Biogeochemical gradients and genomics of denitrifying microbial communities in Siders Pond, a meromictic salt-stratified system

Michelle Pombrol

Candidate for A.B. Biology Brown University

Advisor: Julie Huber

The Josephine Bay Paul Center Marine Biological Laboratory

Semester in Environmental Science December 12, 2014

     

  2  

Biogeochemical gradients and genomics of denitrifying microbial communities in Siders

Pond, a meromictic salt-stratified system

Michelle Pombrol, Brown University, Providence, RI 02912

ABSTRACT

This study analyzes presence and expression of the gene nirK in relation to physical

characteristics, nitrogen concentrations, and denitrification rates within a salt-stratified pond.

nirK codes for the copper nitrite reductase enzyme that catalyzes the reduction of nitrite to nitric

oxide. Profiles of the pond’s physical characteristics and nitrogen concentrations were created

and compared in order to understand how physical characteristics influence rates of

denitrification throughout the water column, the lower half of which is anoxic. Denitrification

rates were estimated with rate experiments. Genetic analysis of microbial communities was

completed via PCR with primers targeting a section of the nirK gene. We were able to verify the

presence of nirK in bacteria throughout the water column, even in the highly oxygenated surface

waters. Analysis of nirK expression was unsuccessful. Still, the presence of nirK in bacterial

genomes throughout the entire water column highlights the metabolic plasticity of

microorganisms living there.

Keywords: denitrifying microbes, water column, stratification, marine nitrogen cycling, nitrite

reductase, nirK

INTRODUCTION

Anthropogenic nitrogen inputs to aquatic systems are increasing as land is being rapidly

developed for commercial and residential use. Denitrification is the main process by which

nitrogen is lost from a system and therefore may be able to prevent eutrophication, which occurs

as a result of nitrogen overload in a system. However, denitrification also releases N2 and N2O,

which are greenhouse gases that may contribute to climate change. Understanding how and when

microbes carry out denitrification may contribute to conservation efforts as well as to efforts to

decrease total greenhouse gas emissions.

Denitrification is a stepwise process in which nitrate and nitrite are used as alternative

electron acceptors in the metabolic pathways of microorganisms. Nitrate and nitrite are first

reduced to nitric oxide; they may be ultimately reduced to N2 gas that is then lost to the

  3

atmosphere (Figure 1). Microorganisms mediate every step in the denitrification process, and

each step is controlled by the activity of specific enzymes encoded by their own genes (Canfield

et al. 2010). This paper studies the distribution and activity of the gene nirK in bacteria in Siders

Pond in Falmouth, MA. nirK encodes for copper nitrite reductase, an enzyme that catalyzes the

reduction of nitrite to nitric oxide. It has been shown that nirK can be used as a molecular marker

for denitrifying bacteria (Braker et al. 2000). Analysis of nirK presence and expression microbial

communities in Siders Pond can provide an understanding of how microorganisms influence

nitrogen cycling in the system.

Siders Pond is a coastal pond with unique features: it is salt-stratified and meromictic,

never mixing below a depth of about 3 m (Caraco 1986). The pond receives freshwater inputs

from groundwater and saltwater inputs from a channel in its southwest corner that floods a few

times per year and allows seawater from Vineyard Sound to flow into the system. This salty

water is denser than freshwater and sinks to the bottom of the pond. The differences in salinity

between the pond’s freshwater and seawater inputs, as well as the unusual depth of the pond,

keep the water column stratified throughout the year. This stratification makes Siders Pond an

ideal location to study denitrification and the microbial communities that carry it out. The water

column can be divided into three layers based on dissolved oxygen concentrations: the oxic,

transition, and anoxic layers. These three distinct layers provide three very different

environments for microbes to inhabit, facilitating study of how denitrifying microbes respond to

the physical characteristics of their immediate environment.

METHODS

Site description. Siders Pond is a salt-stratified meromictic pond located in Falmouth, MA. The

pond receives both freshwater and saltwater inputs – seepage faces allow fresh groundwater to

enter the pond, while a small channel in the pond’s southwest corner allows salt water to flow in

from Vineyard Sound during flooding events (Figure 2). The pond is unusually deep, reaching a

maximum depth of 15 m. (Figure 3). The water column is strongly stratified, showing drastic

changes in dissolved oxygen concentrations, temperature and salinity at specific depths. The

water column is completely anoxic after 6 m (Figure 4), providing an ideal environment for

denitrifying microbes. The pond receives nitrogen inputs from the surrounding area, which is

heavily developed.

