biodiversitas vol. 10, no. 3, july 2009

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

GUIDANCE FOR AUTHORS

BIODIVERSITAS, the J ourna l o f B io log ica l D iv ers i ty publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem; especially in (i) molecular biology and genetics, (ii) taxonomy, biosystematic, and phylogenetics, (iii) ecology and conservation biology (wildlife), as well as (iv) ethnobiology. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emision and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can only be addressed to one of the managing editor (until first acceptance); better to “CC” to the secretary editor for monitoring.. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached.

Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoid, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, its translation to Indonesian-English refers to Glossarium Istilah Asing-Indonesia (2006).

Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written hydroxytoluene butilic to be BHT hereianafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text should use “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 page (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated.

Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. Abstract should not more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used.

Introduction is about 400-600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sntences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explain for why and how the results of the research were taken place, and do not only re-express the mentioned results in the form of sentences. Concluding sentence should preferebly be given at the end of the discussion. Acknowledgments are expressed in a brief. Figures and Tables of maximum of three pages should be clearly presented or printed in laser printer. Title of a picture is written down below the picture, while title of a table is written in the above the table. Photo should be printed in a glossy paper with explanation. Colored picture can be accepted if information in manuscript can lose without picture. Photos and pictures are preferebly presented in a digital file. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement.

Citation in manuscript is written in “name and year” system; and is arranged from oldest to newst. The sentence sourced from many authors, should be structured based on the year of recency. In citing an article written by two authors, both of them should be mentioned, however, for

three and more authors only the family name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd, 2003a, b, c; Sugiyarto, 2004; El-Bana and Nijs, 2005; Balagadde et al., 2008; Webb et al., 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference.

CBE-ELSE-VANCOUVER style in double space are used in this journal with the following modification: Journal: Carranza, S. and E.N. Arnold. 2006. Systematics, biogeography and

evolution of Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 38 (2): 531-545.

Saharjo, B.H. and A.D. Nurhayati. 2006. Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7 (2): 154-158

Book: Rai, M.K. and C. Carpinella. 2006. Naturally Occurring Bioactive

Compounds. Amsterdam: Elsevier Shao, G. and K.M. Reynolds (eds.). 2006. Computer Applications in Sustainable

Forest Management: Including Perspectives on Collaboration and Integration. Berlin: Springer.

Chapter in book: Boonkerd, T. 2003. Loxogramme involuta, Lycopodium carinatum and

L. complanatum. In: Jansen, P.C.M. and N.W. Soetjipto (eds.). PROSEA, Plant Resources of South-East Asia No. 12: Cryptogams. Leiden: Backhuy Publishers.

Webb. C.O., C.H. Cannon, and S.J. Davies. 2008. Ecological organization, biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson, W. and S. Schnitzer (eds.). Tropical Forest Community Ecology. New York: Wiley-Blackwell.

Abstract: Assaeed, A.M. 2007. Seed production and dispersal of Rhazya stricta.

50th Annual Symposium,The International Association for Vegetation Science, Swansea, UK, 23-27 July, 2007.

El-Bana, M.I. and I. Nijs. 2005. The potential of phytogenic mounds (Nebkhas) for rehabilitation of degraded arid ecosystems in Sinai Peninsula. World Conference on Ecological Restoration: A Global Challenge. Zaragoza, Spain, 11-18 September 2005.

Proceeding: Alikodra, H.S. 2000. Biodiversity for development of local autonomous

government. In: Setyawan, A.D. and Sutarno (eds.). Toward Mount Lawu National Park; Proceeding of National Seminary and Workshop on Biodiversity Conservation to Protect and Save Germplasm in Java Island. Sebelas Maret University, Surakarta, 17-20 Juli 2000. [Indonesia]

Thesis, Dissertation: Sugiyarto. 2004. Soil Macro-invertebrates Diversity and Inter-Cropping Plants

Productivity in Agroforestry System based on Sengon. [Dissertation]. Malang: Post-graduate Program, Brawijaya University. [Indonesia]

Information from internet: Balagadde, F.K., H. Song, J. Ozaki, C.H. Collins, M. Barnet, F.H. Arnold,

S.R. Quake, and L. You. 2008. A synthetic Escherichia coli predator-p re y ecos ys te m. Mol ecu l a r Sys te ms B io logy 4 : 18 7 . www.molecularsystemsbiology.com

Publication manuscript “in press” can be cited and mentioned in reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited.

Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0”(null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark.

Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in one to two months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondency in a certain perriod. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request.

NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed to multiply article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

FIRST PUBLISHED: 2000

ISSN: 1412-033X (printed edition)

2085-4722 (electronic)

EDITOR-IN-CHIEF: S u t a r n o

MANAGING EDITORS: Abdel Fattah N. Abd Rabou ([email protected]), Abdulaziz Mohammad Assaeed ([email protected]),

Abdul Latiff Mohamad ([email protected]), Akram Abdel-Moneim Hussien Ali ([email protected]), Alan J. Lymbery ([email protected]), Ali Saad Mohamed ([email protected]),

Bambang Hero Saharjo ([email protected]), Charles H. Cannon Jr. ([email protected]), Edi Rudi ([email protected]), Ehsan Kamrani ([email protected]), Guofan Shao ([email protected]),

Hassan Poorbabaei ([email protected]), Hwan Su Yoon ([email protected]), John Stephen Balirwa ([email protected]), Joko Ridho Witono ([email protected]), Joon-Baek Lee ([email protected]),

Katsuhiko Kondo ([email protected]), Magdy Ibrahim El-Bana ([email protected]), Mahendra Kumar Rai ([email protected]), María de los Ángeles La Torre Cuadros ([email protected]),

Mochamad Arief Soendjoto ([email protected]), Rami Ahmad Zurayk ([email protected]), Salvador Carranza ([email protected]), Sameer Ahmad Masoud ([email protected]),

Shahabuddin ([email protected]), Sugiyarto ([email protected]), Suman Sahai ([email protected]), Thaweesakdi Boonkerd ([email protected])

ENGLISH LITERARY EDITOR: I Made Sudiana ([email protected])

SECRETARY AND TECHNICAL EDITOR: Ahmad Dwi Setyawan ([email protected])

WEBSITE EDITOR: Ari Pitoyo ([email protected])

MARKETING AND BANKING: Rita Rakhmawati, Solichatun c.q. BNI KC Sebelas Maret Acc. No. 0033691646

REVIEWERS: Peer reviewers will be mentioned in the last number of each volume.

PUBLISHER: Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University Surakarta and

Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375.

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF “DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA” No. 65a/DIKTI/Kep/2008 (valid until October 2011)

NOTICE:

Papers should be addressed to one of the member of managing editors; it is strongly recommended to send the papers through email. The managing editors and mailing addresses are: • Dr. Abdel Fattah N. Abd Rabou ([email protected]) – Wildlife Ecology and Environmental Science

Department of Biology, Faculty of Science, Islamic University of Gaza, P.O.Box 108, Gaza Strip, Palestine. Tel. +970-8-2860700, Fax. +970-8-2860800

• Emer. Prof. Dato' Dr. Abdul Latiff Mohamad ([email protected]) – Plant Systematic and Biodiversity School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, National University of Malaysia (UKM), 43600 Bangi, Selangor, Malaysia, Tel. +60-03-89213110, Fax. +60-03-89253357.

• Prof. Dr. Abdulaziz Mohammad Assaeed ([email protected]) – Food and Agriculture Sciences Plant Production Department, College of Food and Agriculture Sciences, King Saud University, P.O. Box 2460, Riyadh 11541, Saudi Arabia. +966 (1) 467 8343 Fax: +966 (1) 467 8467.

• Dr. Akram Abdel-Moneim Hussien Ali ([email protected]) – Plant Ecology and Environmental Science Saudi Arabia Mailing Address: Botany and Microbiology Department, Faculty of Sciences, King Saud University, Riyadh. Tel. +96612725737, Fax. +96614675833. Egypt Mailing Address: Faculty of Science, Zagazig University, Botany Department, Zagazig, Sharkia, Egypt. Tel. +20552357550, Fax. +20552345452, +20552303252.

• Dr. Alan J. Lymbery ([email protected]) – Genetics Division of Veterinary and Biomedical Sciences, Murdoch University, Murdoch, WA 6150, Tel. +61-9360-2729.

• Prof. Dr. Ali Saad Mohamed ([email protected]) – Wildlife and Environmental Science College of Veterinary Medicine, Sudan University of Science and Technology. P.O.Box 204 Khartoum North-Sudan, Tel: +249916916927, +249912690975.

• Prof. Dr. Bambang Hero Saharjo ([email protected]; [email protected]) – Forest Ecology (Forest Fire Management) Forest Fire Laboratory, Department of Silviculture, Faculty of Forestry, Bogor Agricultural University (IPB), IPB Campus at Darmaga, Bogor 16680, P.O. BOX 168, Bogor 16001, West Java, Indonesia, Tel. +62-251-421929, Fax. +62-251-421929.

• Prof. Dr. Charles H. Cannon Jr. ([email protected]) – Evolutionary and Ecological Biology P.R. China Mailing Address: Xishuangbanna Tropical Botanic Garden, Chinese Academy of Sciences, Menglun, Mengla, Yunnan 666303, P.R. China, Tel. +86.691.8715460; +86.871.5160155 (Kunming office), Fax. +86.691.8715070. USA Mailing Address: Department of Biological Sciences, Texas Tech University, P.O. Box 43131, Flint and Main St. Lubbock, TX 794093131, Texas, USA, Tel. 806-742-3993, Fax. 806-742-2963.

• Dr. Edi Rudi ([email protected]) – Marine Biology Biology Department, Faculty of Mathematics and Natural Sciences, Syiah Kuala University (UNSYIAH), Unsyiah Campus at Darussalam, Banda Aceh 23111, Nangroe Aceh Darussalam, Indonesia, Tel. & Fax.: +62-651-7428212; +62-651-7410248.

• Dr. Ehsan Kamrani ([email protected]) – Marine Biology Marine Biology Department, Hormozgan University, P.O. Box: 3995, Bandar Abbas, Islamic Republic of Iran. Tel. +98-761-3336052, Fax. +98-761-3336052.

• Prof. Dr. Guofan Shao ([email protected]) – Geo-Eco-Informatics Department of Forestry and Natural Resources, Purdue University. 715 West State Street, West Lafayette, IN 47907-2061, USA, Tel. 765-494-3630, Fax. 765-494-9461.

• Dr. Hassan Poorbabaei ([email protected]) – Forest Ecology Department of Forestry, Faculty of Natural Resources, University of Guilan, Somehsara 43619, P.O.Box 1144, Islamic Republic of Iran, Tel: +98-182-3223599 – 3223024, Fax: +98-182-3222102- 3223600.

• Dr. Hwan Su Yoon ([email protected], [email protected]) – Molecular Phylogenetics Bigelow Laboratory for Ocean Sciences, P.O. Box 475 180, McKown Point Road, West Boothbay Harbor, ME 04575, USA. Tel: 207-633-9600; Fax: 207-633-9641

• Dr. John Stephen Balirwa ([email protected]) – Aquatic Ecology Fisheries Resources Research Institute (FIRRI), P.O BOX 343, Jinja, Uganda. Tel. +256-043-120484/121369, Fax. +256-043-120192.

• Dr. Joko Ridho Witono ([email protected]) – Plant Systematic Center for Plant Conservation - Bogor Botanical Garden, Indonesian Institute of Sciences (LIPI), Jl. Ir. H. Juanda 13, Bogor 16122, West Java, Indonesia, Tel. +62-251-8322220, Fax. +62-251-8322187.

• Prof. Dr. Joon-Baek Lee ([email protected]) – Marine Biology Department of Oceanography, College of Ocean Sciences, Jeju National University, 1 Ara-dong, Jeju – Korea 690-756, Tel. +82-064-754-3435

• Prof. Dr. Katsuhiko Kondo ([email protected]) – Plant Genetics and Breeding Science Laboratory of Plant Genetics and Breeding Science, Department of Agriculture, Faculty of Agriculture, Tokyo University of Agriculture, 1737 Funako, Atsugi City, Kanagawa Prefecture 243-0034, Japan

• Dr. Magdy Ibrahim El-Bana ([email protected]) – Plant Taxonomy and Ecology Egypt Mailing Address: Biological and Geological Sciences Department, Faculty of Education at Al-Arish, Suez Canal University, Center of Town, Al-Arish, North Sinai 02, Egypt. Tel.: +20-482 2275 70; Fax: +20 683 500 65. Saudi Arabia Mailing Address: Department of Biology, College of Teacher, King Saud University, PO Box 4341, Riyadh 11491, Saudi Arabia.

• Prof. Dr. Mahendra Kumar Rai ([email protected]) – Natural Product Biotechnology Department of Biotechnology, SGB Amravati University, Amravati 444602, Maharashtra, India, Tel: +91-721-2662207/8, Extension-267, Fax: +91 721 2660949, 2662135.

• Dr. María de los Ángeles La Torre Cuadros ([email protected]) – Ecology and Ethnobiology Department of Forest Management, Faculty of Forestry Sciences, National Agrarian University, La Molina, Apdo. 12-056-Lima 100 Peru, Tel. & Fax.: +511-3493902.

• Prof. Dr. Mochamad Arief Soendjoto ([email protected]; [email protected]) – Forest Ecology (Wildlife Conservation) Faculty of Forestry, Lambung Mangkurat University (UNLAM), Jl. Ahmad Yani Km. 36 Banjarbaru 70714, South Kalimantan, Indonesia, Tel. & Fax.: +62-511-4772290.

• Prof. Dr. Rami Ahmed Zurayk ([email protected]) – Ecosystem Management Faculty of Agricultural and Food Sciences, American University of Beirut, Beirut – Lebanon Tel: +961 1 374 374, 4571/7/8, Fax: +961 1 744 460

• Dr. Salvador Carranza ([email protected]) – Animal Phylogeny and Systematic Institute of Evolutionary Biology (CSIC-UPF),CMIMA - Passeig Marítim de la Barceloneta, 37-49, E-08003 Barcelona Spain Tel: +34 93 230 96 44, Fax: +34 932309555.

• Dr. Sameer Ahmad Masoud ([email protected]) – Biotechnology and Genetic Engineering Department of Biotechnology and Genetic Engineering, Faculty of Science, Philadelphia University, P.O. Box 6351, Amman 11118, Jordan, Tel.: + 962 6 479 9000 (Ext. 2265).

• Dr. Shahabuddin ([email protected]) – Animal Ecology and Taxonomy Faculty of Agriculture, Tadulako University (UNTAD), Tadulako Campus at Tondo, Palu 94118, Central Sulawesi, Indonesia, Tel. +62-451-429738. Fax. +62-451-429738.

• Dr. Sugiyarto ([email protected]) – Plant and Animal Ecology Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126. Central Java, Indonesia Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375.

• Dr. Suman Sahai ([email protected]) – Genetics and Agrobiodiversity GENE CAMPAIGN, J- 235/ A, Lane W-15C, Sainik Farms, Khanpur, New Delhi, 110062, India. Tel. +91-11- 29556248, Fax. +91-29555961.

• Prof. Dr. Thaweesakdi Boonkerd ([email protected]) – Plant Systematic Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok 10330, Thailand. Tel. & Fax.: +662-218-5482.

Other technical mails should be addressed to secretary and technical editor: • Ahmad Dwi Setyawan ([email protected])

Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126. Central Java, Indonesia, Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375.

Materials referred to website should be addressed to website editor: • Ari Pitoyo ([email protected]; www.unsjournals.com)

Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126. Central Java, Indonesia, Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375.

ALL COMMUNICATIONS ARE STRONGLY RECOMENDED TO BE UNDERTAKEN THROUGH EMAIL.

THIS PAGE INTENTIONALLY LEFT BLANK

B I O D I V E R S I T A S ISSN: 1412-033X (printed edition) Volume 10, Number 3, July 2009 ISSN: 2085-4722 (electronic) Pages: 109-114

♥ Corresponding address: Gd. PAU, Jl. Kamper, Kampus IPB Darmaga, Bogor 16680 Tel. +62-251-8621257; Fax.: +62-.251-8621724 email: [email protected]; [email protected]

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein Type 2 from Soybean [Glycine max (L.) (Merrill)] cv. Slamet

SUHARSONO1,2,♥, YASSIER ANWAR1, UTUT WIDYASTUTI1,2 1Research Center for Biological Resources and Biotechnology, Bogor Agricultural University (IPB), Bogor 16680.

2Biologi Department, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680.

Received: 10th January 2009. Accepted: 26th May 2009.

ABSTRACT

Metallothionein has an important role in the detoxification of metal ions. It has a low molecular weight and contains cysteine-rich residue. The objective of this research is to isolate and clone the cDNA of gene encoding for metallothionein from soybean [Glycine max (L.) (Merrill)] cv Slamet (GmMt2). We had successfully isolated total RNA by reverse transcription and synthesized total cDNA from total RNA as template. cDNA of GmMt2 had been isolated from total cDNA by PCR. It was successfully inserted into pGEM-T Easy plasmid, and the recombinant plasmids were introduced into Escherichia coli strain DH5α. Sequence analysis by using T7 and SP6 primers showed that the length of PCR-isolated fragment was 257 bp containing 246 bp completed sequence of Mt2 cDNA encoding for 81 amino acids. Enzyme restriction analysis showed that GmMt2 did not contain any restriction sites found in the multi cloning sites of pGEM-T easy. Nucleotide and amino acid alignment analysis using BLAST program showed that GmMt2 was similar with completed cDNA of AtMt2A from Arabidopsis thaliana (L.) Heynh. Amino acid sequence analysis showed that the motifs of Cys sequence of GmMT2 are Cys-Cys, Cys-X-Cys, and Cys-X-X-Cys.

© 2009 Biodiversitas, Journal of Biological Diversity

Key words: soybean, metallothionein, cDNA, isolation, cloning, cysteine.

INTRODUCTION

Metallothionein (MT) is low molecular weight proteins (4-8 kDa), containing rich of cysteine, and capable to bind heavy metal ions. Based on the pattern of cysteine residues distribution along the MT sequence, MT proteins of several species of plants are divided into two types, i.e. type 1 and type 2. Type 1 has a motif Cys-X-Cys, whereas type 2 has Cys-Cys, Cys-X-Cys, and Cys-X-X-Cys motifs where X is an amino acid other than Cys. MTs are present in a vast range of organisms including plants, mammals, fungi and procaryotic organisms (Valle, 1991; Cobbet and Goldsbrough, 2002; Coyle et al., 2002).

In the animals and the plants, MTs not only have an important role in the homeostatic mechanism and detoxification heavy metal ions (Cobbet and Goldsbrough, 2002; Hall, 2002), but they also involve in the process of physiology, regulation of cell growth, proliferation, the activities of metalloenzymes, transcription factor (Haq et al., 2003; Akashi et al.,

2004; Wong et al., 2004), and the infection and cell death (Vasak and Hasler, 2000). In addition, the presence of MTs in the nuclear can protect the DNA from the damage induced by oxidative stress (Chubatsu and Meneghini, 1993; Cai et al., 1995). The synthesis of MTs is induced by several metals, growth signals and hormones (Templeton et al., 1985; Andrews et al., 1987; Nartey et al., 1987). In wheat, aluminum stress caused the increase of expression of gene encoding for MT (Snowden and Gardner, 1993). Pilon-Smith and Pilon (2002) showed that the detoxification of Al was due to the binding of Al by cysteine-rich containing proteins as MTs, glutathione (GSH) dan phytochelatin. MT type 2 (MT2) is one of MT family protein.

Soybean [Glycine max (L.) (Merrill)] cv Slamet is a local cultivar tolerant to acid soil and Al stress. Al can cause oxidative stress by creating radical oxygene species (ROS) (Panda et al., 2003). Since MTs involve in the detoxification of ROS, we suppose that MTs involve also in the detoxification of Al. Therefore the isolation and cloning of cDNA of gene encoding of MT2 from soybean is important. This research has an objective to isolate and clone cDNA of gene encoding for MT2 of soybean cv Slamet.

BIODIVERSITAS Vol. 10, No. 3, July 2009, pp. 109-114 110

MATERIALS AND METHODS

Materials Soybean cv Slamet was used as plant material.

The primers of ActF (ATGGCAGATGCCGAGGATAT) and ActR (CAGTTGTGCGACCACTTGCA) designed based on cDNA of β-actin of soybean (Shah et al., 1982) were used to amplify exon1-exon2 of cDNA of β-actin as a control for the purity of total cDNA. Primers of MF (TCGAGAAAAATGTCTTGCTGTG) and M7R (CTTGCACCTGCAAGTGAAGG) designed based on cDNA of MT2 of Arabidopsis thaliana (L.) Heynh (Acc: NM_1117733) were used to isolate the cDNA of MT2 of soybean (GmMt2). pGEM-T Easy plasmid (Promega) was used as a cloning vector. Escherichia coli strain DH5α was used as a host of recombinant plasmids.

Isolation of total RNA The isolation of total RNA was carried out by using

Trizol Kit (Invitrogen) as described by Mashuda (2006). For this purpose, 1 g of root tips was ground in the mortar in the presence of liquid nitrogen to become the fine powder. These powder were mixed into suspension with 800 μL Trizol in the 1.5 mL micro tubes. This suspension was then incubated in the room temperature for 5 minutes, and after that added with 200 μL chloroform and vortexed thoroughly. After incubation for 3 minutes in the room temperature, the suspension was centrifuged at 10,000 rpm (Jouan BR4i) at 4°C for 15 minutes. The supernatant was collected and added by 500 μL isopropyl alcohol, then incubated at the room temperature for 10 minutes. After the centrifugation at 10,000 rpm, at 4°C for 10 minutes, the liquid was discarded and the pellet was added by 500 μL ethanol 75%, then the tubes were centrifuged at the same condition as previous step. The liquid was discarded, and the pellet was vacuum-dried. The pellet was suspended in 30 μL H2O-DEPC. The quantity and quality of total RNA were determined by spectrophotometer UV-VIS (Cecil CE 2020).

The integrity of total RNAs was determined by electrophoresis in the 1% agarose gel (FMC, USA) in the MOPS buffer (4.2 g L-1 MOPS, 0.41 g L-1 Na-acetate, 0.37 g L-1 Na2-EDTA). For electrophoresis, 1 μL total RNA was mixed with 12 μL premix solution (MOPS, 50% (v/v) formamide, 17.5% (v/v) formaldehyde and 27.5% (v/v) H2O-DEPC). This suspension was heated at 65°C, 10 minutes, and immediately cooled in the ice for 5 minutes, and added by 1/6 volume loading dye (0.25% blue bromophenol, 0.25% xylene cyanol FF, 30% glycerol). This suspension containing total RNAs was electrophoresed at 100 volt 30 minutes. After submerging in the EtBr solution (0.5 μg mL-1) for 30 minutes, and washing by H2O, the total RNAs in the gel were visualized on the UV GelDoc transilluminator (Labquip) and recorded by digital camera.

Synthesis of total cDNA Total cDNA was synthesized from total RNA by

using Superscript III Reverse Transcriptase enzyme (Invitrogen). The composition of the synthesis of total cDNA was 5 μg total RNA, 4 μL RT buffer (5x), 20 pmol oligo(dT), 4 mM dNTP mix, 10 mM DTT, 1 U SuperScript TMIII RTase (Invitrogen), and ajusted to 20 μL by the additon of H2O-DEPC. The synthesis of total cDNA was carried out at 45°C for 50 minutes. The successful of synthesis of total cDNA and the purity of total cDNA from genomic DNA contaminant were determined by PCR using specific actF and actR primers for exon1-exon2 of β-actin. The composition to amplify cDNA of β-actin was 1 μL total cDNA, 1 µL Taq buffer (10x), 40 mM MgCl2, 4 mM dNTP mix, 10 pmol ActF primer, 10 pmol ActR primer, 4% DMSO, 0.5 U Taq DNA polymerase (Fermentas) and H2O in the final volume of 10 μL. The condition of

PCR was pre-PCR at 95°C, 5 minutes, denaturation at 94°C, 30 seconds, primer annealing at 55°C, 30 seconds, and extension at 72°C, 1.5 minutes, with 35 cycles, and post-PCR at 72°C, 5 minutes followed by 15°C, 5 minutes.

Isolation of cDNA of GmMt2 The cDNA of GmMt2 was isolated from total cDNA

by PCR. The composition of PCR was 2 μL total cDNA, 2 μL Taq buffer (10x), 4 mM dNTP mix, 20 pmol MF primer, 20 pmol M7R primer, 4% DMSO, 1 U Taq DNA polymerase (RBC) and completed to 20 μL by H2O. The condition of PCR was pre-PCR at 95°C, 5 minutes, denaturation at 94°C 30 seconds, primer annealing at 58°C, 30 seconds and extension at 72°C, 1.5 minutes, with 35 cycles, post-PCR at 72°C, 5 minutes followed by 15°C, 5 minutes.

Cloning of cDNA of GmMt2 The cDNA of GmMt2 resulted from PCR was

ligated to pGEM–T Easy (Promega) by mixing 3 μL of PCR product, 1 μL (10 ng) pGEM-T Easy, 0.5 U T4 DNA ligase (Promega), 1 μL rapid ligation buffer (10x) and adjusted to 10 μL by H2O. This reaction mixture was incubated at 4°C for overnight. The ligation product was introduced into E. coli DH5α as described by Suharsono (2002).

Selection of E. coli containing recombinant plasmid E. coli DH5α containing recombinant plasmid was

selected by using ampicillin and blue-white selection in the solid LB media (10 g L-1 bacto-trypton, 5 g L-1 yeast extract, 10 g L-1 NaCl, pH7.5, 1.5% bacto agar) containing 100 mg L-1 ampicillin, 10 mM IPTG (isopropyl-β-D-thiogalactopyranoside) and 50 mg L-1 X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyrano-side). White colony grown in the selection media was used as source of template for PCR to detect the presence of GmMt2 in the transformed bacteria. For this purpose, one white colony was picked up by using toothpick, then suspended in 6.5 μL dH2O and heated at 95°C in the waterbath for 10 minutes and

SUHARSONO et al. – Gene encoding for metallothionein from Glycine max 111

immediately cooled in the ice for 5 minutes. This suspension was used as the template to amplify the insert GmMt2 with the same composition and condition of PCR as described for isolation of cDNA of GmMt2.

Isolation and analysis of recombinant plasmid containing GmMt2

The isolation of recombinant pGEM-T Easy plasmid DNA contained in E. coli DH5α was carried out as described by Suharsono (2002). To excised the insert GmMt2 cDNA, recombinant plasmid DNA was cut by EcoR1 (Fermentas) by mixing 200 ng plasmid DNA, 10 U EcoR1, 1x restriction buffer and dH2O in 20 μL solution. The solution was incubated at 37°C for 2 hours.

Sequencing and sequence analysis of GmMt2 Sequencing of GmMt2 cDNA was performed by

using DNA sequencer ABI Model 3100/3130 MERCIAN. Local allignment analysis of GmMt2 was carried out by using BLAST (Basic Local Alignment Search Tools) (http://www.ncbi.nlm.nih.gov/BLAST/) program. Amino acid sequence was deduced by using translation program of EXPASY (http://www.expasy.ch/tools/dna.htm). The analysis of open reading frame (ORF) was carried out by using BESTORF program (http://www.softberry/bestorf/htm). Analysis of restriction sites in the GmMt2 cDNA was performed by using NEBCutter program (http://www.firstmarket.com/cutter/cut2.html).

RESULTS AND DISCUSSIONS

Isolation of total RNA Total RNA of root tips of soybean cv Slamet has

been successfully isolated. Quantification of total RNA by using spectrophotometer showed that the efficacy of total RNA isolation was 187 µg of total RNA per g root tips. This result was enough for the synthesis of total cDNA. The OD260/OD280 ratio of total RNA was 1.88 indicating that isolated total RNA had a very good purity from the protein contaminant (Farrel, 1993).

Figure 1. Total RNA isolated from root tips.

Electrophoresis of total RNA in denaturated agarose gel containing formaldehyde resulted two dominant bands. These two bands were 18S and 28S ribosomal RNA (rRNA) (Figure 1). This result indicated that isolated total RNA was in a very good quality. Therefore mRNA contained in the total RNA was also in a very good quality for the integrity. The integrity of mRNA is very important in the synthesis of cDNA.

Synthesis of total cDNA. Total cDNA had been successfully synthesized

from total RNA as template by reverse transcription method. By using oligo(dT) primer, only mRNA can be used as template for cDNA synthesis because it contains poly-A tail. This poly-A tail can form a complementary pair with oligo(dT) primer. rRNA and tRNA do not have poly-A tail, so they can not be used as template for cDNA synthesis. PCR by using total cDNA as template and spesific primers for cDNA of exon1-exon2 of β-actin gene resulted one band DNA at 450 bp in size (Figure 2).

Figure 2. cDNA of exon1-exon2 of β-actin resulted from PCR by using total cDNA as template. 1= 1 kb ladder DNA, 2= exon1-exon2 of β-actin cDNA.

This result showed that the amplified region was

cDNA of exon1-exon2 and was not genomic DNA of β-actin. Amplication of exon1-exon2 region of genomic DNA resulted about 550 bp DNA fragment containing intron1. This intron1 was spliced during the synthesis of mRNA. The size of intron1 of actin of soybean is around 90 bp (Shah et al., 1982). The absence of 550 bp DNA band in the agarose gel (Figure 2) showed that the synthesized total cDNA was pure and free from genomic DNA contaminant. Beside showing the purity of cDNA from genomic DNA contaminant, this result showed also that the isolated total RNA had a very good quality.

Isolation and cloning of GmMt2 cDNA The isolation of GmMt2 cDNA by PCR by using

total cDNA as a template and specific primers for Mt2 resulted cDNA fragment of about 250 bp (Figure 3). This fragment was then called GmMt2 (Glycine max Mt2) fragment. It has the same size as Mt2 cDNA of A. thaliana (AtMt2A).

28S 18S

1 2

500 pb

1000 pb


Figure 3. GmMt2 fragment resulted from PCR using total cDNA as template. 1= GmMt2, 2= 1 kb marker DNA.

GmMt2 fragment had been inserted in the middle of lacZ of pGEM-T Easy plasmid and this ligation had been successfully introduced into E. coli strain DH5α. The successful of insertion of GmMt2 into pGEM-T Easy plasmid and introduction of recombinant pGEM-T Easy plasmid into E. coli was demonstrated by the presence of white colony grown in the selection LB media containing ampicillin, IPTG and X-gal. Only E. coli strain DH5α containing plasmid can survive in this selection media, and only the colony containing recombinant plasmid had a white color. The blue colonies survived in this selection media contained non-recombinant plasmid. The development of blue color is due to the conversion of uncolored X-gal substrate into blue color by β–galactosidase encoded by lacZ gene. The cloning sites (CS) are located in the middle of lacZ gene. The expression of lacZ is induced by IPTG. The blue color of colonies is developed when in the middle of lacZ does not have an insertion of DNA. If GmMt2 fragment inserts in the lacZ gene, β-galactosidase is not synthesized and the E. coli colonies develop in white color.

The presence of GmMt2 inserted in the recombinant plasmid contained in the white colonies of E. coli was confirmed by colony-PCR. Colony-PCR using white colony as source of template resulted 250 bp DNA fragment showing that this white colony contained GmMt2 fragment (Figure 4).

To reconfirm that GmMt2 had been inserted in the pGEM-T Easy, recombinant plasmid DNA had been isolated from white colony, and cut with EcoR1 to excise insert GmMt2. Digestion of recombinant plasmid DNA by EcoR1 resulted two DNA fragments, one was 3,000 bp fragment DNA corresponding to pGEM-T Easy vector, and the other was 250 bp DNA fragment being similar in size with GmMt2 fragment (Figure 5). This result showed that the GmMt2 fragment had been inserted into pGEM-T Easy plasmid.

Figure 4. The result of PCR using white colony as the source of template. 1= 1 kb DNA marker, 2= GmMt2. Figure 5. Digestion of recombinant plasmid by EcoR1. 1= recombinant plasmid cut by EcoR1, 2= 1 kb DNA marker.

