biogeochemical gradients and genomics of denitrifying ...reduction of nitrite to nitric oxide. it...
TRANSCRIPT
Biogeochemical gradients and genomics of denitrifying microbial communities in Siders Pond, a meromictic salt-stratified system
Michelle Pombrol
Candidate for A.B. Biology Brown University
Advisor: Julie Huber
The Josephine Bay Paul Center Marine Biological Laboratory
Semester in Environmental Science December 12, 2014
2
Biogeochemical gradients and genomics of denitrifying microbial communities in Siders
Pond, a meromictic salt-stratified system
Michelle Pombrol, Brown University, Providence, RI 02912
ABSTRACT
This study analyzes presence and expression of the gene nirK in relation to physical
characteristics, nitrogen concentrations, and denitrification rates within a salt-stratified pond.
nirK codes for the copper nitrite reductase enzyme that catalyzes the reduction of nitrite to nitric
oxide. Profiles of the pond’s physical characteristics and nitrogen concentrations were created
and compared in order to understand how physical characteristics influence rates of
denitrification throughout the water column, the lower half of which is anoxic. Denitrification
rates were estimated with rate experiments. Genetic analysis of microbial communities was
completed via PCR with primers targeting a section of the nirK gene. We were able to verify the
presence of nirK in bacteria throughout the water column, even in the highly oxygenated surface
waters. Analysis of nirK expression was unsuccessful. Still, the presence of nirK in bacterial
genomes throughout the entire water column highlights the metabolic plasticity of
microorganisms living there.
Keywords: denitrifying microbes, water column, stratification, marine nitrogen cycling, nitrite
reductase, nirK
INTRODUCTION
Anthropogenic nitrogen inputs to aquatic systems are increasing as land is being rapidly
developed for commercial and residential use. Denitrification is the main process by which
nitrogen is lost from a system and therefore may be able to prevent eutrophication, which occurs
as a result of nitrogen overload in a system. However, denitrification also releases N2 and N2O,
which are greenhouse gases that may contribute to climate change. Understanding how and when
microbes carry out denitrification may contribute to conservation efforts as well as to efforts to
decrease total greenhouse gas emissions.
Denitrification is a stepwise process in which nitrate and nitrite are used as alternative
electron acceptors in the metabolic pathways of microorganisms. Nitrate and nitrite are first
reduced to nitric oxide; they may be ultimately reduced to N2 gas that is then lost to the
3
atmosphere (Figure 1). Microorganisms mediate every step in the denitrification process, and
each step is controlled by the activity of specific enzymes encoded by their own genes (Canfield
et al. 2010). This paper studies the distribution and activity of the gene nirK in bacteria in Siders
Pond in Falmouth, MA. nirK encodes for copper nitrite reductase, an enzyme that catalyzes the
reduction of nitrite to nitric oxide. It has been shown that nirK can be used as a molecular marker
for denitrifying bacteria (Braker et al. 2000). Analysis of nirK presence and expression microbial
communities in Siders Pond can provide an understanding of how microorganisms influence
nitrogen cycling in the system.
Siders Pond is a coastal pond with unique features: it is salt-stratified and meromictic,
never mixing below a depth of about 3 m (Caraco 1986). The pond receives freshwater inputs
from groundwater and saltwater inputs from a channel in its southwest corner that floods a few
times per year and allows seawater from Vineyard Sound to flow into the system. This salty
water is denser than freshwater and sinks to the bottom of the pond. The differences in salinity
between the pond’s freshwater and seawater inputs, as well as the unusual depth of the pond,
keep the water column stratified throughout the year. This stratification makes Siders Pond an
ideal location to study denitrification and the microbial communities that carry it out. The water
column can be divided into three layers based on dissolved oxygen concentrations: the oxic,
transition, and anoxic layers. These three distinct layers provide three very different
environments for microbes to inhabit, facilitating study of how denitrifying microbes respond to
the physical characteristics of their immediate environment.
METHODS
Site description. Siders Pond is a salt-stratified meromictic pond located in Falmouth, MA. The
pond receives both freshwater and saltwater inputs – seepage faces allow fresh groundwater to
enter the pond, while a small channel in the pond’s southwest corner allows salt water to flow in
from Vineyard Sound during flooding events (Figure 2). The pond is unusually deep, reaching a
maximum depth of 15 m. (Figure 3). The water column is strongly stratified, showing drastic
changes in dissolved oxygen concentrations, temperature and salinity at specific depths. The
water column is completely anoxic after 6 m (Figure 4), providing an ideal environment for
denitrifying microbes. The pond receives nitrogen inputs from the surrounding area, which is
heavily developed.