     

  4  

Field collection. Measurements of DO (% and ‰), salinity, temperature, and PAR were taken

via Hydrolab® at 0.5 m intervals between the surface and the deepest part of the pond. Water for

nitrogen profiling was collected in 250 mL plastic bottles using a GeopumpTM peristaltic pump.

Bottles and tubing were rinsed between samples to avoid nitrogen contamination. Water for

nitrate incubations was collected in 120 mL glass serum bottles with rubber stoppers and metal

crimps to avoid the introduction of oxygen.

Bacterial biomass was collected by attaching sterile SterivexTM filters to the end of the

GeopumpTM tubing and pumping approximately 400 mL of water through the filter. Filters were

then immediately placed in sterile 50 mL conical tubes and frozen using dry ice.

Table 1 shows the depths at which samples were collected for each experiment.

Nitrogen profiling. All water samples were filtered through 25mm ashed glass microfiber filters

to remove debris and microbial biomass before nutrient analysis. Water to be sampled for NH4+

was acidified with 5 N HCl and placed in a refrigerator, while water for NO3-, NO2

-, and total

dissolved nitrogen (TDN) analysis was placed in a freezer.

Ammonium concentrations were measured using colormetric analysis (SES colormetric

analysis protocol). Nitrate, nitrite, and TDN concentrations were measured using a Lachat

automatic analyzer (SOP for nitrate, nitrate from the Grace Analytical Lab).

Nitrate incubations. Nitrate concentrations of water column samples were increased by 30 µM,

regardless of the initial concentration of nitrate in that layer of the water column. This was

achieved by introducing 1 mL of 3,600 µM NO3- solution into the 120 mL serum bottles using a

1 mL syringe and hypodermic needle. An additional hypodermic needle was placed through the

rubber stopper in order to allow water to flow out of the bottle when the nitrate solution was

added. Samples were incubated at 15°C for 4 days, after which serum bottles were opened and

water was analyzed for ammonium and nitrate concentrations using the protocols described

above. Denitrification rates in the water column were estimated by calculating the difference

between the nitrate concentration at the beginning and end of the incubation and dividing by the

incubation time.

  5

Gene expression analysis. SterivexTM filters were stored at -80°C until the time of nucleic acid

extraction. Nucleic acids were extracted using an RNA PowerSoil® Total RNA Isolation Kit and

an RNA PowerSoil® DNA elution accessory kit purchased from MO BIO Laboratories, Inc.

Nucleic acid concentrations were initially quantified using a Thermo Scientific

NanodropTM 2000. RNA concentrations were later further quantified using a Quant-iTTM

RiboGeen® RNA Assay Kit purchased from Life Technologies. Standards were created with

concentrations up to 1,000 ng/mL for a high-range assay.

The presence of bacterial DNA in each sample was tested via PCR with primers targeting

the gene encoding 16S bacterial rRNA (8F and 1492R, sequences 5’

AGAGTTTGATCCTGGCTCAG 3’ and 5’ CGGTTACCTTGTTACGACTT 3’, respectively).

RNA samples were treated with an Ambion TurboTM DNase kit to remove residual DNA.

Samples were treated with 1 uL and incubated at 37°C for 20 minutes. Then, an additional 1uL

of DNase was added and the samples were incubated at the same temperature for another 20

minutes. After the first DNase treatment, DNA contamination was found to still be present in the

samples. Samples were treated again with 2uL of DNase and incubated at 37°C for 30 minutes.

PCR with 16S bacterial rDNA primers showed that contamination was still present after the

second DNase treatment; however, it was determined that presence of 16S rDNA in the samples

would not interfere with possible amplification of nirK and that nirK was not present in the

contaminant.

nirK presence and expression was measured with primers targeting and internal section of

the copper nitrite reductase gene (nirKFlaCU and nirKR3Cu, sequences 5’  

ATCATGGTSCTGCCGCG 3’ and 5’ GCCTCGATCAGRTTGTGGTT 3’, respectively).

PCR products were visualized on 1% agarose gels. All gels were run at 105V for 22-25

minutes. Gels were then imaged and analyzed with a UV transilluminator and one-dimensional

analysis software.

PCR master mix concentrations and thermal profiles for all reactions are shown in Tables

2 and 3, respectively.

