxicon, 41(7): 877-883.

Ismail, M., 1995. The scorpion envenoming

syndrome. Toxicon. 33: 825-858.

Jarrar, B.M. & Al-rowaily, M.A., 2008.

Epidemiological aspects of scorpion stings

in Al-Jouf Province, Saudi Arabia. Ann.

Saudi. Med., 28: 183-187.

Karami, K., Vazirianzadeh, B., Mashhadi, E.,

Hossienzadeh, M. & Moravvej, S.A., 2013.

A Five Year Epidemiologic Study on

Scorpion Stings in Ramhormoz, South-West

of Iran. Pak. J. Zool., 45(2): 469-474.

Kassiri, H., Feizhaddad, M. & Abdehpanah, M.,

2014. Morbidity, surveillance and

epidemiology of scorpion sting, cutaneous

leishmaniasis and pediculosis capitis in

Bandar-mahshahr County, Southwestern

Iran. J. Acute Dise., 194-200. doi:

10.1016/S2221-6189(14)60043-3.

Kassiri, H., Mahijan, N.M., Hasanvand, Z.,

Shemshad, M. & Shemshad, K., 2012.

Epidemiological survey on scorpion sting

envenomation in South-West, Zahedan

Iran. J. Res. Med. Sci., 14(8): 80-83.

Kassiri, H., Shemshad, K., Kassiri, A., Shemshad,

M., Valipor., A. & Teimori, A., 2013.

Epidemiological and Climatological Factors

Influencing on Scorpion Envenoming in

Baghmalek County, Iran. Academic J.

Entomol., 6 (2): 47-54.

Khattabi, A., Soulaymani –bancheikh, R., Achour, S.

& Salmi, L., 2011. Classification of clinical

consequences of scorpion sting: consensus

development. Trans. Roy. Soc. Trop. Med.

Hyg.,105: 364-69.

Lourenço, W.R. & Cuellar, O., 1995. Scorpions,

scorpionism, life history strategiesand

parthenogenesis. J. Venom. Anim. Toxins,

1: 51-62.

Luca, S.M. & Meier, J., 1995. Biology and

distribution of scorpions of medical

importance. In Meier, J., White, J. (Eds.),

Clinical Toxicology of Animal Venoms and

Poisons, 1. CRC Press, Boca Raton, pp.

205-219.


Otero, R., Navio, E., Cespedes, F., Nunez, M.J.,

Lozano, L. & Moscoso, E.R., 2004.

Scorpion envenoming in two regions of

Colombia: clinical, epidemiological and

therapeutic aspects. Trans. R. Soc. Trop.

Med. Hyg., 98: 742-750.

Ozkan, O. & Kat. I., 2005. Mesobuthus eupeus

scorpionism in Sanliurfa region of Turkey. J.

Venom. Anim. Toxins. Incl. Trop. Dis., 11:

479-491.

Ozkan, O., Adigüzel, S., Yakiştiran, S., Cesaretli, Y.,

Orman, M. & Karaer, K.Z., 2006.

Androctonus crassicauda (Olivier 1807)

scorpionism in the Sanliurfa provinces of

Turkey. Turkiye. Parazitol. Derg., 30(3):

239-245.

Polis, G. A., 1990. The Biology of Scorpions.

Stanford University Press. ISBN 978-0-8047

12491.

Pourrezai, S., Hossieni, A., Vazirianzadeh, B. &

Gardani, H. A., 2010. Study on some

epidemiologic parameters among scorpion

stung people who referred to Ramshir

Health Centre, SW Iran, 2007- 2009. 7th

National and 2nd Regional Congress of

Parasitology and Parasitic Diseases in Iran,

Tehran. 481 pp.

Radmanesh, M., 1990. Clinical study of

Hemiscorpius lepturus in Iran. Am. J. trop.

Med. Hyg., 93: 327-332.

Rafizadeh, S. Rafinejad, J. & Rassi, Y., 2013.

Epidemiology of scorpionism in Iran during

2009. J. Arthropod. Borne. Dis., 7: 66-70.

Rein, J. O. 2012. The scorpion files. Norwegian

University of Science and Technology.

http://www.ntnu.no/ub/scorpion-files/.

Shirmardi, S. P., Gandomakar, M., Shamsaei, M.,

Mirakabadi, A. Z., Maragheh, M. G., Shafiei,

M. & Vahidfar, N., 2010. Prepration and

biodistributation study of 99m Tc-labeled

toxic fraction of Iranian Mesobuthus eupeus

scorpion venom. Iran J. Nucl. Med., 18: 37-

44.

Touloun, O., Slimani, T. and Boumezzough, A.,

2001. Epidemiological survey of scorpion

envenomation in Southwestern Morocco. J.

Venom. Anim. Toxins., 7: 199-218.

Vazirianzadeh, B., Hajihosseini, R., Amiri, B. &

Bagheri, S., 2008. Epidemiological study of

scorpionism in the hospitals of Ahvaz, SW

Iran. J. Hlth. Sci., Ahvaz Joundi Shapour

University of Medical Sciences, 2: 17-25.

Vaziriznzadeh, B., Farhadpour, F, Hosseinzadeh,

M., Zarean, M. & Moravvej, S.A., 2012. An

epidemiological and clinical study on

scorpionism in hospitalized children in

Khuzistan Iran. J. Arthropod-Borne Dis.,

6(1): 62-69.

Velasco-castrejon, O., Lara-cguilera, R. & Alatorre,

H., 1976. Aspectos epidemiologicos y

clinicos de la picadura de alacran en una

area hiperendemica. Rev. Invest. Salud

Publica., 36: 93-103.

World Health Organization: 2007. Rabies and envenoming: a neglected public health issue: report of a consultative meeting. Geneva: World Health Organization. ISBN 978 92 4 156348 2.


http://www.ntnu.no/ub/scorpion-files/



Quantitative Profiling of Plasma Protein Fractions in Preeclamptic and

Normotensive Pregnant Women

AASIA SHARIF, *NABILA ROOHI, & YASMIN ASHRAF

Department of Zoology, University of the Punjab, Lahore Pakistan

ABSTRACT

Present study was aimed to investigate electrophoretically separated plasma protein profile of preeclamptic (n=30) and normotensive pregnant women (n=30). The plasma proteins were determined through SDS-PAGE in distinct bands. The protein fractions were quantified using Total Lab Quant software (version 1.0.8) and band percentages of the fractions were calculated and analyzed statistically by Student t-test using Graph Pad Prism (version 5.0). Twelve protein fractions were detected ranging from 250-15 kilodalton (kDa). Significant elevation (p=0.0001) was observed in 250, 173, 131 and 114kDa protein fractions whereas, significant reduction (p=0.0001) in 76 and 66kDa protein fractions was observed when compared in preeclamptic and normotensive pregnant women. However, no significant variations were observed in 90, 59, 51, 25, 18 and 15kDa protein fractions in both the groups. Plasma protein profile, suggests that these six protein fractions have potent linkages to the biology of preeclampsia. Key words: Preeclampsia; Electrophoresis; Proteins; SDS-PAGE

_______________________________________________________________________________________

INTRODUCTION

Preeclampsia (PE) is a relatively common hypertensive disorder of pregnancy that occurs on or after the 20th week of gestation in previously healthy women and is defined as the occurrence of hypertension and significant proteinuria (Eiland et al., 2012). While the etiology is unclear, the placenta is the origin of PE and it releases factors into maternal circulation to induce systemic endothelial dysfunction (Wong & Cox, 2014).

Researchers have discovered that PE is a multi-systemic disorder with complex pathophysiological changes, such as inflammatory response, endothelial dysfunction, activated coagulation system and metabolic changes (Roberts & Lain, 2002). Babies born to preeclamptic mothers are also affected; one third are born preterm, 20% are growth restricted, and evidence indicates that there may be an increase of three- to ten-fold in perinatal deaths (Sibai, 2005; Ferrazzani, et al., 2011).

Fifty one proteins have been identified that are differentially expressed between severe PE women and healthy pregnant women during the third trimester (Liu et al., 2011). HDL associated proteins, SERPINF1, alpha-2-HS-glycoprotein, transthyretin and Retinol binding protein 4, have also been identified and differentially expressed between PE and normal pregnant women (Potter & Nestel, 1979). Fibronectin was found to be up-regulated in the sera of pregnant women complicated with PE, which is known as important

biomarker for the evaluation of endothelial damage in PE (Shaarawy & Didy, 1996). In pregnancy with PE, the free iron and ceruloplasmin concentrations were statistically significantly high as compared to normal pregnant ones (Hameed and Wasan, 2013). Serum C-reactive protein (CRP) levels in mild and severe PE were distinctly higher than those of normal pregnant women in third trimester of pregnancy. Albumin was found to be lower in women with severe PE (Benoit & Rey, 2011). When PE is accompanied by proteinuria there is a remarkable fall in albumin and an increase in alpha (2) macroglobulin level (Horne et al., 1970). Studies have shown that the expression levels of these proteins are increased or decreased according to the disorder and its degree in PE (Baumann et al., 2007).

Currently preeclampsia is diagnosed from clinical observations that occur late in the disease process. Unknown factors possibly released by the preeclamptic placenta into the maternal circulation have been associated with the pathophysiological changes that are characteristic of the disorder. It is generally believed that the pathophysiological changes occurring in preeclampsia may result from the abnormal expression of some proteins.

Aim of the present study was to assess the effects of PE on plasma protein profile of preeclamptic women and comparing with those of normotensive pregnant women by comparing SDS-PAGE technique. For this purpose, high and low molecular weight protein profiles were brought under observation to relate the fluctuations in

http://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20C%5Bauth%5D

https://www.google.com.pk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&cad=rja&uact=8&ved=0CCEQFjAB&url=http%3A%2F%2Fen.wikipedia.org%2Fwiki%2FAlpha-2-HS-glycoprotein&ei=DGNsVY3YAcX1UJL-g0g&usg=AFQjCNGL1fW5bLfogZWVWYeQr9Om8iXr1Q&bvm=bv.94455598,d.ZGU

https://www.google.com.pk/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&cad=rja&uact=8&ved=0CBsQFjAA&url=http%3A%2F%2Fen.wikipedia.org%2Fwiki%2FRetinol_binding_protein_4&ei=t2JsVd_SOov3Uua8gNgG&usg=AFQjCNGVCPWdUGyJxchaUiUkI9OaFlU_nQ&bvm=bv.94455598,d.ZGU

http://www.ncbi.nlm.nih.gov/pubmed/?term=Benoit%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21923989

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rey%20%C3%89%5BAuthor%5D&cauthor=true&cauthor_uid=21923989

288 A. SHARIF ET AL BIOLOGIA (PAKISTAN)

different protein fractions with various health risks in preeclamptic women.


Blood samples (5 ml) of preeclamptic patients (n=30) were collected from Jinnah and General Hospitals of city and age matched healthy normotensive pregnant females from local population. The average age of subjects was 18-40 years and they were between 29–40 weeks of gestation. Written informed consent was taken from each subject prior to the study. Each woman was interviewed (history–taking) and examined for the signs and symptoms of preeclampsia.

Polyacrylamide gel of 12 % and 6% were prepared, for analysis of low and high molecular weight protein fractions, respectively. Protein concentrations were determined by Bradford Assay (Bradford, 1976). Plasma samples were diluted by distilled water and loading dye and then proteins were denatured by heating for two minutes in the boiling water bath before loading onto the gel. Protein marker and equal concentration of each of the plasma samples were loaded in separate wells. The gel was electrophoresed at a current supply of 30 mA and 200 V, in a cooling chamber maintained at 4°C until the dye reached the lower end of the gel. After overnight fixation, gel was stained with coomassie blue for 1 hour with constant agitation and destained afterwards until clear background appeared and protein fractions became visible in the forms of blue colored bands.

Stained gels were scanned for quantification. Total Lab Quant was used for the quantification of separated protein fractions. It provided the data of molecular weight and density covered by each fraction. The band percentage shown by each protein fraction was recorded. The data were analyzed using Student t-test and employed in finding the augmentation or decrease and appearance or disappearance of particular protein fractions for comparison between the control and preeclamptic subjects.

RESULTS

Variations in the plasma protein fractions of preeclamptic patients were considerable when compared to control subjects. An overall comparison of plasma protein profiles of both control and patient groups indicated the expression of twelve protein fractions ranging between 250-15kDa (Table 1). Protein fractions of 250, 173, 131

and 114kDa showed significant increase (p=0.0001), whereas 76 and 66kDa protein fractions indicated a significant decrease (p=0.0001) in preeclamptic patients compared to control subjects. However, no significant variations were observed in 90, 59, 51, 25, 18 and 15kDa protein fractions in both the groups (Table I, Fig., 1 and 2).

Fig., 1: Photographs showing electrophoretically resolved low molecular weight plasma protein

fractions in distinct bands in control subjects (C) and preeclamptic group (PE). M= Protein markers with

known molecular weight in kilodaltons.

Fig., 2: Photograph showing electrophoretically resolved high molecular weight plasma protein

fractions in distinct bands in control subjects (C) and preeclamptic group (PE). M= Protein markers with

known molecular weight in kilodaltons.

VOL. 61 (2) QUANTITATIVE PROFILING OF PLASMA PROTEIN 289

Table I: Average percent raw volumes exhibited by different protein fractions in normotensive and preeclamptic patients. Values are Mean ± SEM.

Molecular weight of proteins (kDa)

Average band percentage of protein fractions

Percentage difference of protein fractions in Preeclamptic group

Control Group

Preeclamptic Group Percentage increase or decrease

p-Value

250 3.34 ± 0.13 5.13 ± 0.21 53.39*** ↑ 0.0001

173 7.15 ± 0.19 13.09 ± 0.55 83.13*** ↑ 0.0001

131 5.01 ± 0.08 6.65 ± 0.27 32.80*** ↑ 0.0001

114 3.73 ± 0.12 5.89 ± 0.18 57.94***↑ 0.0001

90 3.88 ± 0.10 3.61 ± 0.12 6.83 ↓ 0.0989

76 20.65 ± 0.69 13.72 ± 0.57 33.55***↓ 0.0001

66 35.97 ± 0.29 26.73 ± 0.87 25.68***↓ 0.0001

59 7.56± 0.26 8.46 ± 0.39 11.89 ↑ 0.0604

51 7.26 ± 0.27 7.79 ± 0.38 7.27 ↑ 0.2602

25 15.22 ± 0.41 14.56 ± 0.34 4.33 ↓ 0.2235

18 1.94 ± 0.12 2.05 ± 0.14 5.68 ↑ 0.5602

15 1.31 ± 0.09 1.25 ± 0.11 4.73 ↓ 0.6531

↓ Decrease, ↑ Increase, *** Significant at p<0.001 SEM: standard error of estimation

DISCUSSION

In present investigation, the protein profile of normotensive control and preeclamptic patients was studied by SDS-PAGE. The protein fractions ranged between 250-15kDa. The various protein fractions observed included 250 kDa fibronectin (Yang et al., 2009), 173 kDa α-2-macroglobulin (Kim et al., 2013), 131 kDa ceruloplasmin (Castellani et al., 1999), 114 kDa C-reactive protein (Jinbo et al., 1998), 76 kDa transferrin (Jiang et al., 1998) and 66 kDa albumin (Allen et al., 2006). Significant elevation in 250, 173, 131 and 114kDa protein fractions was observed. Whereas, in 76 and 66kDa protein fractions, significantly reduced expression was observed.

Protein fraction of 250kDa reported as fibronectin was found to be increased by 53.39% in preeclamptic patients as compared to controls. Fibronectin plasma levels increase after major trauma resulting in vascular tissue damage, after inflammation, and in diseases such as ischaemic heart disease, stroke and atherosclerosis, (Peters et al., 2003; Claudepierre et al., 1999). Liu et al. (2011) reported that up-regulation of fibronectin is known as an important biomarker for the estimation of endothelial damage in preeclampsia (Shaarawy & Didy, 1996). Fibronectin up-regulation also indicates atherogenesis of the arteriole.

Protein fraction of 173kDa reported as α-2-macroglobulin was found to be increased by 83.13% in preeclamptic patients as compared to controls. α-2-macroglobulin (A2M) is a protease inhibitor in mammals (Armstrong, 2006). When preeclampsia is accompanied by proteinuria then there is a distinct decrease in albumin and an increase in α2-macroglobulin (Horne et al., 1970).

Protein fraction of 131kda reported as ceruloplasmin, was found to be increased by 32.80% in preeclamptic patients as compared to controls. Ceruloplasmin, a glycoprotein in human plasma, has shown significant elevation in mild and severe PE group as compared to control group (Shamsi et al., 2010). Ceruloplasmin is an antioxidant due to its acute phase reactant property, whose elevated concentration is observed in infection, inflammation, trauma, etc (Vassiliev et al., 2005). Aksoy et al. (2003) also found that the plasma antioxidant potential was reduced and ceruloplasmin level was increased compared to normal pregnant women. Ceruloplasmin has central roles in iron metabolism and antioxidant defense (Samokyszyn et al., 1989). Ceruloplasmin blocks the production of toxic oxygen compounds and protects cells from oxidative stress (Healy & Tipton et al., 2007).

Protein fraction of 114kDa was found to be increased by 57.94% in preeclamptic patients as


compared to normotensive control. C - reactive protein, a marker of tissue damage and inflammation, plays an important role in eliciting the inflammatory response that is characteristics of preeclampsia (Ustun et al., 2005). Kumru et al. (2006) observed a negative correlation between serum CRP and length and weight of the newborns in the PE group compared with the control group. CRP level is increased during inflammatory response to tissue injury or infection (Braekke et al., 2005). Erren et al. (1999) had reported that inflammatory profile was more definite when the endothelial damage was more advanced. It is well known that renal dysfunction usually occurs in PE, especially in its severe forms. In cases of renal dysfunction, endothelial dysfunction and increased levels of inflammatory markers such as CRP have been more obvious.

Protein fraction of 76 kDa in our studies was found to be lowered in preeclamptic subjects by 33.55% as compared to control. Transferrin is an iron-binding blood plasma glycoprotein that controls the level of free iron in biological fluids. In physiological and pathological conditions, important alterations of plasma serotransferrin concentration are observed (Inoue et al., 1993). Transferrin levels of the severe and mild preeclampsia groups were found to be reduced as compared to controls (Aksoy et al., 2003). A decreased plasma transferrin can occur in iron overload diseases and protein malnutrition.

The 66 kDa protein fraction was found to be declined by 25.68% in our study. In preeclampsia, hypoalbuminemia secondary to hypovolemia is caused by reduced hepatic blood flow. Thus, hypoalbuminemia can be recognized as an early mark in developing preeclampsia. Serum albumin levels may act as an indicator of the severity of preeclampsia (Gojnic et al., 2004). If serum albumin level is below 2.5 g/dL, the risks of ascites, perinatal mortality and hemolysis elevated liver enzymes low platelet (HELLP) syndrome are increased markedly (Seong et al., 2010). Most of the hypoalbuminemia cases are caused by acute and chronic inflammatory responses. When plasma proteins, especially albumin, no longer retain abundant colloid osmotic pressure to balance hydrostatic pressure, edema develops. Serum albumin level serves as an important predictive indicator and decreased serum albumin levels associate with an increased risk of morbidity and mortality. Moreover, decreased albumin level is frequently obvious in patients with cancer, liver ailments and sepsis (Ballmer et al., 1993; Pasanisi et al., 2001; Ruot et al., 2000).

Conclusively, up-regulation and down-regulation of different protein fractions are attributed to risk of different diseases. Such as the up-regulation of 250kDa indicates risk factor for atherogenesis of the arteriole, which results in hypoxia and ischemia in preeclampsia. Moreover, the up- regulation of protein fraction of 173kDa is the marker for nephrotic syndrome. The up-regulation of 131kda which is a marker of allergic asthma. The up-regulation of 114kDa, in present study, is correlated positively and significantly with diastolic blood pressure and proteinuria. Maternal CRP values also correlate negatively and significantly with fetal weight at birth. The down-regulation of 76kDa protein fraction is a risk factor for bladder cancer, while the depletion of 66kDa is a marker of liver and cardiac ailments. These Six candidate protein fractions have potent linkages to the biology of preeclampsia. However, given the low power of the present 1D study, a follow-up proteomic study was conducted using the 2D technique. 2D will give us more comprehensive understanding about preeclampsia.

REFRENCES

Aksoy, H., Taysi, S., Altinkaynak, K., Bakan,

E., Bakan, N. & Kumtepe, Y., 2003. Antioxidant potential and transferrin, ceruloplasmin, and lipid peroxidation levels in women with preeclampsia. J. Investig. Med., 51(5): 284-187.

Allen, L., Rodgers, P. D., Mensah, S. L. & Schwager, D., 2006. Inhibition of calcium oxalate crystallization by commercial human serum albumin and human urinary albumin isolated from two different race groups: evidence for possible molecular differences. Urol. Res., 34: 373-380.

Armstrong, P. B., 2006. Proteases and protease inhibitors: a balance of activities in host-pathogen interaction. Immunobiology, 211: 263–281.

Ballmer, P. E., Walshe, D., Mcnurlan, M. A., Watson, H., Brunt, P.W. & Garlick, P. J., 1993. Albumin synthesis rates in cirrhosis: correlation with child-Turcotte classification. Hepatology, 18: 292-297.

Baumann, M. U., Bersinger, N. A. & Surbek, D. V., 2007. Serum markers for predicting pre-eclampsia. Mol. Aspects. Med., 28: 227-244.

Benoit, J. & Rey, E., 2011. Preeclampsia: should plasma albumin level be a criterion for severity? J. Obstet. Gynaecol. Can., 33(9): 922-926.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Aksoy%20H%5BAuthor%5D&cauthor=true&cauthor_uid=14577518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Taysi%20S%5BAuthor%5D&cauthor=true&cauthor_uid=14577518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Altinkaynak%20K%5BAuthor%5D&cauthor=true&cauthor_uid=14577518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bakan%20E%5BAuthor%5D&cauthor=true&cauthor_uid=14577518



http://www.ncbi.nlm.nih.gov/pubmed/?term=Bakan%20N%5BAuthor%5D&cauthor=true&cauthor_uid=14577518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kumtepe%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=14577518


http://www.ncbi.nlm.nih.gov/pubmed/?term=Benoit%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21923989

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rey%20%C3%89%5BAuthor%5D&cauthor=true&cauthor_uid=21923989


VOL. 61 (2) QUANTITATIVE PROFILING OF PLASMA PROTEIN 291

Bradford, M., 1976. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem., 72: 248-254.