4
Field collection. Measurements of DO (% and ‰), salinity, temperature, and PAR were taken
via Hydrolab® at 0.5 m intervals between the surface and the deepest part of the pond. Water for
nitrogen profiling was collected in 250 mL plastic bottles using a GeopumpTM peristaltic pump.
Bottles and tubing were rinsed between samples to avoid nitrogen contamination. Water for
nitrate incubations was collected in 120 mL glass serum bottles with rubber stoppers and metal
crimps to avoid the introduction of oxygen.
Bacterial biomass was collected by attaching sterile SterivexTM filters to the end of the
GeopumpTM tubing and pumping approximately 400 mL of water through the filter. Filters were
then immediately placed in sterile 50 mL conical tubes and frozen using dry ice.
Table 1 shows the depths at which samples were collected for each experiment.
Nitrogen profiling. All water samples were filtered through 25mm ashed glass microfiber filters
to remove debris and microbial biomass before nutrient analysis. Water to be sampled for NH4+
was acidified with 5 N HCl and placed in a refrigerator, while water for NO3-, NO2
-, and total
dissolved nitrogen (TDN) analysis was placed in a freezer.
Ammonium concentrations were measured using colormetric analysis (SES colormetric
analysis protocol). Nitrate, nitrite, and TDN concentrations were measured using a Lachat
automatic analyzer (SOP for nitrate, nitrate from the Grace Analytical Lab).
Nitrate incubations. Nitrate concentrations of water column samples were increased by 30 µM,
regardless of the initial concentration of nitrate in that layer of the water column. This was
achieved by introducing 1 mL of 3,600 µM NO3- solution into the 120 mL serum bottles using a
1 mL syringe and hypodermic needle. An additional hypodermic needle was placed through the
rubber stopper in order to allow water to flow out of the bottle when the nitrate solution was
added. Samples were incubated at 15°C for 4 days, after which serum bottles were opened and
water was analyzed for ammonium and nitrate concentrations using the protocols described
above. Denitrification rates in the water column were estimated by calculating the difference
between the nitrate concentration at the beginning and end of the incubation and dividing by the
incubation time.
5
Gene expression analysis. SterivexTM filters were stored at -80°C until the time of nucleic acid
extraction. Nucleic acids were extracted using an RNA PowerSoil® Total RNA Isolation Kit and
an RNA PowerSoil® DNA elution accessory kit purchased from MO BIO Laboratories, Inc.
Nucleic acid concentrations were initially quantified using a Thermo Scientific
NanodropTM 2000. RNA concentrations were later further quantified using a Quant-iTTM
RiboGeen® RNA Assay Kit purchased from Life Technologies. Standards were created with
concentrations up to 1,000 ng/mL for a high-range assay.
The presence of bacterial DNA in each sample was tested via PCR with primers targeting
the gene encoding 16S bacterial rRNA (8F and 1492R, sequences 5’
AGAGTTTGATCCTGGCTCAG 3’ and 5’ CGGTTACCTTGTTACGACTT 3’, respectively).
RNA samples were treated with an Ambion TurboTM DNase kit to remove residual DNA.
Samples were treated with 1 uL and incubated at 37°C for 20 minutes. Then, an additional 1uL
of DNase was added and the samples were incubated at the same temperature for another 20
minutes. After the first DNase treatment, DNA contamination was found to still be present in the
samples. Samples were treated again with 2uL of DNase and incubated at 37°C for 30 minutes.
PCR with 16S bacterial rDNA primers showed that contamination was still present after the
second DNase treatment; however, it was determined that presence of 16S rDNA in the samples
would not interfere with possible amplification of nirK and that nirK was not present in the
contaminant.
nirK presence and expression was measured with primers targeting and internal section of
the copper nitrite reductase gene (nirKFlaCU and nirKR3Cu, sequences 5’
ATCATGGTSCTGCCGCG 3’ and 5’ GCCTCGATCAGRTTGTGGTT 3’, respectively).
PCR products were visualized on 1% agarose gels. All gels were run at 105V for 22-25
minutes. Gels were then imaged and analyzed with a UV transilluminator and one-dimensional
analysis software.
PCR master mix concentrations and thermal profiles for all reactions are shown in Tables
2 and 3, respectively.