RESULTS

Physical profile. The water column of Siders Pond shows strong stratification in relation to its

physical characteristics: salinity, temperature, and DO (Figure 4). Dissolved oxygen begins to

     

  6  

decrease dramatically at approximately 3 m; at approximately 6 m, the dissolved oxygen

concentrations drop to zero and the water column becomes anoxic. Salinity stays relatively

constant until three meters depth, where it begins to increase steadily before reaching a

maximum of approximately 18 psu near the bottom of the water column. Temperatures in the

pond are relatively low, averaging 14.4°C and peaking at 17.1°C at 5.5 meters. At the surface of

the pond PAR is 916 (Figure 5). Within six meters of the surface, PAR drops to zero.

Nitrogen profile. Nitrate concentrations decrease with depth (Figure 6). Nitrate is present in

especially high concentrations in the surface waters. After 2 m, concentrations decrease steadily.

At 6 m and below, nitrate is completely depleted. No nitrite was detected at any depth in the

water column.

The trend in ammonium concentrations is markedly different from the trend in nitrate

concentrations. Ammonium is present at very low concentrations in the oxic and transition layers

(Figure 7). Concentrations of ammonium do not begin to increase until around 8 m. By 12.5 m,

ammonium concentrations reach almost 2000 µM.

Total dissolved nitrogen data showed that dissolved organic nitrogen (DON) is present

throughout the water column, although there is little discernable trend in DON concentrations

(Figure 8). After 9.5 m, ammonium is the only form of nitrogen available in the water column.

Nitrate incubations. Rates of nitrate loss were more than three times higher in the anoxic layer

than in the oxic or transition layer (Figure 9). In the top two layers, nitrate concentrations

decreased at a rate of between 2 and 3 µM per day, while nitrate concentrations in the anoxic

layer decreased by between 6.5 and 7.5 µM per day. It is important to note that estimated rates of

denitrification at 11.5 m and 12.5 m are minimum potential rates. The concentration of nitrate at

these depths in the water column is zero. At the end of the four-day incubation, nitrate

concentration in the water collected from these two depths returned to zero. Thus, the estimated

rate is the maximum rate that we were able to measure given the parameters of the experiment.

Actual rates of denitrification in this portion of the water column may be higher than the

estimated rate.

  7

The addition of nitrate to these water samples did not appear to affect ammonium

concentrations – after four days, ammonium concentrations in the bottles showed very little

change from their original concentrations in the water column (Figure 10).

Nucleic acid extraction. Concentrations of nucleic acids obtained from extractions are displayed

in Figure 11. DNA extraction yielded concentrations ranging from 11.8 ng/µL to 161 ng/µL.

RNA extraction yielded concentrations ranging from zero to 67.3 ng/µL. Further quantification

with Ribogreen showed that the actual range of RNA concentrations was 0.52 ng/µL to 74.96

ng/µL. Samples from all depths above 7.5 m yielded RNA concentrations below 2 ng/µL; these

low concentrations made it impossible to synthesize cDNA from these samples.

Gene presence. PCR using primers targeting 16S bacterial rDNA showed that bacteria are

present throughout the entire water column (Figure 12). PCR with nirK primers showed that nirK

is present in bacterial genomes in all layers of the water column (Figure 13).

Gene expression. Amplification was seen in all cDNA samples amplified with 16S rDNA

primers (Figure 14). Multiple attempts to amplify nirK within bacterial cDNA proved

unsuccessful.

DISCUSSION

Physical profile. Stratification in the pond is maintained by the salinity difference between the

seawater that flows in from Vineyard Sound and the freshwater that enters via groundwater

seepage faces. This stratification is maintained throughout the year (Caraco 1986), allowing the

bottom portion of the water column, where there is no photosynthetically active radiation, to

become anoxic. Dissolved oxygen concentrations are high in the surface waters because this

water experiences atmospheric exchange. Below the surface waters, dissolved oxygen

concentrations decrease rapidly as photosynthetically active radiation becomes scarce due to

light extinction.

The water column does appear to mix up to a depth of approximately 3 m – salinity, DO,

and temperature are all relatively uniform down to this depth, after which they begin to deviate

     

  8  

and gradients develop. This mixing is likely wind driven, rather than a result of turnover within

the pond (Nalven 2011).

Nitrate and nitrite concentrations. The high nitrate concentrations in the surface water of the

pond are likely due to nitrogen loading from the surrounding area. Nitrate is completely absent in

the water column starting at 6 m, where the water column becomes anoxic and denitrification

becomes uninhibited. The complete lack of nitrate below 6 m indicates that denitrification is

occurring at rates that are higher than the rate at which nitrate is entering this portion of the water

column.

