biologylifescienceschool.files.wordpress.com · web viewagents of pollination, abiotic and biotic,...

1. Date:______________ 3. Subject : Biology 5. Periods Required:________ 7. Date of Commencement :__________

Month List of Units/ Sub UnitsActivities (Individual or

Group)Demonstrations / E-Class)Home Assignments

Home AssignmentsHOT and MLL (Minimum

Level of learning ) Question Prepared

Correlation with other Subjects

April

UNIT : REPRODUCTIONLesson : Reproduction in Organisms

REVIEW: Covered In Class –X, XI,

Asexual Reproduction, Means of Asexual Reproduction, Binary Fission , Budding,Formation of specialized structures, Conidia, Gemmules , Buds, Zoospores

Vegetative propagation ,Runner, Rhizome, Sucker, Tuber , Offset, Bulb

Sexual Reproduction, Pre-Fertilisation Events, Juvenile phase/ Vegetative phase,

Reproductive phase Oestrus cycle, menstrual cycle Events in Sexual Reproduction Pre-Fertilisation Events

Gametogenesis, Gamete transfer, Gamete transfer, syngamy , parthenogenesis , fertilization

Post-Fertilisation Events, Zygote, Embryogenesis, Oviparous , Viviparous , Zygote → Develops into → Embryo Ovule → Develops into → Seed

Ovary → Develops into → Fruit → Contains → Seeds → Disperse

and germinate to form new plants

Observation of gemmules buds, rhizome, tubers, conidia from preserved specimens

Collection of seeds of the plants found in the school campus

1. Differentiate between asexual reproduction and sexual reproduction.

2. What are advantages of gametogenesis?

3. Differentiate between menstrual cycle and oestrus cycle.

4.What are advantages of seed dormancy?

5. Enlist various steps of sexual reproduction.

6. What is gemmule ? In which Phyllum it is normally found?

1. Which type of reproduction is faster way of reproduction? Name any two organism in which it is found?

2. Arrange the following in proper sequence.

Ovary , Fruit Contains

seeds, Seeds Disperse and

germinate to form new

plants, , Develops into fruit

and seed

3. What is advantages of

juvenile phase in the life of

any plant?

Economics

2. Class: XII 4.Topic /Lesson : Reproduction in Organisms 6. Expected date of completion:________ 8. Actual Date of Completion:________

Remarks/Suggestion SIGN. OF TEACHER:________________ PRINCIPAL:______________1. Date:______________ 3. Subject : Biology 5. Periods Required:________ 7. Date of Commencement :__________



Home Assignments HOT and MLL (Minimum Level of learning ) Question Prepared

Correlation with other

Subjects Ap

rilUNIT : REPRODUCTIONLesson : Sexual Reproduction in Flowering

Plants REVIEW: Covered In Class –X, XI,

Pre-Fertilisation Events, Flowers , Androecium, Anther:, Structure of microsporangium,Microsporogenesis, Pollen grains, Vegetative cell , Generative cell Gynoecium, Stigma, Style, Ovary , Mega sporangium, Megasporogenesis, Female Gametophyte, Pollination , Autogamy , Geitonogamy, Xenogamy , chasmogamous flowers, cleistogamous flowers ,

Agents of Pollination, abiotic and biotic, Pollination by wind, Pollination by water, Pollination by animals, insect-pollinated flower and their characteristics contrivances for self pollination and contrivances for cross pollination,

Out Breeding Devices, Pollen−Pistil Interactions, Artificial Hybridisation, Emasculation , Bagging Double Fertilisation, syngamy, triple fusion, advantages of double fertilisation , Post-Fertilisation Events, Formation of Endosperm, Development of Embryo, monocot embryo, dicot embryo , Development of Seeds, Development of FruitsApomixis and Polyembryony,

Dissection of flower activity with locally available flower. Demonstration of pollen germination in nutrient medium and on fertilized stigma .Study of wind pollinated and insect pollinated plant from vicinity .