Analysis of GmMt2 fragment DNA sequencing of insert GmMt2 fragment

resulted 257 nucleotides containing 246 bp ORF (open reading frame). This ORF encodes 81 amino acids with 14 cysteine residues. Local alignment analysis with BLASTn showed that GmMt2 had similarity 100% with AtMt2A of A. thaliana.

Since the nucleotide sequence is the same, so the deduced amino acid sequence of GmMt2 is also the same as AtMt2A. Therefore, GmMT2 apparently has a similar role as AtMT2A in the binding and detoxifying metal ions and avoiding oxidative damage (Zhou and Goldsbrough, 1995). Nucleotide analysis showed that GmMt2 contains start (ATG) and stop (TGA) codons, therefore this isolated GmMt2 is a full lenght of cDNA of Mt2 (Figure 6).

Based on restriction site analysis, GmMt2 fragment does not contain restriction sites located in the CS of pGEM-T Easy, therefore all restriction sites in the CS can be used to excise the insert GmMt2 from pGEM-T Easy. GmMt2 fragment contains BbvI,

1000 pb

250 pb

1 2

1000 pb

250 pb

1 2

3000 pb

1000 pb

250 pb

1 2

SUHARSONO et al. – Gene encoding for metallothionein from Glycine max 113

Figure 6. Nucleotide and deduced amino acid sequences of GmMt2.

Figure 7. Orientation of GmMt2 in the CS of pGEM–T Easy.

BsaBI, BtsCI, TseI, FokI, ApeKI, CspCI, HpyCH4III, PshAI, BsrFI, SgrAI, AcuI, BtgZI, MboII, SfaNI, Cac8I dan Hpy188I sites, so these sites can not be used to clone this gene because they will cut it into two fragments or more. The restriction site analysis of the DNA fragment is very important for the genetic engineering.

The analysis of GmMt2 orientation in the CS based on nucleotide sequence showed that GmMt2 fragment was located in the downstream of T7 primer inserted in the lacZ and in the opposite orientation of

the lacZ gene (Figure 7). The orientation of gene is very important for the gene expression.

The analysis of amino acid sequence deduced from nucleotide sequence showed that the motifs of Cys amino acid sequence of GmMT2 are Cys-Cys (3rd – 4th residues), Cys-X-Cys (8-10, 14-16, 67-69, 73-75, 78-80) and Cys-X-X-Cys (20-23). These motifs of Cys sequence of GmMT2 are specific for MT protein type 2 of plant (Robinson et al., 1993; Cobbett and Goldsbrough, 2002).

nuk aa atg tct tgc tgt gga gga aac tgc gga tgt gga tct ggc tgc aag tgc 48 M S C C G G N C G C G S G C K C 16 ggc aac ggt tgt gga ggt tgc aaa atg tac cct gac ttg gga ttc tcc 96 G N G C G G C K M Y P D L G F S 32

ggc gag aca acc aca act gag act ttt gtc ttg ggc gtt gca ccg gcg 144 G E T T T T E T F V L G V A P A 48 atg aag aat cag tac gag gct tca ggg gag agt aac aac gct gag aac 192 M K N Q Y E A S G E S N N A E N 64 gat gct tgc aag tgt gga tct gac tgc aag tgt gat cct tgc acc tgc 240 D A C K C G S D C K C D P C T C 80 aag tga 246 K - 81

recombinant


CONCLUSIONS

Full length of cDNA encoding for metallothionein of soybean cv Slamet (GmMt2) had been isolated and cloned into pGEM-T Easy plasmid. This cDNA has 246 nucleotides encoding for 81 amino acids. GmMt2 has the same sequence as AtMt2 of A. thaliana. The motifs of Cys amino acid sequence of GmMT2 were Cys-Cys, Cys-X-Cys, dan Cys-X-X-Cys.

AKNOWLEDGMENT

This research was financially supported by Competence Research Grant (Hibah Kompetensi), Directorate Research and Community Services, Directorate General of Higher Education, Ministry of National Education, Republic of Indonesia, by Contract SPK 008/HIKOM/DP2M/2008.

REFERENCES

Akashi, K, N. Nishimura, Y. Ishida, and A. Yokota. 2004. Potent hydroxyl radical-scavenging activity of drough-induced type-2 metallothionein in wild watermelon. Biochemical and Biophysical Research Communications 323: 72-78.

Andrews, G.K., K.R. Gallant, and M.G. Cherian. 1987. Regulation of the ontogeny of rat liver metallothionein mRNA by zinc. European Journal of Biochemistry 166: 527-531.

Cai, L., J. Koropatnick, and M.G. Cherian. 1995. Metallothionein protects DNA from copper-induced but not iron-induced cleavage in vitro. Chemistry and Biology 96: 143-155.

Chubatsu, L.S., and R. Meneghini. 1993. Metallothionein protects DNA from oxidative damage. The Journal of Biochemistry 291: 193-198.

Cobbett, C., and P. Goldsbrough. 2002. Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annual Review of Plant Biology 53: 159-182.

Coyle, P., J.C. Philcox, L.C. Carey, and A.M. Rofe. 2002. Metallothionein: the multipurpose protein. Cellular and Molecular Life Sciences 59: 627-647.

Farrel, R.E. 1993. RNA Methodologies. A Laboratory Guide for Isolation and Characterization. San Diego: Academic Press Inc.

Hall, J.L. 2002. Cellular mechanism for heavy metal detoxification and tolerance. Journal of Experimental Botany 53 (366): 1-11.

Haq, F, M. Mahoney, and J. Koropatnick. 2003. Signaling events for metallothionein induction. Mutation Research 533: 211-226.

Mashuda. 2006. Ekspresi Gen Gα dan GST pada Kedelai Kultivar Slamet yang Mendapat Cekaman Aluminium. [Tesis]. Bogor: Sekolah Pascasarjana IPB.

Nartey, N.O., D. Banerjee, and M.G. Cherian. 1987. Immunohistochemical localization of metallothionein in cell nucleus and cytoplasm of fetal human liver and kidney and its changes during development. Pathology 19: 233-238.

Panda, S.K., L.B. Singha, and M.H. Khan. 2003. Does aluminum phytotoxicity induce oxidative stress in greengram (Vigna radiata). Bulgarian Journal of Plant Physiology 29: 77-86.

Pilon-Smiths, E., and M. Pilon. 2002. Phytoremediation of metals using transgenic plants. Critical Review of Plant Science 21: 439-456.

Robinson, N.J., A.M. Tommey, C. Kuske, and P.J. Jackson. 1993. Plant metallothionein. The Journal of Biochemistry 295: 1-10.

Shah D.M., R.C. Hightower, and R.B. Meagher. 1982. Complete nucleotide sequence of a soybean actin gene. Proceeding of the National Academic of Science of the USA 79 (4): 1022-1026.

Snowden, K.C., and R.C. Gardner. 1993. Five genes induced by aluminum in wheat (Triticum aestivum L.) roots. Plant Physiology 103: 855-861.

Suharsono. 2002. Konstruksi pustaka genom kedelai kultivar Slamet. Hayati 9 (3): 67-70.

Templeton, D.M., D. Banerjee, and M.G. Cherian. 1985. Metallothionein synthesis and localization in relation to metal storage in rat liver during gestation. Biochemistry and Cell Biology 63: 16-22.

Valle, B.L. 1991. Introduction of metallothionein. Methods in Enzymology 205: 3-7.

Vasak, M., and D.W. Hasler. 2000. Metallothioneins: new functional and structural insight. Current Opinion in Chemical Biology 4: 177-183.

Wong, H.L., T. Sakamoto, T. Kawasaki, K. Umemura, and K. Shimamoto. 2004. Down-regulation of metallothionein, a reactive oxygen scavenger, by the small GTPase OsRac I in rice. Plant Physiology 135: 1447-1456.

Zhou, J., and P.B. Goldsbrough. 1995. Structure, organization and expression of the metallothionein gene family in Arabidopsis. Molecular and General Genetics 248: 318-328.


Corresponding address: ♥ Fapet Building, 5th Floor, 1st Wing, IPB Campus at Darmaga,

Bogor 16680. Tel. +62-0251-8622833, Fax. +62-0251-8622833 e-mail: [email protected]

♥♥ P.T. Sari Husada Tbk., Jl. Kusumanegara No. 173, PO Box 37 Yogyakarta 55002. Tel. +62-0274-498001 Fax. +62-0274-498008 e-mail:[email protected]

Characterization and Purification a Specific Xylanase Showing Arabinofuranosidase Activity from Streptomyces spp. 234P-16

ANJA MERYANDINI1,♥, TRIO HENDARWIN1,♥♥, FAHRRUROZI1, ALINA AKHDIYA2, DEDEN SAPRUDIN3, YULIN LESTARI1

1Biology Department, Faculty of Mathematics and Natural Science, Bogor Agricultural University (IPB), Bogor 16680. 2Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development (ICABIOGRAD), Bogor 16110

3Chemistry Department, Faculty of Mathematics and Natural Science, Bogor Agricultural University (IPB), Bogor 16680.

Received: 10th May 2009. Accepted: 16th June 2009.

ABSTRACT

Streptomyces spp 234P-16 producing xylanase was isolated from soil sample from Padang, West Sumatra, Indonesia. Crude enzyme (produced by centrifuging the culture at 14000 rpm for about 5 minutes) and purified xylanase have an optimum condition at pH 5 and 90oC. Crude xylanase have half life time of 4 hours, whereas purified xylanase have half life time of 2 ½ hours at 90oC. The molecular mass of purified xylanase was determined to be 42.4 kDa. The Arabinofuranosidase have a Km and Vmax value of 1,98 mg/mL and 523 µmol/minute/mg, respectively


Key words: xylanase, xylooligosaccharide, arabinofuranosidase, Streptomyces.

INTRODUCTION

The utilization of hemicellulosic sugars is essential for efficient conversion of lignocellulosic materials to ethanol and other value-added products. Xylan, a component of hemicellulose, is a complex heteropolysaccharide comprising a backbone of xylose residues linked by β-1,4 D-xylose glycosidic bond (Saha 2000; Saha 2002; Tseng et al., 2002) with side-chain of O-acetyl, α-L-arabinofuranosyl, D-glucuronyl, and O-methyl-D-glucuronyl residues (Kubata et al., 1994; Silveira et al., 1999; Saha 2003). Xylan degrading enzymes includes endo-β-1,4 xylanase dan β-xilosidase and the side-chain are liberated by α-arabinofuranosidase, α-D-glucuronidase, galactosidase and asetil xylan esterase. These enzyme system work synergistically in hydrolysing complex xylan (Sunna et al., 1997; Subramaniyan and Prema, 2002; Ali et al., 2004). Commercial hemicellulase preparation need to be enriched with several accessory enzymes including arabinofuranosidase to be more effectively convert

hemicellulose to simple sugars. Arabinofuranosidases hydrolyze terminal

nonreducing residues from arabinose-containing polisaccharides. Arabinofuranosidases warrant substantial research effort because they represent potential rate limiting enzymes in xylan degradation, particularly those substrate from agricultural residues such as corn fiber, corn stover and rice straw. With the increase of enzyme usage in feed formulations, arabinofuranosidase will be important in the enhancement of feed digestibility.

In our previous research we identified xylanolytic Streptomyces sp 234P-16 that was isolated from soil sample in Padang West-Sumatra. In the present paper we report characterization and purification of enzyme xylanase.


Stock culture and inoculum preparation Streptomyces 234P-16 isolate was rejuvenated in

YM agar-agar media (0.4% yeast extract, 1% malt extract, 1.5% glucose, 1.5% agar-agar). The isolate was then grown in xylan medium (1% yeast extract, 10.3% sucrose, 0.5% Birchwood xylan, 1.5% agar-agar). Incubation was done at 30 ˚C for 7 days.

Determining the optimum time for xylanase production and activity

As much as 2 cockbores of isolate grown in xylan medium was inoculated to 100 mL production

BIODIVERSITAS Vol. 9, No. 3, July 2009, pp. 115-119

116

medium (the same medium as preparation of inoculum) in 500 mL Erlenmeyer. They were incubated with 140 rpm agitation at 30 ˚C for 10 days. Crude extract of xylanase was yielded every day by centrifuging the culture at 14000 rpm for about 5 minutes. Activity of the crude enzyme was measured by using DNS (Dinitrosalisilic Acid) method by Miller (1959) with xylose used as standard. The yielded reducing-sugar was assessed by spectrophotometer with a wavelength of 540 nm. One unit xylanase activity was defined as the amount of enzyme which produces 1 µmol xylose during 1 minute. Protein concentration (mg/mL) was defined by using Bradford method (Bradford 1976). The standard protein used was bovine serum albumin (BSA).

Xylanase characterization Characterization of crude enzyme and the purified

enzyme included the determination of optimum temperature and pH, enzyme stability. The assessment with various pH was carried out within pH 3.0-9.0 with intervals of 0.5. The determination of optimum temperature was done from 30 until 90oC with the intervals of 10oC. The stability of xylanase was tested by incubating the enzyme without substrate in the optimum temperatures.

Hydrolysis analysis using HPLC The enzyme was suspended in 5 mL Birchwood

Xylan 0.5% (w/v) and incubated at optimum condition (50oC, pH 5) for 5 hours, centrifuged at 10.000 rpm, 4oC and the supernatant was analyzed in HPLC (Waters, USA) with the condition: column: carbohydrate, solvent: 60% (v/v) methanol, detector: refraction index.

Precipitation of xylanase crude extract with acetone The xylanase crude extract was precipitated by

using several percentage of acetone concentration to know the optimum condition of xylanase fractionation by acetone. Table of acetone precipitation used was based on Scopes (1987). The percentage of the precipitation used varied from 60-90%.

Purification The precipitated crude enzyme was purified using

DEAE-Sephadex A-50 matrix (Sigma, USA) and Sephadex G-100 matrix. For the DEAE-Sephadex A-50 matrix, the washing buffer were 0.02 M buffer Tris-HCl pH 8.0. and the elution buffer was 0.0-0.5 NaCl in 0.02 M Tris-HCl buffer pH 8.0. The fraction containing xylanase activity was polled and concentrated using PEG6000 and dialysis for 4 hours with 0.2 M phosphate buffer pH 7 before applied to the gel filtration. For the gel filtration 0.02 M phosphate buffer with pH 7.0 was used. The flow rate for chromatography was 0.5 mL/minute

Analysis of SDS-PAGE and Zymogram Protein electrophoresis was conducted by using

Laemmli methods (1970) with acrylamide concentration of 4% for collector gel and 10% for separator gel and 0.5% substrate was added for zymogram. As much as 20 µL of crude extract of the enzyme from acetone 70% precipitation and the purification fraction from gel filtration and anion exchange was inserted to the well of SDS-PAGE.

Substrate specificity The substrate specificity of xylanase was assayed

using p-nitrophenyl-β-D-xylanopiranoside, p-nitrophenyl-α-L-arabinofuranoside, 4-nitrophenyl-asetat, 4-nitrophenyl-α-D-galactopiranoside and p-nitrophenyl-β-D-glucoropiranoside according to Saha (2001).

Kinetic parameters Kinetic parameters were determined by incubating

the enzyme with different amount of substrate. Xylanase was incubated with birchwood xylan (0.05-0.25%) in citrate phosphate buffer pH 5 at 90oC. The value of the Michaelis constant were determined from Lineweaver-Burk plots.

RESULTS AND DISCUSSION

Production of xylanase The daily production curve of xylanase

Streptomyces spp 234P-16 tested at pH 7.2 and a temperature of 37oC (Figure 1). The highest xylanase production was reached on Day-5 with the activity of 0.422 Unit/mL. The optimum time of xylanase production was then used as the standard harvest time in the next xylanase production.

Figure 1. Production curve of Streptomyces sp. 234P-16 xylanase measured at 37 oC and pH 7.2.

Effect of pH on xylanase activity The effect of pH on the crude xylanase activity

measured at 37oC (A) and purified enzyme (B) has been shown in Figure 2.

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

2 3 4 5 6 7 8 9

days

Act

ivity

(un

it/m

l)

MERYANDINI et al. – Xylanase from Streptomyces

117

A B

Figure 2. Effect of pH on Streptomyces sp 234P-16 crude xylanase activity measured at 37oC(A) and purified xylanase activity measured at 90oC (B).

Crude and purified xylanase had its highest activity at pH 5, but the crude enzyme also demonstrated quite high activity at pH 4.5 to 6. Enzyme has specific optimum pH, which is responsible for maximum enzyme activity (Lehninger, 1982). The characteristic of enzyme’s optimum pH is the condition where the catalytic site of the enzyme is at the expected ionization level (Whitaker, 1994).

Effect of temperature on xylanase activity Figure 3 shows the effect of temperature on the

activity of xylanase tested at pH 5. Xylanase displayed its optimum temperature, which was at 90oC. Temperature fluctuation can influence the integrity of secondary, tertiary and quaternary structure of enzyme that can affect on enzyme activity (Whitaker, 1994). A B Figure 3. Temperature effect on Streptomyces sp 234P-16 crude extract (A) and purified (B) xylanase activity measured at pH 5.

Enzyme stability At the optimum temperature, the crude enzyme

have half-life time about 4 hours whereas the purified enzyme about 2.5 hours. Enzyme stability was affected by protein, carbohydrate and cations on the medium. Crude enzyme was more stable than the purified extract perhaps is due to the cations and other protein that function as an stabilizer for the enzyme. Enzyme thermostability is also due to the enzyme ability to maintain its three dimensional structure (Whitaker, 1994).

Figure 4. Stability of crude and purified xylanase Streptomyces sp 234P-16 on 90oC

Hydrolysis analysis using HPLC The main product of the xylan hydrolysis was

arabinose (96.61 ppm) whereas xylose just 26.55 ppm. One of the enzyme should be arabinofuranosidase.

Purification It is clear that the best condition for precipitation

xylanase was 70% acetone as can be seen in Table 2. Acetone concentration of 70% will then used for precipitation xylanase for chromatography application.

Table 2. Sedimentation of crude xylanase with acetone.

% acetone xylanase activity

(Unit/mL)

protein content (mg/mL)

specific activity

(Unit/mg) Crude enzyme 0.07 0.06 1.15

00-60 0.13 0.11 1.24 70 0.23 0.05 4.76 80 0.07 0.03 2.74 90 0.04 0.02 2.33

The result of purification using anion exchange

column showed two peak for xylanase activity and protein content (fraction 15-27 and fraction 27-33). Fraction 19-23 was collected and concentrated using PEG6000 and then dialysis for 4 hours using 0.2M phosphate buffer pH 7. The purification factor increased 6x (Table 3).The concentrated enzyme was then applied to the gel filtration column.

The result of purification using gel filtration showed one peak of xylanase activity and protein content. Using gel filtration increased the purification factor to 17x (Table 3) and the SDS PAGE analysis showed one band with molecular mass of 42.5 kDa (Figure 7).

0.00

0.10

0.20

0.30

0.40

0.50

0.60

30 37 40 50 60 70 80 90

Temperature (oC)

Act

ivity

(U/m

l)

020406080

100120140160180200

1 2 3 4 5

Time (hours)%

act

ivity

purified Crude

0.0000

0.0020

0.0040

0.0060

0.0080

0.0100

4.0 4.5 5.0 5.5 6.0 6.5 7.0

pH

Act

ivity

(U/m

l)

0.00

0.10

0.20

0.30

0.40

0.50

0.60

3 3.5 4 4.5 5 5.5 6 6.5 7 7.2 7.5 8 8.5 9

pH

Act

ivity

(U/m

l)

0.000

0.002

0.004

0.006

0.008

0.010

70 75 80 85 90 95 100

Temperature (o C)

Act

ivity

(U/m

l)


118

Figure 5. Profile of xylanase anion exchange chromato-graphy elution using DEAE-Sephadex A-50 matrix. Figure 6. Profile of xylanases chromatography elution with Sephadex G100 matrix. Table 3. Purification of Streptomyces sp. 234P-16 xylanase. Steps Vol

(mL) Total Protein (mg)

Total Activity (Unit)

Specific Activity (U/mg)

Yield (%)

Purification factor

Crude extract 80 4.80 9.76 2.03 100 1 60-70% aceton 20 0.98 4.66 4.78 47.75 2.34 Anion exchange 10 0.08 1.05 12.96 10.76 6.38 Gel filtration 6 001 0.51 35.42 5.23 17.42

Figure 7. Profile of SDS-PAGE of the purified xylanase from: (1) crude extract, (2-3) 60-70% aceton fraction, (4) anion exchange fraction (19-23), (5-7) gel filtration fraction (21-23). (M) marker,

Substrate specificity Assays with substrate specific showed that this

enzyme has an activity on p-nitrophenyl-α-L-arabinofuranosidase and a β-xilosidase activity (Table 3). Activity of these two enzymes activity in one protein showed a bifungsional enzyme. This kind of enzyme was also report from Trichoderma reesei, Clostridium stercorarium, Lycopersicon esculentum and Thermomonospora fusca BD25 (Clark et al. 1996; Kaneko et al. 2000; Tuncer 2000; Itai et al. 2003).

Table 3. Substrate specificity of purified xylanase Streptomyces spp. 234P-16 on pH 5 and 90oC. Specific Substrate Activity (U/mL) p-nitrophenyl-β-D-xilanopiranoside 1.0 p-nitrophenyl-α-D-arabinofuranoside 40.2 p-nitrophenyl-β-D-glucuropiranoside 0.0 p-nitrophenyl-α-D-galactopiranoside 0.0 4-nitrophenyl-acetat 0.0

Kinetic parameters Reciprocal plots showed apparent Km and Vmax

values of 1.98 mg/mL and 523 mmol/minute/mg. Streptomyces sp. S38 that produced one endo-xilanase and two arabinofuranosidase have a Vmaks value of 5700 ± 600, 620 ± 30 dan 1050 ± 50 IU/mg with KM = 2.22, 1.05 and 0.97 mg/mL, respectively (Georis et al. 2000). Several Km dan Vmaks value from α-L-arabinofuranosidases Streptomyces have also been reported: α-L-arabinofuranosidase from Streptomyces sp. have Km and Vmaks of 3,3 mg/mL and nilai 302 µmol/minute/mg respectively (Belfaquih et al., 2002). Streptomyces sp. B-12-2 has a Km value of 0,8 and 5,8 mg/mL and a Vmaks value of 162 and 470 µmol/minute/mg, respectively (Elegir et al.1994). Xylanase from Streptomyces T7 have a Km value of 10 mg/mL and a Vmaks value of 7610 µmol/minute/mg (Kesker, 1992). Xylanase from Streptomyces sp. QG-11-3 have a Km and Vmaks value of 1,2 mg/mL and 158,85 µmol/minute/mg respectively (Beg et al., 2001).

Figure 8. Xylose content on several Birchwood xylan concentration after incubation at pH 5 and 90 oC

0.00

0.50

1.00

1.50

2.00

2.50

3.00

1 6 11 16 21 26 31 36

Fraction number

OD

280

nm

0.000

0.020

0.040

0.060

0.080

0.100

0.120

Xyl

anas

e ac

tivity

(U/m

l)

OD 280 nm xylanase activity (U/ml)

NaCl(M)

0,0

0,5 M

y = 0.0004x + 0.0115

y = 0.0003x + 0.0494

y = 0.0002x + 0.0697

y = 0.0001x + 0.0898

0.000

0.020

0.040

0.060

0.080

0.100

0.120

0 10 20 30 40 50 60 70

Time (minute)

xilo

sa c

onte

nt (m

g/m

l

0.05% 0.15% 0.25% 0.35%

0.00

0.10

0.20

0.30

0.40

0.50

0.60

0.70

0.80

0.90

1.00

1 6 11 16 21 26 31 36

Fraction number

OD

280

nm

0.000

0.010

0.020

0.030

0.040

0.050

0.060

0.070

0.080

0.090

Act

ivity

(U/m

l)

OD 280 nm Activity

MERYANDINI et al. – Xylanase from Streptomyces

119

Figure 9. Correlation between 1/[S] and 1/[V]

CONCLUSION

Streptomyces sp. 234P-16 was able to produce two xylanolytic enzymes α-L-arabinofuranosidase and β-xilosidase. Crude extract of xylanase was precipitated by 60-70% acetone gradually, purified with anion exchange chromatography using Sephadex A-50 and gel filtration chromatography using Sephadex G-100. The molecular mass of the purified xylanase after ion-exchange was 42.456 kDa and 16.903 kDa but gel filtration showed the molecular mass 42.456 kDa. The optimum temperature and pH was 90 0C and 5.0 respectively. The xylanase could resist of heating at 90 0C for 180 minute. The result of kinetic analysis showed that Vmax was 523 µmol/minute/mg and Km was 1.98 mg/ml.

ACKNOWLEDGMENT

This research was funded by Competitive Research Grand Project (”Proyek Penelitian Hibah Bersaing”) with a contract number of 026/SPPP/PP-PM/DP-M/IV/2005 and 317/SP3/PP/DP2M/II/2006 for Anja Meryandini.

REFERENCES

Ali, M.K., F.B. Rudolph and G.N. Bennett. 2004. Thermostable xylanases 10B from Clostridium acetobotylicum ATCC824. Industrial Microbiology and Biotechnology 31: 229-234.

Beg Q.K., M. Kapoor, L. Mahajan and G.S. Hoondal. 2001. Microbial xylanases and their industrial applications: a review. Applied Microbiology and Biotechnology 56: 326-338.

Belfaquih N., C. Jaspers, W. Kurzatkowski and M.J. Penninckx. 2002. Properties of Streptomyces sp. endo-β-xylanase in relation to their applicability in Kraft pulp bleaching. World Journal of Microbiology and Biotechnology 18: 669-705.

Bradford M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantitaties of protein in utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254.

Clark E.M., M. Tenkanen, S.T. Nakni, and M. Pentika. 1996. Cloning of gene encoding α-L-arabinofuranosidase and β-xylosidase from Trichoderma reesei by expression in Saccharomyces cerevisiae. Applied and Environmental Microbiology 62: 3840-3846.

Elegir G., G. Szakacs and T.W. Jeffries. 1994. Purification, characterization and substrate specificities of multiple xylanases from Streptomyces sp. strain B-12-2. Applied and Environmental Microbiology 60: 2609-2615

Georis J., F. Giannotta, E. De Buylb, B. Granier and J.M. Frere. 2000. Purification and properties of three endo-β-1,4-xylanases produced by Streptomyces sp. strain S38 which differ in their ability to enhance the bleaching of kraft pulps. Enzyme and Microbial Technology 26: 178-186

Itai A., K. Ishihara and J.D. Bewley. 2003. Characterization of expression and cloning of ß-D-xylosidase and α-L-arabinofuranosidase in developing and ripening tomato (Lycopersicon esculentum Mill.) fruit. Journal of Experimental Botany 54: 2615-2622.

Kaneko S., A. Kuno, M. Muramatsu, S. Iwamatsu, I. Kusakabe and K. Hayashi. 2000. Purification and characterization of a family G/11 β-xylanase from Streptomyces olivaceoviridis E-86. Bioscience, Biotechnology and Biochemistry 64: 447-451.

Kesker, S.S. 1992. High activity xylanase from thermotolerant Streptomyces T7, cultural conditions and enzyme properties. Biotechnology Letters 14: 481-486

Kubata B.K., T. Suzuki, H. Horitsu, K. Kawal and K. Takamizawa. 1994. Purification and characterization of Aeromonas caviae ME-1 xylanases V, which produces exclusevely xylobiose from xylan. Applied and Environmental Microbiology 60 (2): 531-535.

Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685.

Lehninger A.L. 1982. Dasar-Dasar Biokimia. Jilid ke-1. Thenawidjaja, M., penerjemah. Jakarta: Penerbit Erlangga.

Miller G.L. 1959. Dinitrosalisilic assay. Analytical Chemistry 31: 426-428.

Saha B.C. 2000. α-L-Arabinofuranosidases: biochemistry, molecular biology and application in biotechnology. Biotechnology Advances 18: 403-423

Saha B.C. 2001. Purification and characterization of an extracellular β-xylosidase from a newly isolated Fusarium verticillioides. Industrial Microbiology and Biotechnology 27: 241-245.

Saha B.C. 2002. Production, Purification and Properties of Xylanase from A Newly Isolated Fusarium proliferatum. Process Biochemistry 37: 1279-1284

Saha B.C. 2003. Hemicellulose bioconversion. Industrial Microbiology and Biotechnology 30: 279-291.

Scopes R.K. 1987. Protein Purification, Principles and Practice. 2th ed.. New York: Springer-Verlag

Silveira F.Q.P., F.A. Ximenes, A.O. Cacais, A.M. Milagres, C.V. Meduros, J. Puls and E.X. Filho. 1999. Hydrolysis of xylans by enzyme systems from solid cultures of Trichoderma harzianum strains. Brazilian Journal of Medical and Biological Research 32: 947-952.

Subramaniyan S., and P. Prema. 2002. Biotechnology of microbial xylanases: enzymology, molecular biology, and application. Critical Reviews in Biotechnology 22 (1): 33-64

Sunna A., S.G. Prowe, T. Stoffregen and G. Antranikian. 1997. Characterization of the xylanases from the new isolated thermophilic xylan-degrading Bacillus thermoleovorans strain K-3d and Bacillus flavothermus strain LB3A. FEMS Microbiology Letters 148: 209-216

Tseng M.J., M.N. Yap, K. Ratanakhanokchai, K.L. Kyu and S.T. Chen. 2002. Purification and partial characterization of two cellulase free xylanases from an alkaliphilic Bacillus firmus. Enzyme and Microbial Technology 30: 590-595.

Tuncer M. 2000. Characterization of β-Xylosidase and α-L-Arabinofuranosidase Activities From Thermomonospora Fusca BD25. Turkish Journal of Biology 24: 753-767.

Whitaker J.R. 1994. Principles of Enzymology for the Food Sciences, 2nd ed. New York: Marcel Dekker Inc.

y = 1033.8x - 871.67R2 = 0.9555

0

2000

4000

6000

8000

10000

12000

0.00 2.00 4.00 6.00 8.00 10.00 12.00

1/[S]

1/V


♥ Corresponding address: Jl..Dr. Soeparno 63, Purwokerto 53122 Tel.: +62-281 638794, Fax: +62-281 631700 e-mail: [email protected]

Correlations Between Degree of Petal Fusion, Leaf Size and Fruit Size: A Case in Syzygium (Myrtaceae)

PUDJI WIDODO1,2♥, ALEX HARTANA3, TATIK CHIKMAWATI3 1Post-graduate School, Bogor Agricultural University (IPB), Bogor 16680

2Faculty of Biology, General Soedirman University (UNSOED), Purwokerto 53122 3Biology Department, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680

Received: 10th May 2009. Accepted: 26th June 2009.

ABSTRACT

Syzygium is one of large genera of the flowering plants. In order to simplify the identification, a classification is required, e.g. based on degree of petal fusion, leaf size and fruit size. Due to variations of vegetative and generative characters, a correlation analysis was carried out. The aim of this research is to know the correlation between degree of petal fusion, leaf length and fruit diameter. The result of this research showed that there is positive correlation between those three variables. The increase of leaf size will increase fruit size and petal lobe depth.


Key words: Syzygium, petal fusion, free, intermediate, fused petal, leaf, fruit size.

INTRODUCTION

Syzygium is a large genus of flowering plant which consists of over ca 1,040 species (Govaerts et al. 2008), or about 1,200 species (Parnell et al., 2007), widely distributed in the tropics and subtropics of the old world from Africa, mainland Asia, Malesia, Australia, New Zealand and the western Pacific (Biffin, 2005). This genus is one of the largest and most taxonomically difficult genera in the Myrtaceae and there is a considerable dispute as to whether it is possible to split it into sections or even whether it should be recognized as a separate genus (Parnell and Chantaranothai, 2002). Due to large number of species, >1000 species (Frodin, 2004), it should be grouped to simplify and ease for recognition. There has been a lot of ways of grouping e.g. based on the succulency of fruits, leaf shape, number of pairs of lateral veins etc. (Chaffey, 1999), geographical Old World and New World (Schmid, 1980).