RESULTS
Physical profile. The water column of Siders Pond shows strong stratification in relation to its
physical characteristics: salinity, temperature, and DO (Figure 4). Dissolved oxygen begins to
6
decrease dramatically at approximately 3 m; at approximately 6 m, the dissolved oxygen
concentrations drop to zero and the water column becomes anoxic. Salinity stays relatively
constant until three meters depth, where it begins to increase steadily before reaching a
maximum of approximately 18 psu near the bottom of the water column. Temperatures in the
pond are relatively low, averaging 14.4°C and peaking at 17.1°C at 5.5 meters. At the surface of
the pond PAR is 916 (Figure 5). Within six meters of the surface, PAR drops to zero.
Nitrogen profile. Nitrate concentrations decrease with depth (Figure 6). Nitrate is present in
especially high concentrations in the surface waters. After 2 m, concentrations decrease steadily.
At 6 m and below, nitrate is completely depleted. No nitrite was detected at any depth in the
water column.
The trend in ammonium concentrations is markedly different from the trend in nitrate
concentrations. Ammonium is present at very low concentrations in the oxic and transition layers
(Figure 7). Concentrations of ammonium do not begin to increase until around 8 m. By 12.5 m,
ammonium concentrations reach almost 2000 µM.
Total dissolved nitrogen data showed that dissolved organic nitrogen (DON) is present
throughout the water column, although there is little discernable trend in DON concentrations
(Figure 8). After 9.5 m, ammonium is the only form of nitrogen available in the water column.
Nitrate incubations. Rates of nitrate loss were more than three times higher in the anoxic layer
than in the oxic or transition layer (Figure 9). In the top two layers, nitrate concentrations
decreased at a rate of between 2 and 3 µM per day, while nitrate concentrations in the anoxic
layer decreased by between 6.5 and 7.5 µM per day. It is important to note that estimated rates of
denitrification at 11.5 m and 12.5 m are minimum potential rates. The concentration of nitrate at
these depths in the water column is zero. At the end of the four-day incubation, nitrate
concentration in the water collected from these two depths returned to zero. Thus, the estimated
rate is the maximum rate that we were able to measure given the parameters of the experiment.
Actual rates of denitrification in this portion of the water column may be higher than the
estimated rate.
7
The addition of nitrate to these water samples did not appear to affect ammonium
concentrations – after four days, ammonium concentrations in the bottles showed very little
change from their original concentrations in the water column (Figure 10).
Nucleic acid extraction. Concentrations of nucleic acids obtained from extractions are displayed
in Figure 11. DNA extraction yielded concentrations ranging from 11.8 ng/µL to 161 ng/µL.
RNA extraction yielded concentrations ranging from zero to 67.3 ng/µL. Further quantification
with Ribogreen showed that the actual range of RNA concentrations was 0.52 ng/µL to 74.96
ng/µL. Samples from all depths above 7.5 m yielded RNA concentrations below 2 ng/µL; these
low concentrations made it impossible to synthesize cDNA from these samples.
Gene presence. PCR using primers targeting 16S bacterial rDNA showed that bacteria are
present throughout the entire water column (Figure 12). PCR with nirK primers showed that nirK
is present in bacterial genomes in all layers of the water column (Figure 13).
Gene expression. Amplification was seen in all cDNA samples amplified with 16S rDNA
primers (Figure 14). Multiple attempts to amplify nirK within bacterial cDNA proved
unsuccessful.
DISCUSSION
Physical profile. Stratification in the pond is maintained by the salinity difference between the
seawater that flows in from Vineyard Sound and the freshwater that enters via groundwater
seepage faces. This stratification is maintained throughout the year (Caraco 1986), allowing the
bottom portion of the water column, where there is no photosynthetically active radiation, to
become anoxic. Dissolved oxygen concentrations are high in the surface waters because this
water experiences atmospheric exchange. Below the surface waters, dissolved oxygen
concentrations decrease rapidly as photosynthetically active radiation becomes scarce due to
light extinction.
The water column does appear to mix up to a depth of approximately 3 m – salinity, DO,
and temperature are all relatively uniform down to this depth, after which they begin to deviate
8
and gradients develop. This mixing is likely wind driven, rather than a result of turnover within
the pond (Nalven 2011).
Nitrate and nitrite concentrations. The high nitrate concentrations in the surface water of the
pond are likely due to nitrogen loading from the surrounding area. Nitrate is completely absent in
the water column starting at 6 m, where the water column becomes anoxic and denitrification
becomes uninhibited. The complete lack of nitrate below 6 m indicates that denitrification is
occurring at rates that are higher than the rate at which nitrate is entering this portion of the water
column.