Braekke, K., Holthe, M. R., Harsem, N. K., Fagerhol, M. K. & Staff, A. C., 2005. Calprotectin, a marker of inflammation, is elevated in the maternal but not in the fetal circulation in preeclampsia. Am. J. Obstet. Gynecol., 193(1): 227-233.

Castellani, R. J., Smith, M. A., Nunomura, A., Harris, P. L. R. & Perry, G., 1999. Is increased redox-active iron in Alzheimer disease a failure of the copper-binding protein ceruloplasmin? Free Rad. Biol. Med., 26: 1508-1512.

Claudepierre, P., Allanore, Y., Belec, L., Larget, B., Zardi, L. & Chevalier, X., 1999. Increased Ed-B fibronectin plasma levels in spondyloarthropathies: comparison with rheumatoid arthritis patients and a healthy population. Rheumatology, 38: 1099-1103.

Eiland, E., Nzerue, C. & Faulkner, M. 2012. Preeclampsia. J. Pregnancy, 586578.

Erren, M., Reinecke, H., Junker, R., Fobker, M., Schulte, H. & Schurek, J. O., 1999. Systemic inflammatory parameters in patients with atherosclerosis of the coronary and peripheral arteries. Arterioscler. Thromb. Vasc. Biol., 19(10):2355-2363.

Ferrazzani, S., Luciano, R. & Garofalo, R., 2011. Neonatal outcome in hypertensive disorders of pregnancy. Early Hum. Dev., 87(6): 445–449.

Gojnic, M., Petkovic, S., Papic, M., Mostic, T., Jeremic, K., Vilendecic, Z. & Djordjevic, S., 2004. Plasma albumin level as an indicator of severity of preeclampsia. Clin. Exp. Obstet. Gynecol., 31(3):209-210.

Hameed, R. M. & Wasan, G. H., 2013. Total Iron Binding Capacity (TIBC), free Iron, Ceruloplasmin,Transferrin and ferritin concentration, in pregnant women with pre-eclampsia. Mag. Al-Kufa Uni. boil., 5(2).

Healy, J. & Tipton, K., 2007. Ceruloplasmin and what it might do. J. Neural. Transm., 114: 777–781.

Horne, C. H. W., Howie, P. W. & Goudie, R. B., 1970. Serum alpha2-macroglobulin, transferrin, albumin, and IgG levels in preeclampsia. J. Clin. Pathol., 23(6): 514–516.

Inoue, T., Cavanaugh, P. G., Steck, P. A., Brunner, N. & Nicolson, G. L., 1993. Differences in transferrin response and numbers of transferrin receptors in rat and human

mammary carcinoma lines of different metastatic potentials. J. Cell Physiol., 156: 212-217.

Jiang, S., Ho, M., Jiang, S. & Chen, H., 1998. Purified NADPH-sulfite reductase from saccharomyces cerevisiae effects on quality of ozonated macherel surimi. J. Food Sci., 63: 777-781.

Jinbo, T., Hayashi, S., Naiki, M. & Yamamoto, S., 1998. Development of C-reactive protein (CRP) assays methods. Vet. Immunol. Immunopath., 61: 195-205.

Kim, J. H., Kim, Y. W., Kim, I. W., Park, D. C., Kim., Y. W., Lee, K. H., Jang, C. K. & Ahn, W. S., 2013. Identification of candidate biomarkers using the Experion automated electrophoresis system in serum samples from ovarian cancer patients. Int. J. Oncol., 42(4): 1257-1262.

Kumru, S., Godekmerdan, A., Kutlu, S. & Ozcan, Z., 2006. Correlation of maternal serum high-sensitive C-reactive protein levels with biochemical and clinical parameters in preeclampsia. Eur. J. Obstet. Gynecol. Reprod. Biol., 124(2): 164-167.

Liu, C., Zhang, N., Yu, H., Chen, Y., Liang, Y., Deng, H. & Zhang, Z., 2011. Proteomic Analysis of Human Serum for Finding Pathogenic Factors and Potential Biomarkers in Preeclampsia. Placenta, 32(2): 168–174.

Pasanisi, F., Orban, A. & Scalfi, L., 2001. Predictors of survival in terminal-cancer patients with irreversible bowel obstruction receiving home parenteral nutrition. Nutrition, 17: 581-584.

Peters, J. H., Loredo, G. A., Chen, G., Maunder, R., Hahn, T. J., Willits, N. H. & Hynes, R. O., 2003. Plasma levels of fibronectin bearing the alternatively spliced EIIIB segment are increased after major trauma. J. Lab. Clin. Med., 141: 401-410.

Potter, J. M. & Nestel, P. J., 1979. The hyperlipidemia of pregnancy in normal and complicated pregnancies. Am. J. Obstet. Gynecol., 133:165–170.

Roberts, J. M. & Lain, K. Y., 2002. Recent insights into the pathogenesis of pre-eclampsia. Placenta, 23: 359–372.

Ruot, B., Breuille, D., Rambourdin, F., Bayle, G., Capitan, P. & Obled, C., 2000. Synthesis rate of plasma albumin is a good indicator of liver albumin synthesis in sepsis, Am. J. Physiol. Endocrinol. Metabol., 279: 244-251.

Samokyszyn, V. M., Miller, D. M., Reif, D. W. & Aust, S. D., 1989. Inhibition of superoxide and ferritin-dependent lipid peroxidation by ceruloplasmin. J. Biol. Chem., 264: 21–26.

http://dx.doi.org/10.1155%2F2012%2F586578

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gojnic%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15491066

http://www.ncbi.nlm.nih.gov/pubmed/?term=Petkovic%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15491066

http://www.ncbi.nlm.nih.gov/pubmed/?term=Papic%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15491066

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mostic%20T%5BAuthor%5D&cauthor=true&cauthor_uid=15491066



http://www.ncbi.nlm.nih.gov/pubmed/?term=Jeremic%20K%5BAuthor%5D&cauthor=true&cauthor_uid=15491066

http://www.ncbi.nlm.nih.gov/pubmed/?term=Vilendecic%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=15491066

http://www.ncbi.nlm.nih.gov/pubmed/?term=Djordjevic%20S%5BAuthor%5D&cauthor=true&cauthor_uid=15491066






http://www.ncbi.nlm.nih.gov/pubmed/?term=Horne%20CH%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Howie%20PW%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Goudie%20RB%5Bauth%5D


http://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20C%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zhang%20N%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yu%20H%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Chen%20Y%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Liang%20Y%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Deng%20H%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zhang%20Z%5Bauth%5D


Seong, W. J., Chong, G. O., Hong, D. G., Lee, T. H., Lee, Y. S., Cho, Y. L., Chun, S. S. & Park, I. S., 2010. Clinical significance of serum albumin level in pregnancy-related hypertension. J. Obstet. Gynaecol. Res., 36(6): 1165-1173.

Shaarawy, M. & Didy, H. E., 1996. Thrombomodulin, plasminogen activator inhibitor type 1 (PAI-1) and fibronectin as biomarkers of endothelial damage in preeclampsia and eclampsia. Int. J. Gynaecol. Obstet., 55(2):135–139.

Shamsi, A. Z., Shakour, S. L. & Rashtchi, Z. N., 2010. Serum level and antioxidant activity of ceruloplasmin in preeclampsia. Pak. J. Biol. Sci., 13: 621–627.

Sibai, B. M., 2005. Thrombophilia and severe preeclampsia: time to screen and treat in future pregnancies. Hypertension, 46(6): l252–1253.

Ustun, Y., Engin, U. Y. & Kamaci, M., 2005. Association of fibrinogen and C-reactive protein with severity of preeclampsia. Eur. J. Obstet. Gynecol. Reprod. Biol., 121(2): 154-158.

Vassiliev, V., Harris, Z. L. & Zatta, P., 2005. Ceruloplasmin in neurodegenerative diseases. Brain Res. Brain Res. Rev., 49: 633-640.

Wong, F. & Cox, B., 2014. Proteomics Analysis of Preeclampsia, a Systematic Review of Maternal and Fetal Compartments. J. Proteomics Bioinform. 10:2.

Yang, X., Clifton, J., Huang, F. & Kovac, S., 2009. Proteomic analysis for process development and control of therapeutic protein separation from human plasma. Electrophoresis, 30: 1185–1193.


http://www.ncbi.nlm.nih.gov/pubmed/?term=Seong%20WJ%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Chong%20GO%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hong%20DG%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lee%20TH%5BAuthor%5D&cauthor=true&cauthor_uid=21040199



http://www.ncbi.nlm.nih.gov/pubmed/?term=Lee%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Cho%20YL%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Chun%20SS%5BAuthor%5D&cauthor=true&cauthor_uid=21040199

http://www.ncbi.nlm.nih.gov/pubmed/?term=Park%20IS%5BAuthor%5D&cauthor=true&cauthor_uid=21040199






Bacterial Colonization and Biofilm Formation in Minimally Processed Fruit of

Olea europaea

*IRAM LIAQAT1, NAJMA ARSHAD & AMINA NASEEM

Department of Zoology, Govt. College University, Lahore, Pakistan

Department of Zoology, University of the Punjab, Lahore, Pakistan

ABSTRACT

Biofilms are communities of organisms embedded in extracellular matrix. Their growth on abiotic and biotic surfaces results in various infections. Hence the objective of this research is to study the bacterial colonization on minimally processed fruit of Olea europaea. Additionally bacterial isolates were characterized for biofilm forming ability using two methods i.e. Congo red and cover slip. Four strains named F1, F2, F3 and F4 were isolated from minimally processed fruit of Olea europaea. Morphological and biochemical characterization showed that isolates belong to genera Pseudomonas spp., Staphylococcus spp., Bacillus spp. and Enterococcus spp. respectively. These strains showed best growth at 37°C temperature and pH 7. The biofilm formation showed by Bacillus spp. was the highest as observed by congo red method. Mutation was induced by exposing these isolates to UV rays at different time intervals. After UV exposure there was an incredible difference in biofilm formation between wild type versus mutant strains. The significant decrease was observed in Enterococcus spp. biofilm formation after 4 and 15 minutes. This finding has important implication in controlling pathogenic bacteria in minimally processed fruit of O. europaea that form biofilm on plant surface and cause plant diseases. Key words: Biofilm quantification, Olea europaea, Processed fruit, UV mutation exposure.

INTRODUCTION

The olive tree (Olea europaea) is an evergreen tree originated from the wild olive tree (O. europaea var. sylvestris). Around 6000 years ago it was cultivated in Palestine. Later, Phoenicians, the Etruscans, the Greeks and the Romans spread it throughout the Mediterranean (Arnan et al., 2012). The vegetative propagation is an integral feature of the olive production line and the first step for establishing new orchards and/or revitalizing old ones. Propagation might be brought in tissue culture through axillary buds or somatic embryogenesis methods to produce rapidly a large number of plants from selected genotypes and to meet increased demand for olive plants certified for both genetic fidelity and phytosanitary characteristics (Annarita, 2009).

Biofilm formation enables single-cell organisms to assume “group behavior, which enables them to survive under adverse conditions. Planktonically living organisms attain biofilm mode after irreversible attachment to the surface (Kostakioti et al., 2013). Bacteria are embedded in a self-produced polymeric substance called as extracellular polymeric substance (EPS) in the biofilm (Flemming & Wingender, 2010). Hence, biofilm-forming pathogens persist, causing chronic and resistant infections including urinary tract infections (UTIs), upper respiratory tract infections, periodontitis, catheter-induced and other infections

(E. coli, Enterococcus faecalis, and others) (Kostakioti et al., 2015). The microbial communities of fruits of olive plant are diverse and include many different genera of bacteria, yeasts, algae, filamentous fungi, and less commonly, protozoa and nematodes. Bacteria are most abundant inhabitants occupying general fruit surface of plant. Epiphytic bacterial populations vary greatly in size among or within the same plant species, also in close proximity, over short time scale or in long growing season (Mercier & Lindow., 2000).

During plant growth and decay, bacteria colonize plant surfaces. Rich availability of nutrients, moisture and neutral pH supports growth of many diverse microbes on various vegetables. Microflora observed on minimally processed vegetables (MPV) and leafy vegetables belong to bacteria from the Pseudomonadaceae and Enterobacteriaceae families. Green olive surface has an ideal environmental condition resulting in development of complex biofilms while processing controlled or natural table olive. Domínguez-Manzano et al. (2012) studied biofilm formation on biotic and abiotic biotic surfaces during fermentation of Spanish style green table olive. In their study, they observed the formation of complex polymicrobial communities on surface which contact with the brine during fermentation of Spanish style Gordal cv. green olive when treated spontaneously or under controlled conditions (inoculated with Lactobacillus pentosus

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kostakioti%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23545571

294 I. LIAQAT ET AL BIOLOGIA (PAKISTAN)

LPCO10). Scanning electron microscopy proved that fermentation process on both abiotic (glass slide) and biotic (olive skin) surfaces produced mixed biofilms by L. pentosus and yeast populations. However, the architectures of biofilm were entirely different on both supports: only aggregates of L. pentosus and yeasts without any EPS were observed on on the glass slides and true mature biofilms were found on the skin of the fruits. Molecular analysis revealed that biofilms formed during fermentation comprise of populations of L. pentosus and yeasts only (Domínguez-Manzano et al., 2012).

The fruit surface of olive plant is important both scientifically and economically to study microbial ecology. Epiphytes play important role in biogeochemical cycling including carbon and nitrogen cycles causing serious effects on health of individual plants. Hence, better understanding of the interactions of microbes with plants and among themselves is necessary to understand practical applications resulting from such relationship. This enhanced knowledge may contribute not only to better understanding of the ecology of human pathogenic bacteria on plant surfaces but also provides new insights for establishing prevention or control strategies to overcome preharvest contamination of crops with various pathogens. Most of the biofilm related research focused on acute infections, however many diseases have been reported to be caused by chronic infections resulting from slime producing bacteria aggregated as biofilms (Bjarnsholt, 2013).

Hence, this study was designed to screen and identify the different types of bacterial strains on fruit surface of O. europaea. Furthermore, biofilm forming capability by isolated strains was investigated.


Plant Samples

Fresh fruits of olive plant (Olea euoropaea) were obtained from plants grown at the National Agricultural Research Centre (NARC), Islamabad and then processed this fresh sample in a jar in special preservatives chemicals.

Bacterial strains purification and isolation

To remove bacteria from the fruits, the 2.5g O. europaea leaves were rinsed with 150 ml of sterile potassium phosphate buffer for 3 min by gentle rotation of flasks (120 rpm). Afterwards, fruits were removed from buffer and rinsed with 50 ml of

sterile buffer. Both the rinse and washing suspensions were mixed and serial dilution plating method was used to select morphologically different and purified strains.

Morphological, biochemical and physiological characterization of isolates

Cell morphology was observed by gram staining and acid fast staining. Following Gerhardt et al. (1994), purified colonies were streaked on various media including macConkey agar, eosin methylene blue agar, blood agar and chocolate agar. Different biochemical tests such as H2S production, Tryptophan deaminase (TDA), catalase, Methyl red, citrate utilization, Indole, Voges Proskauer, denitrification and urease test were performed to characterize bacterial isolates. Physiological characaterization was done on the basis of growth curve for different time intervals at 600nm, pH (5, 7 and 9) and different temperatures (25°C, 37°C and 45°C).

Growth curve

Nutrient broth was prepared and distributed in 4 different flasks (150ml NB in each flask) then autoclaved the flasks at 121ºC temperature and 15lb pressure. Each flask was inoculated with 150μl of pre-inoculums except control. After inoculation first reading of optical density was taken at zero time intervals. Then the flasks were incubated at 37ºC in shaking incubator. After one hour of incubation, second reading of O.D was taken from spectrophotometer. Further readings of optical density at 600nm were taken at various time intervals (0, 1, 2, 3…..10 hours). A graph was plotted by representing the O.D values on Y-axis and the time of incubation on X-axis.

Biofilm formation

Two methods i.e., congo red Assay (Mathur et al., 2006) and air-liquid interface coverslip assay (Mathur et al., 2006) were used to analyse the biofilm forming capability of isolates. Experiment was run in triplicates.

Construction of mutants by UV exposure

Mutations in a number of genes from different strains of bacteria render these bacteria sensitive to UV and/or ionizing radiation. Strains bearing such mutations have been designated rad (for radiation sensitivity) mutants. The corresponding wild-type alleles participate in several distinct DNA repair and DNA damage tolerance pathways. It is likely that some of these genes encode proteins that also participate in DNA replication and/or recombination, since the

VOL. 61 (2) BACTERIAL COLONIZATION AND BIOFILM FORMATION IN OLEA EUROPAEA 295

processes of repair, replication, and recombination may share the need for common enzymes such as DNA polymerases, ligases, and nucleases. Hence, defects in such genes would be expected to affect the efficiency and fidelity of more than one of these aspects of DNA metabolism.

Modified Miller's protocol was applied for induction of mutation through UV irradiation. The plate containing cell suspensions was exposed to UV radiation in a laminar flow cabinet. The UV irradiation was carried out for 3, 4 and 15 minutes. In accordance to original protocol, distance of 37cm was set between culture plate and UV lamp. About 0.1 ml each of Control and mutant strains was spread and counts were made for viable colonies after incubation made in dark at 37°C for 24 hours. Then motility and biofilm formation for these strains was compared.

RESULTS Morphological characterization

Morphologically four different colonies were observed for isolated strains. Some colonies were smooth, round, glistering and regular, some were elevated, shiny with entire margins, while others were small, round, mucoid and elevated (Table I). One strain F1 was gram’s negative and others were gram positive F2, F3, and F4. Only motile strains were selected for study. All of observed bacteria were seen to be encapsulated. Some isolates were non spore forming while others were spore forming (Table II). The gram negative bacterial isolates were also identified by growth on EMB. Pseudomonas spp. and Enterococcus spp. strains were identified by producing green metallic shine on EMB agar.

Table I: Morphological characterization of bacterial strains isolated from minimally processed fruit of Olea europaea

Sr. No.

Strains Shape Colour Margin Elevation Optical character

Texture

1 F1 Cicular Blue green Smooth Raised Opaque Moist

2 F2 Circular Off white Entire Raised Transparent Moist

3 F3 Circular White Entire Flat Transparent Moist

4 F4 Irregular Green Entire Convex, Raised

Opaque Moist

Table II: Morphological characterization of bacterial strains isolated from minimally processed fruit of

Olea europaea

Sr.

No.

Stains Blood agar EMB Gram staining

Endospore staining

Capsule staining

Motility test

1 F1 β + _ _ + +

2 F2 γ _ + _ + +

3 F3 β + + + + +

4 F4 γ _ + _ + +

Biochemical characterization

All the strains were found to be catalase positive except F4 strain. Three strains (F1, F2, F3) were citrate positive which determined its ability to use citrate as a sole carbon source for their energy while remaining one F4 was citrate negative (Table III). H2S production was observed in two strains (F1, and F4) other two strains gave negative results for this test. All three strains (F1, F2, F3) showed

positive result for Voges Proskauer test identifying those bacteria which can ferment glucose while others one was found to be negative. Indole test was observed to be negative for all the strains. Two strains (F1, F2) were positive for urease test but the other two strains (F3, F4) showed negative results. Bacterial strains identified on the basis of biochemical characterization were found belong to genera Pseudomonas spp., Staphylococcus spp. Bacillus spp., and Enterococcus spp. (Table II).


Table: III Biochemical Characterization of bacterial strains isolated from minimally processed fruit of Olea europaea

Sr. No. Biochemical tests Bacterial strains

F1 F2 F3 F4

1 Catalase test + + + _

2 Citrate utilization test + + + _

3 H2S production test + _ _ +

4 Tryptophan Deaminase test + + _ _

5 Indole test _ _ _ _

6 Voges Proskauer test + + + _

7 Methyl Red test + + + _

8 Sucrose Fermentation Test _ + + _

9 Glucose Fermentation test + + + +

10 Lactose Fermentation test _ + + _

11 Denitrification Test _ _ + _

12 Urease test + + _ _

Inference

Pseud

om

onas

spp.

Sta

phylo

coccus

spp.

Baccilu

s s

pp.

Ente

rococcus

spp.

Physiological characterization

Pseudomonas spp. exhibited four hour lag phase and two hour log phase alongwith 3 hour stationary phase and then decline or death phase was observed. Staphylococcus spp. exhibited a four hour lag phase followed by 2 hour log phase. Afterwards a 3 hours stationary phase was observed. Then leveling off was observed. Strain Bacillus spp. showed five hour lag phase then one hour log phase and 1.5 hour stationary phase and then it showed decline in growth phase. Strain Enterococcus spp. has 2 hours long lag phase, followed by 4 hours log phase and 5 hours stationary phase leading to one hour for decline phase afterwards (Fig., 1). In general isolates were found to grow over a broad range of pH (Fig., 2). However, acidic pH has detrimental effect on growth of isolates, showing best growth at pH 7. However, one bacterial strains i.e. Staphylococcus spp. showed best growth at pH 9. All bacterial strains preferred 37°C for best growth, describing those as mesophilic (Fig., 3).

Fig., 1: Growth curve of four bacterial strains (Pseudomonas spp., Staphylococcus spp., Bacillus

spp., and Enterococcus spp.) isolates from minimally processed fruit of Olea europaea.


Fig., 2: Effect of pH on four bacterial strains (Pseudomonas spp., Staphylococcus spp., Bacillus

spp., and Enterococcus spp.) isolated from minimally processed fruit of Olea europaea.

Fig., 3: Effect of Temperature on four bacterial strains (Pseudomonas spp., Staphylococcus spp.,

Bacillus spp., and Enterococcus spp.) isolated from minimally processes fruit of Olea europaea.

Quantification of biofilm formation

Using congo red method, only one strain i.e., Bacillus spp. showed a black crystalline morphology indicating biofilm forming capability. However, Air-liquid interface coverslip method showed that Bacillus spp. formed thick and confluent biofilm structures on the coverslip after 18 h of growth (Data not shown). The coverslips were stained with 0.1% crystal violet, and dark, confluent staining across the surface indicating robust biofilm formation during imaging. The bacterial strain Bacillus spp. possesses a high capacity for biofilm formation on glass surfaces. After exposing the

strains to UV light for 3, 4 and 15 minutes, mutation occurred in all four wild type strains i.e. Pseudomonas spp., Staphylococcus spp., Bacillus spp., and Enterococccus spp. Results revealed that bacterial strain Bacillus spp. possessed a high capacity of biofilm formation and there was significantly low biofilm formation in Enterococcus spp. after 15 minutes of continuous exposure to the UV light method (Figs., 4-6).