In Syzygium, the generic concepts of Merrill & Perry were adopted by the majority taxonomists (Craven et al., 2006). The generic concepts have been based upon relatively fine levels of morphological distinction (Craven, 2001). In this concept, Syzygium includes the species with and without an intercotyledonary inclusion, either inflorescence

solitary or in cluster, on old trunk, axillary, or terminal, calyx either calyptrate or free.

Ashton (2006) accepts the separation of Syzygium Gaertn. from Eugenia L., and the inclusion of Cleistocalyx Blume, now substantiated on both morphological and molecular grounds (Schmid 1972; Harrington and Gadek, 2004; Wilson et al., 2005; Biffin et al., 2006; Craven et al., 2006).

Different plant characters may show varying

degrees of form diversification or conservatism across phylogenetically related taxa (Herrera, 2004). The present study uses data from a recent systematic

study of Sumatran Syzygium to investigate diversity in reproductive and vegetative plant parts. Previous study that had been done include: correlation between the resource status of a flower or individual and the proportion of reproductive resources allocated to female function in Clarkia unguiculata (Mazer and Dawson, 2000), correlation of the proportion of male relative to bisexual flowers in Leptospermum myrsinoides and L. continentale (Myrtaceae) increases

among upper and outer branch positions (O'Brien, 1994; Spalik and Woodell, 1994). Correlation between plant age and proportion of plant gender e.g. in Arisaema triphyllum, younger plants are more likely to be male than female (Policansky, 1981).

In this paper, Syzygium is grouped based on the degree of petals fusion. In general, there are two groups of Syzygium namely (i) species with free petals (the petals spread open at anthesis), (ii) species with coherent petals (the petals are free from each other but they closely cohere and at anthesis fall as a cap). This is sometimes described as a calyptra but it is not

WIDODO et al. – Corellation of petal fusion degree

121

the same as the true calyptras found in Myrtaceae in which the calyx lobes are fused to each other and the component lobes are no longer able to be seen. However, there are a few species that may be intermediate. In general this is a good way of separating the genus into smaller groups. Craven (pers. comm., 2007) stated that although it is an artificial grouping but it can be conducted because of the very large number of species.

Although section Jambosa (free petalled Syzygium) tends to have larger pollens with a proportionally larger apocolpium than section Syzygium (coherent petalled Syzygium), it does not appear possible to distinguish the species of Syzygium on the basis of features of pollen visible under SEM (Parnell, 2003). Thus In some cases, the degree of petal fusion may be important. Another reason why choosing petal fusion for the dividing character is that this character makes the division balanced. The use of other characters such as the present of hairs, leaf form, flower bud shape, fruit size, etc. may cause unbalanced divisions namely very large versus small division. This can be interpreted that the small division may be only an exception or deviation.

Although scientific achievement has been gained in terms of Syzygium, we have not been able to be ready to anticipate the loss of this genus due to aspects related to environment such as the loss of habitats and ecosystems. Although the development of our understanding on Syzygium grows exponentially, the understanding on the biodiversity of these species is still not enough to plan the future of Syzygium. Therefore, a study into the selection of characters is needed.

In practice, there are some problems concerning the variation of petal fusion namely most (66%) of about 2500 specimens of Syzygium at Herbarium Bogoriense are without flowers and or fruits. Difficulties faced in key writing, due to the large number of sterile specimens. The present study examines variations within plants and correlation between the degree of

petal fusion with leaf and fruit size. This allows us to seek preliminary evidence for identifying sets of integrated characteristics. Studying part of covariation

and phenotypic correlations in phylogenetically related taxa may increase our understanding of plant evolution.


Herbarium specimens of Syzygium from Sumatra in the Herbarium Bogoriense (BO), fresh specimens from Bogor Botanical Garden (KRB), and some fresh specimens directly collected from North and West Sumatra were examined. The specimens included 30 described taxa sampled randomly to include the specimens with free petals, free and coherent petals all together at the same specimens (intermediate), and coherent petals. Variables used were the degree of petal fusion, maximum leaf length and the maximum fruit diameter. The degree of petal fusion was scored as coherent (i), intermediate (ii), and free petalled (iii). Organ size covariation and phenotypic correlations were studied among Syzygium species. Scale relationships were investigated by regression analysis.


Generally, the leaf length and fruit diameter correlated positively and significantly. The leaf length also correlated positively with the degree of petal fusion and similarly the fruit diameter (Figure 1). Taxonomic studies can be useful to establish major phenotypic correlations in Syzygium. Sometimes it is difficult to determine whether the plants are free or coherent petalled due to the absence of the flowers. However, it can be solved by comparing them with the other materials from the other islands, or by predicting using correlation.

40302010 0

6

5

4

3

2

1

0

Leaf

Frui

t

40302010 0

3.5

3.0

2.5

2.0

1.5

1.0

Leaf

Peta

l

321

6

5

4

3

2

1

0

Petal

Frui

t

A B C

Figure 1. Positive correlation between leaf length and petal fusion degree, regression: y = 1.55 + 0.0484 x, r = 0.213 (A); positive correlation between leaf length and fruit horizontal diameter, regression: y = - 0.378 + 0.138 x, r = 0.583 (B); Positive correlation between petal fusion degree and fruit horizontal diameter, regression: y = - 0.669 + 1.05 x, r = 0.471 (C).


122

Figure 2. Leaves, inflorescence, and fruits of Syzygium zeylanicum (above), Syzygium zippelianum, (middle) and S. samarangense (below). The degree of petal fusion: coherent (above), intermediate (middle), free petal (below).

There is positive correlation between leaf size and

the degree of petal fusion. The increase of leaf size will increase the depth of petal lobes. This phenomenon may be explained that the increase of leaf areas will increase assimilation process although lack of sun light and the petals will developed and broken into deep lobes. The leaf size correlated positively with fruit size, which means that equilibrium between leaves and fruits should be reached in order

to produce adequate size of fruits. Up to a certain point, leaf expansion has expanded fruit size.

In Syzygium, if leaf length and fruit diameter changes as predicted, then (i) assuming that leaf expansion will increase the petal width due to consequences that some amount of the leaf product will be stored in the petals. (ii) assuming that the increase of petal width will increase the degree of petal fusion or petal tendency to be free because the

WIDODO et al. – Corellation of petal fusion degree

123

increase of size is not followed equally by the strength of fusion. In addition, the petals will be broken and freed by the stress of stamen during development. (iii) assuming that the increase of leaf area should produce larger fruits, because plants of high resource status need larger place to accumulate the product.

The intermediate category of the petal fusion only occurred in a few Syzygium. Normally, plants show the following petal fusion: (i) coherent: petals are connected together, almost no lobes, resembling an operculum that will fall as a cap of the stamens and pistils; (ii) intermediate, in those species of Syzygium that are intermediate between having free or coherent petals, the petals sometimes open out just as they do in species such as S. malaccense or S. aqueum, whereas in other collections of the same species the petals remain coherent and fall as a cap. This is an uncommon feature but it can be seen in S. claviflorum (Craven, pers. comm., 2007) and S. polyanthum; (iii) completely free, the corolla is separated into lobes, normally four lobes (Figure 2).

CONCLUSION

In Syzygium, the frequently visible characters such as the leaf size can be used to predict the rarely visible characters such as degree of petal fusion and fruit size. As leaf size, fruit size and degree of petal fusion correlated positively, one of these characters may be used to represent the rest. Free petals indicate large fruits, and broad leaves. Intermediate petals indicate medium sized leaves and fruits, and coherent petals indicate small leaves and fruits.

ACKNOWLEDGEMENTS

We would like to thank Prof. Dr. Mien A Rifai, who has given advises and supervision to conduct this research. We acknowledge Dr. Lyn Craven for helps, information, and explanation. We also would like to appreciate some colleagues i.e. Samingan, Eddy Riwidiharso, Ilalqisny Insan, and Indarmawan who have given some suggestions.

REFERENCES

Ashton, P.S. 2006. New Syzygium (Myrtaceae) from Northern Borneo. Kew Bulletin 61: 107.

Biffin, E. 2005. Sorting out the confusion: Phylogenetics of large genera and the lessons from Syzygium (Myrtaceae).

Australian Biological Resources Study, Biology 30. Canberra: CSIRO Plant Industry,.

Biffin, E., L.A. Craven, M.D. Crisp and P.A. Gadek. 2006. Molecular systematics of Syzygium and allied genera (Myrtaceae): evidence from the chloroplast genome. Taxon 55 (1): 79-94.

Chaffey, C. 1999. The Blooming Lilly Pilly. Goonellabah: The Society for Growing Australian Plants.

Craven L.A. 2001. Unravelling knots or platting rope: what are the major taxonomic strands in Syzygium sens. Lat. (Myrtaceae) and what should be done with them? In: Saw L.G., L.S. Chua, and K.C. Koo, (eds.), Taxonomy: The Cornerstone of Biodiversity. Proceedings of the Fourth International Flora Malesiana Symposium, Institut Penyelidikan, Kuala Lumpur, 1998.

Craven, L.A, E. Biffin, and P.S. Ashton. 2006. Acmena, Acmenosperma, Cleistocalyx, Piliocalyx and Waterhousea formally transferred to Syzygium (Myrtaceae). Blumea 51: 131-142

Frodin, D.G. 2004. History and concepts of big plant genera, Taxon 53: 753-776.

Govaerts, R., M. Sobral, M., Ashton, P., Barrie, F. Holst, B.,Landrum, L., Nic Lughadha, E., Matsumoto, K., Mazine, F., Proença, C., Soares-Silva, L., Wilson, P. and Lucas, E. 2008. World Checklist of Myrtaceae. The Board of Trustees of the Royal Botanic Gardens, Kew.

Harrington, M.G. and P.A. Gadek. 2004. Molecular systematics of the Acmena alliance (Myrtaceae): phylogenetic analyses and evolutionary implications with reference to Australian taxa. Australian Systematic Botany 17: 63-72.

Herrera, J. 2004. Phenotypic Correlations Among Plant Parts in Iberian Papilionoideae (Fabaceae). Annals of Botany 95 (2): 345.

Mazer, S.J. and K.A. Dawson. 2001. Size-dependent sex allocation within flowers of the annual herb Clarkia unguiculata (Onagraceae): ontogenetic and among-plant variation. American Journal of Botany 88: 819-831

O'Brien, S. P. 1994. Andromonoecy and fruit set in Leptospermum myrsinoides and L. continentale (Myrtaceae). Australian Journal of Botany 42: 751-762

Parnell, J.A. and P. Chantaranothai. 2002. Myrtaceae. Flora of Thailand 7 (4): 778.

Parnell, J.A.N., L.A. Craven, and E. Biffin. .2007. Matters of scale: dealing with one of the largest genera of angiosperms. In Reconstructing the tree of life: taxonomy and systematics of species rich taxa. In: Hodkinson, T.R. and J.A.N. Parnell. (eds.). Systematics Association Special Volume Series 72. 251-273.

Parnell, J.A.N. 2003. Pollen of Syzygium (Myrtaceae) from SE Asia, especially Thailand. Blumea 48 (2): 303.

Policansky, D. 1981 Sex choice and the size advantage model in jack-in-the-pulpit (Arisaema triphyllum). Proceedings of the National Academy of Sciences, USA 78: 1306-1308

Schmid, R. 1972. A resolution of the Eugenia-Syzygium controversy (Myrtaceae). American Journal of Botany 59 (4): 423-436.

Schmid, R. 1980. Comparative anatomy and morphology of Psiloxylon and Heteropyxis, and the subfamilial and tribal classification of Myrtaceae. Taxon 29: 559-595

Spalik, K., and S.R.J. Woodell. 1994. Regulation of pollen production in Anthriscus sylvestris, an andromonoecious species. International Journal of Plant Science 155: 750-754.

Wilson, P.G., M.M. O’Brien, M.M. Helsewood, and C.J. Quinn, 2005. Relationships within Myrtaceae sensu lato based on a matK phylogeny. Plant Systematic and Evolution 251: 3-19.


♥ Correspondence address: Jl. Raya Jakarta-Bogor Km 46, Cibinong-Bogor 16911 Tel. & Fax.: +62-21-8765056 & 8765068 e-mail: [email protected]

Some Notes on Biological Aspects of Captive Javan Warty Pig (Sus verrucosus)

GONO SEMIADI♥, RADEN TAUFIQ PURNA NUGRAHA Zoology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911.

Received: 3rd February 2009. Accepted: 28th May 2009.

ABSTRACT

The Javan warty pig (Sus verrucosus) is an endemic pig to Java and Bawean Islands, while population on Madura Island is thought to be extinct. The problem in establishing ex-situ captive breeding is the lack of information on biology or physiology. A study on these aspects was conducted in 16 Javan warty pigs and 2 cadavers in Surabaya Zoo, Surabaya. Birth profile was evaluated and blood collections were conducted, as well as analysis on spermatozoa morphology. Data showed that blood parameters were not different among the age groups (juvenile and adult) or sex and within the range of Sus scrofa. Extreme values were only obtained from the palette with the female reaching 14.5 x 103/mm3, while adult male and juvenile pigs were 58-75 x 103/mm3. Diameter of both testicles with skin intake was 56.42 mm, with the length of left testicle being 83.29 mm and right testicle 78.88 mm. Javan warty pig spermatozoa had longer size for the head and tail lengths compared to average pigs sperms. Litter size was between two to four, with the average of 2.75 litters (SD 0.98). Low litter size in this species is something that has to be concerned from the conservation point of view, therefore a captive breeding population program needs to be considered.

© 2009 Jurusan Biologi FMIPA UNS Surakarta

Key words: Javan warty pig, Sus verrucosus, blood parameters, sperm.

INTRODUCTION

The Javan warty pig (Sus verrucosus) is an endemic pig to Java and Bawean Islands, while the population on Madura Island is thought to be extinct (Semiadi and Meijaard, 2006). The species is believed to have emerged during the Pleistocene era, almost two millions years ago. Taxonomically, there are still some disagreements on the relation among other pig species (Suripto, 2002; Lucchini et al. 2005), however distinct characters occurred between the Javan warty pig with wild pig Sus scrofa (Suripto, 2002).

Presently, in Indonesia, the species is not protected, however at International level, the IUCN Species Survival Commission has put S. verrucosus in ‘endangered’ category (IUCN, 2007). This shows that the species needs priority attention on conservation action regardless of its non protected status under the Indonesian law. To some level, the species has often been blamed as pest due to its stereotype behavior with wild pig S. scrofa.

Last field survey indicated that the distribution of the species is now fragmented into several small pockets habitat with unknown size of population. Hence, it is believed the population number has decreased drastically since the past study (Semiadi and Meijaard, 2003; 2006). Those decreases are mainly due to hunting activities in the past 10-20 years ago, along with the expansion of the agricultural lands and production forests. Therefore, a conservation effort is needed to save the species through the development of ex-situ facilities with target populations for re-introduction programs.

The main problem in ex-situ development is the limited information on the biology and physiology of the species. Therefore, some observations taken from captive animals were conducted with the aim to gain more information on the biology or physiology of the Javan warty pig.


The study was conducted in Surabaya Zoo, Surabaya, East-Java, using captive Javan warty pigs (Sus verrucosus) that were put in several exhibition and quarantine pens. The majority of the animals were born in captivity, and only two animals were traceable for their origins.

SEMIADI & NUGRAHA – Biology Sus verrucosus in captivity 125

Birth profile Birth profile was evaluated from the Surabaya Zoo

database with the calculation on mean birth date followed Semiadi et al. (1994). Dates of birth were transformed to numerical sequence in Excel (Microsoft Excel 2003) and calculated the mean and standard deviation, and then re-transformed to the actual date.

Blood collection Blood collection was conducted in 16 (♂= 9; ♀= 7)

mixed ages (juvenile, adult, old) Javan warty pigs which were captured using net. Blood was collected either from jugular vein or fore-legs/hind-legs vein, using 5 cc syringe with a 0.5 inch x 20G needle. Collected blood was split into two portions, half of which was transformed into blank vials, and the other half into vials filled with ethylene diamenetetraacetic acid (EDTA). Within two hours after the collection, all blood samples were transported to the designated Surabaya Zoo Medical Laboratory (Laboratorium Medik Prodia) for analysis according to a protocol that has been set and calibrated for wildlife animals. Hematological analysis was run on Advia.12.0 seri 411.OT76011 (USA) and biochemical analysis was run on Modular P.800 (Roche, France).

Since the sample numbers were considered minimal, data were pooled and analyzed descriptively.

Spermatozoa morphometry Semen was collected from

cauda epididymis through aspiration using 10 μL micropipette in one adult cadaver. Five μL of collected semen was then diluted into 995 μL buffer formolsaline solution and kept in tight vials. In the Reproduction Laboratory, Research Centre for Biology LIPI, Cibinong, semen was processed as wet mount and evaluated under phase contrast microscope at 40x magnification (Nikon Optiphot-2), attached to a Nikon FDX 35 camera for documentation. The photos were then scanned at 600 dpi. resolution (Canon 3000 F) and analyzed using Image J ver. 3.7 program.

To transform the pixel value into metric unit, one pixel produces by the Image J ver. 3.7 program was calibrated using micrometer photo at similar magnification, resulting

an equivalent value of 9.3 pixel/ micrometer. Spermatozoa parameters and area analysis followed Kondracki et al. (2005), whereas spermatozoa head total area was calculated following Révay et al. (2004).

Apart from one adult cadaver, one male juvenile (1.5 months) Javan warty pig cadaver was also inspected for any specific characters. All data were processed in Excel (Microsoft Excel 2003) followed by simple statistic calculations.


Blood parameters analysis revealed that no big variations exist among sex or age groups. The only extreme value was on a palette parameter (PLT, 103/mm3), in which female group had a value of 14.5 x 103/mm3, compared to the adult male and juvenile groups with only 58-75 x 103/mm3. Since the best normal parameters of blood values of any species collected should be on specific sex and age categories, the current data are meant as a general guidance only until more data are obtained. In general, the range of each parameter was not too

Table 1. Comparisons on blood hematological and biochemical parameters of several pig species.

Parameters S. verrucosusa S. domesticusb S. domesticusc S. scrofac S. s. aferuse Tot Prot (g/dL) 5.80-10.30 5.83-8.32 6.5-9.0 7.7±0.58 8.21±0.38Albumin (g/dL) 2.30-5.50 2.26-4.04 31-43 4.3±0.36 4.08±0.29Globulin (g/dL) 3.30-6.90 3.95-6.00 - - - WBC (103/mm3) 6.10-7.87 11-22 10.6-24.0 11.5±3.24 9.79±4.27RBC (106/mm3) 7.94-8.90 5-7 5.1-8 5.7±1.06 8.0±0.68 HGB (g/dL) 15.90-18.80 9-13 10-17 12.0±2.15 15.7±1.73HCT (%) 54.60-68.80 36-43 - - - PLT (103/mm3) 12.00-75.00 200-500 - 310 - MCV (µm3) 65.20-77.40 52-62 52-63 63.0±4.04 77.5±5.13MCH (pg) 18.40-22.00 17-24 18-22 21.0±1.38 - MCHC (g/dL) 27.10-32.20 29-34 34-380 33.5 - CHCM (g/dL) 27.20-30.70 - - - - RDW (%) 16.00-17.20 - - - - HDW (g/dL) 1.83-2.41 - - - - MPV (um3) 8.00-11.70 - - - - PDW (%) 7.00-68.30 - - - - PCT (%) 0.01-0.07 - - - - LI (%) 0.00-2.39 - - - - NEUT (%) 22.40-37.50 20-70 15.1-59.5 - - LYM (%) 11.30-23.10 35-75 25.5-71.1 - - MON (%) 42.30-51.90 0-10 1-14 - - EOS (%) 0.00-0.60 0-15 1-13 - - BASO (%) 0.80-15.30 0-3 0-3 - - LUC (%) 0.70-3.50 - - - - # NEUT (103/mm3) 1.37-2.48 2-15 1.9 -10.1 5.7±2.90 - # LYM (103/mm3) 0.75-1.67 3.8-16.5 3.7-14.7 5.3±2.29 - # MON (103/mm3) 3.11-3.76 0-1 0-2.4 0.203 - # EOS (103/mm3) 0.00-0.04 0-1.5 0-2,4 0.139 - # BASO (103/mm3) 0.06-0.94 0-0.5 0-0,5 0.150 - # LUC (103/mm3) 0.06-0.23 - - - - BLAST (%) 0.10-1.20 - - - - Note: a Present data; b Merck (2006); c Brockus et al. (2005); d Friendship et al. (1984); e Harapin et al. (2003).


different from S. scrofa and domesticated pigs (Table 1). The only parameters which gave distinct differences with other pig species were on hematocryte, lympocyte and monocyte.

Testicle shape was similar to common pig species, with the diameter of both testicles with skin intake was 56.42 mm, and length for the left part was 83.29 mm and right part was 78.88 mm. Specific character was observed on spermatozoa where head and tail length tended to be longer compared to S. scrofa or S. s. domesticus (Tables 2 and 3). High cytoplasmic droplet was found in almost all spermatozoa being evaluated (Figure 1). Cytoplasmic droplet is a remnant of the germ cell cytoplasm, that remains adherent at the neck region of the elongating spermatid when it is shed as a testicular spermatozoon at spermiation during normal spermatogenesis (Cooper, 2005). In boar and goat, spermatozoa from the cauda epididymis have a high percentage of distal cytoplasmic droplets that can reach more than 93% (Kato et al., 1996). Whereas in the Javan warty pig, the majority cytoplasmic droplets observed were found at midpiece reaching 97%.

Table 2. Sperm morphometry of adult S. verrucosus.

Head Width (μm) Length (μm) Area (μm2)

Tail Length (μm)

Means 4.86 9.95 38.54 48.01 Stdev. 0.433 0.488 3.234 2.420 Max. 7 11 32 53 Min. 3 8 46 36

Carpal-gland which was located posteriorly on the fore-legs consisted of four lobes that were arranged in line. (Figure 2). The structure of the carpal gland had been visible since 1.5 months old, but with smaller size compared to that the adult ones. In adult pig, the distance between lobes varied from 9.00 mm to 14.75 mm, and the diameter from 0.15 mm to 0.30 mm, from the lower to the top position, respectively. The function of the lobes gland was believed as scent gland in the defensive behavior of reproductive females or as a communication strategy as it is shown in Sus domesticus (Heise-Pavlov, 2005). The number of lobes in this study was less than other Suidae which has five to seven lobes as stated by Farnesi et al. (1999).

Hoof size of adult pig was shown in Table 4, whilst warts and body size was shown in Tables 5 and 6. Necropsy of fresh warts showed no fat deposit and the tissue was firm. Body size of adult cadaver was within the range of common pig species such as S. scrofa (body length 128.7 cm, body weight 56.7 kg, tail length 19.6 cm, ear length 13.1 cm and age 13-18 months; Moretti, 1995).

Three years birth profile (2003-2005) showed a mean birth date of 01 May (SD 60.57 days, n=4), with the range of birth month from March to August. Litter size was considered low, only 2-4 individuals, with the mean 2.75 individuals (SD 0.98, n= 4). No sex ratio was able to determine. Local hunters in West Java

Figure 1. Spermatozoa of adult Javan warty pig (S. verrucosus) at 40 x magnification, using phase contrast microscope. Bar= 25 μm (Photo: R.T.P Nugraha).

A

B Figure 2. Gland lobes on fore-legs of adult (A) and juvenile (B) Javan warty pig S. verrucosus (Photo: G. Semiadi).

SEMIADI & NUGRAHA – Biology Sus verrucosus in captivity 127

Table 3. Comparison of spermatozoa morphometry in several pig species.

Head Species References Width (μm) Length (μm) Area (μm2) Tail

Length (μm) S. verrucosus Present study 4.86 ± 0.43 9.95 ± 0.49 38.54 ± 3.23 48.01 ± 2.42 S. scrofa Gage (1998) 5.0 8.1 -- 28.8 S. s. domestica Hirai et al. (2001) 4.66 ± 0.02 9.27 ± 0.05 35,7 ± 0,22 -- S. s. domestica Kondracki et al. (2005) 4.88 ± 0.28 9.37 ± 0.44 41.17 ± 2.68 46.26 ± 1.75 noted that litters size of wild Javan warty pigs was 50% less of that the S. scrofa (Semiadi, 2005; unpublished data). Coblentz and Baber (1987) reported that litter size of S. scrofa was between 1-10 individuals, with the mean of 4.7 individuals and mortality rate at 19 weeks old reaching 52%. Whereas Baber and Coblentz (1986) showed the mean of litter size for several pig species were between 4.2-7.4 individuals, with post weaning mortality reaching 12.5-34.7%. This shows that in Javan warty pig, low litter size could be a limitation on the success of captive breeding for the re-introduction program within a short period of time, unless excessive numbers of founders are available.

Table 4. Hoof measurements of adult male Javan warty pig S. verrucosus.

Fore-legs Back-legs Left Right Left Right Length (mm) 46.74 43.96 44.67 41.97 Width (mm) 22.28 22.28 19.39 18.83

Table 5. Warts size of adult male Javan warty pig S. verrucosus.

Lateral (Length) Distal (Width)

Under the eyes (mm) 28.56 22.43 On cheek (mm) 120.45 Close to eyes 39.45 Centre 15.27 Bottom 23.40 On nose (mm) 37.72 21.88 Table 6. Body measurements of adult male Javan warty pig S. verrucosus.

Parameters Size (cm) Body length (nose to tail bone) 125.0 Tail length 19.5 Girth diameter 87.0 Ear length 10.95

CONCLUSIONS

From this study it was shown that normal blood parameters of Javan warty pigs were within the range of commonly found pigs. However, the pig had low number of litter per birth.

ACKNOWLEDGEMENTS

Authors wish to thank the Head of Surabaya Zoo and the staff for the permit and cooperation in using and handling the animals. Rosita Sulis Tanty was appreciated for her willingness in collecting the blood and Dr. Arjan Boonman for his comments on the manuscript. This study was funded by Proyek DIPA Puslit Biologi LIPI and part of the analysis was funded through Zoologische Gesellschaft für Arten- und Populationsschutz e.V. (ZGAP), München, Germany.

REFERENCES

Baber, D.W. and B.E. Coblentz, 1986. Density, home range, habitat use and reproduction in feral pigs on Santa Catalina, Califronia. Journal of Mamalogy 67: 512-525.

Brockus, C.W., E.A. Mahaffey, S.E. Bush, and W.K. Despain, 2005. Hematologic and serum biochemical reference intervals for Vietnamese potbellied pigs (Sus scrofa). Comparative Clinical Pathology 13: 162-165.

Coblentz, B.E. and D.W. Baber. 1987. Biology and control of feral pigs on Isla Santiago, Galapagos Equador. Journal of Applied Ecology 24: 403-412.

Cooper, T.G. 2005. Cytoplasmic droplets: the good, the bad or just confusing?. Human Reproduction 20: 9-11.

Farnesi, R.M., D. Vagnetti, B. Santarella, and S. Tei. 1999. Morphological and ultrastructural study of carpal organ in adult female wild swine. Anatomica, Histologia, Embryologia 28:31-38.

Friendship, R.M., J.H. Lumsden, I. McMillan, and M.R. Wilson. 1984. Hematology and biochemistry reference values for Ontario swine. Canadian Journal of Comparative Medicine 48: 390-393.

Gage, M.J.G. 1998. Mammalian sperm morphometry. Proceeding of the Royal Society of London B. 265: 97-103.

Harapin, I., L.J. Bedrica, V. Hahn, B. Šoštarić, and D. Gračner, 2003. Hematological and biochemical values in blood of wild boar (Sus scrofa ferus). Veterinary Archives 73: 333-343.

Heise-Pavlov, S., P. Heise-Pavlov, and A. Bradley, 2005. Carpal glands in feral pigs (Sus domesticus) in tropical lowland rainforest in north-east Queensland, Australia. Journal of Zoology, London. 266:73-80.

Hirai, M., A. Boersma, A. Hoeflich, E. Wolf, J. Foll, T.R. Aumuller, and J. Braun. 2001. Objectively measured sperm motility and sperm head morphometry in boars (Sus scrofa): relation to fertility and seminal plasma growth factors. Journal of Andrology 22: 104-110.

IUCN. 2007. IUCN Red List of Threatened Species. www.iucnredlist.org.

Kato, S., T. Shibukawa, H. Harayama, and Y. Kannan. 1996. Timing of sheding and disintegration of cytoplasmic droplets from boar and goat spermatozoa. Journal of Reproduction Development 42: 237-241.

Kondracki, S., D. Bonaszewska, and C. Mielnicka. 2005. The effect of age on the morphometric sperm traits of domestic pigs (Sus scrofa domestica). Cell & Molecular Biology Letter 10: 3-13.


Lucchini, V., E. Meijaard, C.H. Diong, C.P. Groves, and E. Randi, New phylogenetic perspectives among species of South-east Asian wild pig (Sus sp.) based on mtDNA sequences and morphometric data. Journal of Zoology, Lond. 266: 25-35.

Merck. 2006. The Merck Veterinary Manual. Merck & Co., Inc. http://www.merckvet manual.com/mvm/index.jsp?cfile=htm/bc/ ref_00. htm. 10/02/2006. Diunduh 27 Juni 2008.

Moretti, M. 1995. Biometric data dan growth rate of a mountain population of wild boar (Sus scrofa L.) Tikino Switzerland. IBEX. Journal of Mountain and Ecology 3: 56-59.

Révay, T., S. Nagy, A. Kovács, M.E. Edvi, A. Hidas, W. Rens, and I. Gustavsson, 2004. Head area measurements of dead, live, X- and Y-bearing bovine spermatozoa. Reproduction Fertility and Development 16: 681-687.

Semiadi, G., P.D. Muir, and T.N. Barry. 1994. General biology of sambar deer (Cervus unicolor) in captivity. New Zealand Journal of Agricultural Science 37: 79-85.

Semiadi, G. and Meijaard, E. 2003. Survai Keberadaan Babi Kutil (Sus verrucosus) di Pulau Jawa dan Sekitarnya. [Laporan Akhir]. Bogor: Puslit Biologi LIPI & IUCN PPSG.

Semiadi, G. and E. Meijaard. 2006. Declining populations of the Javan Warty pig (Sus verrucosus). Oryx 40: 50-56.

Suripto, B.A. 2002. Babi hutan (Sus spp.) di Pulau Jawa, masa lalu, masa kini dan masa mendatang. Prosiding Seminar Nasional Bioekologi dan Konservasi Ungulata. IPB, LIPI & Puslitbanghut, Bogor, 5 Pebruari 2002.


♥ Corresponding address:

Jl. Ir. Sutami 36A Surakarta 57126 Tel. & Fax.: +62-271-663375 e-mail: [email protected]

The Effect of Mulching Technology to Enhance the Diversity of Soil Macroinvertebrates in Sengon-based Agroforestry Systems

SUGIYARTO1,2,3,♥ 1Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Surakarta 57126

2Bioscience Program, Post-Graduate Program, Sebelas Maret University (UNS), Surakarta 57126 3Research and Development Center for Biotechnology and Biodiversity, Sebelas Maret University (UNS), Surakarta 57126

Received: 28th January 2009. Accepted: 11th March 2009.

ABSTRACT

Soil macroinvertebrate are strongly influenced by environmental factors. The change of agronomic technology may affect their role in maintaining soil fertility and crop production. The aim of this study was to know the effect of technology of mulching to enhance diversity of soil macroinvertebrate in sengon-based agroforestry system. Field experiment was arranged in randomized block design with treatment i.e: with and without organic matter mulching. Sweet potato used as tested intercrop. Collection of soil macroinvertebrate was carried out using a hand sorting and pit-fall trap methods. Result of the study showed that application of maize residue as mulch enhanced diversity index of surface and deep soil macroinvertebrate, i.e: 0.215 and 0.214 (by 44% and 73% respectively compared no mulching). Organic mulching technology can support diversity of beneficial soil macroinvertebrates.


Key words: agroforestry, soil macroinvertebrates, sengon (Paraserianthes falcataria), mulching.