1. Draw well labelled diagram of internal structure of a flower . 2. Draw well labelled diagram of male gametophyte.

3. Draw well labelled diagram of female gametophyte.

4. Draw well labelled diagram of megasporangia.

5. Describe the development of male gametophyte.

6. Describe the development of female gametophyte.

7. Describe the development of embryo in a seed.

8. Describe the development of endosperm.

1. Draw well labelled diagram of monocot seed.

2. Draw well labelled diagram of typical fruit.

3. Draw well labelled diagram of micro sporangia of anemophilous flower which is recently released.

4. Differentiate between self pollination and cross pollination.

5. Enlist various methods which are employed by a plant to avoid self pollination.

6. Identify the given structure and explain various steps in its development in a seed.

7. Why do the plant breeders prefer apomixis?

ChemistryEconomics

2. Class: XII 4.Topic /Lesson : Sexual Reproduction in Flowering Plants 6. Expected date of completion:________ 8. Actual Date of Completion:________





Correlation with other

Subjects Ap

rilUNIT : REPRODUCTION

Lesson : Human ReproductionREVIEW: covered In Class -X,The Male Reproductive System, testes, Accessory glands and ducts ,External genitalia , Male germ cells, Sertoli cells, Leydig cells, Accessory ducts include Rete testis, Vasa efferentia, Epididymis, Vas deferens,

Female Reproductive System, Ovaries, fallopian tubes, infundibulum, ampulla, Uterus, Cervix and Vagina, External Genitalia, Mammary Glands,

Gametogenesis, spermatogenesis , spermiation, spermiogenesis. , oogenesis and its regulationMenstrual Cycle , follicular phase, ovulatory phase, luteal phase, menstrual phaseMenopause, and menarche,

Fertilisation and Implantation, site of fertilisation zygote., morula, Blastocyst, trophoblast, an inner cell mass, gastrula, fate of three germ layers,

Pregnancy, Parturition and Lactation, colostrum

Study of slides showing various stages of spermatogenesis and Oogenesis in mammalian testis and ovary. Ppt. and videos on this lesson

1. Draw well labelled diagram of internal structure of a testis. 2. Draw well labelled diagram of ovary showing Gametogenesis.

3. Draw well labelled diagram of female gamete in humans.

4. Draw well labelled diagram of male gamete in humans.

5. Describe the male reproductive system of man.

6. Describe the female reproductive system of humans.

7. Describe the development of fertilised egg (ovum) into an embryo.

8. Differentiate between spermatogenesis and Oogenesis.

1. Describe oogenesis with the help of suitable flow chart and specify the ploidy of each stage.

2. If testis fail to descend in scrotal sac in a boy. What changes can be expected in this boy after reaching puberty?

3. Differentiate between egg and morula.

4. Differentiate between blastula and morula.

5. Why do we call placenta as temporary endocrine gland? Enlist various hormones released by it.

6. Identify the given structure and explain various steps in its development in the gonad.

ChemistryBiochemistry

2. Class: XII 4.Topic /Lesson : Human Reproduction 6. Expected date of completion:________ 8. Actual Date of Completion:________

Remarks/Suggestion SIGN. OF TEACHER:________________ PRINCIPAL:______________1. Date:__________ 3. Subject : Biology 5. Periods Required:________ 7. Date of Commencement :__________






May

- Ju

ne

UNIT : REPRODUCTIONLesson : Reproductive Health & Population ExplosionREVIEW: covered In Class -X,Amniocentesis , Birth Control,

Natural Methods, Periodic abstinence, Coitus interruptus, Lactational amenorrhea

Artificial Methods, Barriers, Intra uterine devices (IUDs), Oral contraceptive pills, Surgical methods,

Medical Termination of Pregnancy (MTP), Sexually Transmitted Diseases (STDs), venereal diseases (VD ), Gonorrhoea, Syphilis, Chlamydiasis, Genital herpes, Genital warts, Trichomoniasis, Hepatitis-B, AIDS, preventive measures and its treatments

Infertility, reasons for infertility , Congenital diseases, Drugs, Immunological and Psychological factors

Assisted Reproductive Technologies(ART),

IVF, ZIFT , IUT, GIFT, ICSI, Artificial insemination

Ppt and videos on this lesson.

Finding various cuttings and news articles on the population control measures taken by government to improve the standard of living of public.

Conduction of seminar on HIV AIDs with the help of medical professionals.

