biodegradation of corrosion inhibitors and their influence on

ARTICLE IN PRESS

Microbiological Research 162 (2007) 355—368

0944-5013/$ - sdoi:10.1016/j.

�Correspondfax: +91 4565 2

E-mail addr

www.elsevier.de/micres

Biodegradation of corrosion inhibitors and theirinfluence on petroleum product pipeline

Aruliah Rajasekar, Sundaram Maruthamuthu, Narayanan Palaniswamy�,Annamalai Rajendran

Biocorrosion, Corrosion Protection Division, Central Electrochemical Research Institute, Karaikudi–630 006, India

Accepted 15 February 2006

KEYWORDSDiesel pipeline;Corrosion inhibitors;Rotating cage meth-ods;Biodegradation;Microbiologically in-fluenced corrosion

ee front matter & 2006micres.2006.02.002

ing author. Tel.: +91 45627779.ess: swamy23@rediffma

SummaryThe present study enlightens the role of Bacillus cereus ACE4 on biodegradation ofcommercial corrosion inhibitors (CCI) and the corrosion process on API 5LX steel.Bacillus cereus ACE4, a dominant facultative aerobic species was identified by 16SrDNA sequence analysis, which was isolated from the corrosion products of refineddiesel-transporting pipeline in North West India. The effect of CCI on the growth ofbacterium and its corrosion inhibition efficiency were investigated. Corrosioninhibition efficiency was studied by rotating cage test and the nature ofbiodegradation of corrosion inhibitors was also analyzed. This isolate has thecapacity to degrade the aromatic and aliphatic hydrocarbon present in the corrosioninhibitors. The degraded products of corrosion inhibitors and bacterial activitydetermine the electrochemical behavior of API 5LX steel.& 2006 Elsevier GmbH. All rights reserved.

Introduction

Generally the major bacteria involved in themicrobially influenced corrosion are anaerobicsulfate reducing bacteria (SRB) (Hamilton, 1985;Voordouw et al., 1994; Graves and Sullivan, 1996;Pope and Pope, 1998; Jana et al., 1999), whoseparticipation in corrosion was evidenced decades

Elsevier GmbH. All rights rese

5 227550;

il.com (N. Palaniswamy).

ago (Von Wolzogen Kuhr and Vander Klugt Water,1934). However, aerobic bacteria and fungi parti-cipate in the corrosion process (Shennan, 1988;Videla and Characklis, 1992; Bento and Gaylarde,2001). The microorganisms influence the corrosionby altering the chemistry at the interface betweenthe metal and the bulk fluid (Jones and Amy, 2002;Little and Ray, 2002). SRB have been repeatedlydetected in oil- and gas-producing facilities, as wellas in transportation and storage facilities and aremost likely the cause for the biocorrosion, souringand biofouling problems that often arise at these

rved.

www.elsevier.de/micres

ARTICLE IN PRESS

A. Rajasekar et al.356

sites (Hamilton, 1985; Burger, 1998). The injectionof sulfate-containing seawater into the reservoirsduring the secondary recovery of oil favors theproliferation of the bacteria. Therefore, most ofthe research on microbially influenced corrosionhas focused on SRB. However, recent studiessuggest that SRB need not be present in abundancein the microbial communities responsible formicrobially influenced corrosion (Zhu et al., 2003;Jan-Roblero et al., 2004). CECRI, India also recentlynoticed the absence of SRB in refined diesel(Maruthamuthu et al., 2005) and naphtha-trans-porting pipelines (Rajasekar et al., 2005). Microbialcorrosion studies involving the use of naturalindividual species without SRB obtained fromindustrial systems are scarce (Muthukumar et al.,2003; Bento et al., 2005). However, such studieswould better address the actual problem andincrease the understanding of the microbial speciesinvolved in microbial corrosion and their interac-tions with metal surfaces. It will be useful for thedevelopment of new approaches for the detection,monitoring and control of microbial corrosion inindustrial facilities.