Ammonium concentrations. The rapid increase in ammonium concentrations beginning at 8 m

may be attributed to excretion by microorganisms and the lack of aerobic metabolism in the

anoxic layer.

Denitrification rates. Estimated losses of nitrate were higher in the anoxic layer than in the oxic

and transition layers. While loss of nitrate in the anoxic layer can be attributed to denitrification

by microbes, nitrate loss still occurs in the upper, oxygenated portion of the water column. This

nitrate loss is likely due to uptake of nitrate by bacteria for growth. Although uptake of nitrate for

growth may also be occurring in the anoxic layer, the large difference in the rate of nitrate loss in

this layer suggests that another process is contributing to nitrate losses – in this case, that process

is denitrification. The complete lack of nitrate in the anoxic layer also supports the idea that

denitrification is occurring rapidly there.

Gene presence. Amplification of DNA samples from all depths in the water column indicates

that nirK is ubiquitously present. The presence of nirK in the genomes of bacteria throughout the

water column suggests that all of these bacteria have the genomic potential for denitrification.

However, as the nitrogen profile and calculated denitrification rates show, denitrification itself is

confined to the lower portion of the water column, where the water is anoxic. This suggests that

bacteria in the upper portion of the water column, where denitrification is being inhibited by the

presence of dissolved oxygen, are not expressing genes involved in denitrification. These

  9

bacteria would have no need for the nitrite reductase enzyme and it is likely they are instead

expressing genes involved in other metabolic pathways.

Gene expression. Nucleic acid concentrations were significantly lower in samples taken from

the oxic and transition layers than from the anoxic layer. Low concentrations of RNA in samples

taken at depths above the anoxic layer meant that cDNA could not be synthesized from these

samples. Although the cause of the low nucleic acid concentrations could not be definitively

determined, a number of factors were considered. In 2011, SES student Sarah Nalven estimated

cell counts in the water column and determined that microbial biomass is lower in the oxic layer.

She proposed that biomass might be higher in the oxycline and lower in the water column due to

the many microhabitats that are available to microbes in these areas. It is important to note that

low cell counts alone would not prevent denitrification from occurring in the upper water

column. Potential rates of denitrification may remain high even if cell counts are below 100 cells

per mL (Knowles 1982).

16S rDNA was amplified from samples taken in the anoxic layer. Amplification was

observed in all samples. 16S is a component of the small subunit of prokaryotic ribosomes,

which play an integral role in cell functioning. Thus, the presence of the 16S gene in bacterial

cDNA suggests that bacteria are active.

Multiple attempts to analyze nirK expression by amplifying the gene in bacterial cDNA

were unsuccessful. Although nirK amplification was observed in samples from the anoxic layer,

the results were complicated by amplification in the negative control sample, which contained

RNA that had undergone the cDNA synthesis reaction without reverse transcriptase. The source

of this amplification could not be determined; a PCR reaction with the nirK primer pair and

bacterial RNA samples did not show amplification, suggesting that nirK was not present in the

DNA contaminant.

Although analysis of nirK expression was unsuccessful, it may be possible to quantify

expression of other genes involved in denitrification with similar methods. narG, nosZ, and napA

are strong candidates for gene expression analysis. Primer pairs for these genes have been

described in the literature (Throbäck et al. 2004 & Smith et al. 2007), and these genes all encode

enzymes involved in important steps in denitrification. Another potential candidate, nirS, also

encodes nitrite reductase, although this one contains cytochrome cd1 instead of copper (Braker et

     

  10  

al. 2000). However, it may be even more difficult to quantify gene expression with nirS; in 2010

Yoshida et al. showed that copy numbers of nirK, but not nirS, increase when bacteria are

exposed to conditions conducive to denitrification.

Quantitative PCR (qPCR) is another option for gene expression analysis. The PCR

methods used in this study, had they been successful, would have provided semi-quantitative

expression data. qPCR is able to provide quantitative expression data and may not have faced the

same constraints as the traditional PCR utilized in this study.

CONCLUSIONS & FUTURE DIRECTIONS

Analysis of presence and expression of bacterial denitrifying genes provides insight into

the microbial capacity for denitrification within a system. Siders Pond is situated in an area that

has been heavily developed; thus, a large portion of its nitrogen input is anthropogenic. In

systems such as Siders Pond, denitrification is the main process that alleviates stress on the

system from high nitrogen loading and prevents eutrophication. In order to better understand

how the system handles the large nitrogen load it receives, it is important to understand the

microbial communities that facilitate denitrification. This study demonstrates that the genomic

potential for denitrification exists in bacteria living in all portions of the water column, even

though denitrification itself is confined to the anoxic layer. This, in turn, highlights the metabolic

plasticity of Siders’ microbial communities. It is likely that bacteria living in the oxic and

transition layers have repressed their denitrification genes and are instead expressing genes

involved in an alternative metabolic pathway.