Fig., 4: Biofilm formation by strains isolated from Olea europaea. Four bacterial strains

(Pseudomonas spp., Staphylococcus spp., Bacillus spp., and Enterococcus spp.) were exposed to UV

light for 3 minutes. Biofilm was quantified at 523 nm.



light for 4 minutes. Biofilm was quantified at 523 nm.

All four bacterial strains i.e. Pseudomonas spp., Staphylococcus spp., Bacillus spp. and Enterococcus spp. revealed that Bacillus spp. strain possessed a high capacity for biofilm formation on glass surfaces after exposing strains to UV light for 2 and 3 minutes. Significantly low biofilm for Enterococcus spp. strain was observed after 15 minutes of continuous exposure to the UV light observed by cover slip method (Figs., 4-6).




light for 15 minutes. Biofilm was quantified at 523nm.

DISCUSSION

Over the course of laboratory experimentation, bacterial strains have become domesticated exhibiting behaviour different from their wild type ancestors. Among those, one is the ability to form complex structured community called as biofilms. Biofilm formation is an important indicator of the pathogenicity of the strains. Strains isolated from olive biofilms were characterized morphologically, biochemically and physiologically. Among isolated strains, only four were observed to be morphologically different in colony shape, size and margin. Biochemical characterization revealed that strains belong to genera Pseudomonas spp., Staphylococcus spp., Bacillus spp., and Enterococcus spp Previously, Kendrick et al. (2008) performed a similar study obtaining identical results.

Biofilm formation was assessed by congo red and coverslip methods. Congo red method showed only one strains i.e. Bacillus spp. having ability to form the biofilm. Biofilm formation has been reported previously by different strains including Bacillus sp. Isolated from dental unit water lines (Liaqat et al., 2009).

Biochemical characterization revealed that isolated strains belonged to genera Pseudomonas, Staphylococcus, Bacillus and Enterococcus. In order to construct the motility deficient strains these strains were exposed them to UV light for different time intervals 3, 4 and 15 minutes. The effect of UV radiation was tested on motility and in turn on biofilm forming ability. In a panel of four strains the exposures to Ultraviolet (UV) radiations abolished the structure or rotation of the flagella greatly

reducing biofilm formation when the bacteria were grown under static conditions. While using cover slip method only Bacillus spp. were found to be the strongest biofilm former. Both gram positive and gram negative strains have ability to produce biofilm as reported by O’Toole & Kolter (1998).

The most pathogenic strain was Enterococcus spp. This was exposed to UV radiation for 15 minutes resulting in reduced biofilm formation (1.1) compared to wild type (1.4). Exposing strains to the UV radiations for different periods of times had mutated the biofilm formation of all four strains. This mutation may decrease the growth of micro biota as reported by Lodhia et al. (2009).

Conclusion

The concept of bacterial aggregation and biofilm formation on surface of minimally processed fruit of O. europaea is still at very early stage (Bjarnsholt, 2013). The current study demonstrated that in minimal processing of vegetable leaves, bacterial colonies attached to various vegetables hence produced more complex biofilm structure. Exposure to UV radiation for 15 minutes resulted in significant biofilm reduction at 37°C temperature and 7 pH suggesting the efficacy of this method in food industries involved in processing of fruits and vegetables for human consumption. The use of morphological characterization, biochemical characterization and associated staining techniques provided a powerful tool for investigating biofilm formation on processed fruit and analysing the influence of biofilm in context to product quality and safety attributes

REFERENCES

Annarita, L., 2009. Morphological evaluation of olive plants propagated in vitro culture through axillary buds and somatic embryogenesis methods. Afr. J. Plant Sci., 3: 037-043.

Arnan, X., Lópeza, B.C., Martínez-Vilaltaa, J., Estorachb, M. & Poyatosc, R. 2012. The age of monumental olive trees (Olea europaea) in northeastern Spain. Dendrochronologia., 30: 11–14

Bjarnsholt, T., 2013. The role of bacterial biofilms in chronic infections. APMIS Suppl. 136:1-51.

Domínguez-Manzano, J. 1., León-Romero, Á., Olmo-Ruiz, C., Bautista-Gallego, J., Arroyo-López, F. N., Garrido-Fernández. & A, Jiménez-Díaz, R., 2012. Biofilm formation on abiotic and biotic surfaces during Spanish style green table olive

http://www.europeana.eu/portal/search.html?query=who%3a%28Annarita%20Leva%20%29&rows=24

http://www.sciencedirect.com/science/article/pii/S1125786511000361









http://www.sciencedirect.com/science/journal/11257865

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bjarnsholt%20T%5BAuthor%5D&cauthor=true&cauthor_uid=23635385


http://www.ncbi.nlm.nih.gov/pubmed/?term=Dom%C3%ADnguez-Manzano%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Le%C3%B3n-Romero%20%C3%81%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Olmo-Ruiz%20C%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bautista-Gallego%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Arroyo-L%C3%B3pez%20FN%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Garrido-Fern%C3%A1ndez%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Garrido-Fern%C3%A1ndez%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22656327

http://www.ncbi.nlm.nih.gov/pubmed/?term=Jim%C3%A9nez-D%C3%ADaz%20R%5BAuthor%5D&cauthor=true&cauthor_uid=22656327


fermentation. Int. J. Food. Microbiol., 157(2):230-8.

Flemming, H. C. & Wingender J., 2010. The biofilm matrix. Nat. Rev. Microbiol., 8: 623–633.

Gerhardt, P., Murray, R. G. E., Wood, W. A. & Krieg, N. R., 1994. Methods for general and Molecular bacteriology. American Society for Microbiology, 1325 Massachusetts Ave.,Washington, DC.

Kendrick, C., Rogers, S. & Hill, K., 2008. Isolation and identification of Staphylococcus pasteuri from a presumed clean finger nail. J. Microbiol., 2(2): 18-23.

Kostakioti, M. 1., Hadjifrangiskou, M,. & Hultgren, S. J., 2013. Bacterial biofilms: development, dispersal, and therapeutic strategies in the dawn of the postantibiotic era. Cold Spring Harb Perspect Med. 3(4): doi: 10.1101/cshperspect.a010306.

Kostakioti, M., Hadjifrangiskou, M. & Scott J. H., 2015. Bacterial Biofilms: Development, Dispersal, and Therapeutic Strategies in the Dawn of the Postantibiotic Era, CSH 1-9.

Liaqat, I., Sumbal, F. & Sabri, A. N., 2009. Tetracycline and chloramphenicol efficiency

against selected biofilm forming bacteria. Curr. Microbiol., 59: 212-220.

Lodhia, M. H., Bhatt, K. R. & Thaker, V. S., 2009. Antibacterial activity of essential oils from Palmarosa, Evening Primrose, Lavender and Tuberose. Indian J. Pharm. Sci., 71(2): 134-136.

Mathur, T., Singhal, S., Khan, S., Upadhyay, D. J., Fatma, T. & Rattan, A.. 2006. Detection of biofilm formation among the clinical isolates of Staphylococci: an evaluation of three different screening methods. Indian J. Med. Microbiol., 24(1): 25-29.

Mercier, J. & Lindow, S. E., 2000. Role of leaf surface sugars in colonization of plants by bacterial epiphytes. Appl. Environ. Microbiol., 66:369–374.

O'Toole G.A.1. & Kolter, R., 1998. Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol. Microbiol., 30(2): 295-304.



http://www.ncbi.nlm.nih.gov/pubmed/?term=Kostakioti%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23545571

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hadjifrangiskou%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23545571

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hultgren%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=23545571



http://www.ncbi.nlm.nih.gov/pubmed/?term=Bacterial+Biofilms%3A+Development%2C+Dispersal%2C+and+Therapeutic+Strategies+in+the+Dawn+of+the+Postantibiotic+Era



http://www.ncbi.nlm.nih.gov/pubmed/?term=O%27Toole%20GA%5BAuthor%5D&cauthor=true&cauthor_uid=9791175

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kolter%20R%5BAuthor%5D&cauthor=true&cauthor_uid=9791175

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bacterial+Flagellar+and+twitching+motility+are+necessary+for+Pseudomonas+aeruginosa+biofilm+development



Dose optimization of Alloxan for diabetes in albino mice

*SYED SHAHID IMRAN BUKHARI1, MUDDASIR HASSAN ABBASI

1,2 & MUHAMMAD KHALIL AHMAD

KHAN2.

1Department of Zoology, Government College of Science, Wahdat Road, Lahore-Pakistan.

2Department of Zoology, University of the Punjab, Lahore-Pakistan.

ABSTRACT

Alloxan monohydrate induces diabetes in animals, although streptozotocin. The other diabetogenic chemical is less toxic but comparatively expensive. This study was conducted to provide an optimization of alloxan for diabetes induction in mice with single intraperitoneal injection. Twenty-four healthy Albino mice of a local strain weighing 25 to 30 gms were selected and injected with varying doses of alloxan monohydrate (from 100mg - 400mg)/ kg body weight in order to induce diabetes. The blood sugar random (BSR) and blood sugar fasting (BSF) were checked after 24, 72 hours and 7 days after injecting the alloxan. The mice did not sustain the 400 mg/kg of dose and showed 100% mortality. The optimized dose (200mg/kg) was found to lower the mice mortality by 50%. Diabetic mice attained the blood sugar levels ranging from 220mg/dl to 350mg/dl. There was statistically significant (p< 0.05) increase in feed intake in diabetic group as compared to control group. Whereas, decrease in body weight in diabetic group occurred during the same observational period. It was therefore concluded that our proposed regime may be beneficial for future researchers aiming to develop a similar animal model for the study of pathology of diabetes. Key words: Alloxan monohydrate, streptozotocin, BSR (blood sugar random), BSF (blood sugar fasting).

INTRODUCTION

Diabetes mellitus is a hereditary disorder

with multiple alleles located on different

chromosomes. Defects either in secretion or action

of insulin lead to characteristic elevated sugar level

(Degirmenci et al., 2005; Kota et al., 2012). Type 2

diabetes (T2D) is one of the disease types in which

deficiency of insulin occurs. Persons with diabetes

produce insulin endogenously but gradually their

body cells stop to respond and eventually cells do

not take glucose from blood. In this way a sort of

insulin résistance is developed (Wild et al., 2004). It

is more common among the obese and occurs

mostly above the age of 40years. Inadequacy of

glucose control leads to vascular complications

accounting for morbidities and mortalities

associated with the disease. Glycemic control is

helpful to reduce the risk of developing

complications associated with T2D (ADA, 2012).

T2D is found to be multifactorial and its relationship

with obesity, hypertension and glucose intolerance

is well documented (Steinberger & Daniels, 2003;

Tan et al., 2006). Family history and urban

residency are also linked with increased risks of

diabetes. Certain factors like higher body mass

index (BMI), sluggish lifestyle and hypertension

aggravate the diabetes (Jayawardena et al., 2012).

Earlier studies have also shown those BMI and

waist hip ratios (WHR) are risk factors for T2D

independently (Wei et al., 2012).

Various diabetic animal models have been

established either surgically (Black et al., 1980) or

chemically (Szkudelski, T., 2001) using variety of

modes, doses and routes of administration (Gosh &

Suryawanshi, 2001; Sarasa et al., 2012; Akuodor et

al., 2014). Alloxan in its monohydrate form is one of

the chemical compounds used for the induction of

diabetes since long (Etuk, 2010; Iranloye et al.,

2011). The diabetogenic dose of alloxan varies

considerably amongst species, age and metabolic

state of the animal. To the best of our knowledge

intraperitoneal (i.p) dose of alloxan monohydrate

has not been optimized yet in laboratory mice.

Therefore the present study was undertaken for this

purpose.


Animals

Healthy albino mice of 25 to 30 g were used and kept under observation for one week in the animal house under controlled conditions. The animals were fed pelleted diet having composition of carbohydrates 70%, proteins 18%, fats 4.9%, fiber 3.2%. The feed and water were available ad libitum.

../../ATIQUE/Desktop/insulin%20model/The%20effects%20of%20acarbose%20and%20Rumex%20patientia%20L.%20on%20ultrastructural%20and%20biochemical%20changes%20of%20pancreatic%20B%20cells%20in%20streptozotocin-induced%20diabetic%20rats.htm


All the mice were kept in the standard cages (8

″X18

″X10

″) in groups of three to prevent from

cannibalism and reared at 26±4˚C, relative humidity 55-60% and light dark cycle 12h: 12h.

Chemicals

All the chemicals were of analytical grade and obtained from commercial source as indicated: Alloxan monohydrate from Alfa Acer Johnson Company Great Britain and Blood Glucose determination Glucosure strips from Apex Bio, Taiwan.

Experimental design

Vanitha et al. (2013) method was used to

induce diabetes into the mice. Briefly overnight-

starved mice were made diabetic with a freshly

prepared dose of alloxan monohydrate in pyrogen

free water. Single intraperitoneal dose of 100, 200,

300 and 400 mg/kg b.w. was injected into group I, II,

III & IV, respectively (n=9). Blood was taken from

tail; BSR (Blood Sugar Random) and BSF (Blood

Sugar Fasting) were checked after 24, 72 hours and

at day 07. According to Luka et al, (2013) mice with

BSR and BSF more than 150mg/dl were considered

as diabetic and were used for further study.

Morphological and behavioral changes were

observed throughout the experiment.

Selected dose of Alloxan (group II) was

further used to check its effect on feed intake and

body weight of mice compared with non-diabetic

(negative control). Body weight of each mouse was

measured and recorded for each mouse throughout

the experiment. Measured quantity of pelleted diet

was put into cage and at the end of 24 hours

remaining quantity of feed was weighed.

Fig., 1: Flow sheet showing calculation of LD 50.

Calculation of LD 50.

LD 50 was calculated according to Reed and Munch formulae.


The data was presented as Mean ± S.E.M. One Way Analysis of variance (ANOVA) was performed on means to determine the significant (p < 0.05) difference among the groups.

RESULTS

During the experiment certain behavioral

(sluggish body movements, shivering and timmed

eyes) and morphological changes (thinning of body

hairs and khyphosis) were observed in diabetic

group. The dose of alloxan monohydrate for each

mouse was selected carefully based not only on the

body weight but also on the general conditions of

the animal were also noticed. Most of the mice

became diabetic on first administration. The animal

did not sustain the 400 mg/kg of dose and showed

more than 70% mortality.

Table I: Calculation of LD 50.

Doses Selected

Number of mice uninfected

Number of mice infected

Total Percent infected

c

Uninfected a Infected

b

100 mg/kg 09 0 12 0 0.00

200 mg/kg 03 06 09 06 40.0

300 mg/kg 0 09 09 15 62.5

400 mg/kg 0 09 09 24 72.73 a The sum of all of the uninfected mice at that dose and higher. b The sum of all of the infected mice at that dose and lower. c The total infected divided by the sum of the total uninfected and total infected multiplied by 100.

VOL. 61 (2) DOSE OPTIMIZATION OF ALLOXAN FOR DIABETES 303

Using the numbers in the table above following calculations were performed:

50 - 40 (the percent infected below 50%)

72 (the percent infected above 50%) - 40 (the percent infected below 50%)

=0.31

log102 (dose at which less than 50% of the mice become infected) = 2

0.31+2=2.31

Inverse log 2.31

So LD50=204 or 2.04 x 102 mg/kg

Those mice which were not diabetic after

24h were given booster of 100 mg/kg of alloxan

monohydrate. All the surviving diabetic mice had

blood sugar levels ranging from 220 mg/dl to 350

mg/dl. As they survived without insulin injections,

the mice had developed TD2 which was the

requirement of our animal diabetic model. Blood

sugar levels of 24 mice were recorded before and

after alloxan administration given in Table II (a).

Table II (a): BSR & BSF of mice before and after 24 hours of Alloxan Administration

Group

% Mortality

Dose selected (mg/kg)

BSR (mg/dl) BSF Levels after Alloxan induction

(mg/dl) Before Alloxan

induction After 24 hour of Alloxan induction

I Nil 100 80±3.46

100±3.45 95±2.96

II 50 200 80±3.0 250±3.06 220±3.06

III 75 300 80±2.96 350±4.0 320±5.51

IV 100 400 80±3.16 - -

Table II (b): BSR & BSF of mice before and after 72 hours and 7days of Alloxan Administration

Group

BSR (mg/dl) BSF (mg/dl)

After 72 hours After 07 days After 72 hours After 07 days

I 95±2.65 95±3.65 65±1.09 72±3.00

II 250±3.4 278±4.10 220±2.2 262±5.1

III 345±3.0 356±5.90 315±4.4 355±6.3

IV * * * *

Values represent Means of triplicates with Mean±S.E.M. (*) = died.

Effect of diabetes on feed intake and body weight

There was an increase in the feed intake

from 2.80±0.12 gms to 3.40±0.12 gms /24 hrs from

day 0 to post 21 days in non diabetic group,

respectively. Whereas, in diabetic group the feed

intake increased from 2.97±0.23 gms to 6.20±0.23

grams /24 hrs from day 0 to post 21 days. The result

indicated that there was statistically significant (p<

0.05) increase in feed intake in diabetic group as

compared to normal group (Table III). There was an

increase in the weight of mice from 30.03±0.69 on

day 0 to 34.60±0.64 gms post 21 days in normal

group. Whereas, in diabetic group the decrease in

body weight occurred from 30.47±0.55 to

25.27±0.78 gms during the same observational

period. There was significant decrease (p< 0.05) in

body weight in diabetic group as compared to

normal group (Table II).


Table III: Changes in feed intake and body weight in normal and diabetic mice in grams

No. of Days Feed intake Body weight

Normal Diabetic Normal Diabetic

0 2.80±0.12 2.97±0.23 30.03±0.69 30.47±0.55

7 2.90±0.06a 3.60±0.26 32.40±0.40a 27.57±0.38

a,b,c

14 3.23±0.09a,b

4.80±0.21a,c,d

33.57±0.48a 26.10±0.78

a,b,c,d

21 3.40±0.12a 6.20±0.23

a,b,e 34.60±0.64

a 25.27±0.7878

a,b,c,d

Means with the same superscript differ significantly at p < 0.05. Similar alphabets represent statistically significant values.

DISCUSSION

Various chemical or surgical diabetic animal models have been established to study the disease. Alloxan monohydrate is one of the routinely used chemical compound since long (Etuk, 2010; Iranloye et al., 2011). It varies considerably amongst species, age and metabolic state of the animal. In the present study single intraperitoneal injection of alloxan monohydrate (200 mg/kg) produced experimental diabetes after 07 days in albino mice used as animal model. However, others workers reported its different doses for induction of diabetes. Sarasa et al., 2012 reported 120mg/kg of alloxan monohydrate induced diabetes in mice, Gosh & Suryawanshi, 2001; Akuodor et al., 2014 reported 150 mg/kg of alloxan monohydrate induced diabetes in rats.

The most plausible explanation for induction of diabetes due to alloxan is that following its administration, it may have accumulated in the islets of Langerhans and in the liver where it is reduced to dialuric acid. Lenzen, (2008) reported alloxan to be an effective pro-oxidant selectively cytotoxic to ß cells of the pancreatic islets of Langerhans. Alloxan induced diabetes is also suggested to result from initial islet cell inflammation followed by activation of macrophages and lymphocytes that might be the source of cytotoxic oxygen radicals (Trivedi et al., 2004). In the present study changes in feed intake were also noticed in grams/24 hrs. It was observed that in diabetic mice it was almost twice as compared to normal. The increase in feed intake might be associated with the increased body metabolism. Similar results of change in feed intake were reported by Vanitha et al., 2013. On contrary Mallick et al. (2007), reported decrease in the amount of feed intake in streptozotocin induced diabetic rats. Furthermore, body weight of diabetic mice was significantly reduced in diabetic group post 21 days exposure. Luka et al. (2012) have indicated that diabetes induction with 100 mg/kg of alloxan monohydrate caused reduction in the

amount of weight which may be associated with the increased body metabolism on day 14. Conclusion

It is concluded from the above findings that single intraperitoneal injection of alloxan monohydrate at the dose of 200 mg/kg b.w. produced symptoms of diabetes in mice along with rise of blood sugar random and blood sugar fasting levels more than 150 mg/dl from day 0 to 21 days post induction.

REFERENCES Akuodor, G.C., Udia, P. M., Bassay, A., Chilaka, K.

C. & Okezie, O. A., 2014. Antihyperglycemic and antihyperlipidemic properties of aqueous root extract of Icacina senegalensis in alloxan induced diabetic rats. J. Acute disease. 99-103.

American Diabetes Association, 2012. Diagnosis and classification of diabetes mellitus. Diabetes Care. 35(1): 64-70.

Black, H. E., Rosenblum, I. Y. & Capen, C. C., 1980. Chemically induced (Streptozotocin-Alloxan) diabetes mellitus in the dogs. Am. J. Pathol. 98: 295-306.

Carter, J.S., Pugh, J.A. & Monterrosa, A., 1996. Non-insulin-dependent diabetes mellitus in minorities in the United States. Ann. Intern. Med. 125: 221-32.

Degirmenci, I., Ustener, M.C., Kalender, Y., Kalender, S. & Gunes, H.V., 2005. The effects of Acarbose and Rumex patientia on ultra structural and biochemical changes of pancreatic β-cells in streptozotocin-induced diabetic rats. J. Ethano. Pharmacol. 97(3): 555-559.

Etuk, E.U., 2010. Animals models for studying diabetes mellitus. Agric. Biol. J. N. Am. 1: 130.

../AppData/Local/ATIQUE/Desktop/insulin%20model/The%20effects%20of%20acarbose%20and%20Rumex%20patientia%20L.%20on%20ultrastructural%20and%20biochemical%20changes%20of%20pancreatic%20B%20cells%20in%20streptozotocin-induced%20diabetic%20rats.htm

http://www.sciencedirect.com/science/journal/03788741/97/3

VOL. 61 (2) DOSE OPTIMIZATION OF ALLOXAN FOR DIABETES 305

Gosh, S. & Suryawanshi, S. A., 2001. Effects of Vinca rosea extracts in treatment of alloxan diabetes in albino rats. Indian J. Exp. Biol. 39: 748-759.