Ammonium concentrations. The rapid increase in ammonium concentrations beginning at 8 m
may be attributed to excretion by microorganisms and the lack of aerobic metabolism in the
anoxic layer.
Denitrification rates. Estimated losses of nitrate were higher in the anoxic layer than in the oxic
and transition layers. While loss of nitrate in the anoxic layer can be attributed to denitrification
by microbes, nitrate loss still occurs in the upper, oxygenated portion of the water column. This
nitrate loss is likely due to uptake of nitrate by bacteria for growth. Although uptake of nitrate for
growth may also be occurring in the anoxic layer, the large difference in the rate of nitrate loss in
this layer suggests that another process is contributing to nitrate losses – in this case, that process
is denitrification. The complete lack of nitrate in the anoxic layer also supports the idea that
denitrification is occurring rapidly there.
Gene presence. Amplification of DNA samples from all depths in the water column indicates
that nirK is ubiquitously present. The presence of nirK in the genomes of bacteria throughout the
water column suggests that all of these bacteria have the genomic potential for denitrification.
However, as the nitrogen profile and calculated denitrification rates show, denitrification itself is
confined to the lower portion of the water column, where the water is anoxic. This suggests that
bacteria in the upper portion of the water column, where denitrification is being inhibited by the
presence of dissolved oxygen, are not expressing genes involved in denitrification. These
9
bacteria would have no need for the nitrite reductase enzyme and it is likely they are instead
expressing genes involved in other metabolic pathways.
Gene expression. Nucleic acid concentrations were significantly lower in samples taken from
the oxic and transition layers than from the anoxic layer. Low concentrations of RNA in samples
taken at depths above the anoxic layer meant that cDNA could not be synthesized from these
samples. Although the cause of the low nucleic acid concentrations could not be definitively
determined, a number of factors were considered. In 2011, SES student Sarah Nalven estimated
cell counts in the water column and determined that microbial biomass is lower in the oxic layer.
She proposed that biomass might be higher in the oxycline and lower in the water column due to
the many microhabitats that are available to microbes in these areas. It is important to note that
low cell counts alone would not prevent denitrification from occurring in the upper water
column. Potential rates of denitrification may remain high even if cell counts are below 100 cells
per mL (Knowles 1982).
16S rDNA was amplified from samples taken in the anoxic layer. Amplification was
observed in all samples. 16S is a component of the small subunit of prokaryotic ribosomes,
which play an integral role in cell functioning. Thus, the presence of the 16S gene in bacterial
cDNA suggests that bacteria are active.
Multiple attempts to analyze nirK expression by amplifying the gene in bacterial cDNA
were unsuccessful. Although nirK amplification was observed in samples from the anoxic layer,
the results were complicated by amplification in the negative control sample, which contained
RNA that had undergone the cDNA synthesis reaction without reverse transcriptase. The source
of this amplification could not be determined; a PCR reaction with the nirK primer pair and
bacterial RNA samples did not show amplification, suggesting that nirK was not present in the
DNA contaminant.
Although analysis of nirK expression was unsuccessful, it may be possible to quantify
expression of other genes involved in denitrification with similar methods. narG, nosZ, and napA
are strong candidates for gene expression analysis. Primer pairs for these genes have been
described in the literature (Throbäck et al. 2004 & Smith et al. 2007), and these genes all encode
enzymes involved in important steps in denitrification. Another potential candidate, nirS, also
encodes nitrite reductase, although this one contains cytochrome cd1 instead of copper (Braker et
10
al. 2000). However, it may be even more difficult to quantify gene expression with nirS; in 2010
Yoshida et al. showed that copy numbers of nirK, but not nirS, increase when bacteria are
exposed to conditions conducive to denitrification.
Quantitative PCR (qPCR) is another option for gene expression analysis. The PCR
methods used in this study, had they been successful, would have provided semi-quantitative
expression data. qPCR is able to provide quantitative expression data and may not have faced the
same constraints as the traditional PCR utilized in this study.
CONCLUSIONS & FUTURE DIRECTIONS
Analysis of presence and expression of bacterial denitrifying genes provides insight into
the microbial capacity for denitrification within a system. Siders Pond is situated in an area that
has been heavily developed; thus, a large portion of its nitrogen input is anthropogenic. In
systems such as Siders Pond, denitrification is the main process that alleviates stress on the
system from high nitrogen loading and prevents eutrophication. In order to better understand
how the system handles the large nitrogen load it receives, it is important to understand the
microbial communities that facilitate denitrification. This study demonstrates that the genomic
potential for denitrification exists in bacteria living in all portions of the water column, even
though denitrification itself is confined to the anoxic layer. This, in turn, highlights the metabolic
plasticity of Siders’ microbial communities. It is likely that bacteria living in the oxic and
transition layers have repressed their denitrification genes and are instead expressing genes
involved in an alternative metabolic pathway.