Organic film-forming inhibitors used in the oil andgas industry are generally of the cationic/anionictype and include imidazolines, primary amines,diamines, amino-amines, oxyalkylated amines,fatty acids, dimmer, trimer acids, naphthaneicacid, phosphate esters and dodecyl benzene sulfo-nic acids. Their mechanism of action is to form apersistent monolayer film adsorbed at the metal/solution interface. Thus, the alteration of themolecule of the inhibitor caused by microbialdegradation during their use, which can affecttheir specific performance on corrosion inhibition(Videla et al., 2000). Microbial degradation ofsimple heterocyclic inhibitor of the type morpho-line (C4H9NO) has recently been reported (Poupinet al., 1998). The degradation involved an enzy-matic attack at the C–N position, followed by ringcleavage to produce glycolic acid (Poupin et al.,1998). Romero Dominguez et al. (1998) reportedthe loss in efficiency of organic corrosion inhibitorsin the presence of Pseudomonas fluorescenceisolated from injection water system used in off-sore oil production. Recently Maruthamuthu et al.(2005) has noticed the degradation of corrosioninhibitor and its effect on the corrosion process in a1400 km petroleum product-transporting pipelineat Northwest, India. In petroleum product pipe-lines, it would be better to know if the corrosioninhibitor is acting as a nutrient source or as biocide,or indeed, of what its effect at all. In the presentstudy, a laboratory experiment was designed toevaluate the degradation of corrosion inhibitor by

employing dominating individual species Bacilluscereus ACE4, and its role on corrosion process inpetroleum products.

Experimental

Background information of the study

A cross-country pipeline in North India transportspetroleum products such as kerosene, petrol anddiesel. This pipeline has intermittent petroleumproduct delivery cum pressure-booting stations atdifferent locations. Severe corrosion and micro-fouling problems have been faced in the pipelineeven though corrosion inhibitor was added. Within30 days, about 200–400 kg of muck (corrosionproduct) was received from a 200 km stretch ofthe pipeline (Maruthamuthu et al., 2005). Thecorrosion product was pushed out of the pipeline bypigs (Cylindrical device that moves with the flow ofoil and cleans the pipeline interior) while cleaningthe pipeline. The corrosion product samples werecollected in sterile containers for microbial enu-meration and identification.

Bacterial identification in corrosion product

By using sterilized conical flasks, samples ofcorrosion products were collected from the diesel-transporting pipeline. These samples were trans-ported using icebox from sites to Central Electro-chemical Research Institute (CECRI) – mobilemicrobiological lab. The collected samples wereserially diluted (10-fold) using 9ml of steriledistilled water-blanks and the samples were platedby pour plate technique. The nutrient agar mediumwas used to enumerate heterotrophic bacteria. Thecollected samples were serially diluted up to 10�6

dilution. One millilitre (1ml) of each sample waspoured into sterile petridishes. The preparedsterile nutrient agar medium was poured intosterile petridishes. The plates were gently swirledso that the medium might be distributed evenly inthe plate. Plates in triplicate were prepared foreach dilution. The plates were inverted andincubated at room temperature for 24 h. After24 h, the colonies were counted. Morphologicallydissimilar colonies were selected randomly from allplates and isolated colonies were purified usingappropriate medium by streaking methods. Thepure cultures were maintained in slants for furtheranalysis. The isolated bacterial cultures wereidentified by their morphological and biochemi-cal characteristics at CECRI microbiological lab,

ARTICLE IN PRESS

Biodegradation of corrosion inhibitors and influence on petroleum pipeline 357

karaikudi. The isolated bacterial cultures wereidentified up to genus level by their morphologicaland biochemical characterization viz. gram stain-ing, motility, indole, methyl red, voges-proskauertest, citrate test, H2S test, carbohydrate fermenta-tion test, catalase test, oxidase test, starch,gelatin, lipid hydrolysis, etc (Holt et al., 1994).Ten genera were identified in the corrosion pro-duct. The following genera were identified by bio-chemical test: Bacillus sp., Micrococcus sp., Vibriosp., Pseudomonas sp., Thiobacillus sp., Ochrobiumsp., Xanthobacter sp., Gallionella sp., Legionellasp. and Acinetobacter sp. The dominating genusBacillus sp. (it has also been confirmed by Instituteof Microbial Technology, Chandigarh by employingbio-chemical analysis) has been selected for furtherstudy, which was about 50% in pumping station II.Besides, the dominating genus was identified by16SrDNA gene analysis as Bacillus cereus ACE4, whichwas selected for further biodegradation and corro-sion studies.