Iranloye, B.O., Arikawe, A.P., Rotimi, G. & Sogbade, A.O., 2011. Anti-diabetic and antioxidant effects of Zingiber officinale on alloxan-induced and insulin-resistant diabetic male rats. Niger. J. Physiol. Sci. 26: 89-96.

Jayawardena, R., Ranasinghe, P., Byrne, N.M., Soares, M. J., Katulanda, P. & Hills, A.P., 2012. Prevalence and trends of the diabetes epidemic in South Asia: a systematic review and meta-analysis. BMC Public Health. 12(380): 10-11.

Kota, S.K., Mehr, L.K., Jamula, S., Kota, S.K. & Mody, K.D., 2012. Genetics of type 2 diabetes mellitus and other specific types of diabetes; its role in treatment modalities. Diabetes Metab. Syndr. 6(1): 54-58.

Lenzen, S., 2008. The Mechanisms of Alloxan- and Streptozotocin-induced Diabetes. Diabetologia. 51(2): 216-226.

Luka, C.D. & Habibu, T., 2013. Comparative Studies of the Aqueous Extracts of Ocimum gratissimum, Aloe vera, Brassica oleracea and Ipomoea batatas on Some Biochemical Parameters in Diabetic Rats. J. Pharm. Biol. Sci. 6(3): 23-29.

Luka, C.D., Saleh, B. & Mohamad, A., 2012. Effect of Aquous Extract of Dioscorea domentorum on some biochemical parameters in alloxan-induced diabetic rats. Asian J. Exp. Biol. Sci. 3(2): 450-453.

Mallick, C., Chatterjee, K., GuhaBiswas, M. & Ghosh, D., 2007. Antihyperglycemic effect of separate and composite extract of root of Musa paradisiaca and leaf of Coccinia indica in streptozotocin-induced diabetic male albino rat. Afr. J. Tradit. Complement. Altern. Med. 4(3): 362-371.

Sarasa, D., Sridhar, S. & Prabakaran, E., 2012. Effect of an antidiabetic extract of Trigonella foenum-Graecum on normal and alloxan induced diabetic mice. Int. J. Pharm. Pharm. Sci. 4(1): 92.

Steinberger, J. & Daniels, S.R., 2003. Obesity, insulin resistance, diabetes and cardiovascular risk in children. Circulation. 107: 1448-1453.

Szkudelski, T., 2001. The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol. Res. 50: 536-546.

Tan, K.B.C., Shin, S.W.M., Chow, W.S., Leng, L., Bucala, R. & Belleridge, D. J., 2006. Association between serum levels of soluble receptor for advanced glycation end products and circulating advanced glycation end products in T2D. Diabetologia. 49: 2756-2762.

Trivedi, N.A., Mazumdar, B., Bhatt, I.D. & Hemaventhi, K.D., 2004. Effects of shilajit on blood glucose and lipid profile in alloxan-induced diabetic rats. Indian J. Biochem. Bio. 31: 373-376.

Vanitha, M., Pandian, R.S. & Karthikeyan, J., 2013. Evaluation of Aloe vera Gel for its anti inflammatory activity in diabetes mellitus using animal model system. Int. J. Drug Dev. Res. 5(1): 305-309.

Wei, M., Gaskil, S.P., Haffner, S.M. & Stern, M.P., 2012. Waist circumference as best predictor of non insulin dependent diabetes mellitus (NIDDM) compared to body mass index, Waist/Hip ratio and other anthropometric measurements in Mexican Americans-A 7 years prospective study. Obes. Res. 5(1): 16-23.

Wild, S., Roglic, G., Green, A., Sicree, R. & King, H., 2004. Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care. 27: 1047-53.




Elevated Levels of C - reactive protein in Preeclamptic Women Following 20th

Week of Pregnancy

YASMIN ASHRAF, *NABILA ROOHI, AASIA SHARIF, SAMINA ASHRAF, & SADAF ILYAS

Department of Zoology, University of the Punjab, Lahore Pakistan

ABSTRACT

The aim of the current study was to evaluate the high sensitive C-reactive protein (hsCRP) level in primigravida and multigravida preeclamptic and normotensive pregnant women following 20

th week of

pregnancy. It was a cross sectional study conducted in different hospitals of Lahore from June 2012 to May 2014. Study included 140 participants with 70 preeclamptic cases and equimumeral normotensive pregnant women after 20

th week of pregnancy. Preeclamptic cases were further categorized as primigravida and

multigravida. All of the participants were in the age group of 18-40 years and BMI was in the range of 18-27 kg/m

2. hsCRP levels were measured by Enzyme Link Immunosorbent Assay. Levels of hsCRP were

significantly high in preeclamptic patients compared to normotensive pregnant group. Further the elevation in hsCRP levels was more intensified in primigravida preeclamptic women compared to multigravida preeclamptic women. Determination of serum C – reactive protein levels may be used as potential indicator for the severity of preeclampsia. Key words: C – reactive protein, Preeclampsia, Primigravida, Multigravida

INTRODUCTION

Hypertensive disorders of pregnancy, gestational diabetes and premature birth are common pregnancy disorders. Maternal and foetal health as well as pregnancy outcome is markedly affected by preeclampsia, eclampsia or HELLP (hemolysis, elevated liver enzymes and low platelet volume) disorders. These disorders significantly contribute to maternal morbidity and mortality (Tavana et al., 2010).

Preeclampsia, a complication of the late pregnancy, develops in 7% of all pregnancies. It is characterized by high blood pressure equal to or above 140/90 mmHg with manifestation of proteinuria after 20 weeks of pregnancy. It is one of the leading causes of maternal and foetal morbidity and mortality and currently there is no treatment other than cessation of the pregnancy. About 50,000 mothers die due to pregnancy induced hypertension per year all over the word. It is responsible for 25% of all foetal growth retardation and 15% preterm birth in developed countries (Kameswaramma, 2014).

Preeclampsia may result in eclampsia if seizure develops or exhibits as hemolysis, elevated liver enzymes and low platelet volume (HELLP) syndrome. Eclampsia and HELLP disorders have been linked with severe complications like cerebral hemorrhage, renal failure, lung edema and liver hemorrhage. The recent postulate about the etiology of preeclampsia focuses on mal-adaptation

of the immune responses and malfunctioned trophoblast invasion. Thus, a life-threatening maternal inflammatory response, perhaps directed against foreign foetal antigens, results in a series of activities including imperfect spiral artery remodeling, shallow trophoblast attack, placental infarction and discharge of pro-inflammatory cytokines in the general circulation (Tavana et al., 2010).

Complete pathogenesis of the disease is still not clear, emphasizing a multifactorial etiology. Endothelial cell dysfunction and inflammation are considered to have a critical role in the pathogenesis of preeclampsia. A general inflammatory response includes both the clotting and fibrinolytic system and immune system (Murthy et al., 2012).

C – reactive protein is synthesized in

hepatocytes as a result of infection and tissue

damage (Halder et al., 2013). It is a part of inborn

immune system and takes part in the systemic

response to inflammation (Brown et al., 2013). CRP

was revealed in Oswald Avery's laboratory during

the development studies of patients with

Streptococcus pneumonia infection. In humans,

plasma levels of CRP may rise rapidly and

markedly, as much as 1000-fold or more, after an

acute inflammatory stimulus, largely reflecting

augmented synthesis by hepatocytes (Black et al.,

2004).

308 Y. ASHRAF ET AL BIOLOGIA (PAKISTAN)

C – Reactive protein has been shown to be linked with several diseases, which includes endothelial dysfunction and systemic inflammation such as metabolic syndrome, type II diabetes and cardiovascular disease. Both of the endothelial dysfunction and inflammation have been associated with the pathogenesis of preeclampsia and other important pregnancy complications, including gestational diabetes mellitus and foetal overgrowth. Estimation of CRP level as a marker of inflammation has been of great interest in such complications. Hence, the purpose of the present study was to investigate the hsCRP concentrations in preeclamptic patients after 20

th week of gestation

and to find out the role of C – reactive protein in the pathogenesis of preeclampsia.


It was a cross sectional study conducted in two different hospitals of Lahore from June 2012 to May 2014. In this study CRP level was measured in 140 pregnant women following 20

th week of

gestation, divided into two groups: group A consisted of 70 women (ages 18-40 years, BMI ranges 18-27 kg/m

2) having peeclampsia with blood

pressure 140/90 mmHg or greater, proteinuria 300mg in 24 hours and edema. group B included 70 pregnant women of parallel ages and BMI with normal blood pressure and without proteinuria. Group A and B were further subcategorized as primigravida (a woman who is pregnant for the 1

st

time) and multigravida (a woman who has been pregnant one or more times previously). Multigravida preeclamptic women were also sub grouped on the basis of positive and negative history of pregnancy hypertension. Subjects using any drugs, smoking or having diabetes mellitus, renal disease, cardiovascular disease, chronic hypertension or symptomatic infectious diseases of upper respiratory tract were excluded from the study. After getting approval from the hospitals and

the Ethical review committee, participants were informed about the study and consent was taken from the subjects. Data about all of the participants of the study was taken on a prestructured proforma designed for the study. For measuring C- reactive protein level, venous blood samples were collected using sterilized disposable syringes during the regular antenatal checkup at OPD or in the antenatal ward patients. Blood was centrifuged and

serum was separated and preserved at -80C. CRP was estimated by using commercially available ELISA kit. The data was analysed using graph pad prism version 5. Mean values were compared between two groups using student t-test.

RESULTS Results are shown in Mean ± SEM. Mean ± SEM of age of preeclamptic group is 27.04 ± 0.5931 and that of control group 25.36 ± 0.3606. hsCRP level measured in preeclamptic group were significantly higher 14.80 ± 0.679 mg/l compared to control group 4.978 ± 0.336 mg/l with p-value 0.0001. Further preeclamptic group was divided into two groups i.e., primigravida and multigravida. Level of hsCRP was significantly high in primigravida16.58 ± 0.7438 mg/l than in multigravida 12.29 ± 1.115 mg/l with p-value 0.001. No significant difference was observed in hsCRP level in primi and multigravida of control group. Preeclamptic multigravida group was also divided into two groups on the basis of history of hypertension in previous pregnancy and it was found that the multigravida preeclamptic women with positive history of hypertension in pregnancy showed significantly high level of hsCRP level 20.64 ± 0.952 mg/l as compared to those multigravida preeclamptic women without any history of hypertension 8.795 ± 1.111 mg/l with p-value <0.0001. p<0.05 is taken as significant.

Table I: Inter group comparison of age (years) and CRP (mg/l) level

Preeclamptic group (n= 70)

Control group (n= 70)

Age (years) 27.04 ± 0.593 25.36 ± 0.360

CRP mg/l 14.80 ± 0.679*** 4.978 0± 0.336

*** Significant at P< 0.001

VOL. 61 (2) C-REACTIVE PROTEIN IN PREECLAMPTIC WOMEN 309

Table II: Inter group comparison for obstetric index with reference to CRP (mg/l) value

Preeclampsia (n=70) Mean±SEM

Control (n=70) Mean±SEM

CRPmg/l Primigravida n=41

Multigravida n=29

Primigravida n=34

Multigravida n=36

16.58 ± 0.743 12.29 ± 1.115 5.12 ± 0.515 4.843 ± 0.443

Table III: Level of CRP (mg/l) in multigravida preeclamptic patients with and without history of

hypertension in pregnancy

History of hypertension in pregnancy

Multigravida Preeclamptic subjects

Mean ± SEM

Positive 17 20.64 ± 0.952

Negative 12 8.79 ± 1.111

DISCUSSION

Preeclampsia is a multisystem disorder of human pregnancy. It is characterized by high blood pressure, proteinuria, platelet aggregation and edema. Pathophysiologically, the hallmark of preeclampsia is vasoconstriction which causes maternal hypertension and reduced uteroplacental blood flow resulting in disturbed vascular endothelial integrity with increased vascular penetrability and activation of hyper coagulation (Nanda et al., 2012). There is strong evidence that preeclampsia is a systemic inflammatory disease associated with endothelial cell damage or activation and hyper coagulation. CRP being a sensitive marker of inflammation and tissue damage has been suggested to show an important role in the pathogenesis of preeclampsia. CRP acts as scavenger and is responsible for the clearance of membrane and nuclear antigens (Murthy et al., 2012). Hence, its measurement as a marker for early detection of preeclampsia has been of considerable interest.

The present study shows increased level of CRP in preeclamptic subjects as compared to normotensive pregnant women. This elevation in C-reactive protein level in preeclamptic subjects may be due to exaggerated systemic inflammation during pregnancy that may lead to endothelial dysfunction and preeclampsia (Can et al., 2011; Deveci et al., 2009; Hwang et al., 2007; Kameswaramma, 2014). The etiology of preeclampsia is still not clear. The

most common concept is the poor implantation that causes placental hypoxia and thought to augment the release of inflammatory stimuli into maternal circulation which stimulates the production of proinflammatory cytokines by the placenta as response (Ertas et al., 2010). It has also been observed that degree of severity of the disease relates with the elevated level of CRP protein level, this elevation can be useful in determining the severity of preeclampsia (Ertas et al., 2010). However study of Tavana et al. (2010) showed no significant difference in various hypertensive disorders of pregnancy compared to control pregnant women. This contradiction may be due to the difference of sample size.

Increased concentrations of C-reactive protein in preeclampsia also amplify the involvement of innate immunity in the pathogenesis of preeclampsia, as it is an important component of innate immune system (Molvarec et al., 2011). Serum levels of CRP are higher in healthy pregnant women as compared to non-pregnant women because even normal pregnancy is accompanied by mild systemic inflammatory response (Qiu et al., 2004).

Moreover, in preeclamptic group mean CRP level was high in both primigravida and multigravida preeclamptic subjects but it was more intensified in primigravida than multigravida showing that primigravida have high rate of obstetric complications when compared to multigravida

310 Y. ASHRAF ET AL BIOLOGIA (PAKISTAN)

preeclamptic subjects. No significant difference of mean CRP level was however, observed in primigravida and multigravida among control group. This high risk of obstetric complications in primigravida might be due to the low age as most of the primigravida preeclamptic subjects were in the age of 18-26 years. Young age of primigravida individuals along with lack of awareness about importance of antenatal care might have withdrawn them from taking antenatal care till the progress of obstetric complication (Jaspinder & Kawaljit, 2012). Murthy et al. (2012) have also observed raised CRP level in primigravida than multigravida among preeclamptic patients. Further, an increased incidence of pregnancy induced hypertension in primigravida compared to multigravida preeclamptic patients has also been reported earlier by Cunningham et al. (2005).

The present study also reveals that women with history of hypertension or preeclampsia in previous pregnancy in multigravida preeclamptic group showed significantly higher mean CRP level than those without history of hypertension suggesting the association of recurrence of preeclampsia with pre-pregnancy levels of common cardiovascular and inflammatory markers (Van Rijn et al., 2014). Elevated CRP level has also been reported by Brown et al. (2013) in females who have history of hypertension in pregnancy.

CONCLUSION Preeclamptic women show high level of C reactive protein as compared to normotensive pregnant women in third trimester of pregnancy suggesting that elevated levels of CRP can be taken as potential indicator of preeclampsia. Even in preeclamptic group, primigravida shows higher level of CRP than multigravida patients. Further, multigravida preeclamptic women with history of hypertension in previous pregnancy show significantly higher level of CRP than those without a history of hypertension.

REFERENCES Black, S., Kushner, I & Samols, D., 2004. “C

reactive protein” J. Biol. Chem., 279: 48487-48490.

Brown, C. M., Turner, S. T., Bailey, K. R., Mosley, T. H. Jr, Kardia, S. L., Wiste, H. J., Kullo, I. J. & Garovic, V. D., 2013. Hypertension in pregnancy is associated with elevated C reactive protein levels later in life. J. Hypertens., 31(11): 2213–2219.

Can, M., Sancar, E., Harma, M., Guven, B., Mungan, G. & Acikgoz, S., 2011. Inflammatory markers in preeclamptic patients. Clin. Chem. Lab. Med., 49: 1469-72.

Cunningham, F., Leveno, K., Bloom, S., Hauth, J., Gilstrap, L. & Wenstrom, K., 2005. Williams Obstetrics. 22

nd ed. McGraw-Hill. pp: 131,

768, 779. Deveci, K., Sogut, E., Evliyaoglu, O. & Duras, N.,

2009. Pregnancy associated plasma protein-A and C-reactive protein levels in pre-eclamptic and normotensive pregnant women at third trimester. J. Obstet. Gynecol. Res., 35: 94-8.

Ertas, I. E., Kahyaoglu, S., Yilmaz, B., Ozel, M., Sut, N., Guven, M. A. & Danisman, N., 2010. Association of maternal serum high sensitive C-reactive protein level with body mass index and severity of pre-eclampsia at third trimester. J. Obstet. Gynaecol. Res., 36(5): 970-7.

Halder, A., Agarwal, R., Sharma, S. & Agarwal, S., 2013. Predictive significance of C reactive protein in spontaneous preterm delivery: a prospective cohort study. Int. J. Reprod. Contracept. Obstet. Gynecol., 2(1):47-51.

Hwang, H. S., Kwon, J. Y., Kim, M. A., Park, Y. W. & Kim, Y.H., 2007. Maternal serum highly sensitive c reactive protein in normal pregnancy and preeclampsia. Int. J. Gynaecol. Obstet., 98(2): 105- 9.

Jaspinder, K. & Kawaljit, K., 2012.Obstetric complications: Primiparity Vs. Multiparity. Eur. J. Exp. Biol., 2(5):1462-1468.

Kameswaramma, K., 2014. Estimation of C - Reactive Protein, Magnesium and Uric Acid Levels in Preeclampsia Patients in Comparison with Normal Pregnant Women. Sch. J. App. Med. Sci., 2 (2B): 628-632.

Molvarec, A., Szarka, A., Walentin, S., Beko, G., Karádi, I., Prohászka, Z., & Rigo, J. Jr, 2011. Serum leptin levels in relation to circulating cytokines, chemokines, adhesion molecules and angiogenic factors in normal pregnancy and preeclampsia. Reprod. Biol. Endocrinol., 9:124.

Murthy, K, O.,Vasantkumar, R. R.,Dhananjaya, B. S., Sultana, S. & Shobha, U. N., 2012. Pattern of C – reactive protein in preeclampsia and normal pregnancy. Int. J. Biol. Med. Res., 3(4): 2616-2621.

Nanda, K., Sadanand, G., Muralidhara, K. C. S. & Mahadevappa, K. L., 2012. C-Reactive protein as a predictive factor of

http://www.ncbi.nlm.nih.gov/pubmed/?term=Turner%20ST%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bailey%20KR%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kardia%20SL%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wiste%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kullo%20IJ%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.ncbi.nlm.nih.gov/pubmed/?term=Garovic%20VD%5BAuthor%5D&cauthor=true&cauthor_uid=24029867

http://www.amazon.ca/s/ref=dp_byline_sr_book_2?ie=UTF8&field-author=Kenneth+Leveno&search-alias=books-ca

http://www.amazon.ca/s/ref=dp_byline_sr_book_3?ie=UTF8&field-author=Steven+Bloom&search-alias=books-ca

http://www.amazon.ca/s/ref=dp_byline_sr_book_6?ie=UTF8&field-author=Katharine+Wenstrom&search-alias=books-ca

http://www.ncbi.nlm.nih.gov/pubmed?term=Kahyaoglu%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed?term=Yilmaz%20B%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed?term=Ozel%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed?term=Sut%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed?term=Sut%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed?term=Guven%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

http://www.ncbi.nlm.nih.gov/pubmed/?term=Danisman%20N%5BAuthor%5D&cauthor=true&cauthor_uid=20722986

VOL. 61 (2) C-REACTIVE PROTEIN IN PREECLAMPTIC WOMEN 311

preeclampsia. Int. J. Biol. Med. Res., 3(1): 1307-1310.

Qiu, C., Luthy, D. A., Zhang, C., Walsh, S. W., Leisenring, W. M. & Williams, M. A., 2004. A prospective study of maternal serum C-reactive protein concentrations and risk of preeclampsia. J. Hypertens., 17: 154-60.

Tavana, Z., Zolghadri, J. & Madadi, G., 2010. The Relationship between Maternal Serum

Highly Sensitive C-Reactive Protein, Leptin And Hypertensive Disorders Of Pregnancy. Internet. J. Endocrinol., 6(2).

Van Rijn, B. B., Veerbeek, J. H., Scholtens, L. C., Post Uiterweer, E. D., Koster, M. P., Peeters, L. L., Koenen, S. V., Bruinse, H. W. & Franx, A., 2014. C-reactive protein and fibrinogen levels as determinants of recurrent preeclampsia. J. Hypertens., 32(2): 408-14.


http://www.ncbi.nlm.nih.gov/pubmed/?term=Veerbeek%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Scholtens%20LC%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Post%20Uiterweer%20ED%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Koster%20MP%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Peeters%20LL%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Koenen%20SV%5BAuthor%5D&cauthor=true&cauthor_uid=24351805

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bruinse%20HW%5BAuthor%5D&cauthor=true&cauthor_uid=24351805



http://www.ncbi.nlm.nih.gov/pubmed/?term=Franx%20A%5BAuthor%5D&cauthor=true&cauthor_uid=24351805



Molecular Screening of Aroma Genes in Indigenous and Exotic Rice

Germplasm

MUHAMMAD ASHFAQ1, HAFIZ UMAR FAROOQ

1, MUHAMMAD SABAR

2,

*AMNA ALI

1 &

MUHAMMAD ALI1

1Institute of Agricultural Sciences, University of the Punjab Lahore, Pakistan

2Rice Research Institute Kala Shah Kaku, Muridekay, Punjab, Pakistan

ABSTRACT

Aromatic rice varieties are famous all over the world for its specific taste, superfine long grains and specific aroma which is caused by 2-acetyl-1- Pyroline (2AP) compound. Molecular markers provide the easiest way to distinguish aromatic and non-aromatic varieties on the basis of polymorphism expressed in specific band sizes. A mutation resulting from 8 bp deletions on exon 7 in a gene (badh2) which encodes betaine aldehyde dehydrogenase of chromosome 8 is responsible for the aromatic expression. Two external primers produce a band of 580 bp which is a control check for both aromatic and non-aromatic lines. Two Internal primers anneal with their respective external primers and give 257 bp size band for aromatic and 355 bp for non-aromatic rice lines. Using gene specific marker for aroma, 75 genotypes of rice were screened. PCR analysis showed that 28 varieties were aromatic, 6 varieties were heterozygous and 41 varieties were non-aromatic. These results will be helpful for the rice breeders to develop new aromatic rice varieties by exploiting the identified rice genotypes carrying aroma gene. Key words: Molecular screening, Aroma, DNA markers, rice germplasm

_____________________________________________________________________________________

INTRODUCTION

Rice (Oryza sativa L.) occupies second position amongst the major staple food grains crops all over the world after wheat. It is a major source of one half of the total world population (Khush, 2005). Various varieties of Rice are cultivated in different areas of the world. Some varieties come under geographical indication and restricted to that specific area where they are present. For example Basmati rice in Pakistan and India, Milfor of Philippines, Sadri of Iran, Della of the United States and Jasmine rice in Thailand (Bhattachrjee et al., 2002). Aromatic rice varieties are famous for its specific taste, superfine long grains and its aroma which is caused by the presence of a compound 2-acetyl-1- Pyroline (2AP) (Buttery et al., 1983; Yoshihashi, 2002). Except roots, this compound is present in all parts of the plant. It is very difficult for researchers to distinguish between aromatic and non-aromatic varieties. Classical methods of smelling or chewing are not convenient and reliable methods (Berner & Hoff, 1986).