Future studies should analyze expression of nirK in microbes using cDNA from bacteria

in all layers of the water column. Analysis of other genes involved in the denitrification pathway,

including narG (membrane-bound nitrate reductase), napA (periplasmic nitrate reductase), and

nosZ (nitrous oxide reductase) may provide further insight into the denitrifying capacity of

Siders’ microbial community. Measuring nitrogen loading to the pond and comparing the annual

nitrogen load to rates of denitrification in the anoxic layer may allow us to estimate the capacity

of the pond’s microbial communities to prevent eutrophication.

  11

ACKNOWLEDGEMENTS

I would like to express my gratitude to Julie Huber, without whom this project would not

have been possible. Thanks to Emily Reddington, who was immensely knowledgeable, patient,

and kind. Thanks to Joe Vallino, who lent his vast expertise to the nitrate incubation experiment.

Rich McHorney and Kat Klammer were indispensable during field collection. Thanks to Fiona

Jevon and Tyler Messerschmidt for their endless support; special thanks to Nick Barrett for

providing unconditional encouragement.

     

  12  

REFERENCES

Braker, G., Fesefeldt, A., and Witzel, K-P. (1998). “Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples.” Appl. Environ. Microbiol. Vol. 64 No. 10. 3769-3775. Braker, G., Zhou, J., Wu, L., Devol, A., and Tiedje, J. (2000). “Nitrite reductase genes (nirK and nirS) as functional markers to investigate diversity of denitrifying bacteria in Pacific Northwest marine sediment communities.” Appl. Environ. Microbiol. Vol. 66 No. 5. 2096-2104. Canfield, D., Glazer, A., and Falkowski, P. (2010). “The evolution and future of the earth’s nitrogen cycle.” Science. Vol. 330. 192-196. Caraco, N. (1986). “Phosphorous, iron, and carbon cycling in a salt stratified coastal pond.” Boston University Ph.D. thesis. Grace Analytical Lab. (1995). “Standard operating procedure for nitrate, nitrite (Lachat method).” Knowles, R. (1982). “Denitrification.” Microbiological Reviews. Vol. 46 No. 1. 43-70. Nalven, Sarah. (2011). “Diversity and distribution of sulfate-reducing bacteria in Siders Pond, a meromictic pond.” Semester in Environmental Science Final Project. Semester in Environmental Science. (2014). “Colormetric analysis protocol.” Smith, C., Nedwell D., Dong, L., and Osborn, M. (2007). “Diversity and abundance of nitrate reductase genes (narG and napA), nitrite reductase genes (nirS and nrfA), and their transcripts in estuarine sediments. Appl. Environ. Microbiol. Vol. 73 No. 11. 3612-3622. Throbäck, I., Enwall, K., Jarvis, Å., and Hallin, S. (2004). “Reassessing PCR primers targeting nirS, nirK, and nosZ genes for community surveys of denitrifying bacteria with DGGE.” FEMS Microbiol. Ecology. Vol. 49 No. 3. 401-417. Yoshida, M., Ishi, S., Otsuka, S., and Senoo, K. (2010). “nirK-harboring denitrifiers are more responsive to denitrification-inducing conditions in rice paddy soil than nirS-harboring bacteria.” Microbes Environ. Vol. 25 No. 1. 45-48.

  13

FIGURES

Figure 1. Nitrogen cycling in marine systems

Figure 2. Maps showing location of Siders Pond in Cape Cod, MA

Figure 3. Bathymetry map of Siders Pond

Figure 4. Physical profile of Siders Pond: salinity, DO, and temperature

Figure 5. Physical profile of Siders Pond: PAR

Figure 6. Nitrate concentrations

Figure 7. Ammonium concentrations

Figure 8. TDN profile

Figure 9. Estimated rates of nitrate loss

Figure 10. Ammonium concentrations in nitrate incubation experiment

Figure 11. Nucleic acid concentrations

Figure 12. Gel showing amplification of 16S bacterial rDNA in bacterial DNA samples

Figure 13. Gel showing amplification of nirK in bacterial DNA samples.