Amplification, cloning and sequencing of16S rDNA gene

Genomic DNA was extracted according to Ausubelet al. (1988). Amplification of gene encoding forsmall subunit ribosomal RNA was carried out usingeubacterial 16S rDNA primers (forward primer50AGAGTTTGATCCTGGCTCAG 30 (E. coli positions8–27) and reverse primer 50ACGGCTACCTTGTTACGACTT30 (E. coli positions 1494–1513) (Weisburget al., 1991). Polymerase chain reaction (PCR) wasperformed with a 50-ml reaction mixture containing2 ml (10 ng) of DNA as the template, each primer ata concentration of 0.5 mM, 1.5mM MgCl2 and eachdeoxynucleoside triphosphate at a concentration of50 mM, 1 ml of Taq polymerase and buffer asrecommended by the manufacturer (MBI Fermen-tas). PCR was carried out with a MastercyclerPersonal (eppendorf, Germany) with the followingprogram: initial denaturation at 95 1C for 1min; 40cycles of denaturation (1min at 95 1C), annealing(1min at 55 1C) and extension (2min at 72 1C);followed by a final extension at 72 1C for 5min. Theamplified product was purified using GFXTM PCRDNA and Gel Band Purification kit (AmershamBiosciences) and in pTZ57R/T vector according tothe manufacturer’s instruction (InsT/AcloneTM PCRProduct Cloning Kit, MBI Fermentas) and thetransformants were selected on Luria bertana (LB)medium containing ampicillin (100 mg/ml) and X-gal(80 mg/ml). Sequencing reaction was carried outusing ABI PRISM 310 Genetic Analyzer (PE AppliedBiosystems). For sequencing reaction Big Dye Ready

Reaction DyeDeoxy Terminator Cycle Sequencingkit (Perkin–Elmer) was employed. The obtainedpartial 16S rDNA sequence was then submitted to aBLAST (Altschul et al., 1990) search to obtain thebest matching sequences. The nucleotide sequencedata have been deposited in GenBank.

Biodegradation of corrosion inhibitors andtheir characterization

In the present study, commercially availableinhibitors used in petroleum-transporting pipelinewere evaluated to find out the nature of degrada-tion, which was used in petroleum pipeline. Theinhibitor I is dodecyl-carboxylic acid-based andinhibitor II is amine-based carboxylic acid com-pounds.

The medium used for detecting the corrosioninhibitor degrading process by ACE4 was Bushnell–-

Hass broth (magnesium sulfate—0.20 gm/l; calciumchloride—0.02 gm/l; monopotassium phosphate—1 gm/l; di-potassium phosphate—1 gm/l; ammo-nium nitrate—1 gm/l; ferric chloride—0.05 gm/l,Hi-Media, Mumbai) and Bushnell–Hass agar. Threesets of Erlenmeyer flasks were used for theinhibitor degradation studies using the selectedbacterial strains. Two sets of Erlenmeyer flaskscontaining 100ml of the BH broth and 400 ppm ofcorrosion inhibitors I and II each with ACE4 havingan optical density of 0.045 at 600 nm (initial loadwas about 2.1� 109) were inoculated. An unin-oculated control flask was incubated parallelly tomonitor abiotic losses of the corrosion inhibitors’substrate. The flasks were incubated at 30 1C for 30days in an orbital shaker (150 rpm). Total viablecounts (TVC) for ACE4 cells were performed afterincubation of inocula at different time periods (3,5, 10, 20, 25 and 30 days). Enumeration of B. cereusACE4 was carried out using the standard platingmethod and the colonies were counted after 48 h ofincubation at 30 1C.