However some methods are used for screening of aromatic and non-aromatic rice varieties. In 1971, IRRI was given a simple laboratory method to detect the presence of aroma. In this technique, one gram of fresh milled rice is placed in 50 mL falcon tube and 20 mL distilled water is added in it. Then cover the falcon with

aluminum foil and placed inside the boiling water bath for 10 minutes. After cooling, the presence of aroma detected for every sample and scored as non-aromatic, moderately aromatic and strongly aromatic (Hien & Yoshihashi, 2006). Another chemical method for detection of aroma in rice is using dilute alkali (1.7% KOH) (Sood & Siddiq, 1978). In this method, released aroma is smelled by experts trained for evaluation of aromatic rice. (Lorieux et al., 1996). Sensory methods of aroma detection are not suitable for large number of samples because senses vary from person to person and physical damage in nasal passages may occur due to direct exposure with chemicals during smelling. New methods like gas chromatography for detection of aroma are available but these are complicated and high cost chemicals and large amount of leaf tissues are required for analysis.

The results are not always reliable (Widjaja et al., 1996; Sriseadka et al., 2006). Aroma in rice is a recessive trait. Initially it was considered that a (fgr) gene present on chromosome 8 is responsible for this important trait. (Sood & Siddiq, 1978; Lorieux et al., 1996; Yoshihashi, 2002; Bradbury et al., 2005a). After sequence analysis and genetic mapping of fgr region, It was reported that 8 bp deletions occurred in a (badh2) gene encoding betaine aldehyde dehydrogenase is responsible for fragrance in rice which is located in exon 7 on

314 M. ASHFAQ ET AL BIOLOGIA (PAKISTAN)

chromosome 8 of O. sativa (Bradbury, 2009). Molecular markers such as SSRs (Simple Sequence Repeats or SNPs (Single Nucleotide Polymorphism) are closely linked with aroma responsible gene. It is very simple and very cheap method for screening of aroma for large number of varieties and very small amount of leaf sample is required for this purpose. So, a perfect marker was proposed for aromatic genotyping which targets on 8 bp deletion. The present research was conducted for screening of aroma genes in various rice lines using PCR based markers.


Plant materials

Seventy five (75) rice lines/genotypes originated from diverse locations were collected from Rice research Institute Kala Shah Kaku (list of rice varieties given in Table 1). Some of the rice lines used in this experiment included commercially approved rice varieties. All these varieties were grown in the controlled atmospheric growth chamber (Temperature = 35

oC & Relative Humidity

= 70±5 %) using seedling jars in Molecular breeding lab at Rice Research Institute Kala Shah Kaku.

Genomic DNA Isolation

Total genomic DNA of all the rice lines was isolated from fresh young leaves at seedling stage of plant growth using DNA extraction mini prep protocol. Fresh leaves (5 cm long) were grounded in morter with a pestle by addition of 800 μL pre heated DNA extraction buffer (100 mM Tris HCl pH 8.0, 50 mM EDTA pH 8.0, 500 mM NaCl, 1.25% SDS W/V, 0.38 g per 100 mL Sodium bisulfite). The grinded samples were transferred into 2.0 mL tubes and placed the tubes in water bath at 65

oC for 20

minutes. After removing the tubes from water bath, 800 μL of Chloroform: Isoamyl alcohol (24:1) was added in a fume hood. After closing the caps tightly,

the tubes were inverted gently and repeatedly for 3-5 minutes for mixing. The tubes were centrifuged for 8.0 minutes at 11,000 rpm using micro centrifuge (Hettich, Germany). Lower chloroform phase was discarded and upper aqueous phase supernatant (500-600 µL) was pipetted out into a new 1.5mL micro-centrifuge tube labeled with the same identification number. In order to precipitate the DNA, 1000 μL chilled 100% absolute Ethanol added in 1.5 mL ependorf tubes followed by spinning at 13,200 rpm for 12 minutes. DNA molecules clumped together and pelleted out. Aqueous solution was discarded and washed the pellets with 70% Ethanol to remove the salts and impurities. Again the sample was spun at 13,200 rpm for 3 minutes. The pellet was re-suspended in 100 µL autoclaved 1X TE (Tris EDTA) buffer (10 mM Tris-HCl pH 8.0,1 mM EDTA pH 8.0). The DNA pellets were dissolved in TE buffer by placing into water bath at 65

oC.

DNA was quantified with Nano drop (Thermo USA). Then DNA dilutions (15-20 ng/ul) were prepared for PCR reactions.

PCR Analysis

PCR reactions were carried out in 20 µL containing 4 µL of genomic DNA, 1 µl of each primer (ESP, IFAP, INSP and EAP, sequences are in Table 1), 2 µL of 10X buffer, 1.6 µL of MgCl2 , 1 µL of dNTPs and 0.2 µLTaq DNA polymerase . Thermal cycling conditions of PCR followed by initial denaturation at 94

oC for 5 minutes, followed by 35

cycles of denaturation at 94oC for 30 seconds,

annealing at 55oC for 30 seconds and extension at

72oC for 45 minutes. Amplification products were

detected in horizontal gel electrophoresis system (1.5 % Agarose gel). Running time was 45 minutes at 120 V and post staining with Ethidium bromide for 20 minutes in 1X TBE buffer and then visualized in Gel documentation system.

Table I: List of primer used for analysis of aroma in rice

Primer name Sequence of primers Reference

ESP (External Sense Primer) TTGTTTGGAGCTTGCTGATG

Bradbury et

al., 2005b

EAP (External Anti Sense Primer) AGTGCTTTACAAAGTCCCGC

IFAP (Internal Fragrant Antisense

Primer)

CATAGGAGCAGCTGAAATATATACC

INSP(Internal Non -Fragrant Sense

Primer)

CTGGTAAAAAGATTATGGCTTCA

RESULTS AND DISCUSSIONS

There were four primers which were used for screening of aroma genes, two primers were

forward and two were reverse primers. Two external primers ESP and EAP annealed at conserved regions of both aromatic and non-aromatic varieties and exterior to the area where the mutation occurs.

VOL. 61 (2) MOLECULAR SCREENING OF AROMA GENES 315

These primers gave band of 580 bp in both aromatic and non-aromatic rice varieties. (Bradbury et al., 2005). Two internal primers IFAP and INSP which were specific for specific DNA sequence and annealed with their matching primers ESP and EAP respectively. There were three possible outcomes in amplified PCR products, 580 bp band was produced in both aromatic as well as non-aromatic varieties. a single band of 257 bp indicated the homozygous aromatic variety and similarly a single band of 355 bp showed the homozygous non-aromatic. The presence of all the three bands 257, 355 and 580 bp

considered to be Heterozygous. In present research 75 rice varieties were used. Most of these varieties are indigenous (Pakistan varieties) but some were exotic. PCR analysis concluded that 28 varieties were aromatic, 6 varieties were heterozygous and 41 varieties were non-aromatic. This method of screening of rice germplasm is very simple, inexpensive and convenient for screening of wide range of rice varieties with 100% accuracy.

Fig., 1: Banding patterns showing the presence and absence of aroma genes in rice germplasm amplified 257 bp and 580 bp fragments for aroma; 355 bp and 580 bp fragments for non-aromatic and 257, 355 and

580 bp bands for heterozygous lines.

Lane M=1 kb ladder,lane1=1, lane 2=154, lane3=312,lane4=436-1,lane5=436-3,lane6=448, lane7=449,lane8=454,lane9=1021-3,lane10=1021-5,lane11=1021-6,lane12=1021-118, lane13=1053-1-3,lane14=1053-2-2,lane15=1053-2-4,lane16=IR1552, lane17=4029-A,lane18=4029-B,lane19=4029-3,lane20=4048-11,lane22=4086, lane23=4176,lane24=4266 lane 25=4287-2-3, lane 26= 4288, lane27=4289, lane28=4291, lane29=4320 lane30 =4321, lane31=4375, lane32=4959, lane33=41377-1, lane34=45283-7, lane35=DGWG, lane36=Giza 171, lane37=IR-8, lane38=1R-6-45, lane39=IR-26, lane40=IR-28, lane41=LUKE 3, lane42=PK 13-79-9-1-1, lane43=PK 1385-9-8-3-1 , Lane44=PK 1399, lane45=PK 1498-6-2-4, lane46=PK 2773-1-2-3 , lane47=KSK 403, lane 48= PK 7797-1-2-1-1

316 M. ASHFAQ ET AL BIOLOGIA (PAKISTAN)

Table II: Molecular screening of aroma genes in rice

Sr No Designation Grain Type Variety type Origin Aroma status

1 1 F I Pak Aromatic 2 154 C I Pak Aromatic 3 312 F I Pak Aromatic 4 436-1 F I Pak Aromatic 5 436-3 F I Pak Aromatic 6 448 C I Pak Aromatic 7 449 F I Pak Non Aromatic 8 454 F I Pak Aromatic 9 1021-3 F I Pak Aromatic 10 1021-5 F I Pak Aromatic 11 1021-6 F I Pak Aromatic 12 1021-8 F I Pak Non Aromatic 13 1053-1-2 F I Pak Heterozygous 14 1053-2-2 F I Pak Non Aromatic 15 1053-2-4 F I Pak Aromatic 16 IR 1552 F I Pak Non Aromatic 17 4029-A F I Pak Aromatic 18 4029-B F I Pak Non Aromatic 19 4029-3 F I Pak Non Aromatic 20 4048-11 F I Pak Non Aromatic 21 4086 C I Pak Non Aromatic 22 4176 F I Pak Heterozygous 23 4266 F I Pak Aromatic 24 4287-2-3 C I Pak Non Aromatic 25 4288 F I Pak Non Aromatic 26 4289 F I Pak Non Aromatic 27 4291 F I Pak Non Aromatic 28 4320 F I Pak Non Aromatic 29 4321 C I Pak Non Aromatic 30 4375 C I Pak Non Aromatic 31 4959 C I Pak Non Aromatic 32 41377-1 C I Pak Non Aromatic 33 DGWG C I IRRI Non Aromatic 34 Giza 171 C J Egypt Non Aromatic 35 IR-8 C I IRRI Non Aromatic 36 1R-6-45 C I IRRI Non Aromatic 37 IR-26 C I IRRI Non Aromatic 38 LUKE 3 C J IRRI Non Aromatic 39 Indian Bas F I India Aromatic 40 PK 1385-9-8-3-1 C I Pak Non Aromatic 41 PK 1399 C I Pak Non Aromatic 42 PK 1498-6-2-4 C I Pak Non Aromatic 43 KSK 403 C I Pak Non Aromatic 44 PK 7797-1-2-1-1 C I Pak Aromatic 45 99417 F I Pak Aromatic 46 99512 F I Pak Non Aromatic 47 98408 F I Pak Non Aromatic 48 PK 8647 F I Pak Non Aromatic 49 B 6144 C J IRRI Non Aromatic 50 KSK 434 C I Pak Non Aromatic 51 RC82 C I IRRI Non Aromatic 52 IRBB57 C I IRRI Non Aromatic 53 35234 C I Pak Heterozygous 54 34050 F I Pak Heterozygous 55 33897-1 C I Pak Heterozygous 56 Pusa Bas 1 F I India Aromatic 57 PK 178-2 F I Pak Non Aromatic 58 PK 177 F I Pak Non Aromatic 59 Palman 246 F I Pak Heterozygous

VOL. 61 (2) MOLECULAR SCREENING OF AROMA GENES 317

60 IR-36 C I IRRI Aromatic 61 310 C I Pak Non Aromatic 62 NARC-10-2 C I Pak Aromatic 63 Khush Bas F I IRRI Non Aromatic 64 98 PP-4 F I Pak Aromatic 65 98 PP-50 F I Pak Aromatic 66 NIA-625 C I Pak Non Aromatic 67 Bas 385 F I Pak Aromatic 68 Bas T3 F I Pak Aromatic 69 Bas 370-EP-28 F I Pak Aromatic 70 Bas 370 F I Pak Aromatic 71 PK 13-79-9-1-1 C I Pak Aromatic 72 Bas-1 F I Pak Non Aromatic 73 44156A C I Pak Non Aromatic 74 Bas 198 F I Pak Aromatic 75 Bas 134 F I Pak Aromatic

F=Fine grains; C= Coarse grains; I= Indica; J= Japonica Acknowledgment

We are, specially, thankful to Director, Rice Research Institute Kala Shah Kaku, who arranged the rice germplasm for screening of rice aroma genes and University Grant Commission (University of the Punjab) for providing the funds for this research work.

REFERENCES

Berner, D. K. & Hoff, B. J., 1986. Inheritance of Scent in American Long Grain Rice. Crop Sci., 26(5): 12-18.

Bhattacharjee, P., Singhal, R. S. & Kulkarni, P.R., 2002. Basmati rice: a review. Int. J. Food Sci. Technol., 37(1): 1-12

Bradbury, L. M. T., 2009. Identification of the gene responsible for fragrance in rice and characterisation of the enzyme transcribed from this gene and its homologs. Mol. Breed., 19: 279-283.

Bradbury, L. M. T., Fitzgerald, T. L., Henry, R. J., Jin, Q. & Waters, D. L. E., 2005a.The gene for fragrance in rice. Plant Biotechnol. J., 3: 363-370.

Bradbury, L. M. T., Henry, R. J., Jin, Q., Reinke, R. F. & Waters, D. L. E., 2005b. A perfect marker for fragrance genotyping in rice.Mol. Breed., 16: 279-283.

Buttery, R. G., Ling, L. C., Juliano, B. O. &Turnbaugh, J. G., 1983. Cooked rice aroma and 2-acetyl-1-pyrroline.J. Agric. Food Chem., 31: 823-826.

Hien, N. & Yoshihashi, T., 2006. Evaluation of aroma in rice (Oryza sativa L.) using KOH method, molecular markers and measurement of 2-acetyl-1-pyrroline concentration. Japanese J. Agri. Sci., 50: 190-198.

Khush, G. S., 2005. What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol. Biol., 59: 1-6.

Lorieux, M., Petrov, M., Huang, N., Guiderdoni, E. & Ghesquiere, A., 1996. Aroma in rice: genetic analysis of a quantitative trait. Theor. Appl. Genet., 93: 1145-51.

Sood, B. G. & Siddiq, E. A., 1978. A rapid technique for scent determination in rice. Indian J. Genet. Plant Breed., 38: 268-271.

Sriseadka, T., Wongpornchai, S., Kitsawatpaiboon, P., 2006. Rapid method for quantitative analysis of the aroma impact compound, 2-acetyl-1-pyrroline, in fragrant rice using automated headspace gas chromatography. J. Agri. Food Chem., 54(21): 8183-9.

Widjaja, R., Craske, J. D. & Wootton, M., 1996. Comparative studies on volatile components of non-fragrant and fragrant rices.J. Sci. Food Agri., 70: 151-161.

Yoshihashi, T., 2002. Quantitative Analysis on 2-Acetyl-1-pyrroline of an Aromatic Rice by Stable Isotope Dilution Method and Model Studies on its Formation during Cooking. J. Food Sci., 67: 619-622.


http://www.ncbi.nlm.nih.gov/pubmed/?term=Sriseadka%20T%5BAuthor%5D&cauthor=true&cauthor_uid=17032027

http://www.ncbi.nlm.nih.gov/pubmed/?term=Wongpornchai%20S%5BAuthor%5D&cauthor=true&cauthor_uid=17032027

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kitsawatpaiboon%20P%5BAuthor%5D&cauthor=true&cauthor_uid=17032027

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kitsawatpaiboon%20P%5BAuthor%5D&cauthor=true&cauthor_uid=17032027



Effect of Metal Dust on Workers of Cutlery Industry in Wazirabad, Pakistan

RABIA MEHMOOD & *NADEEM SHEIKH

Department of Zoology, University of the Punjab, Q-A Campus, Lahore, Pakistan.

ABSTRACT

Wazirabad, a city of Pakistan, is well reputed for its cutlery works. In this regard extensive grinding of metals particularly of stainless steel is in practice over here. The toxicity of metal is associated with the path of its introduction in to the body during exposure. Some particular metals are carcinogenic and the employees of metal handling workshops have an extreme risk of exposure to multi metallic dust. The purpose of this study was to find out the hazardous effects of metal dust in the workers of cutlery industry. Blood samples for control were drawn from healthy population of Lahore city (C-1), inhabitants of Wazirabad (E-1=No direct exposure to metal dust) and the workers of grinding units of cutlery industry and grouped in accordance with the duration of exposure to metallic dust i.e. 1-13, 14-26 and 27-40 years for E-2, E-3 and E-4 respectively. Serology was performed by the utilization of commercially available ready to use kits. Serological analysis showed significant positive variations in serum urea (P=0.0013), serum creatinine (P=0.0142), bilirubin total (P=0.0178), ALT (P=<0.0001), ALP (P=0.0318), triglycerides (P=0.0357), cholesterol (P=0.0401), HDL (P=0.0006) and LDL (P=0.0010) when compared with the control. It can be concluded that exposure of metal dust in the cutlery industry of Wazirabad is affecting adversely the normal functioning of kidneys, liver and it calls for serious health concern. Key word: metal dust, cutlery industry, serological analysis

INTRODUCTION

In developing countries like Pakistan where the safety measures are barely accomplished at a very low level, industrial well-being is a burning question and a hot issue (Hussain et al., 2013). It was reported in Tanzania in 2003 that there was a high level of exposure to numerous health hazards and there is a poor use of protective equipment (Rongo et al., 2004). Health issues like dizziness, Cough, headache, eye irritation, skin allergy and backache of cutlery industry workers of Wazirabad city can be attributed to the long term exposure of metallic dust (Hussain et al., 2013).

The metal toxicity is related to its route of exposure viz. inhaled, ingested or absorbed via skin. Certain metals are carcinogenic and the workers in metal handling factories are at maximum risk of exposure (Singh, 2005).

Metallic dust, produced during the processing of certain hard metals cause respiratory tract damage (Lison, 1996). Cutlery industry workers experience heavy metal dust exposure that is produced in whetting or grinding unit (WHU), one of the three units of cutlery industry (Hussain et al., 2013), where mostly the grinding of stainless steel articles is carried out.

Iron-based alloys that contain a minimum of 11% Chromium (Cr) are characterized as stainless steels. Iron and Cr together achieve their stainless

characteristics because of the formation of an invisible adherent chromium rich oxide surface film. Copper, titanium, selenium, nickel, molybdenum, nitrogen, aluminum, silicon, niobium, carbon and sulfur are some other elements which are added to improve the specific characteristics of stainless steel (Davis, 1994). In determining the potential of pneumotoxic reactions concomitant to the stainless steel welding fumes, the presence and composition of constituent metals is significant. Substantial levels of chromium and nickel that are present in welding fumes of stainless steel induce inflammation and damage to the lungs in animal models (Antonini et al., 2004). Iron particulate matter exposure to the whetting workers cause lungs damage (Qazi et al., 2009).

Fe, Cu, Cr and Co were previously reported as redox active metals which generate reactive radicals or free radicals leading to oxidative stress in biological systems .In oxidative stress, a state of formation of increased reactive oxygen species (ROS) is reached due to the disruption of metal ion homeostasis; that can further induce protein modification, lipid peroxidation, DNA damage and other effects (Jomova & Valko, 2011).

The present study was conducted to check the effects of metal dust in terms of serological parameters in the workers of cutlery industry of Wazirabad.

320 R. MEHMOOD & N. SHEIKH BIOLOGIA (PAKISTAN)


Sampling

Questionnaire based data was collected from inhabitants of Wazirabad and the workers of cutlery industry specifically of the whetting units grouped on the basis of duration of exposure to the metallic dust. Data for control group was collected from the persons in Lahore near university of the Punjab.

Assessment of Serological Parameters

Blood samples of inhabitants of Wazirabad and the workers working in metal grinding industry were collected and divided in four experimental groups E-1, E-2, E-3 and E-4 these were compared with C-1 control group. C-1 control group consisted healthy population of Lahore. The E-1 experimental group contained healthy population of Wazirabad while the duration of exposure for E-2, E-3 and E-4 experimental groups is 1-13, 14-26 and 27-40 years respectively. The sera were isolated by spinning the

samples at 4000 rpm for 15 minutes. Liver functioning tests (alkaline phosphatase, alanine transaminases and bilirubin total), renal functioning tests (serum urea, serum creatinine and serum uric acid) and lipid profile (cholesterol, triglycerides, high density lipoprotein and low density lipoprotein) were carried out using commercially available ready to use kits (Linear Chemicals S.L. Spain).


Data were analyzed using one-way ANOVA with post-hoc (Tukey’s test) by using Graphpad prism 5.

RESULTS

Liver Functioning Tests

Serum alkaline phosphatase (ALP) and alanine aminotransferase activity was significantly high in the experimental group E-4 as compared to the C-1 control group and concentration of serum bilirubin total augmented significantly in experimental groups.