Figure 14. Gel showing amplification of 16S bacterial rDNA in bacterial cDNA samples

TABLES

Table 1. Water column sampling table

Table 2. Breakdown of PCR cocktails

Table 3. PCR thermal profiles

     

  14  

Figure 1. Nitrogen cycling in marine systems. This study focuses on denitrification, the stepwise

reduction of nitrate and nitrite mediated by microorganisms.

Figure 2. Location of Siders Pond in Cape Cod. The map on the right shows the channel that

allows salty water to flow into the system from Vineyard Sound.

  15

Figure 3. Bathymetry map of Siders Pond. The star indicates the deepest part of the pond, where

there is a hole that reaches 15 m depth. Measurements and water samples were collected from

the water column above the 15 m hole. Graphic adapted from Giblin, 1990.

Figure 4. Salinity (psu), DO (ppt), and temperature (°C) in Siders Pond. Data gathered on

11/10/14. Water column divided into three layers – oxic, transition, and anoxic – based on

dissolved oxygen concentrations.

     

  16  

Figure 5. Photosynthetically active radiation (PAR) in relation to depth in Siders Pond. PAR

drops to zero within 6 m of the surface of the pond.

Depth (m) Nutrient analysis Nitrate incubation DNA/RNA extraction 0.5 ✓ ✓ 1.5 ✓ ✓ 2.5 ✓ 3.5 ✓ ✓ 4.5 ✓ ✓ ✓ 5.5 ✓ ✓ 6.5 ✓ 7.5 ✓ ✓ 8.5 ✓ ✓ ✓ 9.5 ✓

10.5 ✓ ✓ ✓ 11.5 ✓ ✓ ✓ 12.5 ✓ ✓ ✓ 13.5 ✓ 14.5 ✓

Table 1. Water column sampling. Checkmarks indicate that samples were collected for analysis.

  17

Reagent 16S nirK

DPEC H2O 27.8 μL 27.7 μL

5x buffer 10 μL 10 μL

F primer 5 μL 5 μL

R primer 5 μL 5 μL

dNTP mix 1 μL 1 μL

GoTaq 0.2 μL 0.3 μL

Table 2. Recipe for PCR cocktail (one reaction) for 16S and nirK

16S nirK

Initialization 94.0 °C / 3 mins 94.0 °C / 3 mins

*Denaturation 94.0 °C / 40 sec 94.0 °C / 30 sec

*Annealing 55.0 °C / 1.5 min 60.0 °C / 1 min

*Elongation 72.0 °C / 2 mins 73.0 °C / 1 min

Final elongation 72.0 °C / 10 mins 75.0 °C / 10 mins

*Run for 35 cycles.

Table 3. Thermal profiles for PCR with primers targeting 16S bacterial rDNA and nirK

     

  18  

Figure 6. Nitrate concentrations throughout the water column. Nitrate concentrations are high in

the surface waters but begin to decrease at approximately 2 m depth. Nitrate is absent in the

anoxic layer (6 m and below).

Figure 7. Ammonium concentrations throughout the water column. Ammonium is present in

very low concentrations in the surface waters but concentrations increase rapidly in the anoxic

layer, eventually reaching almost 2,000 µM near the bottom of the pond.

  19

Figure 8. TDN profile. Values are shown up to 8.5 m; after this depth there nitrate and DON are

depleted and all that is left is ammonium. DON values do not show a marked trend in the water

column.

Figure 9. Estimated rates of nitrate loss throughout the water column. Denitrification occurs in

the anoxic layer, contributing to the high rates of nitrate loss there. Rates estimated at 11.5 m and

12.5 m are minimum potential rates.

     

  20  

Figure 10. Ammonium concentrations after nitrate incubation. Ammonium concentrations did

not change significantly from the original concentrations measured from water column samples.

Figure 11. Nucleic acid concentrations as measured by the NandropTM and the RiboGreen®

assay. Note the low nucleic acid concentrations in samples collected above 7.5 m.

  21

Figure 12. Gel showing amplification of 16S gene in PCR products from bacterial DNA

samples. Low DNA concentrations in samples collected from 3.5 m and 5.5 m likely account for

the lack of amplification in wells 4 and 7.

Figure 13. Gel showing amplification of nirK in PCR products from bacterial DNA samples.

Lack of amplification in wells 3 and 5 are likely due to low concentrations of DNA in these

samples, rather than due to the absence of nirK in bacterial genomes at these depths.

     

  22  

Figure 14. Gel showing amplification of 16S rDNA in PCR products from bacterial cDNA

samples. The blue square indicates samples from which amplification was expected.

  23