INTRODUCTION

Land degradation is an important part of global crisis. Rising population pressure and urbanization, combined with land degradation, soil salinization, and global warming have been causing food insufficiency. Controlling the land degradation and their rehabilitation programes may enhance land productivity and contribute to human needs (Edgerton, 2009; Kumar, 2008). Soil biodiversity conservation is an important part of agricultural dan silvicultural management to maintain their production. There are intercorrelation between soil biodiversity, especially soil macroinvertebrates with crop production (Sugiyarto, 2004). Soil macro-invertebrates influence soil processes, which may affect both the physical and chemical fertility of soils (Lavelle and Pashanasi, 1989). Soil macro-invertebrates contribute to the maintenance and productivity of agrosystems. Okwakol (1994) observed a declining trend in fauna biomass and soil chemical properties, indicating that soil macrofauna had a direct effect on soil properties. Soil macroinvertebrates maintain soil physical, chemical and biological fertility by immobilization, humification,

biocontrol processes and play role as decomposer as well as soil engineer to encourage crop production (Lavelle et al., 1994; Hagvar, 1998).

Soil macroinvertebrates belong to soil macrofauna with have no vertebrates. The macrofauna consists of animals with body longer than 4 mm or wider than 2 mm, which are visible to the naked eye (Gorny dan Leszek, 1993). In total, more than 20 taxonomic groups are involved including arthropods, mollusks and earthworms. The Coleopteran or beetles tend to the most diverse (Brown et al., 2001). They can be further divided into three groups, which play different roles in the ecosystem: the epigeics, anecics and endogeics (Lavelle et al., 1994). The epigeics live and feed on surface litter including saprophagous arthropods and pigmented small earthworms, as well as predators of this group (chilopods, ants and some coleopteran). Anecics on the other hand feed on surface litter but build subterranean burrows and nests that provide shelter. They consist of some large pigmented earthworms and the majority of termite species. The endogeics live in the soil and consist mainly of termites and unpigmented earthworms. Based on their behaviour and sampling technical, soil macroinvertebrates are differed to below-ground or deep soil macroinvertebrates and above ground or surface soil macroinvertebrates (Adianto, 1993; Sugiyarto, 2004).

In organic matter decomposition processes, soil macroinvertebrates contribute to fragmentation/


130

comminution and facilitate to bacteria and fungi in mineralization processes (Lavelle et al., 1994). Soil macroinvertebrates also play role in nutrient transportation or distribution, enhancing properties of soil structure and soil forming. So they are important to maintain soil fertility and soil healthy (Adianto, 1993; Foth, 1994; Brown et al., 2001). Soil macroinvertebrates diversity show intercorrelation with ecosystem function, but there little information and no profound interest to their conservation (Lavelle et al., 1994; Hagvar, 1998).

Soil communities, especially soil macroinverte-brates, are strongly influenced by environmental factors, and any change in land use may change their communities (Wallwork, 1970). From the moment a natural system is modified by human activities for agricultural purposes, major changes occurred the soil environment and to the flora and fauna populations and community present (Brown et al., 2001). Simple correlation analysis indicates that soil macrofauna diversity was closely related with soil organic content, soil humidity, domination of ground vegetation and level of light penetration (Sugiyarto, 2000). Surface soil macrofauna diversity at forest habitat, especially at pine stands, were higher level than at cultivated plants habitat (Sugiyarto et al., 2002). Schefflera aromatica showed best influence to increase soil mesofauna diversity, compared with other forest stand at Jobolarangan forest area (Sugiyarto et al., 2001). Land-use changes from mixed forest to sengon plantation in monoculture and agroforestry system degrade diversity of macroinvertebrates. The soil macroinvertebrate in sengon plantation (non-agroforestry) system and in sengon-based agroforestry system, i.e: 0.16 and 0.09 (decreased 47% and 70%, respectively, compared with mix forest (Sugiyarto, 2004).

The effects of clearing, however, and of change in land use, on soil macroinvertebrates have not been widely quantified (Lal, 1987). The tropical rain forests, for instance, are known for their richness. Soil invertebrates diversity and abundance are strongly depend on environmental factors, especially quality and quantity of organic matter as food source and maintaining physic-chemical environment stability (Maftu’ah et al., 2002; Sari et al., 2003). The combination of the various practice adopted by farmers at a particular site are important in determining the soil fauna community and provide an important entry point and opportunity for managing their populations, enhancing their beneficial activities and reducing their negative effects on soil fertility and agricultural production (Brown et al., 2001). Organic matters management system is the key-factor in soil macroinvertebrates conservation.

Mulching is one of agronomical technology to ensure organic matter supply. To support organic matter supply in mulching technology, there is important to develop intercropping system, especially agroforestry system, with produce more crops

residue. Agroforestry, or woody perennial-based mixed species production systems, has the potential to arrest land degradation and improve site productivity through interactions among trees, soil, crops, and livestock, and thus restore part, if not all, of the degraded lands. Food production either directly (producing food grains, root crops, fruits, and vegetables) or indirectly (improving soil conditions and thereby promoting understorey crop productivity especially on degraded sites) constitutes the central theme of most smallholder agroforestry practices (Kumar, 2008). There are many intercrop species producing crops residue in sengon (Paraserianthes falcataria)-based agroforestry system at Jatirejo forest resort, district of Kediri, East Java. Maize (Zea mays L.) is the most dominant intercrop potentially as source of crops residue (Sugiyarto et al., 2007).

The aim of this research is to study the affectivity of mulching technology in enhancing soil macroinvertebrates diversity at the sengon-based agroforestry system. The source of mulch is maize crop residue. Tested intercrop/ understorey species is sweet potato (Ipomoea batatas).

MATERIAL AND METHODS

The research was carried out in sengon plantation at Jatirejo forest resort, district of Kediri, East Java. The field experiment was arranged in randomized complete block design with treatment i.e: with and without organic matter mulching in four replicates. Dry maize crop residue was used as mulch with doses be equally 15 mg/ha. Soil was plowed and made pile in the same direction with sengon plantation line. The experiment block area was (3 x 5) m2. Distance of these block area were 100 cm. Sweet potato used as test intercrop arranged in population be equally 67.134 plant/ha.

Collection of soil macroinvertebrate was carried out using a hand sorting method for deep soil macroinvertebrates and pit-fall trap method for surface soil macroinvertebrates in 4th, 8th, 12th, 16th, and 20th weeks after planted. Samples which be collected was quantified and identified in laboratory of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Surakarta referred to Burges and Raw (1967), Wallwork (1970), Borror et al., (1992), Gorny and Leszek (1993), and (Suin, 1997).

Soil macroinvertebrates diversity value found expression in modified Simpson diversity index (Sugiyarto, 2004) with equation:

D = (1-Σ (pi)2 (qi);

D: diversity index pi: sum of individual in one species/sum of

individual in total species qi: sum of species in one observation unit / sum of

species in all observation unit

SUGIYARTO – Diversity of soil macroinvertebrates in sengon stand

131


Soil is a living entity, comprising an inseparable mixture of solid, liquid and gaseous phases, and diverse fauna and flora, the below ground biodiversity. It is capable of supporting biological growth, and is in equilibrium with its environment. Soil macroinvertebrates is little part of below ground biodiversity but take important role in soil function, especially in organic matter decomposition processes and fixed up soil physical properties. Their existence showed different response to their environment, but their population tend to increase by rising of organic matter available (Crossley et al., 1992). High soil macroinvertebrate diversity and quantity were showed in complex/mixture of different organic matter or low quality (high C/N ratio) of organic matter. Sugiyarto et al. (2007) stated that maize, sengon and elephant grass residue affected higher population of soil macroinvertebrates than sweet potato and papaya residue application.

Result of this research showed that age of sweet potato as intercrop in sengon-based agroforestry system affected soil macroinvertebrates diversity (Figure 1). Increasing of sweet potato age is followed by enhancing of soil macroinvertebrates diversity index, especially on mulching application. Diversity index of surface soil macroinvertebrates increase from 0.092 on fourth week after planted to 0.228 on twentieth week after planted (enhancing 148% respectively). In the same case diversity index of deep soil macroinvertebrates increase from 0.107 on fourth week after planted to 0.210 on twentieth week after planted (enhancing 96% respectively). At without mulch application treatment showed that after twelfth week after planted both surface and deep soil macroinvertebrates diversity index tended to stable or decreased.

Covering level of intercrop at different age and mulching may be act as the major factor supported

soil macroinvertebrates existence. This phenomenon explained that soil macroinvertebrates need above-ground vegetation and mulch as source of food and to protect from environmental disruption, i.e: predator, high light intensity, high temperature, force of rainfall and running off, etc. Brown et al. (2001) mentioned that common agricultural practices giving positive effect on the soil biota, i.e: organic matter (mulch, manure, etc.), less physical disturbance (tillage), green manure, soil covers, crop rotations, liming, fertilization and organic agriculture. Sugiyarto et al. (2007) showed that most of soil macroinvertebrates tend to avid risk of open space or high light intensity. Faunal populations often decline when natural habitats are cleared (Watanabe et al., 1983). Work in the Mabira Forest Reserve in Uganda showed that forest clearance and cultivation have deleterious effects on soil macrofauna communities (Okwakol, 1994, 2000). In a few instances, however, faunal densities and diversity increase following clearing of forest or woodland. Okwakol (1994) reported soil macrofaunal density of 1247 m−2 in cleared and uncultivated site compared with 863 m−2 in the natural forest. Most of the gain was attributed to a dramatic increase in the density of termites as well as increase in the density of predatory surface-active fauna such as spiders, ants and centipedes. This trend was partly attributed to the abundant food supply for wood and litter feeding species. Collins (1980) has showed that type of vegetation has often been shown to be a major determining factor of soil fauna abundance. As land conversion occurs, the above-ground biodiversity is reduced. This impacts the associated soil macrofauna thus lowering the biological capacity of the ecosystem for self regulation. Zake et al. (1994) noted that banana plantations also supported estimated weight biomass of 4.55 g m−2 and macrofauna biomass formed a relatively similar trend to that of organic matter and banana yield.

A B Figure 1. Surface (A) and deep (B) soil macroinvertebrate diversity index in sengon-based agroforestry system with and without mulching application.

without mulching mulching without mulching mulching

Div

ersi

ty in

dex

Div

ersi

ty in

dex

Age (weeks after planting) Age (weeks after planting)


132

This research showed that surface soil macro-invertebrates more responsive to the environment alteration than deep soil macroinvertebrates one. Differ with surface macroinvertebrates, beside be protected by above-ground material, deep soil macroinvertebrates also protected by soil itself. More, the surface soil macroinvertebrates, especially most of insects, chilopods and arachnids, can migrate to another habitat to escape or avoid some disruption. In a survey of termites in natural forest, a cleared but not cultivated site and six sites cultivated for over different periods distinct differences between systems were observed. Twenty-four species, including Odontotermes amanicus (Sjostedt) and Microtermes luteus (Harris), both not previously identified in Uganda, were recorded in natural forest (Okwakol, 2000). Forest clearance resulted in drastic reduction in the number of species to about 40% of what existed in natural forest while cultivation led to further reduction to <20%. Clearance of forests has both direct and indirect effects on termites as disturbance removes vegetation, destroys nest sites, alters the soil environment and food sources and leads to exposure to predators and parasites (Black and Okwakol, 1997). Scientists have begun to quantify the causal relationships between (i) the composition, diversity and abundance of soil organisms, (ii) sustained soil fertility and associated crop production, and (iii) environmental effects, including soil erosion, greenhouse gas emissions and soil carbon sequestration (Lavelle et al., 1997).

This research result showed that mulching technology with maize residue enhanced both surface-and deep soil macroinvertebrates diversity index in sengon-based agroforestry system (Table 1). By mulching application surface soil macroinvertebrate diversity index enhanced from 0.149 to 0.215 (increase 44% respectively), and deep soil macroinvertebrate diversity index enhance from 0.124 to 0.214 (increase 73% respectively). This results reflected multifunction of mulch. It enhance soil macroinvertebrates directly, and also supported more expansive sweet potato growth giving good protection and source of food for soil macroinvertebrates. This showed the important role of mulch to support existence of most species of soil macroinvertebrates like the previous researcher finding (Maftu’ah et al., 2002; Sari et al., 2003). Maize residue is a low quality organic matter that decomposed slowly. Their supplies as mulch give longtime protective function for soil macroinvertebrates. On the contrary, sweet potato and sengon’s residue on this system supplied a lot of food for soil macroinvertebrates and nutrient to ensure the vegetation growth. All of this service factors created suitable environment for soil macroinvertebrates (Sugiyarto et al., 2007).

Table 1. Soil macroinvertebrates diversity index in sengon-based agroforestry system with and without mulching application treatments.

Treatment Soil macro-invertebrates

diversity index

Dominate soil macroinvertebrates

Without mulch 0.149 (Surface) Odontomachus sp. 0.124 (Deep) Ponthoscolex corenthrurus With mulch 0.215 (Surface) Lobopelta ocellifera 0.214 (Deep) Ponthoscolex corenthrurus

By mulching technology, diversity index of deep

soil macroinvertebrates enhanced more dramatically than surface soil macroinvertebrates (Table 1). These indicated that mulch give long-term beneficial to amelioration of soil environment by food-web regulation. Like the previous discussion that deep soil macroinvertebrates are more stable community than surface soil macroinvertebrate. Beside creating a suitable physic-chemical environment, mulching increased surface soil macroinvertebrate potentially as food source for various deep soil predators. So directly, the increasing of surface soil macroinvertebrates population and diversity enhance diversity of deep soil macroinvertebrate. Sugiyarto (2004) concluded that there was positive intercorrelation between surface-and deep soil macroinvertebrate diversity index.

Earthworm (Ponthoscolex corenthrurus) as a soil fertility indicator dominated to deep soil macroinvertebrate community, both with and without mulching application. This species is a decomposer as well as soil engineer. On other hand, there was a difference dominancy of surface soil macroinvertebrate in mulch treatment (Lobopelta ocellifera) and no mulch treatment (Odonthomachus sp.) (Table 1). Odonthomachus sp. is a phytophage species potentially as pest, but L. ocellifera is a predator species potentially as biocontrol agent. These gave evidence that mulching can support to the diverse of beneficial soil macroinvertebrates. Brown et al. (2001) mentioned two main types of classification of soil macrofauna according their function in the soil and crop system, i.e: beneficial group (sapro-, copro-, and necrophages as decomposers or mineralizer; geophages as bioturbators and predators as biocontrol agents) and adverse group (phytophages as parasites or pests). Availability of crop residues as mulch, in other hand, may be able to be alternative food source for some phytophages so it can reduce the intensity of pest herbivory activity.

CONCLUSIONS

Enhancing soil macroinvertebrate diversity on sengon-based agroforestry system can be optimalized by returning of intercrop residue in

SUGIYARTO – Diversity of soil macroinvertebrates in sengon stand

133

mulching technology. Application of maize residue as mulch enhanced diversity index of surface-and deep soil macroinvertebrate, i.e: from 0.149 and 0.124 to 0.215 and 0.214 (by 44% and 73% respectively compared no mulching). Organic mulching technology can support to the diverse of beneficial soil macroinvertebrates.

REFFERENCE

Adianto. 1993. Biologi Pertanian Pupuk Kandang, Pupuk Organik dan insektisida. Bandung: Penerbit Alumni.

Black, H.I.J. and M.J.N. Okwakol, 1997. Agricultural intensification, soil biodiversity and agroecosystem function in the tropics: the role of termites. Applied Soil Ecology 6: 37-54.

Borror, D.J., C.A. Triplehorn, and N.F. Johnson, 1992. Pengenalan Pelajaran Serangga. Penerjemah: Soetiyono, P. dan D.B. Mukayat. Yogyakarta: Universitas Gadjah Mada Press.

Brown, G.G., Pasini, A., Benito, N.P., de Aquino, A.M. and M.E.F. Correia. 2001. Diversity and functional role of soil macrofauna communities in Brazilian no-tillage agroecosystems: a preliminary analysis. International Symposium on Managing Biodiversity in Agricultural Ecosyatems. Montreal, 8-10 November 2001.

Burges, A., and F. Raw. 1967. Soil Biology. London: Academic Press.

Collins, N.M. 1980. The distribution of soil macrofauna on the west ridge of Gunnung (mount) Mulu, Sarawak. Ecologia 44: 275-283.

Crossley, Jr. D.A., B.R. Mueller, and J.C. Perdue. 1992. Biodiversity of microarthopds in agricultural soil: relations to processes. Agriculture, Ecosystems & Environment 40: 37-46.

Edgerton, M.D. 2009. Increasing crop productivity to meet global needs for feed, food, and fuel. Plant Physiology 149: 7-13.

Foth. H.D. 1994. Dasar-dasar Ilmu Tanah. Penerjemah: Soemarto, S.A. Jakarta: Penerbit Erlangga.

Gorny, M. and G. Leszek. 1993. Methods in Soil Zoology. Warsaw: Polish Scientific Publishers.

Hagvar, S. 1998. The relevance of the Rio Convention on Biodiversity to conserving the biodiversity of soil. Applied Soil Ecology 9: 40-45.

Kumar, B.M. 2008. Agroforestry: the new old paradigm for Asian food security. Journal of Tropical Agriculture 44 (1-2): 1-14.

Lal, R. 1987.Typical Ecology and Physical Haplology. John Wiley & Sons, New York.

Lavelle, P. and B. Pashanasi. 1989. Soil macrofauna and land management in. Peruvian Amazonia (Yurimaguas, Loreto). Pedobiologia, 33:283-291

Lavelle, P., D. Bignell, M. Lepage, V. Wolters, P. Roger, P. Ineson, S. Dhillion. 1997. Soil function in a changing world: the role of invertebrate ecosystem engineers. European Journal of Soil Biology. 33: 159-193.

Lavelle, P., M. Dangerfield, C. fargoso, V. Eschenbremer, D. Lopez-haernandes, B. Pashanashi, and L. Brussard. 1994. The relationship between soil macrofauna and tropical soil fertility. In: Woomer, P.L., and N. Swift (eds.). The Biological Management of Tropical Soil Fertility. Chichester: John Wiley and Sons.

Maftu’ah, E., E. Arisoesiloningsih, dan E. Handayanto. 2002. Studi potensi diversitas makrofauna sebagai bioindikator kualitas tanah pada beberapa penggunaan lahan. Biosain 2 (2): 34-47.

Okwakol, J.M.N. 1994. The effect of change in land use on macro fauna communities in Mabira Forest, Uganda. African Journal of Ecology 32: 273-282.

Okwakol, M.J.N. 2000. Changes in termite (Isoptera) communities due to the clearance and cultivation of tropical forest in Uganda. African Journal of Ecology 38: 1-7.

Sari, S.G., E.A. Soesiloningsih, dan A.S. Leksono. 2003. Peningkatan diversitas fauna tanah kritis berkapur di lahan jagung melalui sistem tumpangsari DAS Brantas Kabupaten Malang. Dalam: Agustina, L., D.A. Syekhfani, U. Sunarto, Setyobudi, H. Tarno, dan M. Muhtar (ed.). Memasyarakatkan Pertanian Organik sebagai Jembatan Menuju Pembangunan Pertanian Berkelanjutan. Prosiding Lokakarya Nasional Pertanian Organik. Malang: Penerbit Fakultas Pertanian, Universitas Brawijaya.

Sugiyarto, D. Wijaya, dan S.Y. Rahayu. 2002 Biodiversitas Hewan Permukaan Tanah pada Berbagai Tegakan Hutan di Sekitar Goa Jepang, BKPH Nglerak, Lawu Utara, Kabupaten Karanganyar. Biodiversitas 3 (1): 196-200.

Sugiyarto, M. Effendi, E. Mahajoeno, Y. Sugito, E. Handayanto, dan L. Agustina. 2007. Preferensi berbagain jenis makrofauna tanah terhadap sisa bahan organik tanaman pada intensitas cahnaya berbeda. Biodiversitas 8 (2): 96-100.

Sugiyarto, Pujo M, dan Nursihmiati. 2001. Hubungan Keanekaragaman Mesofauna Tanah dengan Vegetasi Bawah pada Berbagai Tegakan Hutan Jobolarangan. Biodiversitas 2 (2): 140-145

Sugiyarto. 2000. Keanekaragaman Makrofauna Tanah pada Berbagai Umur Tegakan Sengon di RPH Jatirejo, Kabupaten Kediri. Biodiversitas 1 (2): 47-54.

Sugiyarto. 2004. Keanekaragaman Makroinvertebrata Tanah dan Produktivitas Tanah dan Produktivitas Tanaman Sela pada Sistem Agroforestri berbasis Sengon. [Disertasi]. Malang: Program Pasacasarjana UNIBRAW.

Suin, N.M. 1997. Ekologi Hewan Tanah. Cetakan Pertama. Jakarta: Penerbit Bumi Aksara.

Wallwork, J.B. 1970. Ecology of Soil Animals. London: Mc Graw-Hill.

Watanabe, H., S. Ruaysongnern, and H. Taheda. 1983. Soil animal. In: Kyuma, K. and C. Pairntra (eds.). Shifting Cultivation. Bangkok: Ministry of Science, Technology and Energy, Thailand.

Zake, J.Y.K., C. Nkwiine, S. Sesanga, J. Tumuhairwe, M. Okwakol, and D. Bwamiki. 1994. Soil management for sustainable banana production on a ferroalloy in Uganda. In: Adipala, E., M.A. Bekunda, J.S. Tenywa, M.W. Ogenga-Latigo, and J. O. Mugali. (eds.). Proceedings of African Crop Science Conference. Kampala, Uganda: African Crop Science Society.


♥ Corresponding address: PO BOX 153, Manokwari Tel. +62-986-212156, Fax. +62-986-211455. e-mail: [email protected]

Grazing Habitat of the Rusa Deer (Cervus timorensis) in the Upland Kebar, Manokwari

FREDDY PATTISELANNO1,♥, AGUSTINA YOHANA SETYARINI AROBAYA2 1Animal Production Laboratory, Animal Science, Fishery & Marine Sciences (FPPK), State University of Papua (UNIPA), Manokwari 98314

2Biodiversity Research Center (PPKH), State University of Papua (UNIPA), Manokwari 98314

Received: 8th April 2009. Accepted: 12th May 2009.

ABSTRACT

The general objective of the study was to provide current information on grassland communities as deer habitat and its future development plan for a sustainable forage management in upland Kebar, Papua. Quantitative estimation of forage production was carried out by measuring biomass harvest in fresh weight bases, while occasional observations on ranging deer were done within habitat range with the aid of 7x50 binoculars verified by actual visitation of grazed area. The study indicated that Kebar was the only grazing area of deer varies in low layer vegetation composition that comprised of eleven grass species and five legume species. Imperata cylindrica, Paspalum conjugatum, Themeda arguens, Melinis minutiflora and Cyperus rotundus were identified as food plant of deer in Kebar. Among these species T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred species consumed by deer. The biomass harvest (species productivity) was 30.36 kg/ha fresh weight, while deer food productivity in the grassland was slightly lower (26.70 kg/ha) than total productivity of the grassland. The major drainage area is Kasi River, but two other rivers across this valley (Api River, Apriri River) are also supply water to the swampy area.


Key words: grazing, habitat, Rusa, Kebar, Manokwari.

INTRODUCTION

Grasslands are mostly found in arid and semi-arid zones where rainfall is sparse and unpredictable, or in humid zones where topography is steep or temperatures are low. Their existence is also determined by cultural factors, distance to markets or the presence of low fertility or stony soils, salinity or seasonal flooding (Harris, 2000). Grassland Conservation Group (2004) indicates that the grassland biome covers about one quarter of the Earth’s land surface. Unique from most other biomes, grasslands are relatively simple in structure but rich in number of species. However, most areas of the prairie have experienced serious declines in biodiversity.

In Indonesia, large areas of grassland are found in Sumatra, Kalimantan, Sulawesi, Nusa Tenggara, and Irian Jaya (Ivory and Siregar, 1984). The pasture consists of many grasses and legumes, with the commonest genera being Imperata, Paspalum, Chloris, Eleusine, Themeda, Tetrapogon, Polytrias, and Desmodium. During dry season, the land is

almost bare because of overgrazing and uncontrolled burning. In fact, grassland areas were identified as one of several factors that significantly contributed to attract the presence of deer as an important animal protein source and income generating in the rural areas in Papua (Pattiselanno, 2003).

With the development of the Papua Province, more remote areas are being opened and most forestlands are competing with other intensified land use purposes (logging concessionaires, mining, agriculture development, new infrastructure improvement and transmigration), these also influence the grasslands including in the upland Kebar in Manokwari, Papua. In other side, climatic conditions also pressure on grazing land in some areas. As a consequence, the sustainability of use of much grassland is being questioned. Facts show grassland was utilized as places for deer hunting by local communities in the remote areas in Papua (Pattiselanno, 2004).

In order to prepare suitable information on sustainable management of grassland community, assessment is required to record current condition of grassland in the upland Kebar, Manokwari, Papua. The general objective of the study was to provide current information on grassland communities as deer habitat and its future development plan for a sustainable forage management in upland Kebar,

PATTISELANO & AROBAYA – Grazing habitat of Cervus timorensis

135

Papua. Specifically, the study aimed to analyze the potency of grassland area as deer grazing habitat in upland Kebar, West Papua.


Time and place The study was conducted in the upland areas of

Kebar district, during the dry season from August to October 2003. Upland Kebar is known to be a natural grassland area in Manokwari where a large concentration of deer species could be found. The settlement area is situated about 500-1000 m above sea level. At 1000-2000 m above sea level are forested areas. The central part of Kebar district, where the center of local government office, school, health center, and settlement areas are located, occupies about 510 hectares. The topography varies from plain to mountainous areas, which are predominantly Imperata cylindrica areas.

Botanical composition analysis Quantitative estimation of forage production was

carried out by measuring a biomass harvest in fresh weight bases assisted by 100x100 cm2 as the sampling frame and laid every 2m interval along the transect line within the plots. The presence of all vascular species in each sampling frame was recorded and collected by clipping to the ground about 6-7 cm in height, and separated to plant species then weighed.

In the present observation, 565 times quadrate (sampling frame) was investigated in the 375 ha of the study site. Abundance of a species was calculated as the percentage of the quadrates in which the species is present or to be determined as a proportion (percentage frequency) of each plot (Kirby et al., 1997; Hopkins et al., 1999; Conventry et al., 2000).

Occasional observations on ranging deer were done within habitat range with the aid of 7x50 binoculars. Grazed-over and browsed-over plants were verified by actual visitation of grazed area. This permits the identification of practically everything that was eaten, including items that might not have been noticed from distant observations of the vegetation. Identification of vegetation species eaten by deer was done in the grassland because it is the only grazing area in upland Kebar. Herbarium specimens were collected. Descriptions were accomplished in the field for further investigation in the Manokwariense Herbarium, Biodiversity Research Center, The State University of Papua (UNIPA) in Manokwari.

Deer was reported to seek refuge for shelter during the day especially in the dry season. The cover plants utilized for shelter by the deer were monitored, and identified as well. This was done through the presence of hoof marks of deer and other species (wild pig) that might be present in the study site.

Deer habitat characterization Field work was commenced with a comprehensive

reconnaissance of the 510 hectares pasture area with the aid of 7x50 binoculars and a district situation map. Likewise, identification of habitat range and water source distribution was conducted by taking into consideration the distribution of trails and hoof marks, browsed-over and grazed-over plants or feeding areas, bedding, hiding or resting places, mating and playing areas, fecal droppings and deer physical presence. Distribution of all existing water sources (rivers, creeks, springs and lakes) within the identified deer habitat range were documented.

Interviews were conducted among the hunters and local people around the study sites to validate field findings with theirs experiences. All observations and notes from the interviews were recorded. Data on major environmental variables (temperature, humidity and rainfall) were gathered from the meteorology station closest to the study site. Soil characteristics were obtained from previous researches conducted at the same sites.

RESULTS AND DISCUSSIONS

Description of the study site Upland Kebar (Kebar Valley) is a long east-

trending pleistocene/holocene intermontane basin, which is enclosed by fault-bounded mountains up to 2000m high, and 2,703 km2 wide. Geographically, it is located at 500-600m above sea level (132o 35’-134o45’E and 0o15’-3o25’S) or about 150km southwest from Manokwari City. The valley floor is leveled or gently tilted (up to three degrees) and is interrupted by narrow east-trending ridges.

Along its margins are several small alluvial cones, and terrace remnants of high level lake or alluvial deposits rest along the north side of the valley. At the eastern end of the valley, the quaternary basin sediments are cut by the Kasi River and exposed in terraces up to 30 m high. Approximately, Kebar valley covers a total area of 21,841 ha, while the natural pasture comprises 5,391 ha.

Generally, the topography of deer habitat in Kebar is the area with degree of elevation between 0 to 3% and 3% to less than 30%. In the study site, the movement of deer was mostly found close to the flat territory encompassing the grassland and forest site. However, it is common to find deer across the grassland and looking for shelter in the hilly forest block. The hilly grassland territory can be described as the pathway of water from top to the flat areas through the gullies.

Encompassing “The Vogelkop Mountain Rainforest Ecoregion,” Kebar valley has a wet, tropical climate and is subject to seasonal influence of northwest monsoon from November to March and the southeast tradewinds from June to September. Limited meteorological observations indicate a


136

relatively dry season along the north coast when winds are blowing from the southeast.

Rainfall is higher probably up to 3,500 mm per year. Temperatures are uniformly high in the lowlands, which range from about 23oC to 30oC, decreasing with elevation to a mean daily temperature of about 16oC and 2000 m. Relative humidity is also uniformly high, ranging from 80 to 100 percent. Morning cloud or ground fog may hamper aircraft operations in intermontane valleys like Kebar during dry season.

The physical characteristic of soil in Kebar is described as sandy in texture with little coherence structure in Central Kebar. Meanwhile, sandy clay loam in coherent plastic bolus structure is found in Eastern Kebar (Imbiri et al., 1998). Soil pH is about 4.6 (more acidic) to 5.6 (acidic).

Characteristics of deer habitat Botanical composition

Primary forest includes large trees such as Intsia bijuga, with canopy dominated by epiphyte. Almost all the ground were covered by shrubs, ferns and mosses.

Secondary forest was mostly dominated by small diameter trees like matoa (Pometia pinnata), binuang (Octomeles sumatrana), damar (Araucaria, sp.) planted during the Dutch colonization era. Other trees found are: kayu merah (Homalium foetidum), pulai (Alstonia spp.), sukun (Arthocarpus communis), rattan (Calamus spp and Korthalsia sp.), pandan (Pandanus sp.), bamboo (Bambosa sp), kayu raja (Endospermum molucanum), pala hutan (Myristica, spp), sirih hutan (Piper aduncum), sagu (Metroxylon sp.), enau (Arenga pinnata), lansat (Lansium domesticum), kedondong hutan (Spondias dulcis), genemo (Gnetum gnemon), and linggua (Pterocarpus indicus). Certain epiphytes and ferns are also well distributed in the area.

Swampy area includes forest, dominated by Sago (Metroxylon sago) and other aquatic plants. This area is also important as habitat for fresh water fishes, which are utilized by the local people as animal protein sources for the family.

Natural pasture known as grazing areas, in particular location dominated by Imperata cylindrica, and it was easily burned during the dry season. Several studies conducted in this area identified some potential forages that grow and distribute fairly within the valley such as: Melinis minutiflora, Cynodon dactylon, Cyperus rotundus, Themeda arguens, Pennisetum purpureum, Phragmites karka, Tridax procumbens, Panicum maximum, Indigofera hirsuta, Leersia hexandra, Cenchrus ciliaris, Setaria geniculata, Paspalum conjugatum, Digitaria ciliaris, and Paspalum orbicularie. There are leguminous plants found in the pasture such as Crotalaria juncea, Centrosema plumeria, Leucaena leucocephala, and Desmodium sp.

Result of analysis revealed that most of the species were the low layer vegetation found in five sampling plots in 375 ha grassland areas. Eleven grass species and five legume species were identified during the observation in the grassland areas in Kebar (Table 1).

Table 1. Low layer vegetation species found in the upland Kebar grassland.