(a) (b)

(c)

Fig., 1: Inter group comparison of (a) Alkaline Phosphatase (U/L), (b) ALT (U/L) and (c) Bilirubin Total (mg/dl). Outcomes are Mean ± SEM, evaluated by the post-hoc one-way ANOVA. Significance levels are

*=P≤0.05, **=P≤0.01, ***=P≤0.001.

VOL. 61 (2) EFFECT OF METAL DUST ON WORKERS 321

Renal Functioning Tests Statistically substantial escalation of serum urea and serum creatinine was observed in experimental

groups in comparison with control groups. While there was a significant reduction of 37% in E-4 experimental group (P=0.0002) in the levels of serum uric acid.

(a) (b)

(c)

Fig., 2: Inter group comparison of (a) Serum Urea (mg/dl), (b) serum creatinine (mg/dl) and (c) serum uric acid (mg/dl). Results are Mean ± SEM, analyzed by the post-hoc one-way ANOVA. Significance levels are

*=P≤0.05, **=P≤0.01, ***=P≤0.001.

Lipid Profile

There was an increase in level of cholesterol in E-4 experimental group as compared to C-1 control group. Serum triglycerides concentration was observed to rise in experimental groups when compared with control groups. Serum

H.D.L. level changed significantly and a decrease in H.D.L. level was observed in E-3 experimental group in contrast with C-1 control group. There was significant escalation in low density lipoprotein levels in experimental groups.


(a) (b)

(c) (d)

Fig., 3: Inter group comparison of (a) Cholesterol (mg/dl) (b) Triglycerides (mg/dl) (c) HDL (mg/dl) and (d) LDL (mg/dl). Results are Mean ± SEM, analyzed by the post-hoc one-way ANOVA. Significance levels are

*=P≤0.05, **=P≤0.01, ***=P≤0.001.

DISCUSSION The Alanine transaminases activity revealed

an increasing trend in the experimental groups and the elevation was statistically significant as compared to the control. ALT are the enzymes that are present in the mitochondria and cytosol of hepatocytes. Changed permeability of the hepatocytic membrane due to some turbulences in the metabolism or by some injury result in the release of these enzymes (Center, 2007).

A significant increase of serum ALP activity was observed in experimental groups in contrast to the control groups. Liver and biliary tract yield ALP in normal serum. The elevated level of ALP is related to the liver and bone diseases involving the biliary tract. Low levels of ALP can be observed in hypophosphatasia (Whyte, 1994). ALP activity reveals the release of cell membrane fragments in plasma as an outcome of injury or damage, and successive elevation in its activity is due to local

cholestasis pertinent to hepatic damage (Schlaeger et al., 1981). Obstruction in the flow of bile is primarily associated with the increased ALP level followed by an augmented serum total bile acid concentration and lastly hyperbilirubinemia (Brensilver & Kaplan, 1975).

High levels of ALT are found in the liver, while the heart, kidney skeletal muscle, lung, spleen and pancreas have lower levels of ALT. Clinically, the variation in ALT levels depicts the liver diseases relevant to some extent of hepatic necrosis including cirrhosis, viral or toxic hepatitis, carcinoma and obstructive jaundice (Zilva & Pannall, 1979). In acute conditions the extent of ALT activity increase in the plasma approximately reflects the number of effected hepatocytes (Center, 2007).

Concentration of bilirubin total was raised significantly in group E-3 as compared to group C-1, whereas E-2 and E-4 groups have slightly elevated values but not statistically significant. Increase in

VOL. 61 (2) EFFECT OF METAL DUST ON WORKERS 323

bilirubin can be caused by the haemolytic disorders or liver injury at periportal sites involving degenerate cells rising with disturbance of cell membrane integrity ultimately causing the retention of bile pigment in circulation. The cause of bilirubinaemia includes the bile duct obstruction, cirrhosis, hepatitis and deficiencies of some enzymes (Gopinath & Ford, 1972).

In renal functioning tests, decrease in the uric acid concentration and the increase in serum creatinine and blood urea level were statistically significant. Rise in urea level signpost the azotemia condition. The topmost end product of protein nitrogen metabolism is urea in humans the synthesis of which occurs in liver and is excreted in urine through kidneys. Increased serum urea level may possibly point toward liver diseases, diabetes, renal impairment, infection and congestive heart failure (Henry & Reed, 1974).

Levels of triglycerides and cholesterol increased significantly in experimental groups. Triglycerides are the principal lipids found in the human plasma. Diagnostic appraisal and treatment of diabetes mellitus, nephrosis, liver obstruction and lipid metabolism diseases are contingent on the triglycerides level in serum (Bucolo & David, 1973). For intestinal absorption and biliary and liver functions, cholesterol estimation acts as a marker. Cholesterol test plays a strategic role in diagnosing and classifying the hyperlipoprotinaemias. Diabetes, nephritic syndrome and hypothyroidism are caused by elevated cholesterol level (Ellefson & Caraway, 1976).

Lower HDL level was found in experimental groups while the LDL level showed statistically significant elevation. The HDL level may depend upon compromised apoprotein A-1 synthesis .The severity of hepatic diseases and diagnosis are conversely associated with the serum LDL levels which in liver depend on the impaired synthesis of apoprotein B-100. Consequently, the fall of LDL level show the decreased synthesis of apoproteinmB-100 (Merli et al., 1990; Kroon & Powell, 1992). Conclusion

The presence of serious ailments i.e.

improper functioning of liver and kidney as well as lipid profile in the workers of cutlery industry can be perceived from the extensive fluctuations in the levels of certain serological parameters observed in the current study. Therefore, use of proper safety measures and education is strongly recommended.

Acknowledgment

The authors are thankful to the Vice Chancellor, University of the Punjab, for providing funds for the study under PU R&D project for year 2014-15.

REFERENCES

Antonini, J.M., Taylor, M.D., Zimmer, A.T. &

Roberts, J.R., 2004. Pulmonary responses

to welding fumes: role of metal constituents.

J. Toxicol. Environ. Health, Part A, Part A,

67(3): 233-249.

Brensilver, H.L. & Kaplan, M.M., 1975. Significance

of elevated liver alkaline phosphatase in

serum. Gastroenterology, 68(6): 1556-1562.

Bucolo, G. & David, H., 1973. Quantitative

determination of serum triglycerides by the

use of enzymes. Clin. Chem, 19(5): 476-

482.

Center, S.A., 2007. Interpretation of liver enzymes.

Vet.Clin. N Am.- Small, 37(2): 297-333.

Davis, J.R. (1994) Stainless steels. 1st ed. ASM

international.

Ellefson, R.D. & Caraway, W.T., 1976. Lipids and

lipoproteins. Fund. Clin.Chem., 474 pp.

Gopinath, C. & Ford, E.J.H., 1972. Location of liver

injury and extent of bilirubinaemia in

experimental liver lesions. Vet. Pathol., 9(2):

99-108.

Henry, R.J. & Reed, A.H., 1974. Normal values and

the use of laboratory results for the

detection of disease. Clin. Chem.,: 343-370.

Hussain, A., Qazi, J.I. & Ali, S., 2013. Health

imperilments in workers of a cutlery

industrial complex from Pakistan: A

preliminary survey. Biologia (Pakistan),

59(1): 43-50.

Jomova, K. & Valko, M., 2011. Advances in metal-

induced oxidative stress and human

disease. Toxicology, 283(2): 65-87.

Kroon, P.A. & Powell, E.E., 1992. Liver, lipoproteins

and disease: I. Biochemistry of lipoprotein

metabolism. J. Gastroenterol. Hepatol.,

7(2): 214-224.

Lison, D., 1996. Human toxicity of cobalt-containing

dust and experimental studies on the

mechanism of interstitial lung disease (hard

metal disease). Crit. Rev. Toxicol., 26(6):

585-616.


Merli, M., Riggio, O., Romiti, A., Ariosto, F., Mango,

L., Pinto, G., Savioli, M. & Capocaccia, L.,

1990. Basal energy production rate and

substrate use in stable cirrhotic patients.

Hepatology, 12(1): 106-112.

Qazi, J.I., Nasreen, Z. & Nazir, S., 2009. Effects of

inhalation of iron emission particles on

some lung cellular parameters in mice. Pak.

J. Zool, 41(2): 149-153.

Rongo, L.M.B., Barten, F.J.M.H., Msamanga, G.I.,

Heederik, D. & Dolmans, W.M.V., 2004.

Occupational exposure and health problems

in small-scale industry workers in Dar es

Salaam, Tanzania: a situation analysis.

Occup. Med., 54(1): 42-46.

Schlaeger, R., Haux, P. & Kattermann, R., 1981.

Studies on the mechanism of the increase

in serum alkaline phosphatase activity in

cholestasis: significance of the hepatic bile

acid concentration for the leakage of

alkaline phosphatase from rat liver.

Enzyme, 28(1): 3-13.

Singh, V.P., 2005 Metal toxicity and tolerance in

plants and animals. Sarup & Sons. New

Dehli. 328 pp.

Whyte, M.P., 1994. Hypophosphatasia and the Role

of Alkaline Phosphatase in Skeletal

Mineralization. . Endocr. Rev., 15(4): 439-

461.

Zilva, J.F. & Pannall, P.R., 1979. Plasma enzymes

in diagnosis. Clinical Chemistry in Diagnosis

and Treatment. Lloyd-Luke London, pp:

341-342.




New Equidae Remains from Dhok Pathan Formation of Siwaliks, Pakistan

TASNEEM IKRAM1, *MUHAMMAD AKBAR KHAN

2, MUHAMMAD KHALED SIDDIQUE

3, MUHAMMAD

ADEEB BABAR4, KHALID MAHMOOD

5, SEEMAB AZIZ

6 & MUHAMMAD AKHTAR

7

1 Government College for Woman, Farooq Colony, Sargodha, Pakistan

2,3,4,5,6,7 Department of Zoology, Quaid-e-Azam Campus, University of the Punjab, Lahore, Pakistan

ABSTRACT

New remains of Sivalhippus have been identified, described and discussed in this article. The specimens were collected from the Late Miocene-Early Pliocene sites of the Dhok Pathan type locality in the Chakwal district, Punjab province, Pakistan. The material represents the hipparionine species Sivalhippus theobaldi and contributes knowledge about the Late Miocene-Early Pliocene hipparionine horses of the Siwalik continental deposits. Key words: Perissodactyla, horses, hipparionine, Sivalhippus, Miocene, Pliocene.

INTRODUCTION

Sivalhippus has been recorded abundantly

from the Dhok Pathan Formation of the Middle Siwaliks and have been the topic of numerous publications (Lydekker, 1877, 1882, 1884, 1886; Pilgrim; 1910, 1913; Matthew, 1929; Colbert, 1935; Hussain, 1971; Nanda, 1978; Bernor & Hussain, 1985; Khan et al., 2014). The Dhok Pathan fossil mammal fauna as a whole has been characterized as a Sivalhippus - dominated endemic fauna. This genus is endemic in the Siwaliks of the subcontinent (Wolf et al., 2013). Sivalhippus are long in size, plications are less complicated than Hipparion and have visible enamel foldings. Sivalhippus theobaldi is a large sized Siwalik hipparionine (Gao & Ma, 1997; Wolf et al., 2013; Sun, 2013).

Recently, the presently studied material has been recovered from the type locality (Lat. 33º 07' N, Long. 72º 14' E) of the Dhok Pathan Formation of the Siwaliks. The Dhok Pathan village is located in the district Chakwal of the Punjab province, Pakistan (Fig., 1). Many field trips were arranged for the collection of Sivalhippus remains from the Dhok Pathan type locality. The identifiable fossils were carefully chosen from the gross collection and they were numbered and separated for the taxonomic study. The specimens under study have been catalogued as GCS 13/24 (GCS - Government College of Science, institutional abbreviation) and PUPC 69/117 (PUPC – Punjab University Palaeontological Collection, institutional abbreviation). The measurements are expressed in millimeters (mm). Measurements given for teeth are occlusal length and occlusal width. Upper case letters use for upper dentition and lower case letter

for lower dentition. The terminology and measurement of the teeth follow Wolf et al. (2013).

Fig., 1: Map of the Potwar Plateau in Northern

Pakistan; reference locality of the Siwaliks encircled.

SYSTEMATIC PALAEONTOLOGY

Family Equidae Gray, 1821 Subfamily Equinae Steinmann & Doderloin, 1890 Genus SIVALHIPPUS Lydekker, 1877

Sivalhippus theobaldi (Lydekker 1877)

New material

PUPC 69/618, an isolated left upper molar; PUPC 69/161, an isolated left lower 2

nd deciduous

premolar; PUPC 67/424, an isolated left lower 2nd

premolar; PUPC 68/604, an isolated right lower 2

nd

326 T. IKRAM ET AL BIOLOGIA (PAKISTAN)

premolar; PUPC 68/499, an isolated right lower 2nd

molar. Description and comparison Upper Dentition

The molar is hypsodont, well preserved and in late stage of wear (Fig., 2 (1a-c). The protoloph, ectoloph and metaloph are complete. The well-preserved styles are present. The mesostyle is strongly developed while the metastyle is weakly developed. The molar is furnished with simple plications with thick enamel. Prominent hypoconal groove is deeply incised and the fossettes are clear.

Lower Dentition

The premolars are molariform with narrow crown (Fig., 2 (2-5). The anterostylid is present in the 2

nd premolars anteriorly. There is a deep flexid

formed by the union of the anterior side of the metastylid and the posterior sides of the protoconid. The metaflexid and entoflexid are present lingually. The metaflexid is narrow anteroposteriorly. The protoconid and the hypoconid are greater in their antero-posterior diameter than the metaconid and the entoconid. The surface of the crown is uneven because the metaconid and entoconid are vertically higher than the protoconid and the hypoconid. The metaconid is almost rounded in general appearance. The preflexid and postflexid are prominent. The entostylid and the mesostylid are strong.

The molars are described by the isolated, pillar like compressed protocone. The molar size is large with deeply incised hypoconid groove. The enamel is relatively thick on borders of the fossettes which are with simple plications. The dental elements are hypsodont and show complicated plications with bifid pli caballin. The studied specimens show the basic features of Sivalhippus theobaldi in having thick enamel bordering of fossettes with large size. According to Colbert (1935), it is a heavy and large species. All the morphological features of species Sivalhippus theobaldi as described by Lydekker (1882), Colbert (1935) & Ghaffar (2005) are clearly identifiable in the studied specimens. Morphometrically, the described material is somewhat different from the type specimen, which may be considered intraspecific variation (Colbert, 1935; Ghaffar, 2005).

DISCUSSION AND CONCLUSIONS

Sivalhippus is a common hipparionine in the Dhok Pathan Late Miocene of Pakistan (Lydekker,

1882, 1884; Hussain, 1971; Bernor & Hussain, 1985; Bernor et al., 1996; Wolf et al., 2013; Khan et al., 2011, 2014). The Dhok Pathan equid fauna includes at least 3 genus-level lineages of hipparionine horses, including Sivalhippus, Cremohipparion and Hipparion (Bernor et al., 1996; Wolf et al., 2013; Khan et al., 2014). The Dhok Pathan mammalian fauna have close biogeographic relationship with the Late Miocene Eurasian and African localities as noted by the earlier researchers (Haile-Selassie et al., 2004; Wolf et al., 2013; Khan et al., 2014).

Sivalhippus theobaldi from Potwar Plateau described herein contributes to our understanding of the “open country” palaeoenvironment, as the species offers strong support of the open country terrestrial component (Wolf et al., 2013). The increase of the hypsodonty has already been observed from Lower to Upper Dhok Pathan Formation (Hussain, 1971; Wolf et al., 2013), indicating the conversion of forests into grasslands during the Siwalik Late Miocene (Barry et al., 2002).

Table I: Measurement of Sivalhippus theobaldi (mm). The comparison is made with Colbert

(1935), Bernor & Hussain (1985), Ghaffar (2005) & Iqbal et al. (2009). (*) studied material.

W/L

1.1

1

0.4

4

0.4

4

0.4

0

0.5

3

0.4

7

0.3

8

0.4

0

0.4

9

0.6

0

Wid

th

28.5

12.0

11.8

10.0

14.0

15.6

12.0

13.0

13.0

14.0

Len

gth

25.6

27.0

26.8

25.0

26.0

33.0

31.0

26.5

26.5

23.0

Po

sit

ion

M?

dp2

p2

p2

m2

p2

p2

p3

p3

m2

Nu

mb

er

PU

PC

69

/61

8*

PU

PC

69

/16

1*

PU

PC

67

/42

4

PU

PC

68

/60

4*

PU

PC

68

/49

9*

PU

PC

07

/60

PU

PC

83

/49

8

PU

PC

83

/49

8

PU

PC

83

/49

8

GC

S 1

1/2

1

VOL. 61 (2) NEW EQUIDAE REMAINS FROM DHOK PATHAN 327

Sivalhippus is abundantly found in the Potwar Plateau of Pakistan (Bernor et al., 2008, 2010; Wolf et al., 2013; Khan et al., 2014). The Dhok Pathan hipparionine fauna indicates abundance of S. theobaldi. The occurrence of S. theobaldi at Dhok Pathan is congruent with findings of other Late Miocene ungulates in northern Pakistan. The very large hipparionines in Potwar Plateau of Pakistan denotes the existence of “open country” like environment of Potwar Plateau during the Late Miocene.

Fig., 2: Sivalhippus theobaldi. 1. PUPC 69/618, lM;

2. PUPC 69/161, dp2. 3. PUPC 67/424, lp2; 4. PUPC 68/604, rp2. 5. PUPC 68/499, rm2.

REFERENCES

Barry, J.C., Morgan, M.E., Flynn, L.J., Pilbeam, D., Behrensmeyer, A.K., Raza, S., Khan, I., Badgely, C., Hicks, J. & Kelley, J., 2002. Faunal and environmental change in the Late Miocene Siwaliks of Northern Pakistan. Paleobiology, 28: 1-72.

Bernor, R.L. & Hussain, S.T., 1985. An assessment of systematic Phylogenetic and biogeographic relationships of Siwalik Hipparionine Horses. J. Verteb. Paleontol, 5 (1): 32-87.

Bernor, R.L, Koufos G.D, Woodburne, M.O. & Fortelius M., 1996. The evolutionary history and biochronology of European and Southwestern Asian Late Miocene and Pliocene hipparionine horses. In: R.L. Bernor, V. Fahlbusch & H-W. Mittmann (eds.) The Evolution of Western Eurasian Later Neogene Faunas. New York: Columbia University Press. pp: 307-338.

Bernor, R.L., Armour-Chelu M., Gilbert H., Kaiser, T. & Schulz, E., 2010. Equidae. In: L. Werdelin & B. Sanders (eds), Cenozoic Mammals of Africa. University of California Press, Berkeley: 685-721.

Bernor, R.L., Kaiser, T.M. & Wolf, D. 2008. Revisiting Sahabi Equid Species Diversity, Biogeographic Patterns and Diet Preferences. Garyounis Scientific Bulletin, Special Issue, 5: 159-167.

Colbert, E.H., 1935. Siwalik mammals in the American Museum of natural History. Trans. Am. Phil. Soc., 26: 1-401.

Gao, F. & Ma, B., 1997. Perissodactyla. In: Z.Q. He (ed.) Yuanmou Hominoid Fauna. Kunming: Yunnan Press of Science and Technology. 94-114.

Ghaffar, A., 2005. Studies on Equids, Cervids and Carnivora from the Siwalik Hills of Pakistan. Ph.D. Diss., University of the Punjab, Lahore, Pakistan, 412 pp.

Haile-Selassie, Y., Wolde-Gabriel, G., White, T., Bernor, R.L., Degusta, D., Renne, P.R., Hart, W.K., Vrba, E.S., Stanley, A. & Howell, F.C., 2004. Mio-Pliocene mammals from the Middle Awash, Ethiopia. Geobios, 37: 536-552.

Hussain, S.T., 1971. Revision of Hipparion (Equidae, Mammalia) from the Siwalik Hills of Pakistan and India. Bayerische Akademic der Wissenschaffen Abhandlungen, 147: 1-68.

Khan, M.A., Manzoor, F., Ali, M., Bhatti, Z.H. & Akhtar, M., 2011. A new collection of

328 T. IKRAM ET AL BIOLOGIA (PAKISTAN)

hipparionine from the type locality of the Dhok Pathan Formation of the Middle Siwaliks. J Anim. Pl. Sci., 21: 83-89.

Khan, M.A., Ali, S., Iqbal J. & Akhtar, M., 2014. Some New Remains of Hipparionine (Equidae: Mammalia) from Dhok Pathan Upper Miocene, Northern Pakistan. Pakistan J. Zool., 46 (2): 347-354.

Lydekker, R., 1877. Notices of new and other vertebrata from Indian Tertiary and Secondary Rocks. Rec. Geol. Surv. Ind, 10: 30-42.

Lydekker, R., 1882. Indian Tertiary and post-tertiary Vertebrata. Siwalik and Narbada Equidae. Paleontol. Ind., 2: 67-98.

Lydekker, R., 1884. Indian tertiary and post-Tertiary vertebrata. Additional Siwalik Perrisodactyla and Proboscidea, Paleontol. Ind. 2: 1-34.

Lydekker, R., 1886. Catalogue of Fossil Mammalia in the British Museum. Part 3, London, 186 pp.

Matthew, W.D., 1929. Critical observations on Siwalik Mammals. Am. Mils. Nat. Hist Bulls, 56: 437-560.

Nanda, A.C., 1978. Fossil equids from the Upper Siwaliks subgroup of Ambala, Haryana. Himalayan Geol., 8: 149-177.

Pilgrim, G.E., 1910. A notice of New Mammalian Genera and Species from the tertiary of India. Rec. Geol. Surv. India, 40: 63-71.

Pilgrim, G.E., 1913. Correlation of the Siwaliks with Mammal Horizons of Europe. Rec. Geol. Surv. India, 43: 264-326.

Sun, B.Y., 2013. The Miocene Hipparion (Equidae, Perissodactyla) from Shihuiba Locality,

Lufeng, Yunnan. Vert. Palasiatica. 141-

161. Wolf, D., Bernor, R.L. & Hussain, S.T., 2013. A

systematic, biostratigraphic, and paleobiogeographic reevaluation of the Siwalik Hipparionine horse assemblage from the Potwar Plateau, Northern Pakistan. Palaeontographica Abt. A., 300: 1–115.