1. What are the harmful effects of population explosion? How it can be regulated?

2. What is amniocentesis? How it is done? What are its advantages?

3. What is STD. What are its types? How it can be prevented?

4. Expand ICSI. When it is done. What are its advantages?

5. Why we cannot consider MTP as a type of contraception?

6. A couple want to adopt a terminal method of contraception. What will be the method advised to them by a qualified doctor. How it is done in either of them?

7. What the most common reasons for infertility in a couple?

1. Shyamlata’s mother in law wanted to take her to a baba so that she can have a son. But Shyamlata refused to go to a baba . Instead she explained that they are planning to take the help of ART .her mother in-law became very happy on her explanation. What type of values did shyamlata shown. What is ART. What are the technique they can utilize to achieve their dream.

2. Shabana’s overenthusiastic mother in-law wanted to know the gender of the unborn grand -child. Which test she intended to utilize to find the gender of the foetus.what are the harmful effects of this test on the mother and on the society?

Economics Medicines

2. Class: XII 4.Topic /Lesson : Reproductive Health & Population Explosion 6. Expected date of completion:________ 8. Actual Date of Completion:________

Remarks/Suggestion SIGN. OF TEACHER:________________ PRINCIPAL:______________







July

UNIT : GENETICS AND EVOLUTION

Lesson : Principles of Inheritance and Variation

Genetics, Inheritance, Variation, Mendel’s Experiments, seven traits of garden pea, Inheritance of One Gene, Monohybrid Cross, Punnett square, Mendel’s Laws of Inheritance, Law of Dominance, Test Cross, Law of Segregation, Incomplete Dominance, Law of Segregation and Co-dominance, Dihybrid Cross, Chromosomal Theory of Inheritance, Rediscovery of Mendel’s Work, Chromosomal Theory of Inheritance, Dihybrid Cross in Drosophila to Study Linkage and Recombination, Linkage and Recombination, Morgan’s experiment, Explanation of deviation from Mendelian ratio, Sex Determination in Various Animals Including Humans-Male and Female Heterogamety Mutation, Pedigree Analysis, & Genetic Disorders

Finding the various types of variations in pea seeds, practice of monohybrid cross, study of value based questions,observation of various videos and ppt and e-content on this lesson,

1. Define homozygous and heterogametic

2. Define allele, law of dominance, test cross.

3.Describe back cross with the help of suitable cross.

4. Describe the mendels law of independent assortment with the help of suitable cross.

5. A farmer purchased a pair of black pigs for his farm. On crossing they produced 4 white and 3 black piglets. He got fully confused with the result. Explain the out come of the cross with the help of suitable cross.

1. Sumans mother in law started scolding her as she gave birth to second daughter and asked his son Sunil to marry another girl to get a son. Sunil didn’t agreed to it . Instead he tried to convince his mother that gender of the baby is not determined by mother but by the type of sperm with the help of a chart. What values are shown by Sunil? Draw the cross Sunil must have drawn to convince her mother. Explain how gender of the baby is decided?

2 A farmer purchase d two plants of the same species one of them produces white flower while the other produces red flower. When he crossed these plants he found that the f 1 hybrids are producing only pink flower. Why it might have happened? What type of inheritance is shown by these plants?

Social scienceStatistics

2. Class: XII 4.Topic /Lesson : Principles of Inheritance and Variation 6. Expected date of completion:________ 8. Actual Date of Completion:________







July

UNIT : GENETICS AND EVOLUTION Lesson : Molecular basis of inheritanceDNA , Deoxyribonucleotides, Nucleotide, Nucleoside, phosphodiester bond, Double Helix Model for the Structure of DNA, Erwin Chargaff, Complementary bases pair ing, Purines, pyrimidines, Packaging of DNA Helix, Organisation of DNA in prokaryotes, Organisation of DNA in eukaryotes, Histone octamer , nucleosome, Non-histone chromosomal proteins , Discovery of DNA as a Genetic Material, Transforming Principle, Griffith experiments , S strain and R strain, Hershey and Chase Experiment to Confirm DNA as the Genetic Material, Properties of the Genetic Material, DNA is more stable than RNA, DNA Replication, Transcription, Transcriptional Unit, Template Strand and Coding Strand, Gene, Types of RNA, Transcription Process, Genetic Code, Effects of Mutations on Genetic Code, Translation, Regulation of Gene Expression,Human genome project, DNA fingerprinting

study of value based questions,observation of various videos and ppt and e-content on this lesson,

1. Differentiate between DNA &RNA.

2. Differentiate between different types of RNA.

3. Describe Griffith experiment. Which micro organism was used in this experiment? What does this experiment proved?

4. How many codons are present in the given sequence of mRNA?5’ AUGCAAGACCAGGACCAAUAG3’.How many amino acids can be coded by this sequence? What will he sequence of template strand from which it was transcribed?