Occurrence Species A B C D E Grass Imperata cylindrica* + + + + + Paspalum conjugatum* + + + + + Eragrostis brownii - - + + + Themeda arguens* + + + + + Melinis minutiflora* + + + + + Setaria geniculata + + - + + Cenchrus ciliaris + + - + + Leersia hexandra + + + - + Cyperus rotundus* + + - + - Indigofera trifoliata - + + + + Tridax procumbens + - - - - Legumes Biophytum petersianum + + + + + Crotalaria juncea + + + - + Centrosema plumieri + + - + + Desmodium sp + + - - + Mimosa pudica + + + + + Note: (*) Observed species consumed by the deer; + Present in the area; - Absent in the area.

Potential forage for deer Identification of low layer vegetation species eaten

by deer was undertaken to identify potential source of food. In this study, identification was carried out in the grassland dominated by I. cylindrica since it is the only grazing area for deer in Kebar. During the observation, evidences by tracing trails and hoof marks, browsed-over and graze-over plants or feeding areas were established.

Among the eleven species of low layer vegetation found in the grassland of Kebar, five were found to be eaten by deer. These include I. cylindrica, P. conjugatum, T. arguens, M. minutiflora, and C. rotundus. It was observed that T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred feeds of deer. Some previous species recognized in Kebar such as I. cylindrica, Penisetum purpureum, M. minutiflora and Penisetum purpureophoides were also preferred by deer kept in backyard model in Manokwari (Pattiselanno et al., 2008).

Wirdateti et al. (2005) noted approximately 40 species, and mostly from Euphorbiceae, Leguminoceae, Fabaceae, Poaceae and Convolvulaceae were consumed by Cervus timorensis in captivity area in PT Kuala Tembaga, in Bitung, North Sulawesi. Similarly, Garsetiasih (2005) cited that certain forages have been eaten by deer in captivity for example: Setaria sp., Brachiaria decumbens, Andropogon

PATTISELANO & AROBAYA – Grazing habitat of Cervus timorensis

137

contortus, Eragrostis bahiensis, Scleria lithosperma and Andropogon fastigiatus. Therefore, P. purpureopoides was fed to the deer in the captive breeding at Taman Safari, Cisarua, Bogor (Wirdateti et al., 1997). Different species consumed by deer in different habitat showed that food was not limited factor to breed deer under captivity condition (Semiadi, 1986; Subekti, 1995).

Kencana (2000) explained that T. arguens, C. rotundus and I. cylindrica are the food plants of deer in the Rumberpon Island. In Wasur Merauke, potential forages identified as food plants for deer were Setaria sp., Panicum maximum, P. purpureum, Setaria spachelata, Brachiaria decumbens and Melinis minutiflora (Environment Study Center of Papua University, 2000). Sutrisno (1993) indicated that among the eleven species eaten by Javan Deer in Menipo Island, the most preferred were Microlaena stipoides, Danthonia pilosa, I. cylindrica, and Paspalum scrobiculatum. In Kebar, the bedding site is dominated by I. cylindrica approximately 75-100 cm tall. While the bedding site in Wasur, Merauke is dominated by Acacia species (Pattiselanno, 2002). In Rumberpon Island, the main species are Gleichenia linearis and Dacridium sp (Murwanto et al., 2000).

Biomass harvest Results of clipping of grassland vegetation showed

that the total biomass harvest averaged 30.36 kg/ha fresh weight, with the highest account is by I. cylindrica (16.92 kg/ha) followed by P. conjugatum (6.73 kg/ha) fresh weight. Biomass harvest in this study is also considered as species productivity expressed in kg/ha fresh weight.

Four species considered to be the most dominant in the study site were I. cylindrica (55.74%), P. conjugatum (22.18%), E. brownii (9.37%), and T. arguens (8.94%). Others were found in fairly low percentages. As cited by Imbiri et al. (1998) five dominant species in the natural pasture in Kebar were I. cylindrica, P. conjugatum, M. minutiflora, C. rotundus, and T. procumbens.

Water sources availability The major drainage area is the Kasi River.

However, there are two other rivers across this valley (Api River, Apriri River) that also supply water to the swampy area. During the rainy season, deer were mostly concentrated in the forest belt (as shelter) during daytime (from 0800 to about 1600 h), to utilize the water flowing from the stream inside the area. However, since the study was conducted in a dry season, flocks expanded their movement closer to water source (swampy areas, and rivers) to find water. Pellet, trail, and hoof marks were some evidences during the sighting in the grassland and swampy sites.

CONCLUSIONS

Kebar, as the only grazing area of deer varies in low layer vegetation composition that comprised of eleven grass species and five legume species. Imperata cylindrica, Paspalum conjugatum, Themeda arguens, Melinis minutiflora and Cyperus rotundus were identified as food plant of deer in Kebar. Among these species T. arguens, M. minutiflora, C. rotundus and I. cylindrica were the most preferred species consumed by deer. The biomass harvest (species productivity) was 30.36kg/ha fresh weight, while deer food productivity in the grassland was slightly lower (26.70kg/ha) than total productivity of the grassland. The major drainage area is Kasi River, but two other rivers across this valley (Api River, Apriri River) are also supply water to the swampy area.

ACKNOWLEDGEMENT

This article is partly of small grant research granted by the Nagao Natural Environment Foundation, Japan fiscal year 2002 to the first author.

REFERENCE

Conventry, R., B. Jackes, W. Edwards, C. Gardiner, and J. Landsberg. 2000. Structure and Dynamics of Tropical Savannas (Laboratory and Field Manual and Lecture Supplements). James Cook University, Australia.

Environment Study Center University of Papua. 2000. Survey kawasan lindung di Merauke Irian Jaya. Report to the Provincial Plan and Development Institute of Irian Jaya. Manokwari: University of Papua.

Garsetiasih, R. 2005. Small scale deer breeding for rural forest communities. Buletin Konservasi Alam 5 (4): 33-37

Grassland Conservation Group. 2004. Grassland: Lecture Series. Ducks Unlimited E-newsletter March 17, 2004.

Harris, P.S. 2000. Grassland resource assessment for pastoral systems. FAO Plant Production and Protection. Paper 162. Rome: FAO UN.

Hopkins, A., F.F. Pywell, S. Peel, R.H. Johnson, and P.J. Bowling. 1999. Enhancement of botanical diversity of permanent grassland and impact on hay production in Environmentally Sensitive Areas in the UK. Grass and Forage Science 54 (2): 163-173

Imbiri, A.N.N.H., F. Wanggai and R.A. Maturbongs. 1998. An ecological aspect of Biophytum petersianum Klotzhch in Kebar District Manokwari. Beccariana 1 (2): 8-11.

Ivory, D.A. and M.E. Siregar, 1984. Forest research in Indonesia, past and present. Asian Pasture. FFTC Book Series No. 25: 12-29

Kencana, S. 2000. Habitat Rusa Timor (Cervus timorensis) dan kapasitas tampung padangan alam Taman Buru Pulau Rumberpon Manokwari. [Thesis]. Manokwari: Universitas Cenderawasih.

Kirby, D.R., T.P. Hanson and C. Hull. 1997. Diets of Angora Goats leafing spurge Euphorbia ecula infested rangeland. Weed Technology 11: 734-738

Murwanto, A.G., R.A. Maturbongs and F. Pattiselanno. 2000. Estimation of population of the Timor Deer (Cervus timorensis) in Natural Pasture Rumberpon Island. Media Konservasi 7 (1): 17-20

Pattiselanno, F. 2002. The ecological study and estimating Rusa Deer (Cervus timorensis) number in Wasur National Park


138

Merauke, West Papua, Indonesia. [Report]. Tokyo: Nagao Natural Environment Foundation, Japan.

Pattiselanno, F. 2003. Deer (Cervidae: Artiodactyla: Mammalia) wildlife potential with future expectations. Tigerpaper 30 (3): 13-16

Pattiselanno, F. 2004. Berburu Rusa di rimba Papua? Majalah Pertanian Berkelanjutan SALAM (September 2003) 8: 33

Pattiselanno, F., D. Iisir, A. Takege dan D. Seseray. 2008. Kajian awal penangkaran Rusa Timor (Cervus timorensis) system Back Yard di Manokwari, Papua Barat. Biosfera 25 (2): 95-100.

Semiadi, G. 1986. Beberapa tinjauan kemungkinan budidaya rusa. Bulletin Peternakan 10 (1): 11-13

Subekti, D.T. 1995. Mengenal usaha peternakan rusa. Ruminansia 9 (3): 34-35

Sutrisno, E. 1993. Population Ecology of the Javan Deer (Cervus timorensis) in Menipo Island, East Nusa Tenggara, Indonesia. [Thesis] Los Baños: The University of Philippines Los Baños.

Wirdateti, M. Mansur and A. Kundarmasno. 2005. Behavioral study of Timor Deer (Cervus timorensis) in PT Kuala Tembaga, Aertembaga Village, Bitung-North Sulawesi. Animal Production 7 (2): 121-126.

Wirdateti, W.R. Farida and M.S.A Zein. 1997. The daily behavior of Java Deer (Cervus timorensis) in captive breeding at Taman Safari Indonesia. Biota 2 (2): 78-81.


♥ Corresponding address: Jl. Surabaya 6, Malang 65145 Tel. +62-0341-562180, Fax. +62-0341-566936 e-mail: [email protected]

Population Dynamics of Banteng, Buffalo and Deer in Bekol Savannah, Baluran National Park

S U H A D I ♥ Biology Department, Faculty of Mathematics and Natural Sciences, State University of Malang (UM), Malang 65145.

Received: 14th January 2009. Accepted: 17th May 2009.

ABSTRACT

Baluran National Park give contribution at regional development to draw tourist and fascination provided is savannah in area. Savannah circumstance, forest, landscape, climate, vegetation and wild animal is represent experienced attraction. Research method use population dynamics perception of banteng, buffalo and deer in savannah of Bekol year 2004 and year 2005 as primary data, while secondary data year population dynamics 2003, 2004, and year 2005 outside savannah of Bekol, year population dynamics 2003 in savannah of Bekol. Secondary data obtained from daily report of Controller ecosystem Forest Worker animal discovery Baluran National Park from Section Bekol. Research location of outside savannah Bekol were Balanan, Perengan, Bitakol, Karangtekok, Pandean, Pondok jaran, Bama, Curah uling, Gunung Montor, Lempuyang, Bilik, Batangan, Labuhan Merak, Kramat, Semiang, Sirokoh, Lemah bang, Gunung Krasak, and Glengseran. The populations of banteng and buffalo in the savannah were unstable compared to the populations of them outside Bekol savannah. The populations of banteng and buffalo in Bekol savannah decreased, whereas the populations of them outside the Bekol savannah increased. The population of deer in Bekol savannah in 2004 was better than population of 2003, 2005, and 2006, whereas the population of deer outside Bekol savannah in 2006 increase significantly. The populations of banteng, buffalo, and deer decreased from year to year, in which the reductions of banteng and buffalo populations were obviously significant.

© 2009 Biodiversitas, Journals of Biological Diversity

Key words: banteng, buffalo, deer, Bekol savannah, Baluran National Park.

INTRODUCTION

Indonesia is one of countries which has not professionally developed the potentials of wildlife either for the purpose of export, hunting or recreations in the national park. The circumstances are connected to current government policies (Alikodra, 1983). The national park gives a contribution to regional development in order to increase the tourist attendance. Savannah circumstances, forest, landscape, climate, vegetation, and wildlife are natural attractions. An everlasting conception of tourism development is designed to manage tourist, growth, conditions which do not destroy attractions and also to create tourist objects. Visitors and also attractions remain to be taken care by preserving the permanency of the tourist objects and by developing high awareness of the tourists. The savannah is destined to manage totally disappeared endangered, vulnerable animals by protecting natural ecosystem,

grazing or browsing wildlife which represent important target. This matter can be used for research purpose for example wildlife behavior, wildlife interactions, and source of germplasm used livestock breeding. Management of savannah that guaranteed the continuity life of endangered species, and vulnerable animals is one of the bio-diversity conservation (MacKinnon et al., 1988). Biodiversity is an expression of the existence of miscellaneous variations of the forms, presentations, number and characteristics which are clearly seen in the level of social interaction, ecosystem, species, and genetics (Sastrapradja et al., 1989).

Problems in management of savannah are: (i) competitions between animal food plants and non- animal food plants, (ii) invasion of dominant exotic plants, (iii) competitions between crops due to water availability and soil nutrition, (iv) decrease of stamina vitality and movement activity of wildlife, and (v) low productivity of animal food (McIlroy, 1964).

Bekol savannah area is black young alluvial covering between 1500-2000 hectares (Alikodra, 1987). The success of Cervidae family living in a new habitat is due to the plasticity in devouring species of crops supplied in the habitat (Klein, 1985), and so other herbivore do Acacia nilotica Willd ex. Del


140

dominates Bekol savannah (Saraswati, 2002; Djufri, 2004a,b, 2005). The population of A. nilotica in Bekol savannah from 1960 to 2005 continually increases, and brings to a climax in 1990 covering 464,882 hectares. A. nilotica aging more than 5 years decreases the diversity and biomass of herbage (Suhadi, 2008), whereas the trampling of banteng, buffaloes, and deer increases the herb seed bank on the trample (Suhadi, 2003). The trampling by banteng decreases number of crops species around 38,88%, trampling by buffaloes decreases number of crops species around 27,27%, and trampling by deer decreases number of crops species around 18,18% (Suhadi, 2004).

Bekol savannah is habitat of wildlife for example banteng, buffaloes, and deer (Sabarno, 2002). The estimated amount of bantengs population was 16, buffaloes 338, and deers 400 (Santoso, 1984), whereas in Bama area bordering on Bekol savannah the population of bantengs is 72 (Alikodra, 1987). The interaction between bantengs and wild buffaloes in Baluran National Park, East Java impact the dynamic population of banteng (Ashby et al., 1986), therefore in 1985/1986 number of buffaloes which move to other areas is 635 (Report data on the distribution of buffaloes).

The purpose of this research are: (i) to carefully examine the dynamic population bantengs, buffaloes, and deers in the Bekol savannah or outside Bekol savannah, (ii) to carefully examine the population variables within 3 years which can be used to improve the wildlife management in Baluran National Park.

MATERIAL AND METHODS

The research used to calculate population is a concentrated method (Alikodra, 1989). The observation applied is the observation of bantengs, buffaloes, and deers populations in Bekol savannah in 2004 and 2005 as primary data, and the secondary data is the population of 2003, 2004, 2005, and 2006 in the area outside Bekol savannah, and the population of 2003 and 2006 in Bekol Bekol savannah. Locations outside Bekol savannah are Balanan, Perengan, Bitakol, Karangtekok, Pandean, Pondok Jaran, Bama, Curah Uling, Gunung Montor, Lempuyang, Bilik, Batangan, Labuhan Merak, Kramat, Semiang, Sirokoh, Lemahbang, Gunung Krasak and Glengseran (19 points of observation).

To compare the difference species of wildlife, location, and population dynamics of 2003, 2004, 2005 and 2006 used ANOVA and GenStat Release 4.24DE program.

RESULT AND DISCUSSION

The population of wildlife in 2003 The population of bantengs in May and June 2003

is 22, in August 11, and September 17. In January,

February, March, April, July, October, November, and December the population of bantengs in Bekol savannah was not found. The population of banteng in May, June, July, August, and September outside Bekol savannah is 23, 9, 22, 7, and 13 (Table 1). This condition was caused by the decline of rainy days which influence grass growth (Figure 1). According Lekagul et al. (1977) banteng has more characteristic of grazers than browsers and like open space. The appearance of banteng in Bekol savannah was low, namely 33% and the average monthly population was 6, outside the savannah 66% and the average monthly population is 7 (Table 1). Human activities may be done in Bekol savannah. In Bekol savannah is the habitat for wildlife which provides animal food, social communication protects/brings up, raises their children (Alikodra, 1983). Research of Suhadi (1996) indicates that in the location which has more human activities the bull has more guarding activities and less grazing activities, whereas bull has more grazing activities. Similar condition occurs in Bekol savannah which has a roadway going to Bama out savannah, through which the tourist go for a recreation in Baluran.

Population of buffaloes in Bekol savannah during 2003 remains stable, outside Bekol savannah in April and August 3 respectively (Table 1). In Baluran National Park buffaloes are found mostly in water mudholes. In Bekol savannah the mudholes were dry, water mudholes were only found side of Bekol savannah and outside Bekol savannah. The buffaloes like open forest or meadow/grass place (Lekagul et al., 1977). The home range of buffaloes in Australia consist of forest, savannah, muddy area, well, mineral salt (Tulloch, 1978). The population of buffaloes in 1984 reaches 1293 and decreased from year to year and in 1999, 11 were still left. Buffaloes brought illegally to the outside of Baluran National Park from 1980/1981 fiscal year to 1998/1999 fiscal year were 731.

The population of deers in Bekol savannah in May, June, August, and September are 114, 206, 154, and 172 respectively. The population of deer outside Bekol savannah from April to December the highest in April reaches 238 (Table 1). From May to December the group of deer becomes divided equally. The average population from May to December was 66 per month. There was no rain from July to October (Figure 1). The amount of deer in Bekol savannah in August and September are 154 and 172 respectively (Table 1). The population of deer in Bekol savannah in the dry season remains high because most of the animal food was obtained by browsing A. nilotica. Grazing done excessively by wildlife will reduce fire and invasion of wooden crops (Bucher, 2000). The population of deer in Bekol savannah may help distribution of A. nilotica.

LSD 5% test shows that the bantengs and buffaloes populations in the savannah compared to the population outside Bekol savannah indicate no significant difference. Similarly, the population of banteng and deer in the savannah compared to

SUHADI – Banteng in Bekol savannah Baluran NP 141

outside Bekol savannah indicates no significant difference, but the deers, bantengs, and buffaloes shows no significant difference (Table 2 and 3). The interaction between location of banteng and location of buffalo shows no significant difference, whereas the location of deer indicates significant difference. This condition shows that the area of Bekol savannah 420 hectares and the area outside of Bekol 9600 hectares with total number of banteng and buffalo may provide enough room for home range and may have animal food. Interaction location of deer obviously differs because deer have wider home range than home range of banteng and buffalo at the same time.

The population of wildlife in 2004 The population of banteng reaches the peak in

July in the amount of 30, but in October, November, and December no banteng is found (Table 1). The average population of banteng in Bekol savannah 8, the presence frequency was 75% per month, whereas outside Bekol savannah 4 and the presence frequency was 83% per month. In October 2004 no banteng is found either outside Bekol savannah. This October is the peak of dry season (Figure 2). Grass in the savannah mostly dry therefore banteng go into the forest (Lekagul et al., 1977). In 2004 the presence

frequency of bantengs is 75% whereas the presence frequency in 2003 is only 33%. There are three dry months in 2004 namely August, September, and October, whereas in 2003 there are 4 dry months, namely July, August, September, and October (Figure 1A and 1B). The short dry months in 2004 Bekol savannah provides sufficient animal food so the presence frequency of in 2004 is higher than the presence frequency in 2003.

The population of buffalo in Bekol savannah in March, July, August, and September 2004 are 5, 46, 31, and 31. The monthly average population is 10 and presence frequency 33%. The population outside Bekol savannah in March and September in the same year is 1 and 4 respectively (Table 1). The average population of buffalo per month is less than 1 and the presence frequency 16%. The average population of buffalo per month in Bekol savannah is higher than the population outside Bekol savannah. According to Tulloch (1978) buffaloes browsing dry crop leaves. The presence of buffaloes in Bekol savannah is higher the occurrence outside the savannah. If we compare the 2003 and 2004 data the presence of buffaloes increase from 0% to 33%. This condition is caused by the rainfall; in 2004 there are 3 dry months, whereas in 2003 there are 4 dry months, whereas in 2003 there are 4 dry months (Figure 1B).

Table 1. Population of wildlifes in the savannah and outside Bekol savannah, Baluran National Park 2003, 2004, 2005, and 2006.

2003 2004 2005 2006 In the

savannah Outside the savannah

In the savannah

Outside the savannah

In the savannah


In the savannah


Months

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r

Bant

eng

Buf

falo

Dee

r January 0 0 0 0 0 0 7 0 55 4 0 139 14 1 74 2 1 139 0 0 0 3 13 210Pebruary 0 0 0 0 0 0 2 0 36 3 0 62 0 0 0 0 4 57 1 0 0 2 13 158March 0 0 0 0 0 0 5 5 245 5 1 11 1 1 190 1 5 207 0 0 0 3 13 168April 0 0 0 6 3 238 6 0 79 26 0 135 3 2 242 0 2 68 0 0 73 3 13 36 May 22 0 114 23 0 31 3 0 102 0 0 39 0 22 9 2 40 9 0 0 2 3 13 395June 22 0 206 9 0 59 8 0 92 6 0 65 1 0 70 3 0 36 0 0 0 3 13 219July 0 0 0 22 0 43 36 46 112 3 0 161 2 13 50 1 0 56 2 10 0 1 3 311August 11 0 154 7 3 47 17 31 60 1 0 77 3 6 0 0 7 290 1 6 0 2 7 213September 17 0 172 13 0 33 4 18 116 4 4 26 1 0 0 2 13 360 1 6 0 2 7 321October 0 0 0 1 0 74 0 0 0 0 0 29 0 0 0 3 13 397 3 2 0 0 11 217November 0 0 0 4 0 4 0 0 90 1 0 46 3 2 0 0 11 211 3 0 0 0 13 58 December 0 0 0 0 0 62 0 0 0 2 0 65 1 0 0 2 11 211 1 0 0 2 13 68 Table 2. Variance analysis of wildlifes population in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006.

2003 2004 2005 2006 Source of variation d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr. d.f. s.s. m.s. v.r. F. pr.Location 1 18 18 0,01 0,921 1 939 939 0,84 0,363 1 29322 29322 6,87 0,011 1 81272 81272 37,54 <0,001 Species 2 37563 18782 10,45 <0,001 2 82017 41008 36,74 <0,001 2 184646 92323 21,63 <0,001 2 154095 77047 35,59 <0,001 Location_Species 2 117 58 0,03 0,968 2 209 104 0,90 0,911 2 53203 26601 6,23 0,004 2 139445 69723 32,20 <0,001 Replication 11 23276 2116 1,18 11 14924 1357 1,22 11 29039 2640 0,62 11 19191 1745 0,81 Residual 55 98865 1798 55 61387 1116 55 234758 4268 55 119079 2165 Total 71 159840 71 159476 71 530969 71 513082


142

Table 3. Test of LSD 5% of wildlifes population in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006.

2003 2004 2005 2006 Source of variation Average Average Average Average Location Bekol savannah 19,9 a 32,6 a 19,8 b 3,1 b Outside Bekol savannah 18,9 a 25,4 a 60,1 a 70,3 a Species Banteng 6,5 a 6,0 b 1,9 b 1,5 b Buffalo 0,3 a 4,4 b 6,4 b 6,5 b Deer 51,5 b 76,7 a 111,5 a 102,0 a Location_Species Bekol savannah_Banteng 6,0 a 7,3 b 2,4 b 1,0 b Bekol savannah_ Buffalo 0,0 a 8,3 b 3,9 b 2,0 b Bekol savannah_ Deer 53,8 b 82,2 a 52,9 a 6,2 b Outside Bekol savannah_Banteng 7,1 a 4,6 b 1,3 b 2,0 b Outside Bekol savannah_ Buffalo 0,5 a 0,4 b 8,9 b 11,0 b Outside Bekol savannah_ Deer 49,2 b 71,2 a 170,1 a 97,8 a Note: Figure followed by the same character in the column indicated no significant differences on LSD 5% test A B C D Figure 1. Distribution of rainfall in Baluran National Park. A. 2003, B. 2004, C. 2005, D. 2006.

The monthly average population of deer in Bekol savannah in 2004 is 72 and the presence frequency 83%, outside savannah is 71 and the presence frequency 100% (Table 1). The presence of deer outside savannah is higher than in the savannah because of the evenly spread of animal food even skin, leaves, and crown of A. nilotica are browsed by the deer. The exploration of deer in very short time is higher than those of banteng and buffalo, therefore

deer can easily move from one place to another in very short time. In August, September, and October in 2004 there is no rain (Figure 2), and November there are 3 amounts of rain and the amount of rainfall is 67 mm. In December 2004 herbage in Bekol savannah is grown over but does not spread evenly. In October and December 2004 no deer was found because the spread of herbage was uneven and the movement of deer to search for food is high enough. Outside Bekol

Num

ber o

f rai

ny d

ays

0

5

10

15

20

N um ber o f ra iny days

M on ths

Jan. P ebr. M arch A pril M ay June Ju ly A ug. S ept. O ct. N ov . D ec.

Rai

nfal

l (m

m)

0

100

200

300

400

500

600

M onth vs R a in fa ll, m m M onth vs H ighest ra in fa ll, m m

M onths

Jan . Feb r. M arch A pril M e i June Ju ly A ug . S ep. O ct. N ov. D ec.

Num

ber o

f rai

ny d

ays

0

2

4

6

8

10

12

14

16

18

20


Rai

nfal

l (m

m)

0

50

100

150

200

250

300

M on th vs R a in fa ll,m m M on th vs H ighest ra in fa ll,m m

M onths

Jan. Febr. M arch A pril M e i June Ju ly A ug.

Num

ber o

f rai

ny d

ays

0

2

4

6

8

10

12

14


Rai

nfal

l (m

m)

0

20

40

60

80

100

120

140

160

180

200

M onth vs R a in fa ll, m m M onth vs H ighest ra in fa ll, m m

M on ths

Jan. F ebr. M arch A pril M e i June Ju ly A ug . S ep . O ct. N ov . D ec.

Num

ber o

f rai

ny d

ays

0

2

4

6

8

10

12

14


Rai

nfal

l (m

m)

0

50

100

150

200

250

300

M onth vs R a in fa ll, m m M onth vs H ighes t ra in fa ll,m m


savannah the presence frequency of the deer is 100% because herbage can be still be found at the location close by the well.

Based on LSD 5% test of the locations in the savannah and outside Bekol savannah in 2004 indicate no significant difference. The population of deer compared to the population of banteng and buffalo indicates significant difference (Table 1 and 2). The interaction of banteng location and buffalo location shows difference, but interaction of deer location indicates significant difference (Table 3). The condition of 2003 population and 2004 population remain stable.

The population of wildlife in 2005 The population of banteng in Bekol savannah the

highest in January 2005 number in 14 with the monthly average population is 2, whereas outside Bekol savannah is 1 (Table 1). The amount of rainfall from January to June 2005 is 7-274 mm (Figure 1C). The condition indicated that Bekol savannah has sufficient animal food and water availability, but the presence frequency of banteng is only 66,66%. It happen because of human activity disturbance consequently the amount of banteng from year to year degrades. If we make a comparison, the monthly average number of banteng outside Bekol savannah is higher than the number in the savannah. According to Alikodra (1989) the ideal banteng environment composition are, (i) primary forest border on meadow as shelter to protect them from predator attack, a place to sleep and take a stand a place to breed and (ii) coast forest or tidal forest which has a function as a buffer zone, consisting wind shield, to prevent it from salt intrusion and a shelter or place to take a rest, a place to hunt for food and also to avoid banteng hunter entering forest preserve from the sea. The presence frequency of banteng in the savannah and outside Bekol savannah remains low which enable banteng to take shelter in the primary forest or tidal forest.

The highest population of buffalo in Bekol savannah in 2005 is in May amounting to 22 and monthly average population is 4 and the presence frequency is 66.66%. Outside Bekol savannah the highest population is 40, the monthly average population is 8 and presence frequency 16.66% (Table 1). The population of buffalo outside savannah is higher because well can still be found in the savannah. In May rainfall is 9 mm, number of rainy days is 2 and the highest rainfall is 5 mm (Figure 1C). In May number of buffalo in Bekol savannah degrades. It shows that the quantity of water decreases so the buffaloes in the savannah can only be found water stream and mudholes. Outside Bekol savannah a lot of water stream can still be found thus the population of buffaloes in May reaches 40.

The population of deer in Bekol savannah in 2005 the high in April reaches 242, and monthly average population is 52 and the presence frequency is 50%.

The population of deer outside Bekol savannah the highest in October is 397, monthly average population is 86 and presence frequency is 100% (Table 1). The average population of deer per month in Bekol savannah is higher than outside savannah because herbage is sufficient enough for the need of deer and deer activities are not disturbed by human activities. In May the population of deer in the savannah and outside of the savannah is very low because the amount of rainfall is 9 mm, number of rainy days are 2, and the highest rainfall is 5 mm (Figure 1C) lower than the rainfall in another months. Rainfall of 5 mm per month after 14 days increases the growth of herb up to 52%, whereas rainfall of 132 mm per month will increase herb up to 70% (McIvor and Gardener, 1985). In January, February, March 2004 the monthly rainfall is high, but number of deer fluctuates, it is likely that number of deer in the savannah does not depend on the grass supply.

Base on LSD 5% test, the location in the savannah and outside Bekol savannah in 2005 indicated significant difference. The population of banteng and buffalo differ significantly (Table 2). The interaction among location of banteng and location of buffalo and location deer differ significantly (Table 3).

The population of wildlife in 2006 The population of banteng in 2006 in Bekol

savannah the highest in October and November is 3 and monthly average population less than 1, whereas outside of the savannah of Bekol is 2 (Table 1). Number of rainfall from January to June is between 15 and 177 mm (Figure 1D). Such condition indicates that Bekol savannah has sufficient water for the need of herbage. The low presence frequency of bantengs which is only 58.33% is caused by human activities; therefore number of banteng from year to year degrades. If we make a comparison, the monthly average number of banteng in the savannah is lower than the number of banteng outside of Bekol savannah because of the significant difference between the existence of forest and the savannah. The presence frequency of bantengs in the savannah and outside the Bekol savannah is still low because banteng possibly takes a shelter in primary forest and tidal forest. In 2006 number of banteng population is lower than the number of bantengs population in 2005, it is possible that banteng is in a place outside the points of observation.

The highest population of buffalo in Bekol savannah takes place in July amounting to 10 and monthly average population is 2 and the presence frequency is 33,33%.The highest population of buffalo outside Bekol savannah is 13, and the monthly average population is 11 and the presence frequency is 100,00%. The population of buffalo outside the savannah is higher because many wells can still be found there. In May number of rainfall is 15 mm, number of rain days are 3 and the highest rainfall is 8 mm (Figure 1D). In May number of buffalo is high


144

Table 4. LSD test 5% population of wildlifes in the savannah and outside Bekol savannah Baluran National Park 2003, 2004, 2005, and 2006.

Source of variation AverageBekol savannah 18.9 b Location

Outside Bekol savannah 43.7 a Banteng 4.0 b Buffalo 4.4 b

Species

Deer 85.5 a

2003 19.4 b 2004 29.0 ab 2005 39.9 a

Year

2006 36.7 a

Bekol savannah_Banteng 4.2 c Bekol savannah_Buffalo 3.6 c Bekol savannah_Deer 48.8 b Outside the savannah_Banteng 3.7 c Outside the savannah_Buffalo 5.2 c

Location_ Species

Outside the savannah_Deer 122.1 a

Bekol savannah_2003 19.9 bc Bekol savannah_2004 32.6 c Bekol savannah_2005 19.7 bc Bekol savannahl_2006 3.1 b Outside Bekol savannah_2003 18.9 bc Outside Bekol savannah_2004 25.4 c Outside Bekol savannah_2005 60.1 a

Location_ Year

Outside Bekol savannah_2006 70.3 a

Banteng_2003 6.5 c Buffalo_2003 0.3 c Deer_2003 51.5 b Banteng_2004 6.0 c Buffalo_2004 4.4 c Deer_2004 76.8 b Banteng_2005 1.9 c Buffalo_2005 6.4 c Deer_2005 111.5 a Banteng_2006 1.5 c Buffalo_2006 6.5 c

Species_ Year

Deer_2006 102.0 a b

Bekol savannah_Banteng_2003 6.0 cc Bekol savannah_Banteng_2004 7.3 c Bekol savannah_Banteng_2005 2.4 c Bekol savannah_Banteng_2006 1.0 c Bekol savannah_Buffalo_2003 0.0 c Bekol savannah_Buffalo_2004 8.3 c Bekol savannah_Buffalo_2005 3.9 c Bekol savannah_Buffalo_2006 2.0 c Bekol savannah_Deer_2003 53.8 b Bekol savannah_Deer_2004 82.2 b Bekol savannah_Deer_2005 52.9 b Bekol savannah_Deer_2006 6.3 c Outside Bekol savannah_Banteng_ 2003 7.1 c Outside Bekol savannah_Banteng_ 2004 4.6 c Outside Bekol savannah_Banteng_ 2005 1.3 c Outside Bekol savannah_Banteng_ 2006 2.0 c Outside Bekol savannah_Buffalo_ 2003 0.5 c Outside Bekol savannah_Buffalo_ 2004 0.4 c Outside Bekol savannah_Buffalo_ 2005 8.9 c Outside Bekol savannah_Buffalo_ 2006 11.0 c Outside Bekol savannah_Deer_2003 49.2 bc Outside Bekol savannah_Deer_2004 71.2 b Outside Bekol savannah_Deer_2005 170.1 a

Location_ Species_ Year

Outside Bekol savannah_Deer_2006 197.8 a

which indicates that the quantity of water especially in savannah of Bekol degrades therefore buffaloes can only be found in the water stream can still be found therefore the population of buffalo in May reaches 13. From July to August number of buffalo degrades and so buffaloes possibly search for watery areas.