Future studies should analyze expression of nirK in microbes using cDNA from bacteria
in all layers of the water column. Analysis of other genes involved in the denitrification pathway,
including narG (membrane-bound nitrate reductase), napA (periplasmic nitrate reductase), and
nosZ (nitrous oxide reductase) may provide further insight into the denitrifying capacity of
Siders’ microbial community. Measuring nitrogen loading to the pond and comparing the annual
nitrogen load to rates of denitrification in the anoxic layer may allow us to estimate the capacity
of the pond’s microbial communities to prevent eutrophication.
11
ACKNOWLEDGEMENTS
I would like to express my gratitude to Julie Huber, without whom this project would not
have been possible. Thanks to Emily Reddington, who was immensely knowledgeable, patient,
and kind. Thanks to Joe Vallino, who lent his vast expertise to the nitrate incubation experiment.
Rich McHorney and Kat Klammer were indispensable during field collection. Thanks to Fiona
Jevon and Tyler Messerschmidt for their endless support; special thanks to Nick Barrett for
providing unconditional encouragement.
12
REFERENCES
Braker, G., Fesefeldt, A., and Witzel, K-P. (1998). “Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples.” Appl. Environ. Microbiol. Vol. 64 No. 10. 3769-3775. Braker, G., Zhou, J., Wu, L., Devol, A., and Tiedje, J. (2000). “Nitrite reductase genes (nirK and nirS) as functional markers to investigate diversity of denitrifying bacteria in Pacific Northwest marine sediment communities.” Appl. Environ. Microbiol. Vol. 66 No. 5. 2096-2104. Canfield, D., Glazer, A., and Falkowski, P. (2010). “The evolution and future of the earth’s nitrogen cycle.” Science. Vol. 330. 192-196. Caraco, N. (1986). “Phosphorous, iron, and carbon cycling in a salt stratified coastal pond.” Boston University Ph.D. thesis. Grace Analytical Lab. (1995). “Standard operating procedure for nitrate, nitrite (Lachat method).” Knowles, R. (1982). “Denitrification.” Microbiological Reviews. Vol. 46 No. 1. 43-70. Nalven, Sarah. (2011). “Diversity and distribution of sulfate-reducing bacteria in Siders Pond, a meromictic pond.” Semester in Environmental Science Final Project. Semester in Environmental Science. (2014). “Colormetric analysis protocol.” Smith, C., Nedwell D., Dong, L., and Osborn, M. (2007). “Diversity and abundance of nitrate reductase genes (narG and napA), nitrite reductase genes (nirS and nrfA), and their transcripts in estuarine sediments. Appl. Environ. Microbiol. Vol. 73 No. 11. 3612-3622. Throbäck, I., Enwall, K., Jarvis, Å., and Hallin, S. (2004). “Reassessing PCR primers targeting nirS, nirK, and nosZ genes for community surveys of denitrifying bacteria with DGGE.” FEMS Microbiol. Ecology. Vol. 49 No. 3. 401-417. Yoshida, M., Ishi, S., Otsuka, S., and Senoo, K. (2010). “nirK-harboring denitrifiers are more responsive to denitrification-inducing conditions in rice paddy soil than nirS-harboring bacteria.” Microbes Environ. Vol. 25 No. 1. 45-48.
13
FIGURES
Figure 1. Nitrogen cycling in marine systems
Figure 2. Maps showing location of Siders Pond in Cape Cod, MA
Figure 3. Bathymetry map of Siders Pond
Figure 4. Physical profile of Siders Pond: salinity, DO, and temperature
Figure 5. Physical profile of Siders Pond: PAR
Figure 6. Nitrate concentrations
Figure 7. Ammonium concentrations
Figure 8. TDN profile
Figure 9. Estimated rates of nitrate loss
Figure 10. Ammonium concentrations in nitrate incubation experiment
Figure 11. Nucleic acid concentrations
Figure 12. Gel showing amplification of 16S bacterial rDNA in bacterial DNA samples
Figure 13. Gel showing amplification of nirK in bacterial DNA samples.