5.What will be the sequence of the coding strand for the given strand of Mrna?5’ AUGCAAGACGACCACCAAUAG3’

1. Which process is shown by the following diagram?

2. Describe the formation of mRNA in E coli with the help of suitable diagram.

3. Enlist any six characteristics of genetic code. Explain any two characteristics.

4. Define the Chargoff rule.

5. In an organism’ X’ the DNA contain 20% adenine . What must be the % of Guanine?

Chemistry Physics

2. Class: XII 4.Topic /Lesson : Molecular basis of inheritance 6. Expected date of completion:________ 8. Actual Date of Completion:________







July

UNIT : GENETICS AND EVOLUTION

Lesson : Evolution

Origin of Life, Urey and Miller experiment, Theories of Evolution, Charles Darwin, Evidences of Evolution, Fossils, Comparative anatomy and morphology , Homologous organs, Analogous organs , Adaptive melanism , Industrial melanism, development of resistance of DDT pesticide in mosquitoes, Adaptive Radiation, Biological Evolution & Mechanism of Evolution, Branching descent , natural selection , Mechanism of Evolution, Hardy-Weinberg Principle,

p2 + 2pq + q2 = 1, Evolution of Plants, Evolution of Animals, Origin and Evolution of Man

Study of value based questions,observation of various videos and ppt and e-content on this lesson,

1. Which theory of evolution was proposed by Charles Darwin? What are its main points?

2. Describe Lamarckism.

3. Differentiate between homologous organ and analogous organs.

4. Explain hardy Weinberg principle with the help of suitable example.

5. Describe industrial melanism. Which organism has shown this ?

1. Describe Oparin Haldane experiment.

2. What are living fossils? Give two examples.

3. What is connecting link? Give two examples.

4. Why do the Wisdom teeth present in our body are called vestigial organ. Enlist any four other vestigial organs.

Chemistry Physics Anatomy History

2. Class: XII 4.Topic /Lesson : Evolution 6. Expected date of completion:________ 8. Actual Date of Completion:________







Augu

st

UNIT : BIOLOGY IN HUMAN WELFARE

Lesson : Human Health and DiseaseCommon Diseases in Humans, Ways to Ensure Good Health, Pathogenic DiseasesBacterial Diseases, Typhoid, Pneumonia, Viral Diseases, Common cold, HIV, Protozoan Diseases, Malaria, Amoebiasis, Fungal Diseases, Ringworms, Diseases Caused by Worms, Ascariasis, taeniasis, Elephantiasis (filariasis), Life Cycle of Plasmodium, Sporozoites, Gametocytes role of female anopheles mosquito, Immunity, Types of immunity, Innate immunity , Physical barriers , Physiological barriers , Cellular barriers , Cytokine barriers , Acquired immunity , B-lymphocytes , T-lymphocytes , Active Immunity, Passive immunity, vaccination, Allergies, Autoimmunity, primary lymphoid organs , secondary lymphoid organs, MALT , AIDS, Cancer Commonly Abused Drugs, Opioids (Heroin), Cannabinoids, Cocaine, Drugs Normally Used as Medicines, Nicotine, Ill Effects of Smoking


1. Describe replication of HIV in a cell. Name the type of cell HIV infects.

2. What is the causative agent for Malaria. What is the vector for this disease.In which stage of its life cycle the malarial parasite infect humans?

3. Draw well labelled diagram showing the structure of antibody.

4. Differentiate between active and passive immunity.

5. What are the withdrawal symptoms of drug addiction?

1. A person has met with an accident and there was severe blood loss. Doctors decided to provide him immunity to counteract the pathogen. Name the type of immunity the doctors must have given.