At the end of the 30 days of incubation period,the residual corrosion inhibitors I and II for eachsystem of the entire flask were extracted with anequal volume of dichloromethane. Evaporation ofsolvent was carried out in a hot water bath at 40 1C.The 1 ml of the resultant solution was analyzed byFourier-transform infrared spectroscopy (FTIR) andH1 Nuclear magnetic resonance spectroscopy(NMR). FTIR spectrum (Nicolet Nexus 470) wastaken in the mid-IR region of 400–4000 cm�1 with16-scan speed. The samples were mixed withspectroscopically pure KBr in the ratio of 1:100and the pellets were fixed in the sample holder, andthen the analysis was carried out. Infrared peaks

ARTICLE IN PRESS


localized at 2960 and 2925 cm�1 were used tocalculate the CH2/CH3 ratio (absorbance) andfunctional group of both aliphatic and aromaticcomponents present in corrosion inhibitors. H1 NMR(Bruker, 300mHz) analysis was used to detect theprotons of the nuclei in the diesel compound. Thesample of diesel was dissolved using deutratedchloroform solvent. Tetra methyl silane (TMS) wasused as a reference standard.

The corrosion inhibitors I and II were character-ized to find out the quantitative degradation byemploying high performance liquid chromatography(HPLC) and gas chromatography-mass spectroscopy(GC-MS), respectively. Since inhibitor I could not becharacterized by GC-MS because of the nature ofthe product, HPLC has been employed for thequantitative degradation. The 1 ml of the resultantcorrosion inhibitor solution was analyzed by Ther-mo Finnigan gas chromatography/mass spectro-metry (Trace MS equipped with an RTX-5 capillarycolumn (30m long� 0.25mm internal diameter)and high purity nitrogen as carrier gas. The ovenwas programmed between 80 and 250 1C with aheating temperature of 10 1C/min. The GC reten-tion data of the inhibitor correspond to thestructural assignations carried out after Wielylibrary search with a database and by mass spectrainterpretation. The HPLC solvent delivery systemthat consisted of analytical–shim-pack CLC-OCTADECYL SILANE (ODS-C18, 4.6mm ID, 25 cm) and UV-spectrophotometric (240 nm) were from SHIMADZU,Japan. The volume of sample injection is a loop fullof 20 ml with the flow rate 1ml/min. The mobilephase is methanol.

Inhibitor efficiency test

Rotating cage testCorrosion inhibition efficiency was studied by

rotating cage test (ASTM G170, Papavinasam et al.,2000). API 5LX grade steel (C-0.29 max, S-0.05max, P-0.04 max, Mn-1.25max.) coupons of size2.5� 2.5 cm were mechanically polished to mirrorfinish and then degreased using trichloro ethylene.Four coupons supported by polytetro fluro ethylene(PTFE) disks were mounted at 55mm apart on therotatory rod. Holes were drilled in the top andbottom PTFE plates of the cage in order to increasethe turbulence on the inside surface of the coupon.The rotatory rod runs at 200 rpm, which corre-sponds to a linear velocity of 0.53m/s. In thepresent study the following systems were used:500ml of diesel with 2% water containing 120 ppmchloride as a control system I; 500ml of diesel with2% water containing 120 ppm chloride and 2ml of

inoculum about 108 CFU/ml as a control system II;500ml of diesel with 2% water containing 120 ppmchloride and 10 ppm of corrosion inhibitors I and IIeach and marked as systems III and IV; while 500mldiesel with 2% of water containing 120 ppmchloride, 10 ppm of corrosion inhibitor I and II eachwith 1% BH broth for bacterial growth andinoculated with 2ml of inoculum about 108 CFU/ml as the experimental systems V and VI, respec-tively. Since bacteria need inorganic nutrients, BHbroth has been added in the presence of bacterialsystem. After 7 days, the coupons were removedand washed in Clark’s Solution for 1min to removethe corrosion products, rinsed with sterile distilledwater, and then dried. Final weights of the sixcoupons in each system were taken and the averagecorrosion rates were also calculated and standarddeviations are also presented. The inhibitionefficiency (IE) was calculated as follows:

Inhibition efficiency ðIE%Þ ¼W�W inh

W� 100,

where Winh and W are the values of the weight-lossof steel after immersion in solutions with andwithout inhibitor, respectively.