The population of deer in 2006 Bekol savannah the highest in April amounting to 73, monthly average population is 6 and presence frequency is 16,66%. The population of deer outside the savannah of Bekol the highest in May amounting to 395, monthly average population is 197 and the presence frequency is 100% (Table 1). The population outside the savannah per month is higher because animal food is sufficient for the need of deer and also the activities of deer are not disturbed by human activities. From January to December remains stable except in April and May the population number of deer are 73 and 2 respectively because A. nilotica are chop down in the population of deer in Bekol savannah.

Based on LSD 5% test locations in the savannah and outside Bekol savannah in 2006 indicate significant differences (Table2). The population of deer, banteng, and buffalo are significantly different. The interaction among banteng, buffalo, and deer outside Bekol savannah show significant differences (Table 3). This condition is caused by the frequent chop down of A. nilotica in Bekol savannah. Based on LSD 5% test locations in the savannah and outside of the savannah of Bekol 2003, 2004, 2005, and 2006 indicate significant differences. During 4 years the population of wildlife outside Bekol savannah is better than population in the savannah. In 2003, 2004, 2005, and 2006 the population of the banteng and buffalo differ significantly (Table 3 and 4). During 4 years the population of deer is better than the population of banteng and buffalo. The population of deer in Bekol savannah in 2004 is the best population of all 2003, 2005, 2006 population, whereas outside Bekol savannah the 2006 population of deer is the best. During 4 years the populations of banteng and buffalo in Bekol savannah decline, on the contrary the populations of banteng and buffalo outside Bekol savannah increase although LSD 5% test shows no significant differences (Table 4).

CONCLUSION AND SUGGESTION

The populations of banteng and buffalo in the savannah are unstable compared to the populations of them outside Bekol savannah. The populations of banteng and buffalo in Bekol savannah decrease, whereas the populations of them outside the Bekol savannah increase. The population of deer in Bekol savannah in 2004 is better than population of 2003, 2005, and 2006, whereas the population of deer outside Bekol savannah in 2006 increase significantly. The populations of banteng, buffalo, and deer decrease


from year to year, in which the reductions of banteng and buffalo populations are obviously significant. Bekol savannah has not yet attracted the wildlifes to graze. The wildlifes especially banteng are annoyed by human being activities, roadway heading to Bama beach which also cuts Bekol savannah which disturbs the movement of wildlife requires to be studied furthermore, the direction of roadway which cuts the savannah should be changed to the outskirt of savannah. The low frequency of banteng and buffalo in Bekol savannah is due to the fact that the savannah has not fulfilled the criteria for banteng and buffalo to live in for example, human being activities which annoy them, insufficient limited number of herbage for their food and availability of water. Qualitative research should be done to verify the exact number of wildlifes smuggled outside of Baluran National Park because number of wildlifes which are died, missing, and given to the retired government officials are not properly recorded without any officials report.

REFERENCES

Alikodra, H.S. 1983. Ekologi Banteng (Bos javanicus d’Alton) di Taman Nasional Ujung Kulon. [Disertasi]. Bogor: Fakultas Pascasarjana Institut Pertanian Bogor.

Alikodra, H.S. 1987. Tanaman eksotik akasia (Acacia nilotica) dan masalahnya bagi ekosistem savana di Taman Nasional Baluran. Duta Rimba 79-80 (13): 30-34.

Alikodra, H.S. 1989. Pengelolaan Satwaliar. Bogor: Fakultas Kehutanan, Institut Pertanian Bogor.

Ashby, K.R. and C. Santiapillai. 1986. The Ecology of Free Living Water Buffalo (Bubalus bubalis L.) in Sri Lanka and with Particular Reference to Ruhuna National Park. Tigerpaper 10 (11): 20-26.

Bucher, E.H. 2000. Chaco and Caatinga-South American Arid Savannas, Woodlands and Thickets. In: Huntley, B.J. and B.H. Walker (ed). Ecology of Tropical Savannas. Berlin: Springer-Verlag.

Djufri. 2004a. Invasi spesies eksotik akasia berduri (Acacia nilotica) (L.) Willd ex Del. di Taman Nasional Baluran Jawa Timur: ancaman terhadap eksistensi savana. ENVIRO 4 (2): 88-99.

Djufri. 2004b. Acacia nilotica (L.) Willd. ex Del. dan permasalahannya di Taman Nasional Baluran Jawa Timur. Biodiversitas 5 (2): 96-104.

Djufri. 2005. Pola distribusi dan asosiasi tumbuhan bawah pada tegakan akasia (Acacia nilotica) (L.) Willd. ex. Del. di Savana Kramat Taman Nasional Baluran JawaTimur. ENVIRO 5 (1): 48-54.

MacKinnon, J., K. MacKinnon, G. Child, and J. Thorsell (eds). 1988. Managing Protected Areas In the Tropics. Gland, Switzerland: International Union for Conservation of Nature and Natural Resources.

McIlroy, R.J., 1964. An Introduction to Tropical Grassland Husbandry. London: Oxford University Press.

Klein, D.R. 1985. Population ecology the interaction between deer and their food supply in biology of deer production. Bulletin New Zealand 22: 23-32.

Lekagul, B. and J.A. McNeely. 1977. Mammals of Thailand. Bangkok: Sahakarnbhat Co.

McIvor, J.G. and C.J. Gardener. 1985. Germination of introduced pasture species in the semi-arid tropics. In: Tothill, J.C. and J.J. Mott (eds). Ecology and Management of the World’s Savannas. Canberra: The Australian Academy of Science.

Sabarno. 2002. Savana Taman Nasional Baluran. Biodiversitas 3 (1): 207-212.

Santoso, N. 1984. Studi Populasi Banteng dan Kerbau Air di Padang Penggembalaan Bekol Taman Nasional Baluran. [Skripsi]. Bogor: Fakultas Kehutanan Institut Pertanian Bogor.

Saraswati, A. 2002. Daya dukung Savana Bekol terhadap keberadaan rusa timor (Cervus timorensis). Prosiding Seminar Nasional Taman Nasional Baluran I. Jember, 11 Agustus 2002.

Sastrapradja, D.S., S. Adisoemarto, K. Kartawinata, S. Sastrapradja, dan M.A. Rifai. 1989. Keanekaragaman Hayati untuk Kelangsungan Hidup Bangsa. Bogor: Puslitbang Bioteknologi LIPI

Suhadi. 1996. Perilaku Banteng (Bos javanicus d'Alton) di Padang Penggembalaan Sadengan Taman Nasional Alas Purwo. [Tesis]. Jakarta: Program Pascasarjana Universitas Indonesia.

Suhadi. 2003. Seeds bank dispersal on trampled by banteng (Bos javanicus d’Alton), water buffalo (Bubalus bubalis), large deer (Cervus timorensis) in the Baluran National Park. AGRITEK 11 (3): 469-476.

Suhadi. 2004. Sebaran tumbuhan bawah bekas injakan banteng (Bos javanicus d’Alton), kerbau liar (Bubalus bubalis), dan rusa (Cervus timorensis) di Taman Nasional Baluran. Biota 9 (2): 78-83.

Suhadi. 2008. Kajian Invasi Acacia nilotica Willd ex. Del dan Injakan Satwa terhadap Diversitas dan Biomassa Herba di Savana Bekol Taman Nasional Baluran. [Disertasi]. Malang: Program Pascasarjana Fakultas Pertanian Universitas Brawijaya.

Suhadi. 2008. Perkembangan tumbuhan Acacia nilotica Willd ex. Del di Savana Bekol Taman Nasional Baluran. Prosiding Lokakarya Nasional Herbarium Seminar dan Konggres PTTI Ke VIII. Cibinong-Bogor, 21-23 Oktober 2008.

Tulloch, D.G. 1978. The Water Buffalo (Bubalus bubalis) in Australia; Grouping and Home Range. Melbourne: Australian Wildlife Research.


♥ Corresponding address: Jl.Raya Jakarta-Bogor Km 46, Cibinong-Bogor 16911 Tel. & Fax.: +62-21-8765066, +62-21-8765062 e-mail: [email protected]

Ethnobotanical study on the Genus Pandanus L. f. in certain areas in Java, Indonesia

WARDAH♥, FRANCISCA MURTI SETYOWATI "Herbarium Bogoriense", Botany Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911

Received: 23rd February 2009. Accepted: 4th May 2009.

ABSTRACT

There were two species of Pandanus recorded in Java, Pandanus amaryllifolius Roxb. and Pandanus tectorius Sol. The leaf of P.tectorius is commonly harvested as source of handicraft materials, while P. amaryllifolius is for culinary aromatic purposes only. The pandan kunyit (P. tectorius Sol.) in Bangkalan and pandan jeksi (P. tectorius Sol. var. samak Werb.) in Kebumen (Central Java) are the best resource for plaiting industry. Prospect of Pandanus plaiting can rise the income of farmers in the village and rise foreign exchange depend on how to fulfill the best pandan and its processing. It is hoped the good relation between farmers and government to sustain and develop the pandan production.


Key words: ethnobotany, Pandanus, uses, Java.

INTRODUCTION

Pandanaceae is plants family which geographically distributed from seaside to high mountains. Pandanaceae consists of 3 genera, namely Sararanga Hemsl. (2 spp.), Freycinetia Gaidich. (175 spp.), and Pandanus Parkinson (600 spp.) (Stone 1976). Distribution area of genus Freycinetia spp. are Java, Sumatra, Maluku; Pandanus spp. in Java, Sumatra, Bali, Sulawesi, Kalimantan, Little Sunda Islands, Maluku, and Papua, whereas Sararanga spp. currently was found in eastern Indonesia (Sulawesi). The diversity of Pandanaceae gave inspiration to inventory use and its potential for Indonesian people.

Backer and Bakhuizen van den Brink Jr. (1968) stated that there are 15 types of Pandanus in Java, namely P. andamanensium (southern coast of W. and on Nusakambangan), P. labyrinthicus (W. coas of Sumatra; migh also occur in Java), P. faviger (Lamongan and Bali), P. pygmaeus, P. amaryllfolius, P. vandermeeschii, P. utilis, P. boninensis, P.kurzii Merr., P. tectorius Soland ex Park, P. polycephalus Lamk, P. furcatus Roxb., P. bidur Jungh ex Miq, P. nitidus Kurz, and P. Hasskarlii. Based on herbarium specimen belongs to Herbarium Bogoriense (BO), LIPI there are 11 types of Pandanus.

Pandanus is valuable in either its benefit or

ecology Pandanus is useful for ritual, ornamental plants, fragrance, and as industrial material, such as bag, rope, hat, plaited, mat, house and building roofs. From ecology aspect, Pandanus can be used as restraining material for wind, sand erosion and tsunami wave, especially in coastal areas with mangrove. Besides wild and cultivated Pandanus species correlated with development of community culture currently, the shifting is occurred because of using other products, such as plastic, coconut husks, “mendong” and iron. Some references stated that Pandanaceae has various uses such as foodstuffs, traditional medicine, building material or roof, fiber material, local technology and other uses (Powell, 1976a, 1976b; Stone, 1982, 1983, 1984; Rose, 1982; Silltoe, 1983, Hyndman, 1984; French, 1986; Haberle, 1991a, 1991b; Miliken, 1994; Leigh, 2002; Walter and Sam, 2002).

In Java, handicrafts made from Pandanus are found in East Java (Madura, Lamongan) and Central Java (Karanganyar district, Kebumen). Pandan handicrafts came from Banten (Bojong Manik district, Rangkasbitung) are sold as local product markets at West Java and surrounding areas. Pandanus in East Java (Madura, Lamongan) and Central Java (Karanganyar district, Kebumen) has good prospect, but the quality should be improved, so the pandan handicrafts communities can fulfill demand at foreign market. Pandan handicrafts were exported to several countries, such as plaited mat from East Java (Lamongan) were exported to China, whereas from Central Java (Karanganyar district, Kebumen) were exported to Canada, China, German, France, and Japan. Pandan handicrafts from Banten (Bojong

WARDAH & SETYOWATI – The use of Pandanus in Java

147

Manik district, Rangkasbitung) were sold for local products at West Java and its surroundings. The pandan handicrafts has good prospects in increasing devisa (foreign exchange), so collaboration of communities and government are needed to preserve and develop pandan products.

The objective of this research was to discover and describe the potential of Pandanaceae as foodstuff, local technology material, traditional medicines, ornamental plants, building materials (roofs), socio-cultural roles (tradition ritual and other social values), etc. Socioeconomic roles of Pandanaceae for communities life was also analyzed, i.e. domestication aspects (evolution of extractivisme activities to cultivation to development), post harvest technology, art and crafts techniques (indigenous technology) of Pandanaceae, its management and preservation.


Area study. Data collecting were conducted at several villages in East Java, Central Java and Banten as follows: (i) Galis Dajah village, Konang district, Bangkalan, East Java, (ii) Durjan village, Kokop district, Bangkalan, East Java, (iii) Aeng Tabar village, Tanjung Bumi district, Bangkalan, East Java, (iv) Saplasan village, Sepulu district, Bangkalan, East Java, (v) Sumber Dadi village, Mantup district, Lamongan, East java, (vi) Grenggeng village, Karanganyar district, Kebumen, Central Java, (vii) Kalirejo village, Kebumen district, Kebumen, Central Java, (viii) Kebon Cau village, Bojong Manik district, Rangkasbitung, Banten.

Procedures. The research used method which commonly used in anthropology, ecology, physiology, phytochemistry, socio-economy and ethnobiology research. Direct participation in communities life was essential method to obtain information. Information was obtained by open-ended interviewing, free, direct observation at communities and arranging questionnaire. Interview was carried out with customary head, traditional healers, craftsmen, labor, and communities having knowledge on Pandanaceae. Information were also obtained from direct observation at communities location, sample collection (plants and artefak), literature and its analyses.


Use of pandan Although pandan has long been used by

communities in Java for various uses from plaiting mat to medication, and there are previous report on pandan ethnobotany in Java, completed scientific record which specifically assess pandan use at industry scale at Java was reported by Hofstede

(1925), where Tangerang (Banten Province now) is considered as one of pandan industry center at Java. The pandan type which most used as raw material for handicrafts industry is Pandanus tectorius (Keim et al., 2006). The products of pandan industry in Java Islands itself were marketed to throughout Indonesia (at that time Netherlands East Indies), even to foreign countries; such as several countries in Europe (Netherlands, France, Italy), Egypt, USA, Canada, Australia, Singapore and with export volume reached 4,8 million pandan hat of 1.049.000 guilder in production year of 1920 which considered as huge export value at that time. However, since Indonesia Independence, export volume of pandan industry was continuously decreasing and at that time pandan industry was dominated by Philippines, which has long been major competitor in Indonesia pandan industry (Hofstede, 1925). After Hofstede until present, study on pandan industry in Java, such as at Banten, Central Java particularly Kebumen, and East Java has not much been done, and also information of current pandan ethnobotany.

Observation of Pandanaceae in East Java, especially Bangkalan regency, was carried out at 4 villages of 4 districts. The communities used pandan as plaiting material. Survey result showed that the best quality of plaiting product was handicrafts made by communities of Galis Dajah village, Konang district. Pandan handicrafts produced by communities from Sumber Dadi village, Mantup district, Lamongan regency have various types, such as plaited mat, slipper, trash box, tissue box, hat, shopping bag, party bag, laundry box, jewelry box, wallet, etc. Thus pandan plaiting crafts from Kalirejo village and Grenggeng village, Kebumen regency has good quality for export, because the communities has good knowledge in pandan processing and making pandan plaiting crafts, from cultivation, maintaining, and use of each pandan species. The processing of raw material into pandan plaiting products was complicated, so the making of pandan plaiting crafts should be managed professionally with involving private sector (local entrepreneurs).

Pandan traditionally is used by communities in Malesia and Pacific for various daily uses. Use of pandan at western part of Malesia (including western part of Indonesia) was not as broader as eastern part of Malesia or eastern part of Indonesia and Pacific (Powel, 1976a, 1976b; Stone, 1982, 1983, 1984; Jebb, 1992; Leigh, 2002). At western part of Indonesia, pandan leaves generally was used as food flavorings (P. amaryllifolius Roxb.) and other uses was only for households appliances purposes, such as plaited mat, hat and traditionally ceremony (pandan samak P. odoratissimus; pandan bidur P. dubius Speng. and cangkuang P. furcatus Roxb.). At Lombok (West Nusa Tenggara) pandan leaves were used for war traditional ceremony which related to soil fertility procession (Keim, 2007).


148

There are two species of Pandanus recorded from areas understudy: Pandanus amaryllifolius Roxb. and P. tectorius Sol. This finding is in accordance with Hofstede (1925) that the two species are among the most cultivated species of Pandanus in Java, in which the leaves of P. tectorius is most commonly harvested for source of handicraft materials, while P. amaryllifolius for culinary aromatic purposes only

Species diversity At Galis Dajah village (Konang district), Durjan

village (Kokop district), and Aeng Tabar village (Tanjung Bumi district), the communities only know one pandan species, that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village (Sepulu district) it is known 4 pandan species, those are: (i) “Pandan langka” (the rare pandan, Pandanus

tectorius Sol.). The plants are small and short; leaves are also small and short with length 60-90 cm, width 3-4 cm, spiny. The plants are used to make plaited mat but not preferable because of poor quality.

(ii) “Pandan panjang” (the long pandan, Pandanus tectorius Sol.). The plants are big and tall, leaves with length 150-250 cm, width 5-8 cm, spiny. This plants are preferred by villagers for making plaited mat.

(iii) Spinelless pandan (Pandanus tectorius Sol.). This taxon was previously identified as Pandanus tectorius Sol. var. laevis by Backer and Bakhuizen van den Brink Jr. (1968). However, according to Keim (2009, pers. comm.) the infraspecific classification in P. tectorius is best avoided as P. tectorius is known for its morphological variability, thus the variety infraspecific category is tentative. The plants are big and tall until 10 m, spineless leaves edge. This pandan species are not used for making plaited mat, but as feedstuffs.

(iv) “Pandan wangi” (the odorous pandan, Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin and sharp leaves at edge like sword, fragrant odor. Pandan wangi is used for traditional food preparation, especially at Melayu communities, it is used as dye, perfume, and appetite. Its extract has been used in food industries, such as bread and biscuit factories as dye materials, and also soya beverage and coconut milk. Pandan wangi has used for traditional medicines for morbili fever, gonorrhea, syphilis, and anemia.

The communities of Kebumen, Central Java have known 5 pandan species, those are: (i) “Pandan jeksi” (Pandanus tectorius Sol.). Its

leaves are green, thin and limp, glossy, length of 75-125 cm, flexible, short and soft spiny, fast growing. This species is used more for making plaiting materials because the product is glossy white and has good export quality.

(ii) “Pandan sari” (Pandanus tectorius Sol.). The leaves are not too long only 100-160 cm, soft spiny, slow growing. This species was more used for sewing plaiting border of various crafts.

(iii) “Pandan jaran” (the horse pandan, Pandanus tectorius Sol.). The leaves are longer than pandan jeksi (150-190 cm), rigid and easy to break. This species is seldom used for plaiting because of yellow spotted leaves.

(iv) “Pandan pantai” (the beach pandan, Pandanus tectorius Sol.). Grow at coastal areas, the tree was tall, its leaves are rigid, less used for plaiting.

(v) “Pandan wangi” (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin wide 4.5 cm and length of 40-80 cm and also sharply at the edge like sword. In Java, the plants can be found at home yard because of fragrant odor and generally used for fragrant and food colorants (Heyne 1927).

Based on data collected on pandan types used at Java with same local names compare to data recorded by Heyne (1927), it showed that until present the pandan types are still used by communities. This proved that pandan was considered as commodity which can support daily living of rural communities.

Processing of pandan Generally processing of pandan at each village

was similar, but there are several difference at boiling, soaking, and shaving stages. The processing of pandan was done without boiling, through soaking process, and without soaking process. Besides, duration of soaking process and shavings process also differ based on quality of processed pandan products. The processing stages will affect the quality of plaiting materials. The processing stages of pandan plaiting crafts are as follows: (i) Taking pandan leaves at planting fields (garden, backyard, rice field) using knife. (ii) Removing thorn using string. (iii) Dividing one leaf into 4-8 based on leaves width and its uses, using glass-thread/string. (iv) Boiling pandan leaves for 1 hour and then air-dried. (v) Soaking in cold water for 2 days and the water was changed every day to get pandan color into white and glossy. (vi) Sun-drying of pandan leaves. (vii) Leaves shavings using bamboo. (vii) Sun-drying of pandan leaves. (viii) Leaves shavings using bamboo. (ix) Plaiting pandan leaves.

At plaiting stages, it is requires skill and patient. It takes 2 days to make plaited mat with size 1x2 m2, if it is done continuously, but if it is done in leisure time it will take longer. For size of plaited mat, it is used “cengkol” term. One cengkol is measured from elbow to middle finger. Plaited mat with size 5x3 cengkol is sold at price Rp 20,000.

At Durjan village, Kokop district. There are traditional market every Wednesday where villagers buy and sell their daily basic needs, such as foods, medicine, materials for ritual, crafts materials and

WARDAH & SETYOWATI – The use of Pandanus in Java

149

handicrafts (plaited mat). Raw pandan plaited mat or without boiling process with size 1.2x2 m2 and colored brown was sold at Rp 15,000 per sheet., while plaited mat with same size but with boiling process was sold at Rp 30,000 and colored glossy white. Plaiting materials in ribbon form, boiled, and unshaved was sold at Rp 7,000/bound. One bound was enough to make small size plaited mat. The estimation of length of pandan leaves and plaiting product are as follows: Table 1. .Length of pandan leaves and plaiting product Length of pandan leaves Plaiting product 70 cm 40 cm 85-90 cm 50 cm 100 cm 60 cm

At Kalirejo village (Kebumen) and Sumber Dadi

(Lamongan), pandan plaiting products was dyed using synthetic dyes.

Diversity of pandan species At Galis Dajah village (Konang district), Durjan

village (Kokop district), and Aeng Tabar village (Tanjung Bumi district), the communities only know one pandan species, that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village (Sepulu district) it is known 4 pandan species, those are: (i) Pandan langka (Pandanus tectorius Sol.). The plants are small and short, leaves are also small and short with length 60-90 cm, width 3-4 cm, spiny. The plants are used to make plaited mat but not preferable because of poor quality. (ii) Pandan panjang (Pandanus tectorius Sol.). The plants are big and tall, leaves with length 150-250 cm, width 5-8 cm, spiny. This plants are preferred by villagers for making plaited mat. (iii) Pandan tidak berduri (Pandanus tectorius Sol. var. laevis). The plants are big and tall until 10 m, spineless leaves edge. This pandan species are not used for making plaited mat, but as feedstuffs. (iv) Pandan wangi (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin and sharp leaves at edge like sword, fragrant odor. Pandan wangi is used for traditional food preparation, especially at Melayu communities, it is used as dye, perfume, and appetite. Its extract has been used in food industries, such as bread and biscuit factories as dye materials, and also soya beverage and coconut milk. Pandan wangi has used for traditional medicines for morbili fever, gonorrhea, syphilis, and anemia.

The communities of Kebumen, Central Java have known 5 pandan species, those are: (i) Pandan jeksi (Pandanus tectorius Sol.). Its leaves are green, thin and limp, glossy, length of 75-125 cm, flexible, short and soft spiny, fast growing. This species is used more for making plaiting materials because the product is glossy white and has good export quality. (ii) Pandan sari (Pandanus tectorius Sol.). The leaves

are not too long only 100-160 cm, soft spiny, slow growing. This species was more used for sewing plaiting border of various crafts. (iii) Pandan jaran (Pandanus tectorius Sol.). The leaves are longer than pandan jeksi (150-190 cm), rigid and easy to break. This species is seldom used for plaiting because of yellow spotted leaves. (iv) Pandan pantai (Pandanus tectorius Sol.). Grow at coastal areas, the tree was tall, its leaves are rigid, less used for plaiting. (v) Pandan wangi (Pandanus amaryllifolius Roxb.). The plants grow in clumps and have thin wide 4.5 cm and length of 40-80 cm and also sharply at the edge like sword. In Java, the plants can be found at home yard because of fragrant odor and generally used for fragrant and food colorants (Heyne, 1927).

CONCLUSION

The communities of Konang, Kokop and Tanjung Bumi districts, East Java province only know one pandan species, that are pandan kunyit (Pandanus tectorius Sol.), whereas at Saplasah village, Sepuluh district the communities know 4 Pandanus species, those are pandan langka (Pandanus tectorius Sol.), pandan panjang (Pandanus tectorius Sol.), spineless pandan (Pandanus tectorius Sol. Var. laevis) and pandan wangi (Pandanus amaryllifolius Roxb.). In Central Java, pandan Jeksi (Pandanus tectorius Sol. var. samak Werb.) has good quality and good prospect as plaiting materials, because the plants are big, tall, green-colored and long leaves; pandan sari (Pandanus tectorius Sol.), pandan jaran (Pandanus tectorius Sol.), pandan pantai (Pandanus tectorius Sol.), and pandan wangi (Pandanus amaryllifolius Roxb.). In West Java, there is one pandan species, that are Pandanus tectorius Sol.

REFERENCES

Backer, C.A. and R.C. Bakhuizen van den Brink Jr. 1968. Flora of Java (Spermatophytes only) vol. 3 Groningen: Nv.P. Noordhoff.

French, B.R. 1986. Food Plants of Papua New Guinea: A Compedium. Tasmania: Sheffield.

Haberle, S.G. 1991a. Ethnobotanical research in the Tari Basin. Papua New Guinea Program & Abstract of New Perspectives on the Papua New Guinea Highlands, An interdisciplinary Conference on the Duna, Huli and Ipili Peoples. Canbera: Australian National University.

Haberle, S.G. 1991b. Ethnobotanical Research in the Tari Basin. Southern Highlands Provinci, Papua New Guinea. Monograph, Biogegraphy and Geomorphology. Canberra: Australia National University.

Heyne, K. 1927. De Nuttige Planten van Nederlandsch Indië. 2nd ed. Vol. 1. Batavia: Department van Landbouw, Nijverheid en Handel in Nederlandsch Indië.

Hofstede, H.W. 1925. Het Pandanblad: Als grondstof voor de Pandan hoedenindustrie op Java. Eibergen: H. Heinen.

Hyndman, D.C. 1984. Ethnobotany of Wopkaimin Pandanus: significant PNG Plant Resources. Economic Botany 38 (3): 287-303.

Jebb, M. 1992. A Field Guide to Pandanus in New Guinea, the Bismarck Archipelago & the Solomon Islands. Madang: Christensen Research Institute.


150

Keim, A.P., Rugayah, S. Prawiroatmodjo, M. Rahayu, F.I. Windadri, S. Sunarti, K. Kramadibrata, Y. Santika, Dewi, Sunardi, dan Hamzah. 2006. Keanekaragaman suku pandan (Pandanaceae) di beberapa wilayah terpilih dalam lingkup Taman Nasional Ujung Kulon, Banten. Laporan Perjalanan Eksplorasi dan Pengungkapan Pemanfaatan Flora untuk Revisi Suku-suku Terpilih, Taman Nasional Ujung Kulon-Banten. Herbarium Bogoriense, Bogor. Bogor: Puslit Biologi LIPI.

Keim, A.P. 2007. 300 tahun Linnaeus: Pandanaceae, Linnaeus dan Koneksi Swedia.Memperingati 300 tahun Carolus Linnaeus. Pusat Penelitian Biologi-LIPI. Bogor, 24 Mei 2007.

Leigh, C. 2002. Baining Dances and Bark Cloth Masks. East Britain Province-Papua New Guinea. Tucson. A: Art-Pacific.

Milliken W. 1994. Ethnobotany of the Yali of West Papua. Edinburgh: Royal Botanic Garden.

Powell, J.M. 1976a. Ethnobotany. In: Paijmans, K. (ed.). New Guinea Vegetation. Amsterdam: Elsevier.

Powell, J.M. 1976b. Some useful wild and domesticated plants of the Huli of Papua. Science in New Guinea 4: 173-201.

Rose, C.J. 1982. Preliminary observation on the Pandanus nut (Pandanus julianetti Marteli). Proceedings of the Second Papua New Guinea Food Crops Conference. Port Moresby: Departement of Primary Industry, PNG.

Stone, B.C. 1976. On the biogeography of Pandanus (Pandanaceae). Société de Biogéographie 458: 69-90.

Stone, B.C. 1982. New Guinea Pandanaceae. First approach to ecology and biogeography. In: Gressitt. J.L (ed). Biogeography and Ecology of New Guinea. Vol.1 Monograhiae Biologicae 42. The Hague: Dr. W. Junk Publ.

Stone, B.C. 1983. A guide to collecting Pandanaceae (Pandanus, Freycinetia and Sararanga). Annals of the Missouri Botanical Garden. 70: 137-145.

Stone, B.C. 1984. Pandanus from Ok Tedi Region, PNG collected by Debra Donoghue. Economic Botany 38 (3): 304-313.

Walter, A. and C. Sam. 2002. Fruits of Oceania. ACIAR Monograph No 85 Canberra: ACIAR.


♥ Corresponding address: Jl. Raya Bogor Km. 46 Cibinong-Bogor 16911 Tel. +62-21-8765066. Fax. +62-21-8765063/62 e-mail: [email protected]

Extraction of Coconut Oil (Cocos nucifera L.) through Fermentation System

RINI HANDAYANI♥, JOKO SULISTYO, RITA DWI RAHAYU Microbiology Division, Research Center for Biology, Indonesian Institute of Sciences (LIPI), Cibinong-Bogor 16911

Received: 28th October 2008. Accepted: 4 December 2008.

ABSTRACT

Coconut oil (Cocos nucifera L.) has a unique role in the diet as an important physiologically functional food. The health and nutritional benefits that can be derived from consuming coconut oil have been recognized in many parts of the world for centuries. There are few techniques for coconut oil extraction, such as physical, chemical, and fermentation or enzymatic processes using microbial inoculum as enzymatic starter. Starter with different concentration (1.0; 2.5; 5.0; and 10%) of microbial strains were added into coconut cream and allowed to be fermented for over night. The extracted oil was analyzed for further experiment, especially on its antibacterial activity. The maximum yield of 27.2% was achieved by adding 5.0% starter. Water content, acid value, FFA, and peroxide value of the fermented coconut oil were 0.3%, 0.45%, 0.22% and 2.54% respectively. A gas chromatogram showed that this fermented oil contained high lauric acid (46.82%), and 6.01% caprylic, 7.5% capric, 17.02% miristic, 7.21% palmitic, 3.11% palmitoleic, 5.41% stearic, and 1.3% linoleic acid, respectively. An inhibitory effect of such kind coconut oil which contains potential fatty acid against bacterial growth was further examined. It was found that this edible oil exhibited antibacterial activity to inhibit the growth of Bacillus subtilis, Escherichia coli, Pseudomonas fluorescence, Bacillus cereus and Salmonella; however it showed slightly inhibitory effect when it was exposed to Bacillus cereus and Escherichia coli.