2. Raza was bitten by a poisonous snake. He was brought to a hospital Doctors gave him injection ‘X” to save his life. What is the X. How it is prepared? 3. Define neoplast. What way it is different from a normal cell? What does a neoplastic cell causes?

Chemistry History

2. Class: XII 4.Topic /Lesson : Human Health and Disease 6. Expected date of completion:________ 8. Actual Date of Completion:________







Augu

st

UNIT : BIOLOGY IN HUMAN WELFARE Lesson : Strategies for Enhancement in Food Production

Animal HusbandryFarm Management, Dairy Farm ,management, Poultry Farm Management, Animal Breeding, Aims of breeding, Inbreeding, Out-breeding , Out-crossing , Cross-breeding, Interspecific Hybridization , Controlled Breeding techniques, Artificial Insemination, Multiple Ovulation embryo Transfer (MOET) Technology, Apiculture, Fisheries, Plant Breeding, Classical plant breeding, Modern plant breeding, Steps Involved in Breeding a New Genetic Variety of a Crop, Collection of genetic variability, Evaluation and selection of parents, Crop hybridisation among selected parents, Selection of superior recombinants, Testing, release and commercialisation, Wheat and Rice, Indian Hybrid Crops, Applications of Plant Breeding, Conventional breeding, Mutational breeding, Genetic engineering, Pest-Resistant Crops, Improvement in Food Quality, Single-Cell Protein (SCP), Tissue Culture, Applications of tissue culture


1. Enlist various Steps Involved in Breeding a New Genetic Variety of a Crop. Explain any two steps of it.

2. What are the advantages of apiculture? Which organism is reared in this culture?

3. Describe mutational breeding.

4. What is micro propagation? What are its advantages?

5. Differentiate between inbreeding and out breeding.

1. Arrange the following in proper order a. Artificially inseminated

b. Fertilized egg is recovered at 8 − 32 cell stages

c. Cow is administered with FSH-like hormone

d. Super ovulation

e. Transferred to a surrogate mother.

2. Expand SCP. What are its advantages over conventional source of protein

Agriculture Animal husbandry

2. Class: XII 4.Topic /Lesson : Strategies for Enhancement in Food Production 6. Expected date of completion:________ 8. Actual Date of Completion:________







Augu

st

UNIT : BIOLOGY IN HUMAN WELFARE

Lesson : Microbes in Human Welfare

Household Applications, Lactic acid bacteria (LAB), Milk Curd, Fermentation,

Cheese making, Industrial applications, Fermented beverages , Saccharomyces cerevisiae, Antibiotics, Chemicals, enzymes, and bioactive agents, Microbes in Sewage Treatment, primary Treatment , sequential filtration , by sedimentation, Secondary Treatment,

Floc = Bacteria + Fungal filaments , Activated Sludge, Microbes as Bio control Agents, Bacillus thuringiensis , Trichoderma, Baculoviruses, Nucleopolyhedrovirus, IPM , Microbes as bio-fertilizers


1. What is the role of Saccharomyces cerevisiae?

2. Define antibiotics. Give two examples of antibiotics. How do they work?

3. What is floc? What are its advantages?

4. What is IPM. What are its advantages?

5. Why do every city need to treat its sewage? Enlist various steps of sewage treatment. Explain any two steps of sewage treatment.

1. What are biological pest control agents? What are its advantages over conventional pesticides?

2. What is the role of lactobacilli for food industry?

3. Draw well labelled diagram of bioreactor.

4. What are advantages of using bioreactors in an industry?

5. A farmer is spraying a solution containing Bacillus thuringiensis on his crop> what may be his purpose to spray this on his crop?