Autotomy: An Important Tool in Spiders to Avoid Life Threatening Situations

*HAFIZ MUHAMMAD TAHIR, SAJIDA NASEEM, KHANUM ZAHRA, USMAN AKHATAR, RAZIA

MUMTAZ, RAMEESHA KHALID & MUHAMMAD NOUMAN

Department of Zoology, University of Sargodha, Pakistan.

ABSTRACT

In the present study autotomy was induced in pholcid and lynx spiders. We recorded self amputation in only 13.45% house spiders compared to 42.5% in lynx spiders. Highest self-amputation rate in house spiders was observed in leg II (21%). However, lynx spiders showed 60% self-amputation in leg II. Almost 89% house spiders removed their legs when stretched from femur. However, lynx spiders (90%) automize their leg when stretched from metatarsus. For both group of spiders self amputation was higher in adult and between coxa and trochanter. It is confirmed from the study that self amputation is an important phenomenon in spiders to protect themselves in life-threatening situations. Key words: self amputation, lynx spiders, house spiders, avoiding life-threatening situations

________________________________________________________________________________________________

INTRODUCTION

Animal adopt wide range of strategies to

avoid life-threatening situations. Autotomy is an important phenomenon in arthropods that allows animals to escape from predators (Taylor et al., 2008). To get rid of predation many animals sacrifice their body parts. However, the specific body part sacrificed differ among taxa. The scarified body parts include caudal lamellae, claws and legs (Lewis, 1981; Roth & Roth, 1984; Dixon, 1989; Spivak & Politis, 1989; Robinson et al., 1991; Carlberg, 1992, 1994; Juanes & Smith, 1995; Foelix, 1996; Guffey, 1998). It has been observed by many researchers that during molting of crustaceans, insects, and spiders their appendages may get stuck in the old exoskeleton and there is a utmost desire to shed these body parts for their survival (Bedford, 1978; Foelix, 1982; Robinson et al., 1991; Brock, 1999). Self severing is also common during interspecific interactions between males (Smith, 1992).

Many spiders lose legs when they come across predators or conspecifics (Roth & Roth, 1984; Foelix, 1996; Brueseke et al., 2001). The wolf spider, Schizocosa avida (Walckenaer 1838), spontaneously removes its leg to successfully avoid capture by the scorpion, Centruroides vittatus (Say, 1821 and Punzo, 1997). Orb-weaving spiders (Argiope spp.) also undergo leg autotomy if they are stung in a leg by venomous insect prey (Phymata fasciata) to prevent venom to reach in other parts of body (Eisner & Camazine, 1983). Loss of an appendage may also impair foraging abilities, locomotor performance, competitive abilities, and mating (Vollrath 1990; Brock & Smith 1998; Dodson & Beck, 1993; Amaya et al., 2001; Ramsey et al.,

2001; Mariappan et al., 2000; Taylor & Jackson 2003; Bateman & Fleming, 2005) of individuals. For spiders autotomy may not be expensive as their survival is more important than sacrificed leg (Formanowicz, 1990; Klawinski & Formanowicz, 1994; Punzo, 1997). Autotomy is a voluntary action and an externally applied pulling force is not important for reflex separation of a part from the body. Bonnet (1930) observed that anesthetized spiders cannot autotomize their limbs. The leg is usually autotomized between the coxa and trochanter (Wood, 1926) and infrequently between patella and tibia (Berland, 1932).

Present study was planned to answer the questions: (1) Can we induce autotomy in spiders by stretching their legs from different points? (2) Which of the spider’s leg is more likely to show autotomy? (3) How long do the atomized legs show movement? (4) Which are the part the spiders automize their legs? To get the answers of these questions house and lynx spiders were used as model.


Study was conducted in Molecular Systematics Laboratory, Department of Zoology, University of Sargodha, Sargodha, Pakistan. For the study, live house spiders were collected from old houses and stores. Lynx spiders were collected from Agricultural fields in the vicinity of University of Sargodha. Each spider was kept individually in glass jars to avoid cannibalism. Mouth of each jar (12 cm high and 4 cm wide) was coved with mesh cloth and tightened with rubber band. Spiders were maintained in the laboratory at room temperature. In the laboratory, spiders were fed with mixture of

330 H. M. TAHIR ET AL BIOLOGIA (PAKISTAN)

honey, sugar and soya sauce. Each spider was used only once in the experiment.

Legs of spiders were stretched with the help of forceps, first from the femur and then from metatarsus and tarsus. It was ensured during the experiment that force of stretching remains the same, for each leg and for all spiders. Only the blunt forceps were used for the study so that they may not damage the spiders. For each leg, experiment was repeated on 30 spiders. Descriptive statistics was performed with the help of Minitab 13.3. Wilcoson Sign Rank test was used for comparisons between two groups of spiders. Distribution of data was assessed for normality before using statistical analysis.

RESULTS

Results of the study revealed that only 13.45% house spiders showed self amputation compared to 42.5% in lynx spiders. The difference was statistically significant (P< 0.05). The comparison of voluntary detachment of legs between two groups of spiders has been depicted in Figure 1. Highest self-amputation rate in house spiders was observed in leg II (21%) compared to leg III (60%) in lynx spiders. The automized leg of house spiders showed movement for 15-20 seconds after automization. However, we did not record movement in the leg of lynx spiders after detachment from the body. Only 11% house spiders automized their leg while stretched from the tarsus or metatarsus. However, 89% spiders remove their legs when stretched from femur. But more than 90% lynx spiders automize their leg when stretched from metatarsus.

Most of the spiders (both groups) which automized their leg were adults (87% in house spiders and 92% lynx spiders. It was noticed that if a house spider did not spontaneously cast off its leg on stretching it from the femur; it rarely automized the leg while stretching from tarsus or metatarsus. But this was not true for lynx spiders. Majority of spiders (71% house spiders and 83% lynx spiders) automized their legs between coxa and trochanter. Lynx spiders automize their legs more quickly as compared to house spiders (P< 0.05). Furthermore, it was observed that when we tried to hold leg of lynx spider, they construct web with the forcep or ground within few seconds. In case of no autotomy, when leg of lynx spider was released more than 90% spiders brought their legs into the mouth. This behaviour was not found in house spiders.

0

15

30

45

60

I II III IV

Leg no.

Pe

rc

en

tag

e

House spiders

Lynx spiders

Fig.,1: Induced autotomy in house and lynx spiders

in laboratory.

DISCUSSION

Individuals that do not possess physical defense mechanisms to avoid predation protect themselves by amputation of different body parts (Needham, 1953). Removal of appendage has been reported in various species of spiders (Roth & Roth, 1984). Foelix (1996) observed that 5–20% of the total sample mainly remove their limb. Brueseke et al. (2001) and Dodson & Beck (1993) independently found that this percentage can be as high as 30–40% depending on the species, age, sex, and time of year (Dodson & Beck, 1993; Brueseke et al., 2001).

Leg autotomy has been observed to occur in spiders when a leg was pulled or injured (Parry 1957; Wood, 1926). Present study reveals that more than70% cases of leg amputation occur at the point between coxa and trochentor. These findings are comparable with previously documented studies of Parry (1957) and Wood (1926). Similar findings have also been reported in many studies where scorpions were used to grasp spider’s limb (Robinson et al., 1970; Foelix, 1982). In all these experiments, after the stimulus of close grip the coxa shows sudden upward movement while rest of leg remained relatively fix (Punzo, 1997) causing the leg to readily separate between coxa and trochanter (Wood, 1926; Bonnet, 1930). Wood (1926) declared through examination of spider leg that the coxa-trochanteral joint is weakest joint so it is favorable point for amputation. This special mechanism avoids loss of excessive hemolymph after autotomy and allow spider to live even after several limb amputations (Wood, 1926; Parry, 1957). According to Randall (1981) some species

VOL. 61 (2) AUTOTOMY IN SPIDER 331

can tolerate autotomy if it occurs at coxa but if coxa is removed they cannot survive due to excessive bleeding and infection as coxa provides an efficient wound healing mechanism.

During study it was found that more than 90% lynx spiders self amputate their leg when stretched from metatarsus. Autotomy at this specific joint may be due to lack of extensor muscle (Ellis, 1944; Parry & Brown, 1959a; Whitehead & Rempel, 1959; Ruhland & Rathmayer, 1978). Leg extension at this joint mainly occurs by hydraulic pressure. Parry & Brown (1959b) during their study on salticid Sitticus pubescens found low hydraulic pressure at tibia metatarsus joint before jamming at rest position (Wilson, 1970; Anderson & Prestwich, 1975; Parry & Brown, 1959a) When we try to stretch its leg at metatarsus position leg autotomy occurs due to its inability to be stretched.

The percentage of autotomy in second pair of legs is highest in this study in house spiders compared to leg III in lynx spiders. These findings are in accordance with Guffey (1998) who observed autotomy in two daddy long leg spider species, Leiobunum nigripes and Leiobunum vitlalum. The second pair of legs is documented in previous literature as important in sensing the environmental conditions (Comstock, 1920; Sankey & Savory, 1974). Moreover, the second pair of legs are longer than any others in Leiobunum (Comstock, 1920; Kaestner, 1968; Sankey & Savory, 1974), so these legs are most likely to encounter with predators or entangle in traps and thus to be autotomized .

Our results that mostly the adult spiders automized their legs are in agreement with the results documented in literature. According to researchers adult male wolf spiders would have a higher incidence of leg loss because of higher activity levels and being more prominent relative to juveniles (Cady, 1984; Kotiaho et al., 1998; Persons, 1999; Persons & Uetz, 1999; Walker & Rypstra, 2003). Differences in the frequency of limb loss among adults and juveniles may also be due to the fact that juveniles are more able to regenerate lost limbs during subsequent molts.

REFERENCES

Amaya, C. C., Klawinski, P. D. & Rormanowicz, D.

R., 2001. The effects of leg autotomy on running speed and foraging ability in two species of wolf spider (Lycosidae). Am. Midl. Nat., 145: 201–205.

Anderson, J. F. & Prestwich, K. N., 1975. The fluid pressure pumps of spiders (Chelicerata, Araneae). Z. Morph. Tiere., 81: 257-277.

Bateman, P. W. & Fleming, P. A., 2005. Direct and indirect costs of limb autotomy in field crickets, Gryllus bimaculatus. Anim. Behav., 69: 151–159.

Berland, L., 1932. Les Arachnides. Lechevalier, Paris.

Bedford, G. O., 1978. Biology and ecology of Phasmatodea. Annu. Rev. Entomol., 23: 125–49.

Bonnet, P., 1930. 'La mue, l'autotomie et la regeneration chez les Araignees, avec une tudedes Dolomedes d'Europe.' Bull. Soc. Hist. nat. Toulouse., 59: 237p.

Brock, P. D., 1999. The amazing world of stick and leaf insects. Amateur Entomol., 26: 1–165.

Brock, R. E. & Smith, L. D., 1998. Recovery of claw size and function following autotomy in Cancer productus (Decapoda: Brachyura). Biol. Bull., 194: 53–62.

Brueseke, M. A., Rypstra, A. L., Walker, S. E. & Persons, M. H., 2001. Leg autotomy in the wolf spider Pardosa milvina: a common phenomenon with few apparent costs. Am. Midl. Nat., 146: 153–160.

Cady, A. B., 1984. Microhabitat selection and locomotor activity of Schizocosa ocreata (Walckenaer) (Araneae: Lycosidae). J. Arachnol., 11: 297–307.

Carlberg, U., 1992. Cost of autotomy in the Phasmida (Insecta). I. Species with low autotomy frequency. Zool. Anz., 228: 229–237.

Carlberg, U., 1994. Cost of autotomy in the Phasmida (Insecta). II. Species with high autotomy frequency. Zool. Anz., 232:41–49.

Comstock, J .H., 1920. The Spider Book. Doubleday, Page & Co., Garden City, New York.

Dixon, K. A., 1989. Effect of leg type and sex on autotomy in the Texas bush katydid, Scudderia texensis. Can. J. Zool., 67: 1607–1609.

Dodson, G. N. & Beck, M. W., 1993. Precopulatory guarding of penultimate females by male crab spiders, Misumenoides formosipes. Anim. Behav., 46: 951–959.

Eisner, T. & Camazine, S., 1983. Spider leg autotomy induced by prey venom injection: An adaptive response to “pain”. Proc. Natl. Acad. Sci. U. S. A., 80: 3382–3385.

Ellis, C. H., 1944. The mechanism of extension in the legs of spiders. Biol. Bull. 86: 41-50.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Eisner%20T%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Camazine%20S%5Bauth%5D

332 H. M. TAHIR ET AL BIOLOGIA (PAKISTAN)

Foelix, R. E., 1982. Biology of spiders. Harvard Univ. Press, Cambridge, Massachusetts.

Foelix, R. F., 1996. Biology of spiders. Oxford University Press, New York.

Formanowicz, D. R., 1990. The antipredator efficacy of spider leg autotomy. Anim. Behav., 40: 400–409.

Guffey, C., 1998. Leg autotomy and its potential fitness costs for two species of Harvestmen (Arachnida, Opiliones). J. Arachnol., 26: 296–302.

Juanes, F. & Smith, L. D.,1995. The ecological consequences of limb damage and loss in decapod crustaceans: a review and prospectus. J. Exp. Mar. Biol. Ecol., 193: 197–223.

Kaestner, A., 1968. Invertebrate Zoology, Vol. II: Arthropod Relatives, Chelicerata, Myriapoda (translated by H. W. Levi & L. R. Levi). Interscience Publishers, New York.

Klawinski, P. D. & Formanowitz, D. R., 1994. Ontogenetic change in survival value of leg autotomy in a wolf spider, Gladicosa pulchra (Keyserling) (Araneae: Lycosidae), during scorpion attacks. Can. J. Zool., 72: 2133–2157.

Kotiaho, J., Alatalo, R. V., Mappes, J., Parri, S. & Rivero, A., 1998. Male mating success and risk of predatin in a wolf spider: A balance between sexual and natural selection. J. Anim. Ecol., 67: 287–291.

Lewis, J. G. E., 1981. The biology of centipedes. Cambridge University Press, Cambridge.

Mariappan, P. Balsundaram, C. & Schmitz, B., 2000. Decapod crustacean chelipeds: an overview. J. Biosci., 25: 301–313.

Needham A. E., 1953. The incidence and adaptive view of autotomy and regeneration in Crustacea. Proc. Zool. Soc. Lond., 123: 111-122.

Parry, D. A. & Brown, R. H. J., 1959a. The hydraulic mechanism of the spider leg. J. Exp. Biol., 36: 423-433.

Parry, D. A. & Brown, R. H. J., 1959b. The jumping mechanism of salticid spiders. J. Exp. Biol. 36: 654-664.

Parry, D. A., 1957. Spider leg muscles and the autotomy mechanism. Quart . J . Microscop. 36: 654-664.

Persons, M. H., 1999. Hunger effects on the foraging responses to perceptual cues in immature and adult wolf spiders (Lycosidae). Anim. Behav., 57: 81–88.

Persons, M. H., & Uetz, G. W., 1999. Age and sex-based differences in the use of prey

sensory cues in wolf spiders (Araneae: Lycosidae). J. Insect. Behav., 12: 723–736.

Punzo, F., 1997. Leg autotomy and avoidance behaviour in response to a predator in the wolf spider, Schizocosa avida (Araneae: lycosidae). J. Arachnol., 25: 202–205.

Randall, J.B., 1981. Regeneration and autotomy exhibited by the black widow spider, Latrodectus variolus Walckenaer. W. Roux's Arch. Dev. Biol., 190: 230-232.

Ramsey, K., Kaiser, M. J. & Richardson, C. A., 2001. Invest in arms: behavioral and energetic costs of multiple autotomy in starfish (Asterias rubens). Behav. Ecol. Sociobiol., 50: 360–365.

Robinson, J. V., Hayworth, D. A. & Harvey, M. B., 1991. The effect of caudal lamellae loss on swimming speed of the damselfly Argia moesta (Hagen) (Odonata: Coenagrionidae). Am. Midl. Nat., 125: 240–244.

Ruhland, M. & Rathmayer, W., 1978. Die Beinmuskulatur und ihre Innervation beider Vogelspinne Dugesiella hentzi (Ch.) (Araneae, Aviculariidae). Zoomorphologie 89: 33-46.

Robinson, M. H., Abele, L. G. & Robinson, B., 1970. Attack autotomy: a defense against predation. Sci., 169: 300-301.

Roth, V. D. & Roth, B. M., 1984. A review of appendotomy in spiders and other arachnids. Bull. Br. Arachnol. Soc., 6: 137–46.

Sankey, J. H. P. & Savory, T. H., 1974. British Harvestmen. Academic Press, New York. Sci ., 98 :331-340.

Smith, L. D., 1992. The impact of limb autotomy on mate competition in blue crabs, Callmectes sapidus Rathbun. Oecologia, 89: 494-501.

Spivak, E. D. & Politis, M. A., 1989. High incidence of limb autotomy in a crab population from a coastal lagoon in the province of Buenos Aires, Argentina. Can. J. Zool., 67: 1976–1985.

Taylor, P. W. & Jackson, R. R., 2003. Interacting effects of size and prior injury in jumping spider conflicts. Anim. Behav., 65: 787–794.

Taylor, P. W., Roberts, J. A., Wignall, A. E. & Uetz, G. W., 2008. Foreleg Autotomy Reduces Mating Success of Male Schizocosa ocreata Wolf Spiders. J. Insect. Behav., 21: 193-202.

Vollrath, F., 1990. Leg regeneration in web spiders and its implications for orb weaver phylogeny. Bull. Br. Arachnol. Soc., 8: 177–184.

http://www.researchgate.net/profile/Phil_Taylor

http://www.researchgate.net/researcher/34292901_J_Andrew_Roberts

http://www.researchgate.net/profile/Anne_Wignall

http://www.researchgate.net/researcher/9473752_George_W_Uetz

VOL. 61 (2) AUTOTOMY IN SPIDER 333

Walker, S. E. & Rypstra, A. L., 2003. Sexual dimorphism and the differential mortality model: Is behaviour related to survival? Biol. J. Linn. Soc., 78: 97–103.

Whitehead, W. F. & Rempel, J. G., 1959. A study of the musculature of the black widow spider, Latrodectus mactans (Fabr.). Can. J. Zool. 37: 831-870.

Wilson, R. S., 1970. Some comments on the hydrostatic system of spiders (Chelicerata, Araneae). Z. Morph. Tiere 68: 308-322.

Wood, F. D., 1926. 'Autotomy in spiders. J. Morph., 42: 143-195.




Optimization of Medium Volume and Temperature for Improved α-amylase

Production by Saccharomyces cerevisiae GCB-20

*SIKANDER ALI1 & NADIA SHAMIM

2

1Institute of Industrial Biotechnology (IIB), GCU Lahore, Pakistan

2Department of Botany, GCU Lahore, Pakistan

ABSTRACT

In the present study, selection of an appropriate volume and temperature for α-amylase production by Saccharomyces cerevisiae GCB-20 has been reported. The fermentation medium at the level of 15-40 ml was investigated in 250 ml conical flasks for enzyme production. Maximum α-amylase production (210 IU/ml/min) by S. cerevisiae GCB-20 was obtained in 25 ml of fermentation medium at 35°C. The kinetic analysis indicated that the volumetric production of biomass and α-amylase was significantly improved at the optimized fermentation conditions. Key words: Saccharomyces cerevisiae, α-amylase, microbial fermentation, thermophilic behavior

INTRODUCTION

Αlpha amylase is an extracellular hydrolytic enzyme which degrades α-1,4 linkages in starch. This enzyme is potentially used in paper, pulp, food, pharmaceutical as well as detergent industries. Different microorganisms have been extensively used for its biosynthesis (Nigam & Sing 1995; Liu et al., 2013; Hu et al., 2014). The amylase of fungal origin has been found to be much more stable as compared to the bacterial enzyme (Duochuan et al., 1997).

The production of enzyme is highly sensitive to temperature and volume of media (Abou-Dobara et al., 2011). Optimization of a suitable volume of production medium is essential to ensure adequate air supply, nutrient availability, microbial growth and subsequent enzyme production (Hernandez-Montanez et al., 2012; Shetty 2015). The main objective of present study was to optimize the kinetic behavior for the effect of various volumes and temperature on α-amylase biosynthesis by Sacchromyces cerevisiae GCB-20.


Organism and Inoculum Preparation

Sacchromyces cerevisiae strain GCB-20 was obtained from the available stock culture of IIB, GCU Lahore, Pakistan. Previously, it was isolated from baker’s yeast and identified. The culture was grown on potato dextrose starch agar medium at pH 7.2. Yeast cell suspension was used as an inoculum. The suspension was prepared in the sterilized 0.05 % (w/v) monoxal O.T. (di-octyl ester

of Na-sulpho succinic acid). Each millilitre of the suspension contained 2.6×10

6 CFU/ml (Hu et al.,

2014).

Fermentation Technique

Fifty millilitre of the production medium containing (g/l): peptone 20, yeast extract 3, starch 10, CaCl2 2, MgSO4 0.5 dissolved in phosphate buffer (pH 7.2) was transferred to a 250 ml Erlenmeyer flask (in duplicate) and cotton plugged. The flasks were steam-sterilized in an autoclave at 15 p.s.i. (121°C) for 20 min and later cooled to room temperature. One millilitre of the prepared inoculum was aseptically dispensed to each of the flasks. Then the flasks were positioned in a rotary shaking incubator (200 rpm) at 30°C for 72 h. After incubation, the fermented culture broth was spun at 7000 rpm for 20 min. The cell free clear supernatant was stored at 4ºC, till further use.

Enzyme Assay

Αlpha amylase estimation was carried out following the procedure of Rick & Stegbauer (1974). For this, the enzyme mixture at pH 5.5 was incubated at 40

oC using 1% Linter’s soluble starch

solution. The reducing sugars (as maltose moiety) were estimated by adding 3,5-dinitro salicylic acid (DNS) reagent. The mixture was boiled for 5 min. Later, it was cooled. The OD546 was measured by using a UV/VIS scanning spectrophotometer (CECIL CE-7200, Aquaris, UK) against the maltose as a standard.