Figure 14. Gel showing amplification of 16S bacterial rDNA in bacterial cDNA samples
TABLES
Table 1. Water column sampling table
Table 2. Breakdown of PCR cocktails
Table 3. PCR thermal profiles
14
Figure 1. Nitrogen cycling in marine systems. This study focuses on denitrification, the stepwise
reduction of nitrate and nitrite mediated by microorganisms.
Figure 2. Location of Siders Pond in Cape Cod. The map on the right shows the channel that
allows salty water to flow into the system from Vineyard Sound.
15
Figure 3. Bathymetry map of Siders Pond. The star indicates the deepest part of the pond, where
there is a hole that reaches 15 m depth. Measurements and water samples were collected from
the water column above the 15 m hole. Graphic adapted from Giblin, 1990.
Figure 4. Salinity (psu), DO (ppt), and temperature (°C) in Siders Pond. Data gathered on
11/10/14. Water column divided into three layers – oxic, transition, and anoxic – based on
dissolved oxygen concentrations.
16
Figure 5. Photosynthetically active radiation (PAR) in relation to depth in Siders Pond. PAR
drops to zero within 6 m of the surface of the pond.
Depth (m) Nutrient analysis Nitrate incubation DNA/RNA extraction 0.5 ✓ ✓ 1.5 ✓ ✓ 2.5 ✓ 3.5 ✓ ✓ 4.5 ✓ ✓ ✓ 5.5 ✓ ✓ 6.5 ✓ 7.5 ✓ ✓ 8.5 ✓ ✓ ✓ 9.5 ✓
10.5 ✓ ✓ ✓ 11.5 ✓ ✓ ✓ 12.5 ✓ ✓ ✓ 13.5 ✓ 14.5 ✓
Table 1. Water column sampling. Checkmarks indicate that samples were collected for analysis.
17
Reagent 16S nirK
DPEC H2O 27.8 μL 27.7 μL
5x buffer 10 μL 10 μL
F primer 5 μL 5 μL
R primer 5 μL 5 μL
dNTP mix 1 μL 1 μL
GoTaq 0.2 μL 0.3 μL
Table 2. Recipe for PCR cocktail (one reaction) for 16S and nirK
16S nirK
Initialization 94.0 °C / 3 mins 94.0 °C / 3 mins
*Denaturation 94.0 °C / 40 sec 94.0 °C / 30 sec
*Annealing 55.0 °C / 1.5 min 60.0 °C / 1 min
*Elongation 72.0 °C / 2 mins 73.0 °C / 1 min
Final elongation 72.0 °C / 10 mins 75.0 °C / 10 mins
*Run for 35 cycles.
Table 3. Thermal profiles for PCR with primers targeting 16S bacterial rDNA and nirK
18
Figure 6. Nitrate concentrations throughout the water column. Nitrate concentrations are high in
the surface waters but begin to decrease at approximately 2 m depth. Nitrate is absent in the
anoxic layer (6 m and below).
Figure 7. Ammonium concentrations throughout the water column. Ammonium is present in
very low concentrations in the surface waters but concentrations increase rapidly in the anoxic
layer, eventually reaching almost 2,000 µM near the bottom of the pond.
19
Figure 8. TDN profile. Values are shown up to 8.5 m; after this depth there nitrate and DON are
depleted and all that is left is ammonium. DON values do not show a marked trend in the water
column.
Figure 9. Estimated rates of nitrate loss throughout the water column. Denitrification occurs in
the anoxic layer, contributing to the high rates of nitrate loss there. Rates estimated at 11.5 m and
12.5 m are minimum potential rates.
20
Figure 10. Ammonium concentrations after nitrate incubation. Ammonium concentrations did
not change significantly from the original concentrations measured from water column samples.
Figure 11. Nucleic acid concentrations as measured by the NandropTM and the RiboGreen®
assay. Note the low nucleic acid concentrations in samples collected above 7.5 m.
21
Figure 12. Gel showing amplification of 16S gene in PCR products from bacterial DNA
samples. Low DNA concentrations in samples collected from 3.5 m and 5.5 m likely account for
the lack of amplification in wells 4 and 7.
Figure 13. Gel showing amplification of nirK in PCR products from bacterial DNA samples.
Lack of amplification in wells 3 and 5 are likely due to low concentrations of DNA in these
samples, rather than due to the absence of nirK in bacterial genomes at these depths.
22
Figure 14. Gel showing amplification of 16S rDNA in PCR products from bacterial cDNA
samples. The blue square indicates samples from which amplification was expected.
23