Chemistry Engineering Agriculture

2. Class: XII 4.Topic /Lesson : Microbes in Human Welfare 6. Expected date of completion:________ 8. Actual Date of Completion:________








Sept

embe

r

UNIT : BIOTECHNOLOGY

Lesson : Biotechnology : Principles and Processes

Biotechnology, Basis of Modern , biotechnology, Genetic engineering , Aseptic techniques , Genetic Engineering, Creation of recombinant DNA, Gene cloning, Gene transfer into host organism, Construction of a Recombinant DNA, Restriction Enzymes as Tools of RDT, Endonucleases , Exonucleases , pallindromic, Naming restriction enzyme, Gel Electrophoresis, Cloning Vectors, Plasmids , bacteriophage, Components of a plasmid cloning vector, Origin of replication (ori), Selectable marker, Cloning sites, selecting recombinants, Alternate selectable marker, Cloning vectors for plants and animals, Ti plasmid , Retrovirus , Competent host, Microinjection , Ballistics (Gene Gun), Processes of RDT, Isolation of Genetic Material (DNA), Cutting of DNA at Specific Locations, Polymerase Chain Reaction (PCR), Denaturation, Annealing, Extension, Bioreactors,Downstream Processing


1. What is the significance of “ ori” in a plasmid. What will happen if restriction enzyme cuts the ‘ori’ gene in a plasmid of interest?

2. What is palindromic sequence? Write two palindromic sequences.

3. Expand PCR. What are advantages of PCR?

4. What is Taq -Polymerase? From which organism its is obtained? Where it is utilized?

5. Draw well labelled diagram of pbr 322. What are its advantages?

1. Which is the most commonly used cloning vector?

2. Enlist various methods which can be used for introduction of rDNA / desirable gene in a cell. Explain any two methods.

3. Arrange the following in a proper sequencea. isolate the DNA from cell b. incubate the DNA fragmentsc. Splice the DNAd. Use gel electrophoresis to separate desirable DNAe. Transfer the rDNA in to host cellf. Splice the vector? Plasmid and add desirable DNA

2. Class: XII 4.Topic /Lesson : Biotechnology : Principles and Processes 6. Expected date of completion:________ 8. Actual Date of Completion:________







Sept

embe

r

UNIT : BIOTECHNOLOGY

Lesson :Biotechnology and its Applications

Applications of Biotechnology in Agriculture, Genetically Engineered Crops, Bt Cotton, Bacillus thuringiensis , RNA Interference (RNAi), transposons , Applications of Biotechnology in Medicine, Recombinant Therapeutics, Genetically Engineered Insulin, Pro-enzyme insulin Mature insulin, Gene Therapy, ADA deficiency , cDNA, Molecular Diagnosis, PCR, ELISA, Hybridisation, Transgenic Animals, Reasons for Producing Transgenic Animals, Study of normal physiology, Study of diseases, Biological products, Vaccine safety tests, Chemical safety testing, Ethical Issues Associated with Transgenic Animals, GEAC , Biopiracy


1. What is pro insulin? What way it is different from mature insulin?Can we use pro insulin for therapeutic use instead of insulin? Explain.

2.A kid is detected with a rare disease/ condition SCID. What this SCID stands for? Why it is caused? How it can be treated?

3. Enlist various advantages of transgenic animals.

4. Which test is utilized to detect whether the person has HIV or not? Which sample is used to perform this test?

1. What is RNAi, against which organism it is most commonly used? How this work?

2.What are transposomes? What is their significance?

3. Enlist various advantages of Bt cotton over conventional cotton Plants?

4. Enlist various stages in preparation of Bt- cotton from a normal cotton plant.

5. What is biopiracy? How it can be prevented?

Chemistry Biochemistry Medicine Agriculture

2. Class: XII 4.Topic /Lesson : Biotechnology and its Applications 6. Expected date of completion:________ 8. Actual Date of Completion:________






Oct

ober

UNIT : ECOLOGY

Lesson : Organisms and PopulationsOrganisms and Environment,

Abiotic Factors, Temperature , Water , stenohaline, euryhaline , Soil , Light, photoperiodism,

Responses to Abiotic Factors, Regulate, Conform , Migrate , Suspend, diapauses, Adaptations, Desert plants , Animals of colder regions , Allen’s rule, Population, Sex ratio , Age distributionPopulation Growth, Natality (B) , Mortality (D) , Immigration (I) , Emigration (E)

Nt + 1 = Nt + [(B + I) − (D + E)], Growth Models, Exponential Growth ,

dN/ dt = rN, logistic growth

Life History Variations, Population Interactions, Interspecific interactions, Predation , Competition ,

Gause’s Competitive Exclusion, principle , Parasitism , Commensalism, Mutualism or symbiosis

Finding various types adaptions seen in the animals and plant in our viscinity.