Key words: coconut oil, inoculum, fermentation, lauric acid, antibacterial.

INTRODUCTION

A novel method on improving quality of coconut oil (Cocos nucifera L.) to produce best quality of coconut oil for industrial application is increased. One of them is a method of extraction through fermentation or enzymatic system (Rosenthal et al. 1996). Virgin coconut oil (VCO) is made from fresh coconuts, not copra. Since high temperatures and chemicals solvent are not used, the oil retains its naturally occurring phyto- chemicals which produce a distinctive coconut taste and smell. The oil is pure white when the oil is solidified, or crystal clear like water when liquefied. The oil contained high lauric acid (C-12, c.a. 50%) as saturated fatty acid and has known well as medium chain fatty acid (MCFA). MCFAs are burned up immediately after consumption and therefore the body uses it immediately to make energy rather than store it as body fat (Enig, 1996; Kabara, 1984).

Studies have revealed that populations who

traditionally consume large quantities of coconut as a part of their diet have a low incidence of health problems associated with blood clotting, including heart disease and stroke (Prior et al., 1981). Coconut oil is very stable and does not need to be refrigerated since it contains a saturated fatty acid, because all the carbon-atom linkages are filled or saturated with hydrogen. This means that they do not normally go rancid, even when they heated, degraded, irradiated, oxygenated for cooking or other purposes (Issacs, 1986; Rindengan and Novarianto, 2004).

The VCO processed by fermentation or enzymatic system has more beneficial and safety effect rather than traditional methods from copra, since they often infected by insects or aflatoxin producing molds that caused potential toxicity problem during manufacturing. Traditional coconut oils are considered to be low quality products which indicated by high moisture and free fatty acid content. It was therefore easily to rancid and turned to brown and exhibited relatively short life-time by sensory test (Soeka et al, 2008).

Extraction process of coconut oil through fermentation or enzymatic system involved microbial starter inoculums or enzymatic starter that play a role on breaking of coconut milk emulsion, while through traditional processes the oil extraction were carried


152

out physically by using of heating or mechanical expelling (Ketaren, 1986). Activities of enzymes were affected by substrate and enzyme concentration, pH, temperature, and incubation time (Pelczar and Chan, 1986). Microbial starter was utilized as their shown on proteolytic, amylolytic and lipolytic capacities. These kinds of enzymes are required to hydrolyse protein, carbohydrate and lipid components contained in the coconut kernel. Basically, the purpose of the fermentation or enzymatic processes is to make the coconut emulsion into unstable condition and therefore easily to separate into oil phase on upper layer and carbohydrate, protein and water phase on below layer (Soeka et al, 2008; Rahayu et al, 2008).

The purpose of research was to develop the extraction method of coconut oil to produce high quality virgin coconut oil (VCO) and expectedly useful for improving technology on extraction of VCO naturally.


Microbial strains The strains used in this experiment were

Lactobacillus bulgaricus, Saccharomyces cerevisiae, Candida rugosa, Aspergillus oryzae, Salmonella, Pseudomonas fluorescens, Escherichia coli, and Bacillus substilis, soy-sauce starter (Aspergillus oryzae), bake yeast (Saccharomyces sp), tempeh starter (Rhizophus oligosporus), and beverage yeast (Candida utilis) obtained from the collection of Microbiology Division of Research Center for Biology, Indonesian Institute of Science (LIPI) Cibinong-Bogor.

Chemical reagents Bacto-peptone, yeast extract, agar, potatoes

dextrose agar (PDA), KH2PO4, MgSO4.7H2O, soluble starch were purchased from Sigma and Merck.

Steps of experiment The experiment was carried out on five steps, i.e.:

(i) strains selection, (ii) starter production, (iii) coconut oil extraction, (iv) qualitative and quantitative analysis of oil product, (v) assay on antibacterial activity of coconut oil.

Coconut oil preparation The coconut type used for making virgin coconut

oil was according to method of Rindengan and Novarianto (2004). The coconut cultivars used in this experiment were kelapa dalam, genjah salak, and genjah kuning. Matured coconut was grated and the grated coconut was then mixed with hot tap water (1:1, w/v). After squeezing and filtering, coconut milk was pooled into a clean jar and stayed for 1h. After separating into two layers those were cream on upper part which riched in oil content while skim layer riched in protein on below part was drained off, and the remained cream one was then fermented overnight to prepare virgin coconut oil.

Agar media preparation Potatoes dextrose agar (PDA) media and nutrient

agar (NA) media containing 0.75 g yeast extract, 1.25 g peptone, 5g agar and 10g potato or malt extracts, respectively, were prepared according to Cappuccino and Sherman (1983). These ingredients were dissolved into 250 mL distilled water, and then melted using microwave for 3 min to accelerate their solubility. The melted media were poured into tubes and autoclaved for 15 min at 121ºC and cooled down onto elevate rack to prepare slant culture media.

Microbial screening To prepare enzymatic starter for extracting virgin

coconut oil, both of yeast and mold strains were inoculated onto PDA and bacterial strain onto NA and then incubated for 3 days at room temperature. Stock cultures were transferred into liquid media containing coconut water, coconut skim, pineapple or malt extract, urea and molasses.

Assay for enzymatic activities Selected media for assaying proteolytic and

amylolytic activities was referred to a method of Sulistyo et al. (1999). One ose-needle of stock culture of bacterial strain was inoculated into nutrient broth (NB) and incubated for 24h at 37oC. One mL of culture was added into 9.0 mL of NB media and incubated for 24h at 37oC. One mL of respective stock cultures were inoculated into 9.0 mL NB, and incubated at 37oC for 2 days. Proteolytic activity was measured semi quantitatively on the media containing 1% KH2PO4, 2% MgSO4.7H2O, 1% yeast extract, 5% agar and 2% skim milk. Qualitatively analysis was done based on activity tested on agar media grown with 3 days-old microbial strains. The proteolytic activity was indicated by present of clear zone surrounded colonies of strains. Amylolytic activity was measured as by measuring proteolytic activity when 1% soluble starch was applied to the media rather than 2% skim milk. Observation was carried out on present of clear zone after employing iodine reagent (Mestecky et al, 2004).

Enzymatic starter preparation The media for production of starter containing

coconut water, coconut skim, pineapple or malt extract, urea and molasses in 500mL Erlenmeyer flask was sterilized using autoclave for 15 min at 121ºC. After cooling down to a room temperature, the media were inoculated by Lactobacillus bulgaricus, Aspergillus oryzae, Candida rugosa and Saccharomyces cerevisiae, respectively. The respective starters those were incubated with different cultures were then employed to the coconut cream and incubated at 40oC for overnight. The oil was obtained through this process were then measured and analyzed. Influence of strains growth toward incubation temperature at 25, 30, 35, 40 and 45oC and pH of media at 3, 4 , 5, and 6 during incubation

HANDAYANI et al. – Extraction of virgin coconit oil

153

on the shaker for 5 days and employed concentration of starter at 1%, 3%, and 5% toward the yield of obtaining coconut oil were studied to determine capacity of respective microbial strains those were suitable for preparing an effective starter in producing high yield of VCO (Sulistyo et al., 1999).

The strain that exhibited high yield on oil production was selected and examined further in comparison to the capacities of commercial starter products on extracting coconut oil through fermentation system, such as soy-sauce starter mold (A. oryzae), bake yeast (Saccharomyces sp.), tempeh starter (R. oligosporus), and alcoholic beverage yeast (C. utilis). The obtaining oils derived from different coconut type were then filtered through activated charcoal and analyzed using gas chromatography (GC).

Yield measurement Yield of obtaining coconut oil was determined by

using the method of gravimetric (v/v) as follows: Yield = Volume of obtaining oil (mL) x 100% Volume of coconut cream (mL)

Fatty acid analysis Sample of VCO was analyzed according to the

method of Rietschel et al. (1972). Approximately 20-30 mg of sample was placed into a tube with cap and added with 1.0 mL 0.5 N NaOH in methanol and hydrolyzed for 20 min. After addition with 2.0 mL of 16% BF3 in methanol and 2.0 mL of saturated NaCl to remove emulsion, the reaction mixture was then extracted with hexane. The hexane layer was then transferred into a flask containing anhydrate 0.1g Na2SO4 as moisture absorbent. The prepared sample was injected onto GC using internal standard of fatty acids, under GC condition at 190-200ºC, flow rate 1.0 cm/s, fused silica capillary column (3 m length), flame ionization detector and volume of sample injection was 4.0 µL.

Proximate analysis According to the method of Suminar et al. (2001),

the proximate analysis for determining acid value, free fatty acid, moisture and peroxide content of VCO was carried out by preparing 2.5g of sample onto erlenmeyer flask. A titration reagent of 25 mL alcohol-benzene (1:1, v/v) was pre-heated on a water bath at 70ºC for 10 min after addition with 3 drops of phenolphtalein as indicator and the mixture was titrated with 0.01N NaOH up to the solution just turned to slight red. The solution was mixed with sample and heated for 5 min and titrated again with 0.01N NaOH at least for 10 min.

Acid value = A x N x 40 Sample weight (g) FFA (%) = A x N x M x 100% Sample weight (mg)

A = Quantity of NaOH N = Normality of NaOH M = MW of lauric acid

Moisture content Moisture content was determined by weighing 10g

of sample and placed onto a petri dish that had already determined for its blank weight. The sample was heated at 105ºC for 2h in an oven and cooled it down in a desiccator for approximately 15 min and weighed again.

Moisture content = A - B x 100% A

Assay on antibacterial activity Antibacterial activity was assayed by preparing

nutrient broth (NB) in some reaction tubes. The media containing 0.3g yeast extract and 0.5g peptone in distilled water was sterilized by autoclaving at 121oC for 15 min. The NB media was incubated on the shaker after inoculating with 1ose of tested bacteria for 2 days. One mL of pre-incubated media which containing the tested bacteria was then diluted into the tubes containing 9.0 mL of sterilized distilled water and more over diluted gradient up to obtaining dilution at 10-3. Finally, 0.1 mL of the 10-3 diluting sample was transferred onto the petri dish containing NA media. To determine the activity of VCO against bacterial growth, a smeared paper dish with VCO was placed onto the media, and the activity of antibacterial was assayed by observing the present of clear zone surrounding the colony that had grown by tested strains after 2 days incubation (Carson and Riley, 1995).


Amylolytic and proteolytic activity To determine the capacity of some microbial

strains in producing enzymatic starter that was suitable for extraction of VCO, we had employed four selected microbial strains were L. bulgaricus, S. cerevisiae, C. rugosa and A. oryzae. The enzymatic activities of these strains were investigated according to the method of gel diffusion on the media containing starch for amylolytic activity or skim milk for proteolytic activity as mentioned in the Methods and Materials. The strain of L. bulgaricus showed the highest activity for amylolytic and proteolytic enzymes as indicated by formation of colony surrounding clear zones. Diameter of clear zone (± 2.0 cm) was undoubtedly illustrated that the strain of L. bulgaricus capable to produce amylase and protease those were availably important to digest protein and carbohydrate which contained in coconut cream as its substrate. The strain L. bulgaricus was furthermore selected to be employed as potential starter for extracting VCO, while the other strains, S. cerevisiae, C. rugosa and A.oryzae, respectively. A. oryzae had not been


154

employed as starter since their proteolytic and amylolytic activities given are lower than L. bulgaricus (Table 1).

Table 1. Proteolytic and amylolytic activities of the selected strains.

Diameter of clear zone (cm) Activity/Strain LB K-1A SC CR Proteolytic 2.0 1.6 1.3 1.6 Amylolytic 2.1 1.4 1.4 1.5

Note: LB: Lactobacillus bulgaricus; K-1A: Aspergillus oryzae; SC: Saccharomyces cerevisiae; CR: Candida rugosa.

Fermentation system The fermentation of coconut cream occurred when

the enzymatic starter had been employed for processing. Crude coconut oil was formed due to a phenomenon of protein digestion that plays a role to stabilize emulsion of the coconut cream into a soluble material. The enzymatic starter with high capacity of amylolytic and proteolytic could hydrolyze carbohydrate and protein which contained in the coconut the cream as its substrate into soluble sugar and amino acid and peptide (Soeka et al., 2008). The extraction process of coconut oil via fermentation or enzymatic system involved microbial cell and enzymes those could solve the emulsion; however, their activities were influenced by some conditions of substrate, enzyme, pH, temperature, and incubation period (Pelczar and Chan 1986).

Preliminary step on extraction process of VCO was initiated after separating the coconut cream which higher in lipid content from coconut skims which higher in carbohydrate and protein content as shown on Figure 1.A. After addition with starter followed by overnight fermentation of the coconut cream at room temperature, the starter containing enzymes were stimulated to digest starch and ferment it into alcohol and organic acids that

coagulate protein in consequence of phases formation of oil on upper part, protein in the middle and water layer on lower part (Rindengan and Novarianto, 2004). Due to a lower molecular weight, the oil part formed through the process could be directly separated from protein and water part by draining off both of them through a valve (Figure 1.B). To reduce interference of water content or insoluble materials into the oil part, a further process of obtaining oil by refining through filter paper or vacuum filter and rinse with hot water following by vacuum evaporation was required to avoid chemically processing to achieve the virgin state of oil as shown on Figure 1.C.

Fermented coconut oil has been known well as virgin coconut oil (VCO) since high temperatures, chemicals or other physical treatment are not used in its processing. As it had been naturally and traditionally processed through enzymatic fermentation, unhydrogenated, undeodorized, and unbleached, the component of fatty acids, especially lauric acid of this coconut oil is not change since it is least vulnerable of all the dietary oils to oxidation and free-radical formation, and it is therefore the safest to use in cooking. It does not become polymerized and form by-products as do other oils when heated to normal cooking temperatures (Kaunitz and Dayrit, 1992; Rindengan and Novarianto, 2004; Sulistyo, 2004).

Structurally, coconut oil is very rare amongst all the other dietary lipids. As a different class of saturated fat that behaves very differently in the body from each other, since it is composed almost entirely of medium chain fatty acids (MCFA), a powerful anti-microbial, where mother's milk is very high in them. Coconut oil is composed of an incredible 64% MCFA. The body metabolizes MCFA and absorbed directly from the intestine into the portal vein, and sent straight on to the liver, where they are burned for

A B C

Figure 1. A. Coconut milk separation, B. Fermentation process, C. Purified coconut oil.


155

fuel, almost like a carbohydrate. Rather than produce fat, they are used to produce immediate energy. And, the body uses much less energy to digest MCFA. They are easily digested by saliva and stomach enzymes and do not require pancreatic enzymes. This relieves stress on both the pancreas and the digestive system. For this reason, MCFA are essential in baby formulas, and are routinely used in hospitals for patients with digestive, metabolic and malabsorption problems. Also, the MCFA in VCO are used to improve insulin secretion and the utilization of glucose, and therefore greatly helps relieve the symptoms and reduce the health risks of diabetes (Enig, 1996).

Screening on microbial strains Influence of employing pH (Figure 2), temperature

(Figure 3) and starter concentration (Fig 4) on the yield of extracting coconut oil exhibited that the strain of L. bulgaricus could effectively extract the oil higher than the tested microbial strains when the starter was employed to incubate the coconut cream under the fermentation condition at pH 5.0, 45ºC and 5% starter concentration.

Figure 2 showed the influence of incubation pH on the yield of extracting oil. It was found that the highest yield of oil (27.0%) could be obtained after incubating the starter at pH 5.0. It is probably that the strain of L. bulgaricus which employed as the starter is a facultative aerobic strain that had optimal proteolytic capability at pH 5.0. This pH value is affected on occurring toward substrate binding enzyme since the concentration of H+ potentially affected a linkage between active site of enzyme and its substrate which led to conform the active site into optimal condition for binding the substrate based on the principal of Lock and Key.

Figure 3 showed the influence of incubation temperature on the yield of extracting oil. It was found that the highest yield of oil (27.2%) could be obtained after incubating the starter at 45oC. It is probably that the strain of L. bulgaricus behaves at optimal condition between 40-45oC. The binding of enzyme to its substrate and rising temperature up to a certain degree had increased kinetic energy and promoted movements of reacted molecules. It was therefore increasing bumping occurrence between enzyme and its substrate optimally. The enzyme exhibited its activity at certain optimal condition of temperature, and therefore when the temperature is over than its optimal condition, the enzyme would certainly be denaturated.

Figure 4 showed the influence of starter concentration on the yield of extracting oil. It was found that the highest yield of oil (26.8%) could be obtained after incubating the starter at 5.0% (v/v). At low concentration rate of reaction was too low, however, the rate would be higher as increasing of substrate concentration which catalyzed by the enzyme. Increasing of enzyme is not effective when

the concentration of substrate achieves optimal condition since the enzyme is saturated by the substrate binding enzyme complexes.

05

1015202530

3 4 5 6

pH of Starter

Yie

ld o

f Oil

(%)

LB K-1A CR SC

Figure 2. Effect of pH of starter on yield of extracting oil.

0

10

20

30

25 30 35 40 45

Incubation Temperature (0C)

Yie

ld o

f Oil

(%)

LB K-1ACR SC

Figure 3. Effect of temperature on yield of extracting oil.

0

10

20

30

1 3 5

Starter Concentration (%)

Yiel

d of

Oil (

%)

LB K-1A CR SC

Figure 4. Effect of starter concentration on yield of extracting oil.

Moreover the starter capability of L. bulgaricus in extracting of VCO was investigated furthermore in the comparison to other strains contained in soy-sauce starter mold (A. oryzae), bake yeast (Saccharomyces sp), tempeh starter (R. oligosporus), and alcoholic beverage yeast (C. utilis). To produce kinds of VCO products, the coconut milk was prepared by different strain of coconut cultivars such as kelapa dalam of Cianjur Regency, genjah salak and genjah kuning of Bogor Regency. The yield of oil derived from each types of coconut were then purified by filtration and absorption using absorbent of activated charcoal as shown on Table 2.

The Table showed that the highest yield of oil was obtained by using coconut cream of kelapa dalam


156

Table 2. Yield (mL) of VCO derived from different type of coconut. Coconut Cultivars

VCO starter

Kecapstarter

Tempeh starter

Beverageyeast

Bakeyeast

Kelapa dalam 25.5 28.0 21.0 - - Genjah salak 21.5 23.0 18.0 - - Genjah kuning

15.5 17.0 15.0 - -

Note: (-) none oil formed after processing.

(24.83 mL) while using genjah salak and genjah kuning gave lower yield of oil was 20.83 mL and 15.83 mL, respectively. It was apparent that initial composition of coconut cream significantly influence on final yield of extraction oil. The coconut cream of kelapa dalam exhibited calories (359 cal) and lipid by means of oil content (34.7%) higher than both of the genjah types of coconut cultivar those were 180 cal and 13.0% on the average (Palungkun, 1993). It was found that the oil layer was formed on the coconut cream was incubated by the starter of L. bulgaricus, A. oryzae of soy-sauce and R. oligosporus of tempeh inoculum, while there was none of oil layer found on the coconut cream was incubated by Saccharomyces sp. of bake and C. utilis of beverage starters. Apparently, the enzyme of these kinds of starters had been inactivated or not appropriated as the starter for enzymatic fermentation process of coconut oil, and resulted in none oil formation since the coconut cream as the substrate was not agreed with the enzymes contained in such starters.

Fatty acid analysis of VCO To determine fatty acid composition of the virgin

coconut oil (VCO) obtained by the enzymatic fermentation, sample of the oil was then analyzed by using GC. It was found that the highest yield of lauric acid of oil (42.95%) was obtained by employing the starter of L. bulgaricus into coconut cream derived from kelapa dalam strain as shown on Table 3. Table 3. Analysis of lauric acid of extracting VCO.

Lauric acid concentration (%) Fatty Acid VCO-LIPI AO–D LB-D AO-GS LB-GSLauric acid 46.82 41.46 42.95 40.68 35.08

Table 3 showed that the VCO obtained by

employing the starter of L. bulgaricus into coconut cream of kelapa dalam (LB-D) yielded higher lauric acid content (42.95%) rather than by employing the starter of A. oryzae with strain of kelapa dalam (AO-D, 41.46%) and the starter A. oryzae with the strain of genjah salak (AO-GS, 40.68%) or the starter of L. bulgaricus with the strain of genjah salak (LB-GS, 35.08%). It was found somehow; the yield of obtaining oil still lower yet rather than the oil had been obtained by using the starter of VCO-LIPI as the standard of comparison of previous experiment

(Soeka et al., 2008).

Quantitative analysis of VCO To determine the content of FFA, moisture

content, peroxide value, the extracting VCO obtained by using of the starter of L. bulgaricus was then analyzed and showed as following table,

Table 4. Analysis of VCO according to SII. 0150-72 for edible oil.

Component of Analysis

Reference Value of SII

Concentration (%)

Moisture content Max 0.5 % 0.30 Acid value Max 0.5 % 0.45 Free fatty acid Max 2.5 % 0.22 Peroxide value Max 3.0 % 2.54

Table 4 showed that characteristic of obtaining

VCO for edible oil referred to the moisture content, acid value FFA and peroxide values was agreed with a range of value in accordance to the Standard International of Indonesia (SII) 0150-72 for edible oil. It was suggested that our VCO which was extracted through enzymatic fermentation process by employing the starter of L. bulgaricus was appropriated to be consumed as safety and healthy edible oil. The quality of the obtaining oil was corresponded to requirement for quality standard of good edible oil. One of spoiled edible oil indicator is high in acid and peroxide values, since their existences in the product indicate an alteration caused by oxidation on chemical content is being occurred and resulted frequently in a problem of rancid.

Assay of antibacterial activity The antimicrobial properties lauric acid and its

derivative monolaurin from coconut oil have shown promise in this study. Lauric acid, which is present in high concentration in coconut oil, forms monolaurin in the animal body and this derivative of lauric acid can inhibit the growth of pathogenic microorganisms (Kabara, 1984). The research focused on Pseudomonas fluoresence, Bacillus substilis, Salmonella and Escherichia coli. To determine potential of lauric acid contained in this extracting oil obtained through enzymatic fermentation, this oil was then studied furthermore against microbial growth. Its antimicrobial activity was observed by the existence of clear zone formed surrounding paper-disc that had pre-submerged into this oil on the media grown with colonies of tested microbial strains. It was found that the clear zone surrounding the paper disc on the media fully grown with strain of Salmonella, indicated that this oil had activity against the growth of tested strain as shown on Figure 5. It is now clear and scientifically validated that the inclusion of coconut oil in the diet could and should be utilized for its preventive and healing properties.


157

Figure 5. Assay of antibacterial activity of VCO. (1), VCO-LB; (2), VCO-CR; (3), Copra oil; (4), Palm oil; (5), traditional coconut oil.

CONCLUSION

The strain of Lactobacillus bulgaricus could effectively extract the virgin coconut oil higher than the other tested microbial strains when it was employed into the coconut cream under the enzymatic fermentation condition at pH 5.0, 45ºC and 5% starter concentration. The highest yield of oil was obtained by using coconut cream derived from coconut strain of kelapa dalam while using genjah salak and genjah kuning gave only lower yield. It was found that the highest lauric acid (42.95%) was obtained by employing the starter of L. bulgaricus into coconut cream of kelapa dalam strain. Characteristic of obtaining VCO as edible oil that had been referred to the moisture content, FFA, acid and peroxide values was in a good agreement in accordance to the Standard International of Indonesia (SII) 0150-72. To determine potential of lauric acid contained in this oil, the study was focused on some microbial strains and It was found that there were clear zone surrounding the paper disc after submerging into this oil, onto agar media grown with strain of Salmonella, indicating that this oil exhibited activity against the growth of the tested microbial strain.

REFFERENCES

Carson, C.F., and T.V. Riley. 1995. Antimicrobial activity of the major components of the essential oil of Melaleuca alternifolia. Journal Applied Bacteriology 78 (3): 264-269.

Cappuccino, J.G. and N. Sherman. 1983. Microbiology a Laboratory Manual. New York: Addison-Wesley Publishing Company.

Enig, M.G. 1996. Health and nutritional benefits from coconut oil: an important functional food for the 21st century. AVOC Lauric Oils Symposium, Ho Chi Min City, Vietnam, 25 April 1996.

Issacs, C.E. 1986. Membrane-disruptive effect of human milk: inactivation of enveloped viruses. Journal of Infectious Diseases 154: 966-971.

Ishwanto, T. 2001. Bioproses Enzimatik dan Purifikasi Minyak Kelapa Fermentasi (Fermikel) [S1-Tesis]. Bogor: Fakultas Teknologi Pertanian, Universitas Juanda.

Kabara, J.J. 1984. Medium-chain Fatty Acids and Esters as antimicrobial agents. In: Kabara, J.J. (ed.). Cosmetic and Drug Presentation: Principles and Practice. New York: Marcel Dekker, Inc.

Kaunitz, H., C.S. Dayrit. 1992. Coconut oil consumption and coronary heart disease. The Philippine Journal of Internal Medicine 30:165-171.

Ketaren S. 1986. Minyak dan Lemak Pangan. Jakarta: UI Press. Mestecky, J., F.W. Kraus, D.C. Hurst, and S.A. Voight. 2004. A

simple quantitative method for α-amylase determinations. Analytical Biochemistry 30 (2): 190-198.

Palungkun, R. 1993. Aneka Produk Olahan Kelapa. Jakarta: Penebar Swadaya.

Pelczar, M.J. dan E.C.S. Chan. 1986. Dasar-dasar Mikrobiologi. Jakarta: UI Press.

Prior, I.A., F. Davidson, C.E. Salmond, and Z. Czochanska. 1981. Cholesterol, coconuts, and diet on Polynesian atolls: a natural experiment: the Pukapuka and Tokelau Island studies. American Journal of Clinical Nutrition 34: 1552-1561.

Rahayu, R.D., J. Sulistyo, and A. Dinoto. 2008. Enzymatic properties of microbial solid starters on coconut oil recovery. Proceeding of the International Seminar on Chemistry. 679-686.

Rietschel, E.T., H. Gottert, O. Luderitz, and O. Westphal. 1972. Nature and linkages of the fatty acids presents in the lipid A component of Salmonella lipopolysaccharides. European Journal of Biochemistry 28: 166-173.

Rindengan, B. dan H. Novarianto. 2004. Minyak Kelapa Murni: Pembuatan dan Pemanfaatan. Edisi ke-1. Jakarta: Penebar Swadaya.

Rosenthal, A., D.L. Pyle, and K. Niranjan. 1996. Aqueous and enzymatic processes for edible oil extractin. Journal of Enzymology Microbial Technology 19: 402-420.

Sulistyo, J., Y.S. Soeka, E. Triana, dan R.N.R. Napitulu. 1999. Penerapan teknologi fermentasi pada bioproses fermentasi minyak kelapa (fermikel). Berita Biologi 4 (5): 273-279.

Sulistyo, J. 2004. Pemasyarakatan, Penerapan, dan Pengembangan TTG. Lokakarya TTG-Badan Pemberdayaan Masyarakat dan Penanggulangan Sosial Pemerintah Kota Bogor. Bogor, 4 November 2004.

Soeka, Y.S., J. Sulistyo, dan E. Naiola. 2008. Analisis biokimia minyak kelapa hasil ekstraksi secara fermentasi. Biodiversitas 9 (2): 91-95.

Suminar, S., Purwatiningsih, D. Tohir, dan M. Farid. 2001. Kimia Organik II. Bogor: Jurusan Kimia, Fakultas Matematika dan Ilmu Pengetahuan Alam, Institut Pertanian Bogor.


♥ Alamat korespondensi: Jl. Ir. Sutami 36A Surakarta 57126 Tel. & Fax.: +62-271-663375 e-mail: [email protected]

Potency of Lobak Leaves (Raphanus sativus L. var. hortensis Back) as Anticancer and Antimicrobial Candidates

RITA RAKHMAWATI♥, ENDANG ANGGARWULAN, ESTU RETNANINGTYAS Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Surakarta 57126.

Received: 11th November 2008. Accepted: 18th December 2008.

ABSTRACT

One of vegetables can preventive cancer and have been used traditionally to cure infection, such as lobak (Raphanus sativus L.). Ineffectiveness antibiotics to against microbial infections was still problem until now. Types of antibiotics and anticancer agents from natural resources should be explored and developed. This study was aimed to know toxicity effect and antimicrobial activity of active fractions from lobak leaves. Toxicity study was conducted using Brine Shrimp Lethality Test (BST). Samples were prepared at the concentration of 100, 500, and 1000μg/mL. Antibacterial study against Staphylococcus aureus was conducted using agar-well diffusion method at concentration 30, 40, 50, 60, 70, 80, 100%. Ethyl acetate fraction from methanol extract is the most active that had larger clear zone in S. aureus culture (10,64 mm) and insoluble ethyl acetate fraction from methanol extract is the most active against A. salina (84% death A. salina at 100 µg/mL). Bioactive compounds at active fraction were identified to contain polar compounds.


Key words: Raphanus sativus L., BST, Staphylococcus aureus, active fraction.

INTRODUCTION

Based on epidemiological evidences, consumption of vegetables, belonging to the Brassicaceae family, has been associated with a decreased incidence of various cancers (Duthie et al., 2003; O’Hare al., 2006). On the basis of this information, researchers recently have estimated that vegetable consumption prevent 20% to 50% of all cases of cancer (Nestle, 1997). Lobak (Raphanus sativus L.) is not only vegetables but in many countries, lobak is used in traditional medicines (Shoeb, 2006). There were three species of lobak variety in Java, var. hortensis Back., var. niger Willd. and var. radicula Pers. Lobak var. hortensis have white sprouts and long cylinder. Lobak var. niger have black sprouts, meanwhile var. radicula with red skins or pure white throughout (Backer and Bakhuizen v.d. Brink, 1968). In this study, we focus on lobak var. hortensis.

Lobak is reported as good remedy used for treatment of anti tumor, anti infection, chemoprevention for breast cancer, and immunomodulator (Wijayakusuma, 2005). Lobak has been traditionally used for medicinal purposed, therefore further research is needed. The current study was carried out to determine the toxicity of

lobak against A. salina, and the antimicrobial activity of lobak leaves against S. aureus.


Material Lobak leaves (Raphanus sativus L.) were

collected from Tawangmangu in August 2008. Chemicals such as silica gel GF254, ethanol, n-hexane, methanol, chloroform, and ethyl acetate were purchased from Merck (Darmstadt, Germany), aquadest, sea water, Artemia salina egg, yeast (Fermipan®), cerium (IV) sulfate, Staphylococcus aureus (Rosenbach) colony, Nutrient Agar (NA) and Muller Hinton (MH), amoxicillin, rotary evaporator (Heidolph vv 2000, Germany), micropipette, lamp 5 watt, aerator, micro syringe, oven, spray, laminar air flow and UV detector.

Extraction Extraction was carried out by simple maceration

process. The powdered leaves (600 g) were initially macerated with 1700 mL chloroform (24 hours x 3) at room temperature. Macerate were filtered and distilled in rotary evaporator and concentrated to obtain the crude chloroform extract. Residue were remacerated (24 hours x 3) with methanol (1700 mL) for 24 hours, then filtered. Procedure was done as above mentioned and the crude methanol extract obtained. Sample was prepared by dissolving 50 mg

RAKHMAWATI et al. – Raphanus sativus leaves as anticancer and anti microbes

159

of each sample in 5 mL of chloroform: methanol (1:1) v/v and obtained stock solution 10 µg/mL. The extract of chloroform and methanol were examined their toxicity and antimicrobial activity against S. aureus. The most active extract was partitioned with ethyl acetate and obtained fraction to form insoluble and soluble ethyl acetate fraction. Both of them were further examined with reduced concentration.