One Unit Amylase

The amount of enzyme which releases reducing group from 1% soluble starch in 30 min to equalize

336 S. ALI & N. SHAMIM BIOLOGIA (PAKISTAN)

0.1 mg maltose hydrate, under the defined assay conditions.

Kinetic Study

All the growth and subsequent product formation kinetic variables for continuous batch fermentation were calculated according to the procedure laid down by Pirt (1975) and Lawford & Rouseau (1993). The value of µ (h

-1) was

determined from the plot of In (x) vs the time interval. The enzyme yield coefficient specifically Yp/x was calculated by the relation: Yp/x=dp/dx. Qp (IU/ml/min) was compared from the peak slope of enzyme synthesized vs the time duration of fermentation. Qx (g cell mass/l/h) was calculated from the highest slope of biomass formation vs. the time of fermentation. The specific rate of enzyme as product formation was computed by the following equation, qp = µ×Yp/x.


The treatment and significance effects were equated by following the statistical method of Snedecor & Cochran (1980). The comparisons of post hoc multiples were imposed under one-way analysis of variance (I-ANOVA).


The optimization of medium volume for

enzyme production is highly critical for air or oxygen supply, nutrient availability, growth of selected microorganism and synthesis of enzyme as reported earlier by Mimura & Shinichi (1999). In the present study, variable volumes of the production medium (15-40 ml) were assessed in 250 ml Erlenmeyer flasks. The maximum enzyme activity was observed in 25 ml of the fermentation medium (Fig., 1). As the medium volume was further increased, the enzyme activity was reduced. It was possibly be due to the fact that reduction in agitation intensity of the

medium, decline in air or oxygen supply took place and thus enzyme production was decreased as reported by Ivanova et al. (2001). At lower production medium, the enzyme synthesis also remained less. It was due to the essential nutrients of the production medium which were not sufficient for the yeast growth (i.e., S. cerevisiae GCB-20) and hence enzyme formation. Similar types of studies have also been described by Hou et al. (2013).

The production of enzyme is highly sensitive to the temperature (Kubrak et al., 2010). Therefore, optimization of temperature is required for maximum α-amylase production. The fermentation was undertaken at different temperature. The production of the enzyme was found to be optimal at 35°C (Fig., 2). Fogarty & Kelly (1990) have reported that 30°C was optimal for enzyme production by the yeast culture. However, in present study 35°C was selected. It was possibly due to thermophilic behavior of the yeast culture.

The kinetic parametric study indicated that the volumetric rates of enzyme production were more significant as 25 ml of the fermentation medium (Table I). The kinetic parametric study also highlighted that the production of the enzyme and biomass formation was highly significant at 35

oC

(Table II). Any increase or decrease in temperature resulted in a decline not only in yield of the enzyme but also the volumetric rates of enzyme formation as reported by Esfahani et al. (2008). Thus, 25 ml volume of medium and 35

oC was selected for

enzyme production.

From the present study, it was concluded that 25 ml of fermentation medium at 35°C gave maximum α-amylase production by S. cerecvisiae GCB-20.

Table I: Kinetic study of different medium volumes for α-amylase production by S. cerevisiae GCB-20.

Kinetic parameters

Medium volume (ml)

15 20 25 30 35 40

Yp/x

Qp

Qx

qp

56000±24

5.5±1.5

0.083±0.01

11200±10

62241.3±25

6.5±1.2

0 .096±0.03

12448.26±20

67804.8±22

6.53±1.5

0.136±0.9

13560±14

53055.5±25

6.36±3.1

0.12±0.01

10611.1±20

52638.8±20

6.31±1.7

0.11±0.06

10527.76±23

57187.5±21

6.1±1.9

0.106±0.04

11437.5±14

Yp/x= enzyme produced/g cell mass formation, Qp=enzyme produced/l/h, Qx= g cell mass formation/l/h, qp=U/g/h.

VOL. 61 (2) α-AMYLASE PRODUCTION BY SACCHAROMYCES CEREVISIAE 337

Table II: Kinetic study at different temperature for α-amylase production by S. cerevisiae GCB-20.

Kinetic

parameters

Temperature (ºC)

30 35 40 45

Yp/x

Qp

Qx

qp

14285.7±21

1.66±1.8

0.116±0.5

2857.14±9

26705.8±14

3.5±1.1

0.141±0.05

5341.16±10

25000±25

3.0±1.4

0.12±0.01

5000±15

17647±20

2.0±1.2

0.113±0.5

3529.34±9

Yp/x= enzyme produced/g cell mass formation, Qp=enzyme produced/l/h, Qx= g cell mass formation/l/h.

0

20

40

60

80

100

120

140

15 20 25 30 35 40 45 50

Volume of medium (ml)

En

zym

e a

cti

vit

y

(IU

/ml/m

in)

0

2

4

6

8

10

DC

M (

g/l)

Enzyme activity DCM

Fig., 1: Effect of different medium volumes on α-amylase production by S. cerevisiae GCB-20. Each value is an average of three parallel replicate. Y-error bars indicate the standard error from mean value. p<0.05.

0

50

100

150

200

250

30 35 40 45

Temperature (°C)

En

zy

me

ac

tiv

ity

(IU

/ml/

min

)0

2

4

6

8

10

DC

M (

g/l

)

Enzyme activity DCM

Fig., 2: Effect of temperature on α-amylase production by S. cerevisiae GCB-20. Each value is an average of three parallel replicate. Y-error bars indicate the standard error from mean value. p<0.05.

REFERENCES

Abou-Dobara, M.I., El-Sayed, A.K., El-Fallal, A.A. & Omar, N.F., 2011. Production and partial characterization of high molecular weight extracellular alpha-amylase from Thermoactinomyces vulgaris isolated from Egyptian soil. Pol. J. Microbiol., 60: 65-71.

Duochuan, L., Yijun, Y., Youliang, P., Chongyao, S., Peijin, Z. & Yicun, H., 1997. Purification and properties of a thermostable alpha amylase from the thermophilic fungus Thermomyces lanuginosus. Acta. Microbiol. Sin., 37: 107-114.

Esfahani, Z.B., Rostami, K. & Mirdamadi, S.S., 2008. Some studies of alpha-amylase production using Aspergillus oryzae. Pak. J. Biol. Sci., 11: 2553-2559.

Fogarty, W.M. & Kelly, C.T., 1990. Recent advances in microbial amylases. In: W.M. Forgarty, C.T. Kelly Ed., Microbial Enzymes and

Biotechnology, 2nd

Ed. Elsevier Science Publisher, London, UK. pp:71-132.

Hernandez-Montanez, Z., Juarez-Montiel, M., Velazquez-Avila, M., Cristiani-Urbina, E., Hernandez-Rodriguez, C., Villa-Tanaca, L. & Chavez-Camarillo, G., 2012. Production and characterization of extracellular α-amylase produced by Wickerhamia sp. X-Fep. Appl. Biochem. Biotechnol., 167: 2117-2129.

Hou, J., Osterlund, T., Liu, Z., Petranovic, D. & Nielsen, J., 2013. Heat shock response improves heterologous protein secretion in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol., 97: 3559-3568.

Hu, W., Liu, J., Che, J., Wang, S., Lu, D., Wu, Q. & Liu, W., 2014. A mutation of Aspergillus niger for hyper-production of citric acid from corn meal hydrolysate in a bioreactor. J. Zhej. Uni. Sci., 12: 1-7.
















338 S. ALI & N. SHAMIM BIOLOGIA (PAKISTAN)

Ivanova, V., Yankov, D., Kabaivanova, L. & Pashkkoulov, D., 2001. Simultaneous biosynthesis and purification of two extra cellular alpha amylases from Bacillus hydrolases in aqueous system. J. Biochem. Eng., 8: 61-81.

Kubrak, O.I., Storey, J.M., Storey, K.B. & Lushchak, V.I., 2010. Production and properties of alpha-amylase from Bacillus sp. BKL20. Can. J. Microbiol., 56: 279-288.

Lawford, H. & Rouseau, J.D., 1993. Mannose fermentation by ethanologenic recombinants of Escherchia coli. Biotechnol. Lett., 15: 615-620.

Liu, Z., Osterlund, T., Hou, J., Petranovic, D. & Nielsen, J., 2013. Anaerobic α-amylase production and secretion with fumarate as the final electron acceptor in Saccharomyces cerevisiae. Appl. Environ. Microbiol., 79: 2962-2967.

Mimura, H. & Shinichi, N., 1999. Physiological characteristics of Bacillus spp. Biocontrol Sci., 4: 105–8

Nigam, P. & Singh, D., 1995. Enzymes and microbial systems involved in starch processing. Microbial Technol., 17: 770-778.

Pirt, S.J., 1975. Principles of Cell and Microbe Cultivation. Black Wells Scientific, NY, USA.

Rick, W. & Stegbauer, H.P., 1974. Alpha amylase of reducing groups. In: H.V. Bergmeyer (Ed) Methods of Enzymatic Analysis, Vol. 2 Academic Press, NY, USA. pp: 885-890.

Shetty, V.G., 2015. Production and optimization of citric acid by Aspergillus niger using molasses and corncob. Int. J. Pharm. Pharm. Sci., 7: 152-157.

Snedecor, G. W. & Cochran, W.G., 1980. Statistical Methods, 7

th edition. Iowa State Univ.

Press, Ames. Iowa, USA.










Fossils of Gazella (Bovidae, Mammalia) from Dhok Bun Amir Khatoon Chinji

Formation of Pakistan

MUHAMMAD ADEEB BABAR, SAIMA MAZHAR, *MUHAMMAD AKBAR KHAN, MUHAMMAD

KHALED SIDDIQUE, KHALID MAHMOOD & MUHAMMAD AKHTAR

Dr. Abu Bakr Fossil Display and Research Centre, Department of Zoology, Quaid-e-Azam Campus, University of the

Punjab, Lahore, Pakistan

ABSTRACT

In the Siwaliks, the genus Gazella is represented by Gazella sp. reported from the Chinji Formation, G. lydekkeri and G. superba from the Nagri and Dhok Pathan formations but this genus was not reported from the Soan Formation of the Siwaliks. New remains have been recovered from the Middle Miocene of the Siwaliks. The scope of this study is to add new anatomical features to this genus. Key words: Artiodactyls, vertebrates, Pliocene, Pleistocene, Siwaliks.

_______________________________________________________________________________________

INTRODUCTION

Gazelles are diverse herbivorous mammals

that inhabit wide spectrum of habitats and occur

naturally over large part of the globe. The wide

variety of Gazella is found across the Eurasia from

China to Spain and to the far south of South Africa.

Gazella sp., G. lydekkeri and G. superba were

found in the Siwaliks (Pilgrim, 1937, 1939). Gazella

is known from the Pliocene of Eurasia and several

Pleistocene localities in Africa. It is abundantly

found at the same time in Asia and southern parts of

Europe.

The specimens were naturally excavated

and found in the nearby area of the Dhok Bun Amir

Khatoon village (Fig., 1). The embedded material

was carefully recovered with the help of different

kinds of tools including chisels, small brushes and

geological hammers. Some parts were broken,

which were assembled with some kind of gum

(resin) such as Araldite, Magic stone, Elfy, Elite and

Fixin. Some specimens were not in a good

condition. These were thoroughly washed and

cleaned in the laboratory with the help of fine

needles and brushes, and prepared for the study.

Specimen catalogue number consists of

three parts: GCS (institutional abbreviation of

Government College of Science, Wahdat road,

Lahore, Punjab, Pakistan), the collection year

(numerator) and serial number of the respective

year (denominator). Terminology used, follows

Pilgrim (1937, 1939).

Fig., 1: Map of the Potwar Plateau in northern Pakistan showing the studied locality.

SYSTEMATIC PALAEONTOLOGY

Family BOVIDAE Gray, 1821 Subfamily BOVINAE Gray, 1821 Tribe ANTILOPINI Gray, 1821 Genus GAZELLA Blainville, 1816

Gazella sp. Geographical distribution: The species is known from the Lower Siwaliks of the subcontinent (Pilgrim, 1937, 1939; Akhtar 1992; Khan et al., 2009, 2013). Stratigraphic range: Lower Siwaliks. Locality: Dhok Bun Amir Khatoon (Chinji Formation, Lower Siwaliks), district Chakwal, province Punjab, Pakistan. New Material: GCS 13/12, partial left upper first molar; GCS 13/13, partial upper molar; GCS 13/16,

340 M. A. BABER ET AL BIOLOGIA (PAKISTAN)

right upper third molar; GCS 13/10, right mandible fragment with second molar; GCS 13/11, mandible fragment with second molar.

DESCRIPTION:

The upper molars are nearly quadrate and rugose. The major cones are interconnected to each other (Fig., 2(1)). The ectostyle is weakly developed. The longitudinal valleys are not much deep. The mesostyle is well developed. The anterior and posterior ribs are moderately developed.

The

cingulum is poorly developed antero-posteriorly.

The fossettes are wide and crescent shape.

The goatfold is present anteriorly in the lower molars. The preprotocristid is larger than the postprotocristid (Fig., 2(3)). The apices of the conids are somewhat conical. The conids have non smooth convex lingual wall. The ectostylid is absent or rudimentary present. The parastylid is less developed than the mesotylid. The paraconus rib is flat and the metaconus rib is prominent. The posterior fossette is narrower than the anterior one. The anterior fosssette is simple and wide.

Fig., 2: Gazella sp. 1. GCS 13/12, partial left upper first molar; 2. GCS 13/16, right upper third molar; 3. GCS 13/10, right mandible fragment with second molar. Views: a, occlusal; b, lingual; c, labial.

VOL. 61 (2) FOSSILS OF GAZELLA (BOVIDAE, MAMMALIA) 341

COMPARISON AND DISCUSSION

The general teeth pattern shows selenodonty and mesodonty, without entostyle and strong anterior median rib (Fig., 2). The molars are small with finely rugose enamel and can be included in medium sized bovids (Pilgrim, 1939; Khan et al., 2009). The lower molar represents goat fold (Fig., 2). The dimensions and morphology of the studied material reveal all the features of the species Gazella, found in the lower Siwaliks of Pakistan.

The numerous previously reported species of gazelles are now placed in three genera, mainly based on the body size. The small sized includes the genus Gazella; the medium sized gazelles include the genus Eudorcas; the large bodied gazelles include the genus Nanger. Nevertheless, the specific identification is very difficult due to high intraspecific variability. The gazelle community is clearly related to the physiographic setting of sites with extensive open or bush-covered plains at no great distance (Bibi & Güleç, 2008; Kostopoulos, 2005). The grazing species as Gazella, Procapra, Saiga tend to form larger herds, probably as a defense against predators (Brashares et al., 2000).

The genus Gazella was recorded from the Lower and Middle Siwaliks and not found in the Upper Siwaliks (Pilgrim, 1937, 1939; Khan, 2008; Khan et al., 2014). The absence of gazelles in the Upper Siwaliks may be an indication of the absence of bushed lands. However, this also raises a question of how they suddenly became extinct during the Siwalik Pleistocene in Pakistan.

Table I: Comparative measurements (in mm) of the cheek teeth of Gazella sp. Referred data are

taken from Colbert (1935).

Specimens Nature Length Width W/L ratio

GCS 13/10* rM2

14.2 9.47 1.53

GCS 13/11* MM2

17.1 9.00 0.19

GCS 13/12* IM1

10.7 13.5 0.79

GCS 13/13* M 8.30 11.1 1.33

GCS 13/14* M2

18.6 14.5 1.28

GCS 13/16* rM3 10.8 13.1 0.82

AMNH 19519

M1 16.0 12.0 0.75

AMNH 19547

M1 17.0 13.5 0.79

Conclusions

Gazella sp. was recovered from the Chinji Formation of Dhok Bun Amir Khatoon, Chakwal, Northern Pakistan. The outcrops of Dhok Bun Amir Khatoon represent one gazelle species along with the other Middle Miocene mammalian species Progiraffa exigua, Giraffokeryx punjabiensis, Listriodon pentapotamiae and Deinotherium indicum. The associated fauna of Gazella sp. indicates bushed lands in Dhok Bun Amir Khatoon during Middle Miocene.

REFERENCES

Akhtar, M., 1992. Taxonomy and Distribution of the

Siwalik Bovids. Ph. D. Diss., University of the Punjab, Lahore, Pakistan.

Brashares, J. S., Th. Garland, & P. Arcese. 2000. Phylogenetic analysis of coadaptation in behavior, diet, and body size in the African antelope. Behavior. Ecol., 11:452–463.

Bibi, F. & Güleç, E., 2008. Bovidae (Mammalia: Artiodactyla) from the Late Miocene of Sivas, Turkey. J. Vert. Palaeontol., 28: 501-519.Colbert, E.H., 1935. Siwalik mammals in the American Museum of Natural History. Trans. Am. Phil. Soc., 26: 1- 401.

Khan, M.A. & Akhtar, M., 2014. Antilopes (Mammalia,

Ruminantia, Bovidae) from the Upper Siwaliks of Tatrot, Pakistan, with description of a new species. Paleontologic. J., 48(1): 79-89.

Khan, M.A., Batool, A., Nayyer, A.Q. & Akhtar, M.,

2013. Gazella lydekkeri (Cetartiodactyla: Ruminantia: Bovidae) from the Middle Siwaliks of Hasnot (Late Miocene), Pakistan. Pakistan J. Zool., 45(4): 981-988.

Khan, M.A., Iliopoulos, G. & Akhtar, M., 2009. Boselaphines (Artiodactyla, Ruminantia, Bovidae) from the Middle Siwaliks of the Hasnot, Pakistan. Geobios, 42: 739-753.

Khan, M.A., 2008. Fossil bovids from the late Miocene of Padri, Jhelum, Pakistan. Pak. J. Zool., 40(1): 25-29.

Kostopoulos, D.S., 2005. The Bovidae (Mammalia, Artiodactyla) from the late Miocene of Akkaşdaği. Geodiversitas, 27: 747–791.

Pilgrim, G.E., 1937. Siwalik antelopes and oxen in the American Museum of Natural History. Bull. Amer. Mus. Nat. Hist., 72: 729-874.

Pilgrim, G.E., 1939. The fossil Bovidae of India. Pal. Ind. N. S., 26: 1-356.


BIOLOGIA (PAKISTAN) PKISSN 0006 – 3096 (Print) December, 2015, 61 (2), 343 ISSN 2313 – 206X (On-line)


A Note on the Status of Tariqilabeo (Pisces: Cyprinidae)

MUHAMMAD RAMZAN MIRZA & *MUHAMMAD NAEEM JAVED

Department of Zoology, Government College University, Lahore, Pakistan

ABSTRACT

The subgenus Tariqilabeo was proposed by Mirza & Saboohi (1990) to accommodate Labeo macmahoni Zugmayer which was subsequently elevated to genus. Later on this genus was merged into the synonymy of the widely distributed South-East Asian genus Crossocheilus. Since Tariqilabeo is quite different from Crossocheilus, it is suggested that Tariqilabeo be recognized as a valid genus different from Crossocheilus. At present only two species are included in this genus. 1. Tariqilabeo diplochilus (Heckel, 1838) 2. Tariqilabeo macmahoni (Zugmayer, 1912) Key words: Tariqilabeo, Crossocheilus macmahoni, Labeo macmahoni

INTRODUCTION

Tariqilabeo Mirza & Saboohi 1990, was

proposed as a subgenus to accommodate Labeo macmahoni Zugmayer which was subsequently raised to genus level by Mirza, 2003. Kullander et al. (1999) treated Tariqilabeo macmahoni Zugmayeras the synonym of Crossocheilus diplochilus Heckel. It was realized that this genus is similar to the South-East Asian genus Crossocheilus and hence was merged into its synonymy (Mirza & Arshad, 2008). Dr. S. O. Kullander, wrote in a letter dated 27-11-1999. “Concerning Crossocheilus diplochilus and Tariqilabeo macmahoni, my conclusion is different. I believe that diplochilus is a Tariqilabeo.It looks very different from any Indian or Southeast Asian Crossocheilus”. In the light of remarks by Dr. Kullander, we are of the opinion that Tariqilabeo be recognized as a valid genus. At present only two species, viz., Tariqilabeo diplochilus (Heckel) and Tariqilabeo macmahoni (Zugmayer) be included in this genus.

SYNONYMS OF TARIQILABEO DIPLOCHILUS

(HECKEL, 1838) Barbus diplochilus Heckel, 1838. Cirrhina latia Day, 1880. Crossocheilus latia diplochilus Mirza &

Kashmiri, 1973. Crossocheilus diplochilus Mirza, 1990.

SYNONYMS OF TARIQILABEO MACMAHONI (ZUGMAYER 1912)

Labeo macmahoni Zugmayer, 1912. Labeo (Tariqilabeo) macmahoni Mirza &

Saboohi, 1990. Tariqilabeo macmahoni Mirza, 2003.

Crossocheilus macmahoni Mirza & Arshad, 2008.

REFERENCES

Day, F., 1880. On the fishes of Afghanistan. Proc.

Zool. Soc. London.1880: 224 – 232.

Heckel, J. J., 1838. Fishe aus Cashmir. Wien.

Kullander, S. O., Fang, F., Delling, B. & Ahlander,

E., 1999. The fishes of the Kashmir valley.

In: River Jhelum, Kashmir Valley: Impact on

the aquatic environment (ed. L. Myman),

Swedmar, Sweden. Goteborg.

Mirza, M. R., 1990. Freshwater fishes in Pakistan,

Lahore: Urdu Science Board.

Mirza, M. R., 2003. Checklist of freshwater fishes of

Pakistan. Pakistan J. Zool. Suppl. Series 3:

1 - 30

Mirza, M. R. & Arshad, M., 2008. Status of Labeo

macmahoni Zugmayer (Pisces: Cyprinidae)

(S.C.) Pakistan J. Zool. 40 (6): 465 – 466.

Mirza, M. R. & Kashmiri, K. M., 1973. Fishes of the

river Soan in Rawalpindi District. Biologia.

19:61 – 82.

Mirza, M. R. & Saboohi, N., 1990. A note on the

freshwater fishes of the river Dasht with the

description of Tariqilabeo new subgenus

(Pisces: Cyprinidae). Pakistan J. Zool., 22:

405 – 406.

Zugmayer, E., 1912. Eight new fishes from

Baluchistan. Ann. Mag. nat. Hist., 10: 595 –

599.


biologia - government college university · biologia (pakistan) issn 0006-3096 ... s. s. i., jahan,...

Documents