Study of videos and ppts on this lesson.Observing relationship of various animals and plant with respect to each other and assigning them appropriate term for interaction shown.

1.What do you mean by euryhaline organisms. Explain with the help of suitable example.

2. Polar bear spend their winter sleeping in their hideout. What way it helps?

3. What is brood parasitism? Explain it with the help of suitable example.

4. Draw the type of age pyramid of age group indicating the expanding population.

5. What is denoted by the following formula Nt + 1 = Nt + [(B + I) – (D + E)]

6. How does kangaroo rat survive in the extreme condition of desert although it doesn’t drink water? Enlist various adaptations it must be having.

1. Observe the following diagramWhat does A,B C represent in the diagram?

2. In desert animals like desert fox the size of the ear is longer while in arctic fox it is smaller, explain why?

3. Explain the type of relationship exhibited by Rhizobium bacteria and roots of leguminous plants.

4. Which type of growth curve will be shown by an alien organism when first time introduced in a favourable environment ?

Chemistry Physics Geography Statistics

2. Class: XII 4.Topic /Lesson : Organisms and Populations 6. Expected date of completion:________ 8. Actual Date of Completion:________






Oct

ober

UNIT : ECOLOGY

Lesson : Ecosystem

Structure of Ecosystem, Productivity, primary productivity., gross primary productivity (GPP) , net primary productivity (NPP), NPP = GPP − Respiratory losses (R), Secondary productivity , Decomposition, Fragmentation, Leaching, Catabolism, Humification , Mineralization, Energy Flow , photosynthetically active radiation (PAR)., Food chain , Food web , Trophic level , Standing crop Standing state ,

Ecological Pyramids , Pyramid of number, Pyramid of biomass, Pyramid of energy, Ecological Succession, primary succession, (secondary succession, Climax community , Pioneer species , Sere(s) , Hydrarch succession , Xerarch succession , Nutrient Cycling, Carbon Cycle, Phosphorus Cycle

Drawing food chain for various types of ecosystems, identification of various trophic level from any food chain or food web, drawing pyramids of energy for any given ecosystem,Observation of e content , videos or ppt on the topics

1. Define primary productivity. What way it is different from secondary productivity?

2. Expand the given equation NPP = GPP – R

3. Describe the type of succession happening on a rock which is exposed to the environment recently due to land slide.

4. In which ecosystem we can get the pyramid of biomass inverted state and why?

5. Which type of succession is faster, primary succession or secondary succession and why?

6. Describe the Biological Nitrogen fixation.

7. What is denitrification? What is its effect on the soil fertility?

1. Why do any food chain cannot have more than 6 trophic levels?

2. Which on is considered more stable food chain or food web and why?

3. What is leaching? What are its harmful effects?

4. Differentiate between primary succession and secondary succession.

5. Differentiate between climx community and pioneering community.

6. Describe phosphorus cycle with the help of suitable flow chart.

7. Raju used to buy urea in large quantity for his field. His friend Ali advised him not to spend this much of money on urea . Instead he advised him to grow leguminous plants as an intercrop and explained him how this leguminous plant will be beneficial for his field. What values did Ali shown? Provide the Scientific explaination for the statement of Ali .

Chemistry, Geography,

2. Class: XII 4.Topic /Lesson : Ecosystem 6. Expected date of completion:________ 8. Actual Date of Completion:________



Group)Demonstrations / E-Class) Home Assignments



Nov

embe

r

UNIT : ECOLOGY

Lesson : Biodiversity and Conservation Biodiversity, Genetic diversity , Species diversity Ecological diversity , Patterns of Biodiversity, Latitudinal gradients , advantages of biodiversity, hotspots of biodiversity

Species-Area relationships log S = log C + Z log A

Importance of biodiversity ,Characteristics of a stable community,

Loss of Biodiversity,

Over-exploitation , Alien-species invasion , Co-extinction , Habitat loss and fragmentation ,

Biodiversity ConservationIn-situ conservation , national park, sanctuary, sacred forest, sacred lakes, Ex-situ conservation, gene bank, seed bank, zoological park , botanical garden, tissue culture, sperm bank, cryopreservation.