Larvae A. salina hatching Artemia salina eggs were hatched in a container

filled with aerated sea water and illuminated with 5 watt light source. The container was compartmentalized into dark compartment and lightened one with several holes. After 24 hours, brine shrimp larvae were collected by pipette from the lightened side through the holes; then 48 hours of A. salina larvae were ready for toxicity test.

Assay for antibacterial activity S. aureus with agar-well diffusion method

All the stock cultures were obtained from Faculty of Medicine, Sebelas Maret University. Stock cultures were regenerated on nutrient agar (NA) slants and incubated at 37oC for 24 hours for bacterial proliferation. Muller Hilton Medium was sterilized at 121oC for 15 minutes, then cool down until 50oC. After that MH medium were inoculated with cultures (1-2 ose) and homogenized. Active cultures used for experiments were prepared by transferring a loopful of culture to 10 mL of nutrient agar in petri dish.

The medium seeded with test organism were punctured with sterile cork borer to make wells. Methanol extract and chloroform extract at 60, 70, 80,100%; insoluble and soluble ethyl acetate fraction at 30, 40, 50% were transferred to each well under aseptic condition and incubated for 24 hours. The antimicrobial activity was detected as clear zone of inhibition around wells and it was measured in millimeter (mm). Each experiment was replicated three times. Amoxicillin was used as control.

Brine Shrimp Lethality Test (BST) From this stock solution, 1000, 500 and 100 μg/mL

was transferred to 5 vials and 5 vials were kept as control having chloroform: methanol (1:1) v/v. Brine shrimp (A. salina larvae) eggs were hatched in a shallow rectangular plastic dish, filled with sea water. An unequal partition was made in the plastic dish with the help of a perforated device. Eggs were sprinkled into larger compartment, which was placed under the dark condition while the smaller compartment was opened to ordinary light. After two days naupils were collected. A sample of the test extract and fraction were prepared and transferred to vials. Some vials were kept as control having solvent only. The solvent was allowed to evaporate overnight. When shrimp Larvae were ready, 1 mL of sea water was added to each vial along with 10 shrimps and the volume was adjusted with sea water to 5 mL per vial and give

yeast 1 pipettes. After 24 hours the number of surviving shrimps was counted. Each experiment was replicated thrice.

Thin Layer Chromatography (TLC) Extract and fraction obtained then speckled on

plate TLC silica gel GF254 and developed with appropriate mobile phase. Detection with UV254, UV366, and cerium (IV) sulphate was conducted to monitoring bioactive compounds.


Extraction and activity test with BST The fresh lobak leaves were dried under sunlight

and covered with black cloth. This was carried out to protect compounds from oxidation or enzymatic reactions such as decomposition, change on the pH stimulate hydrolysis of iridoid and glycoside flavonoid compounds (Cannell, 1998). Drying process stopped when the leaves can be easily broken. There was effort to maintain the water level in raw material to 5-10%. It was expected at that water level, most fungi can not grow. The raw material then powdered to easily assist the penetration of solvent onto cellular structure of plant, in other to help secondary metabolite dissolution and broaden extraction field (Cannell, 1998). Bioassay guided extraction using BST was aimed to determine the activity of chloroform and methanol extract. BST was simple, fast, reliable, inexpensive, reproducible and can be used to gain depiction of toxicity from one compound or substance (Carballo et al, 2002) by counting the total death of A. salina (Meyer et al., 1982). Brine shrimp bioassay results (Table 1) clearly indicated that methanol extract has more toxic effect than chloroform extract.

Table 1. Results of BST using chloroform extract and methanol extract of lobak leaves.

Replication (% death) Sample Concentration

(μg/mL) 1 2 3 1000 80 84 80 500 64 70 64

Methanol extract

100 10 0 34 1000 6 28 14 500 10 26 8

Chloroform extract

100 12 20 4 Control 0 8 6

According to Lee et al. (2006), the activity of a

methanol extract of radish (R. sativus) sprouts for the induction of nicotinamide adenine dinucleotide (phosphate) NAD(P)H/quinone reductase (QR), which plays critical roles in protection against chemical carcinogens and other toxic xenobiotics, was examined in murine Hepa1c1c7 cells. Active


160

substance indole-3 carbinole in lobak can be use as anti tumor, preventing carcinogenesis against cell line estrogen responsive, serves as immunomodulator and increase TNF (tumor necrosis factor) (Irma and Gilang, 2008). The methanol extract was found to be the most active extract, and then partitioned using liquid-solid partition with ethyl acetate, and result in two fractions. The two fractions obtained were then tested with BST. TLC was conducted on every stages of partition process to monitor the content of compounds and to ensure that there is no overlapping compound between the two extracts or fractions. The result shows that insoluble ethyl acetate fraction caused a higher percent death than soluble ethyl acetate fraction (Table 2.).

Table 2. Results of BST from soluble ethyl acetate fraction and insoluble ethyl acetate fraction of lobak leaves.

Percent death (%) Concentration

(μg/mL) Soluble ethyl

acetate fraction

Insoluble ethyl acetate fraction

100 10 84 According to Meyer et al., (1982) several naturally extracted products which had LC50 < 1000 µg/mL using brine shrimp bioassay were known to contain physiologically active principles. Although toxicity test using BST does not give a clear depiction on cytotoxicity against cancer cell, however this method has been reported useful for screening anticancer test. Seventy plants collected from Central Kalimantan shown that 17 plants were potential as bioactive compound resources (Wahyuningsih et al., 2008). This result showed that the toxicity activity of the insoluble ethyl acetate fraction of lobak leaves (84% death) was higher than that of the other

fractions, so this fraction could be potential as anticancer candidate. The antioxidant properties of radish (Raphanus sativus L.) sprouts (Kaiware Daikon) extract, in which the glucosinolate glucoraphasatin (GRH), showing some antioxidant activity, is present at 10.5% w/w. (Barillari et al., 2006; Salah-Abbès, et al., 2007; Yee et al., 2007). Sulforaphan (SFN) from Brassicaceae family especially broccoli (Brassica oleacea italica), was reported could induce apoptosis in cancer cell. SFN has been identified as potent inducers of phase 2 enzymes in human (Alessio, 2008).

Duthie et al. (2007) reported that free radicals cause damage to the DNA and other molecules. Over time, such damage may become irreversible and lead to disease including cancer. Antioxidants have been used as important protective agents for human health (Poon et al., 2004). Because antioxidants can neutralize free radicals as the natural by-product of normal cell processes, daily consumption antioxidant was suggested to prevent cancer. Antimicrobial bioassay Staphylococcus aureus local strain was used to test antibacterial activity. Cultures for experiments were regenerated into Nutrient agar (NA) slants and incubated at 37oC for 24 hours for bacterial proliferation. Mueller Hinton (MH) was used to test antibacterial activity because it has complete nutrition. Agar-well bioassay was employed for testing antibacterial activity of lobak leaves. The medium seeded with test organism were punctured with sterile cork borer to make wells (6 mm diameter) (Ali et al., 2006). Each extracts were made to a final concentration of 60, 70, 80, and 100%. Antimicrobial activity of chloroform and methanol extract lobak leaves as shown in Table 3.

A B C Figure 1. Result of zone of inhibition of soluble ethyl acetate fraction against S. aureus at (A) 30 %, (B) 40%, (C) 50%.

RAKHMAWATI et al. – Raphanus sativus leaves as anticancer and anti microbes

161

Table 3. Antimicrobial activity of chloroform and methanol extract lobak leaves.

Zone of inhibition (mm) Sample 0,1% 60% 70% 80% 100% Chloroform extract - 0 0 0 0 Methanol extract - 7,78 7,29 9,86 12,68 DMSO control - - - - 0 CMC control 0 - - - -

Methanol extract shown to be more toxic than chloroform extract. The polarity from methanol extract showed by growth inhibition against positive-gram bacteria (Hartini, 2008). Table 3 shows increase zone of inhibition by methanol extract from various concentration. Antibacterial compound in lobak leaves tend to be polar. This can be shown from Table 3 that the inhibitory activity (measured by zone of inhibition) of chloroform extract was not pronounced against S. aureus. Saponin, flavonoid and polyphenol in lobak leaves and sprouts are potential as antimicrobial. Methanol extract of lobak sprouts contain isothiocyanate compound which can inhibit bacterial activity in mouth (Ervina et al., 2001). Several researchers have reported that methanol extracts have potential activity against bacteria. Methanol extract of Tectona grandis, Asphaltum punjabianum, and Valeriana wallachi have been reported inhibit Alternaria cajani, Curvularia lunata, Fusarium sp., Bipolaris sp. and Helminthosporium sp. in various concentration (1000, 2000, 3000, 4000, 5000 μg/mL) (Shalini and Srivastava, 2008). The methanol extract of Piper ribesoides root was effective on S. aureus. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values of the methanol extract of P. ribesoides were 3.125 mg/mL and 6.250 mg/mL, respectively (Zakaria et al., 2007). Methanol extract of Cassia nigricans Vahl. is also reported potential as antimicrobial candidate (Ayo and Amupitan, 2004).

Furthermore, methanol extract was partitioned with ethyl acetate to yield 2 fractions, soluble and insoluble ethyl acetate fraction. Soluble ethyl acetate has more polar compounds. On the other hand, insoluble ethyl acetate has semi polar compounds. Each extracts were made to a final concentration of 30, 40 and 50% (Figure 1 and Table 4).

Table 4. Antimicrobial activity (Zone of inhibition) of soluble and non-soluble ethyl acetate lobak leaves methanol extract.

Zone of inhibition (mm) Sample 30 % 40% 50% Insoluble ethyl acetate 0 0 0 Soluble ethyl acetate 5,21 7,58 10,64 CMC control - - 0 Ethyl acetate control - - 0

The current work has shown that soluble ethyl acetate is a potential source of antimicrobial agents and it is active against S. aureus (gram-positive bacteria). We assumed that this due to the existence of polar compounds in soluble ethyl acetate fraction. Based on the cell wall structure; gram-negative bacteria have an outer cell wall that is rich in lipopolysaccharides, preventing the polar compounds from penetrating the membrane causing cell lyses, whereas gram-positive bacteria do not have lipopolysaccharides that decorate the membrane, therefore the compound can easily destroy the protein porins and cause cell lyses (Jawetz et al., 2005; More, 2007). This finding demonstrated that the higher concentration of sample, result in larger zone of inhibition due to higher amount of bioactive compound to be applied.

Amoxicillin is a member of the penicillin antibiotic group, used as positive control, which is effective against gram-positive bacteria. Amoxicillin inhibits transpeptidase, preventing cross-linking of bacterial cell wall and leading to cell death. Amoxicillin is sufficiently lipophilic to cross through the membranes of gram positive bacteria. The presence of the polar side chain on the 6 position also confers amoxicillin suitable for entrance into gram negative bacteria through their polar porins (Siswandono and Soekardjo, 2000). This result showed that zone of inhibition amoxicillin is 26.7 mm.

This research is opened up the potential use of lobak leaves as anticancer and antimicrobial agents which to our knowledge, is the first report. Bioactive compounds at both of fractions were identified to contain polar compounds. In our study, lobak leaves are not only vegetables, but it san be exploited as used medicinal plant so it can be considered as nutraceuticals which have a nutritional role in the diet and phytochemical constituents of this plant have long term health promoting due to long term use in the daily diet.

CONCLUSION

Insoluble ethyl acetate fraction from methanol extract was the most active (100 µg/mL, 84% death) against A. salina. On the other hand, the soluble ethyl acetate fraction from methanol extract exhibited strong inhibitory activity against S. aureus (10.64 mm).

ACKNOWLEDGMENT

The authors thank to Yustin Nur Khoiriyah, Tahan Ristiningsih, and Jenny Virganita for assistance this research. This research was supported by PHK A-2 Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta, fiscal year 2008.


162

REFERENCES

Alessio, P., O. Marina, B. Giovanna, B. Jessica, R. Iori, M. Paolini, F. Ferroni, F.M. Grazia, G.F. Pedulli, and L. Valgimigli. 2008, Cytotoxic and antioxidant activity of 4-methylthio-3-butenyl isothiocyanate from Raphanus sativus L. (kaiware daikon) sprouts. Journal of Agricultural and Food Chemistry 56 (3): 875-883.

Ali, A., H. Yusminah, dan Darminto. 2006. Penapisan dan karakterisasi parsial senyawa antimikroba dari siput bakau dan profil kromatografi lapis tipis fraksi aktif. Hayati 12: 63-68.

Ayo, R.G. and J.O. Amupitan. 2004. Antimicrobial activity screening of crude extract from leaves of Cassia nigricans Vahl. ChemClass Journal 1: 24-26.

Backer, C.A. and Bakhuizen v.d. Brink, Jr.1968. Flora of Java. Volume 1. Groningen: N.V. Noordhof.

Barillari, J., R. Cervellati, S. Costa, M.C. Guerra, E. Speroni, A. Utan, and R. Loril. 2006. Antioxidant and choleretic properties of Raphanus sativus L. Sprout (kaiware daikon) extract. Journal Agriculture and Food Chemistry 54 (26): 9773-9778.

Cannel, R.J.P. 1998. Natural Products Isolation. New Jersey: Humana Press.

Carballo, J.L., Z.L.H. Inda, P. Perez, and M.D. Gracia-Gravalos. 2002. A comparison between two brine shrimp assays to detect in vitro cytotoxicity in marine natural products. BMC Biotechnology 2 (17): 1-5.

Duthie, G.G, S.J. Duthie, and J.A.M. Kyle. 2000. Plant polyphenol in cancer and heart disease; implications as nutritional antioxidant. Nutrition Research Rreview 13: 79-106.

Ervina, M., I.S. Soediro, and S. Kusmardiyani. 2007. Telaah Fitokimia Akar Lobak (Raphanus sativus L. var. hortensis Back.) sebagai Penangkap Radikal Bebas. [Thesis]. Bandung: Sekolah Farmasi ITB.

Hartini, Y.S., Soegihardjo, Maria, dan K. Kurniawan. 2006. Daya antibakteri campuran ekstrak etanol buah adas (Foeniculum vulgare Mill) dan Kulit Pulosari (Alyxia reinwardtii Bl.). [Laporan Penelitian]. Yogyakarta: Fakultas Farmasi UGM.

Irma dan Gilang. 2001. Tanaman Obat Untuk Penderita Kanker. www.pdpersi. co.id.

Jawetz. E., J.L. Melnick, and E.A. Adelberg. 2005. Microbiology untuk Profesi Kesehatan. Penerjemah: Huriati dan Hartanto. Jakarta: Penerbit Buku Kedokteran EGC.

Lee, S.O. and I.S. Lee. 2006. Induction of Quinone Reductase, The Phase 2 anticarcinogenic marker enzyme, in Hepa1c1c7 cells by radish sprouts, Raphanus sativus L. Journal of Food Science 71 (2): 144-148.

Meyer, B.N., N.R. Ferrigni, J.E. Putnam, L.B. Jacobsen, D.E. Nichols, and J.L. McLaughlin. 1982. Brine shrimp: a convenient

general bioassay for active plant constituents. Planta Medica 45 : 31-34.

More, F.N. 2007. Antimicrobial properties of Conifer Essential Oils, CUEF Report, Departement of Biological Science, Thompsons Rivers University

Nestle, M. 1997. Broccoli sprouts as inducers of carcinogen-detoxifying enzyme systems: clinical, dietary, and policy implications. PNAS 21: 11149-11151

O’Hare, T., L. Force, L. Wong and D. Irving. 2006. Anti-cancer Potential of Asian Brassicas Glucosinolates & Chemoprevention. Kingston: Rural Industries Research and Development Corporation Publication.

Poon, H.F., V. Calabrese, and D.A. Butterfield. 2004. Free radicals and brain aging. Clinical Geriatri Medical 20: 329-359.

Salah-Abbès, J.B., S. Abbès, Z. Ouanes, Z. Houas, M.A. Abdel-Wahhab, H. Bacha, and R.Oueslati. 2007. Tunisian radish extract (Raphanus sativus) enhances the antioxidant status and protects against oxidative stress induced by zearalenone in Balb/c mice. Journal of Applied Toxicology 28 (1): 6 -14

Shalini and R. Srivastava. 2008. Antifungal activity screening and HPLC analysis of crude extract from Tectona grandis, shilajit, Valeriana wallachi. The Internet Journal of Alternative Medicine 5 (2). http://www.ispub.com/journal/the_internet_journal_of_alternative_medicine/volume_5_number_2_3/article/antifungal_activity_screening_and_hplc_analysis_of_crude_extract_from_tectona_grandis_shilajit_valeriana_wallachi.html.

Shoeb, M. 2006. Anticancer agents from medicinal plants. Bangladesh Journal Pharmacology 1: 35-41.

Siswandono dan B. Soekardjo. 2000. Kimia Medisinal. Surabaya: Airlangga University Press

Wahyuningsih, M.S.H., S.Wahyuono, Dj. Santosa, J. Setiadi, Soekotjo, S.M. Widiastuti, R. Rakhmawati, and D.S.C.Wahyuni. 2008. Eksplorasi tumbuhan dari hutan kalimantan tengah sebagai sumber senyawa bioaktif. Biodiversitas 9: 169-172.

Weng, J., C. Tsai, S.K. Kulp., C. Chen. 2008. Indole-3-carbinol as a chemo-preventive and anti-cancer agent, Cancer Letters 262 (2): 153-163.

Wijayakusuma, H. 2000. Ensiklopedia Milenium: Tumbuhan Berkhasiat Obat Indonesia. Jakarta: Prestasi Insan Indonesia

Yee, L.W., E.H.K. Ikram, A.M.M. Jalil, and A. Ismail. 2007. Antioxidant capacity and phenolic content of selected commercially available cruciferous vegetables. Malaysian Journal of Nutrition 13 (1): 71-80.

Zakaria, Z., S. Sreenivasan, and M. Mohamad. 2007. Antimicrobial activity of Piper ribesoides root extract against Staphylococcus aureus. Journal of Applied Biological Sciences 1 (3): 87-90.

PEDOMAN UNTUK PENULIS

BIODIVERSITAS, Journal of Biological Diversity (Biodiversitas) mempublikasikan tulisan ilmiah, baik hasil penelitian asli maupun telaah pustaka (review) dalam lingkup keanekaragaman hayati (biodiversitas) tumbuhan, hewan, dan mikrobia; pada tingkat gen, spesies, dan ekosistem; khususnya dalam (i) bidang biologi molekuler dan genetika, (ii) taksonomi, biosistematik, dan filogenetik, (iii) ekologi dan konservasi biologi (hidupan liar), serta (iv) etnobiologi. Setiap naskah yang dikirimkan akan ditelaah oleh redaktur pelaksana dan redaktur ahli. Penulis diwajibkan menuliskan karyanya dalam Bahasa Inggris, semua tulisan dalam Bahasa Indonesia harus diterjemahkan ke Bahasa Inggris. Jurnal ini terbit empat kali setahun, setiap bulan Januari, April, Juli, dan Oktober. Dalam rangka mendukung upaya pengurangan laju pemanasan global oleh sarana transportasi dan perusakan hutan untuk produksi kertas, penulis sangat dianjurkan mengirimkan naskah melalui e-mail. Naskah dan komunikasinya hanya dapat ditujukan kepada salah satu penyunting pelaksana, dengan tembusan kepada sekretaris redaksi untuk pemantauan. Setiap naskah harus disertai pernyataan bahwa tulisan merupakan hasil karya penulis atau para penulis dan belum pernah dipublikasikan.

Tulisan diketik pada satu sisi kertas putih, ukuran A4 (210x297 mm2), dalam satu kolom, menggunakan spasi ganda, jenis huruf Times New Roman, ukuran 12 point, dengan jarak tepi 2 cm di semua sisi. Pada tabel dapat digunakan spasi dan ukuran huruf yang lebih kecil. Program pengolah kata atau jenis huruf tambahan dapat digunakan, namun harus PC compatible dan berbasis Microsoft Word. Nama ilmiah (genus, spesies, author), dan kultivar atau strain disebutkan secara lengkap pada penyebutan pertama kali. Nama genus dapat disingkat setelahnya penyebutan yang pertama, kecuali menimbulkan kerancuan. Nama author dapat dihilangkan setelah penyebutan pertama. Misalnya pertama kali ditulis Rhizopus oryzae L. UICC 524, selanjutnya ditulis R. oryzae UICC 524. Nama daerah dapat dicantumkan apabila tidak menimbulkan makna ganda. Penyebutan nama ilmiah secara lengkap dapat diulang pada bagian Bahan dan Metode. Tatanama kimia dan biokimia mengikuti aturan IUPAC-IUB.

Simbol-simbol kimia standar dan penyingkatan untuk nama kimia dapat dilakukan apabila jelas dan umum digunakan, misalnya pertama kali ditulis lengkap butilat hidroksitoluen (BHT) selanjutnya ditulis BHT. Ukuran metrik menggunakan satuan SI, penggunaan satuan lain harus diikuti nilai ekuivalen dengan satuan SI pada penyebutan pertama. Penyingkatan satuan, seperti g, mg, mL, dan sebagainya tidak diikuti titik. Indek minus (m-2, l-1, h-1) disarankan untuk digunakan, kecuali dalam hal-hal seperti “per-tanaman” atau “per-plot”. Persamaan matematika tidak selalu dapat dituliskan dalam satu kolom dengan teks, untuk itu dapat ditulis secara terpisah. Angka satu hingga sepuluh dinyatakan dengan kata-kata, kecuali apabila berhubungan dengan pengukuran, sedangkan nilai di atasnya dituliskan dalam angka, kecuali di awal kalimat. Pecahan sebaiknya dinyatakan dalam desimal. Dalam teks digunakan “%” bukannya “persen”. Pengungkapan ide dengan kalimat yang rumit dan bertele-tele perlu dihindari, sebaiknya digunakan kalimat yang efektif dan efisien. Naskah hasil penelitian diharapkan tidak lebih dari 25 halaman (termasuk gambar dan tabel), naskah telaah pustaka menyesuaikan, masing-masing halaman berisi 700-800 kata, atau sebanding dengan naskah dalam nomor penerbitan ini.

Judul ditulis secara padat, jelas, dan informatif, maksimum 20 kata. Judul ditulis dalam bahasa Indonesia dan Inggris untuk naskah dalam bahasa Indonesia atau bahasa Inggris saja untuk naskah dalam bahasa Inggris. Naskah yang terlalu panjang dapat dibuat berseri, tetapi naskah demikian jarang diterbitkan jurnal ini. Judul pelari (running title) sekitar lima kata. Nama penulis atau para penulis pada naskah kelompok ditulis secara lengkap dan tidak disingkat. Nama dan alamat institusi ditulis lengkap dengan nama dan nomor jalan (lokasi), kode pos, nomor telepon, nomor telepon genggam, nomor faksimili, alamat e-mail, dan website. Pada naskah kelompok perlu ditunjukkan penulis untuk korespondensi beserta alamat dengan urutan seperti di atas. Abstract sebaiknya tidak lebih dari 200 kata, cukup ditulis dalam bahasa Inggris saja. Kata kunci (Keywords) sekitar lima kata, meliputi nama ilmiah dan daerah (apabila ada), topik penelitian dan metode-metode khusus yang digunakan. Pendahuluan (Introduction) sekitar 400-600 kata, meliputi latar belakang, tinjauan pustaka dan tujuan penelitian. Bahan dan Metode (Materials and Methods) sebaiknya ditekankan pada cara kerja dan cara analisis data.

Hasil dan Pembahasan (Results and Discussion) ditulis sebagai satu rangkaian, pada tulisan yang cukup panjang sebaiknya dibuat beberapa sub judul. Pembahasan merupakan jawaban pertanyaan mengapa dan bagaimana hasil penelitian dapat terjadi, bukan sekedar mengungkapkan kembali hasil penelitian dalam bentuk kalimat. Pembahasan yang lengkap dan menyeluruh lebih disukai dari pada pembahasan yang tidak tuntas. Naskah telaah pustaka tanpa sub judul Bahan dan Metode, serta Hasil dan Pembahasan. Kesimpulan (Conclusion) sebaiknya tetap diberikan, meskipun biasanya sudah terungkap pada Hasil dan Pembahasan. Ucapan terima kasih (Acknowledgments) apabila diperlukan ditulis secara singkat. Gambar dan Tabel maksimum tiga halaman, dapat dibuat dengan tinta cina atau printer laser. Judul gambar ditulis di bawah gambar, sedangkan judul table ditulis di atas tabel. Foto dicetak pada kertas glossy dan diberi keterangan. Gambar berwarna dapat diterima

apabila informasi ilmiah dalam naskah dapat hilang tanpa gambar tersebut. Setiap gambar dan foto sebaiknya menyertakan file digital. Penulis dianjurkan menyertakan foto atau gambar untuk sampul depan, meskipun tidak dimuat dalam naskah sendiri. Tidak ada lampiran, semua data atau analisis data dimasukkan dalam Hasil dan Pembahasan.

Pustaka dalam naskah ditulis dalam bentuk nama belakang penulis dan tahun; serta diurutkan dari pustaka lama ke baru. Pada kalimat yang diacu dari beberapa penulis, maka nama penulis diurutkan berdasarkan kebaharuan pustaka. Naskah yang ditulis oleh dua penulis, maka nama keduanya disebutkan, sedang naskah yang ditulis oleh tiga penulis atau lebih, maka hanya nama penulis pertama ditulis diikuti et al. atau dkk., misalnya: Sprent dan Sprent (1990) atau (Smith 1982a, b; Baker and Manwell, 1991; Suranto et al., 1998). Sitasi bertingkat sebagaimana ditunjukkan dengan kata cit atau dalam sebaiknya dihindari, gunakan pustaka asli.

Daftar Pustaka diketik dengan spasi ganda. Sitasi mengikuti CBE-ELSE-Vancouver style dengan modifikasi sebagai berikut:

Jurnal: Saharjo, B.H. and A.D. Nurhayati. 2006. Domination and composition

structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7 (2): 154-158

Buku: Rai, M.K. and C. Carpinella. 2006. Naturally Occurring Bioactive

Compounds. Amsterdam: Elsevier

Bab dalam buku: Boonkerd, T. 2003. Loxogramme involuta, Lycopodium carinatum and

L. complanatum. In: Jansen, P.C.M. and N.W. Soetjipto (eds.). PROSEA, Plant Resources of South-East Asia No. 12: Cryptogams. Leiden: Backhuy Publishers.

Abstrak: Assaeed, A.M. 2007. Seed production and dispersal of Rhazya stricta.

50th Annual Symposium,The International Association for Vegetation Science, Swansea, UK, 23-27 July, 2007.

Prosiding: Alikodra, H.S. 2000. Biodiversity for development of local autonomous

government. In: Setyawan, A.D. and Sutarno (eds.). Toward Mount Lawu National Park; Proceeding of National Seminary and Workshop on Biodiversity Conservation to Protect and Save Germplasm in Java Island. Sebelas Maret University, Surakarta, 17-20 Juli 2000. [Indonesia]

Tesis, Disertasi: Sugiyarto. 2004. Soil Macro-invertebrates Diversity and Inter-Cropping Plants

Productivity in Agroforestry System based on Sengon. [Dissertation]. Malang: Post-graduate Program, Brawijaya University. [Indonesia]

Informasi dari Internet: Balagadde, F.K., H. Song, J. Ozaki, C.H. Collins, M. Barnet, F.H. Arnold,

S.R. Quake, and L. You. 2008. A synthetic Escherichia coli predator-p re y ecos ys te m. Mol ecu l a r Sys te ms B io logy 4 : 18 7 . www.molecularsystemsbiology.com

Naskah publikasi “in press” dapat disitasi dan dicantumkan dalam daftar pustaka. “Komunikasi pribadi” dapat disitasi, tetapi tidak dapat dicantumkan dalam daftar pustaka. Penelitian yang tidak dipublikasikan atau sedang dalam tahap pengajuan publikasi tidak dapat disitasi.

Beberapa catatan tambahan. Naskah diketik tanpa tanda hubung (-), kecuali kata ulang. Penggunaan huruf “l” (el) untuk “1” (satu) atau “O” (oh) untuk “0” (nol) perlu dihindari. Simbol α, β, χ, dan lain-lain dimasukkan melalui fasilitas insert, bukan mengubah jenis huruf. Kata-kata dan tanda baca sesudahnya tidak diberi spasi.

Kemajuan naskah. Pemberitahuan naskah dapat diterima atau ditolak akan diberitahukan sekitar satu bulan setelah pengiriman. Naskah dapat ditolak apabila materi yang dikemukakan tidak sesuai dengan misi jurnal, kualitas materi rendah, format tidak sesuai, gaya bahasa terlalu rumit, terjadi ketidakjujuran keaslian penelitian, dan korespondensi tidak ditanggapi. Penulis atau penulis pertama pada naskah kelompok akan mendapatkan satu eksemplar jurnal yang memuat tulisannya selambat-lambatnya sebulan setelah naskah diterbitkan. Cetak lepas (offprint) hanya diberikan dengan permintaan khusus. Penulis akan kembali mendapatkan satu eksemplar jurnal nomor penerbitan berikutnya.

PENTING: Penulis atau para penulis dalam naskah kelompok setuju memindahkan hak cipta (copyright) naskah yang diterbitkan kepada BIODIVERSITAS, Journal of Biological Diversity. Penulis tidak lagi diperkenankan menerbitkan naskah secara utuh tanpa ijin penerbit. Penulis atau pihak lain diperkenankan memperbanyak naskah dalam jurnal ini selama tidak untuk tujuan komersial. Untuk penemuan baru, penulis disarankan mengurus hak patennya sebelum mempublikasikan dalam jurnal ini.

MOLECULAR BIOLOGY AND GENETICS

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein Type 2 from Soybean [Glycine max (L.) (Merrill)] cv Slamet SUHARSONO, YASSIER ANWAR, UTUT WIDYASTUTI

109-114

Characterization and Purification a Specific Xylanase Showing Arabinofuranosidase Activity from Streptomyces spp. 234P-16 ANJA MERYANDINI, TRIO HENDARWIN, FAHRRUROZI, ALINA AKHDIYA, DEDEN SAPRUDIN, YULIN LESTARI

115-119

TAXONOMY, BIOSYSTEMATICS, PHYLOGENETICS

The Correlations between the Degree of Petal Fusion and the Size of Leaf and Fruit: A Case in Syzygium (Myrtaceae) PUDJI WIDODO, ALEX HARTANA, TATIK CHIKMAWATI

120-123

Some Notes on Biological Aspects of Captive Javan Warty Pig (Sus verrucosus) GONO SEMIADI, RADEN TAUFIQ PURNA NUGRAHA

124-128

ECOLOGY AND BIOLOGICAL CONSERVATION

Enhancing Diversity of Soil Macroinvertebrates in Sengon-based Agroforestry Systems by Mulching Technology SUGIYARTO

129-133

Grazing Habitat of the Rusa Deer (Cervus timorensis) in the Upland Kebar, Manokwari FREDDY PATTISELANNO, AGUSTINA YOHANA SETYARINI AROBAYA

134-138

Population Dynamics of Banteng, Buffalo and Deer in Bekol Savannah, Baluran National Park SUHADI

139-145

ETHNOBIOLOGY

Ethnobotanical Study on the Genus Pandanus L. f. in Certain Areas in Java, Indonesia WARDAH, FRANCISCA MURTI SETYOWATI

146-150

OTHERS

Extraction of Coconut Oil (Cocos nucifera L.) through Fermentation System RINI HANDAYANI, JOKO SULISTYO, RITA DWI RAHAYU

151-157

Potency of Lobak Leaves (Raphanus sativus L. var. hortensis Back) as Anticancer and Antimicrobial Candidates RITA RAKHMAWATI, ENDANG ANGGARWULAN, ESTU RETNANINGTYAS

158-162

Front cover: Sus verrucosus (PHOTO: GONO SEMIADI)

Published four times in one year PRINTED IN INDONESIA

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

ISSN: 2085-4722 (electronic) ISSN: 1412-033X (printed)

biodiversitas vol. 10, no. 3, july 2009

Documents

written hydroxytoluene

scientific articles

managing editor

original research

author s

original content of

secretary editor

oryzae uicc