Finding various types of plants and animals in your surrounding,

Finding why western ghat are called as hot spots of biodiversity,

Study of ppt and videos and e content for this lesson

1. Define biodiversity. What are its types?

2. What is hot spots of biodiversity? Name any two hot spots of biodiversity in India.

3. Give any three characteristics of stable community.

4. What are the effects of introduction of alien species introduction in a new environment on the endemic species? Explain it with the help of suitable example.

5. What is in -situ conservation? Explain it with the help of suitable example.

1. What is sacred forest what way it help in conservation of biodiversity?

2. Enlist various reasons for loss of bio diversity of a given ecosystem. Explain any two reasons.

3. Expand the given equation with the usual meanings log S = log C + Z log A

4. In Assam now days the problem of wild elephant entering the crop field is a common phenomenon. Amal told his class mates that it is happening due to excessive increase in the elephant population and their number should be reduced. To which Suraj told them that it not due to excess population of elephant but due to habitat loss and fragmentation due to faulty agricultural practices and increasing urbanisation and it can be easily solved by increasing forest cover and removal of illegal settlement in the reserve forest. What values are shown by Suraj?

Ecology Geography Biotechnology Tourism

2. Class: XII 4.Topic /Lesson : Biodiversity and Conservation 6. Expected date of completion:________ 8. Actual Date of Completion:________






Nov

embe

r

UNIT : ECOLOGYLesson : Environmental Issues

Air Pollution, sources of air pollution , Control of Air Pollution, scrubber, CNG, catalytic converters , Unleaded petrol, use of chimneys, electrostatic precipitators,

Greenhouse Effect, The greenhouse gases (CO2, methane, etc.) , Water Pollution, Domestic sewage , Industrial Effluents , biomagnifications, bioaccumulation, Thermal wastewater discharge , Eutrophication, Control of Water PollutionIntegrated wastewater management ,

Solid Waste management, Agrochemicals Wastes, Radioactive Wastes, Improper Utilisation of Resources, Soil erosion and desertification , Water logging and soil salinity , Ozone Depletion, chlorofluorocarbons (CFCs)

Montreal Protocol , Deforestation

Study of ppt and videos and e content for this lessonFinding various types of control measures used in your locality,

1. Define air pollution. What are the main sources of air pollutants?

2. What is the harmful effect of CFC. Where it is normally used?

3. What precautions need to be taken while handing the nuclear waste? How it can be safely disposed?

3. Define soil erosion. What are its causes? What are its harmful effects? How it can be controlled?

4. A farmer has been applying DDT in his field since last few years. Suddenly he found that the number of fish eating bird population of nearby pond is reducing drastically. When he checked the concentration of DDT in the pond water, it was negligible, but the birds body were showing comparatively very high concentration of DDT? How is it possible? Explain with the help of suitable flow chart. What this phenomenon is called as?

1. some years back thinning of ozone layer is observed in Antarctica was observed? What might be the probable cause of it? What are its potential dangers?

2. Suresh went for morning walk with his friend Salim to see the pond of his friend. To his surprise he found that large number of fishes are coming to water surface and making bubble. Salim happily told hem that the fishes are very happy and they are coming to water surface to greet him. Suresh politely told him that it is not true and there is something wrong with the water quality and D O. He also explain the reasons for this phenomenon and its control measures. What values are shown by Suresh? What this phenomenon is called as?

ChemistryPhysicsEngineering

2. Class: XII 4.Topic /Lesson : Environmental Issues 6. Expected date of completion:________ 8. Actual Date of Completion:________






Nov

embe

r

UNIT : ECOLOGYLesson :

1.

2. Class: XII 4.Topic /Lesson : Revision 6. Expected date of completion:________ 8. Actual Date of Completion:________






Dece

mbe

r

REVISION AND REMIDIAL CLASS FOR LATE BLOOMERS

2.

2. Class: XII 4.Topic /Lesson : 6. Expected date of completion:________ 8. Actual Date of Completion:________






Janu

ary


3.







Febr

uary


4.



biologylifescienceschool.files.wordpress.com · web viewagents of pollination, abiotic and biotic,...

Documents