Electrochemical methods for the evaluation ofinhibitors

After the weight-loss experiments (rotatingtest), electrochemical tests were carried out in aspecial cell containing aqueous medium collectedfrom the rotating cage (Schiapparelli and Mey-baum, 1980). API 5LX steel coupon of size 1 cm2

(0.155 inch2) as working electrode, and a standardcalomel electrode (SCE) and a platinum wire ascounter electrode were employed for impedanceand polarization studies. An EG & G electrochemi-cal impedance analyzer (Model M6310 with soft-ware M398) was used for AC impedancemeasurements. After attainment of a steady-statepotential, an AC signal of 10mV amplitude wasapplied and impedance values were measured forfrequencies ranging from 0.01 to 100Hz. The valuesof Rct were obtained from the Nyquist plots. Afterfinishing the impedance study, the same couponswere used for polarization for avoiding the filmdisturbance in the oxide film in the presence ofbacteria. The tafel polarization curves were ob-tained by scanning the potential from the opencircuit potential toward 200mV anodically andcathodically. The scan rate was 120mV/min.Polarization measurements were carried out po-tentiodynamically using model PGP201, employingpotentiostat with volta master-1-software.

ARTICLE IN PRESS

10 5 10 15 20 25 30 35

10000

1E+08

1E+12

Incubation time (days)

log

CF

U /m

l

Corrosion Inhibitor ICorrosion Inhibitor IIControl

Figure 1. Growth of Bacillus cereus ACE4 in BH liquidmedium in the presence and absence of corrosioninhibitors I and II.


Surface analysis studyTo verify the adsorption of inhibitor on the metal

surface in rotating cage test after 10 days, the filmformed on the metal surface was carefully removedand dried, mixed thoroughly with potassium bro-mide (KBr) and made as pellets. These pellets aresubjected to FTIR spectra (Perkin–Elmer, NicoletNexus �470) to find out the protective film formedon the surface of the metal coupons.

Results and discussion

In oil pipelines, water can also stratify at thebottom of line if the velocity is less than thatrequired to entrain water and sweep it through thepipeline system. Liquids (hydrocarbon) stratifyalong the bottom of the pipe, with water forminga separate layer beneath the liquids where hydro-carbon degradation occurs at the interface easilyby microbes. Hence, the role of bacteria ondegradation and corrosion is an important area inpetroleum product pipelines. The involvement ofbacterial species on corrosion inhibitor degradationand corrosion has been studied by various investi-gators (Freiter, 1992; Prasad, 1998; Videla et al.,2000; Maruthamuthu et al., 2005). This is the firststudy that enlightens the role of individual speciesof Bacillus cereus ACE4 on biodegradation ofcorrosion inhibitor in petroleum products and itsinfluence on corrosion process in tropical countries.

Identification of bacterial isolates

The diesel hydrocarbon biodegradative strainACE4 was isolated from the corrosion product ofdiesel-transporting pipeline, North India. The pre-liminary identification of ACE4 by biochemical testindicated that the isolate belongs to the genusBacillus sp. Phenotypic profile of strain ACE4 isshown in Table 1. Amplification of gene encodingfor small subunit ribosomal RNA of ACE 4 wascarried out using eubacterial 16S rDNA primers. The

Table 1. Biochemical characterization of strain ACE4

Positive test

CatalaseCytochrome oxidaseVoges-Proskauer test

Reduction of nitrate, Gelatinase Casein hydrolysis,D-glucose, fructose, maltose, salicin, trehalose, andxyloseElectron acceptors, e.g. Fe(III), selenate

16S rDNA amplicons derived from ACE4 was clonedin pTZ57R/T vector. The recombinant plasmid(pACE4, harboring 16S rDNA insert) was partiallysequenced. The sequence obtained was matchedwith the previously published sequences availablein NCBI using BLAST. Sequence alignment andcomparison revealed more than 99% similarity withBacillus cereus. The nucleotide sequence data havebeen deposited in GenBank under the sequencenumber AY912105.

Biodegradation analysis

Enumeration of bacteriaThe total viable count of bacteria in the presence

and in the absence of corrosion inhibitors I and IIduring degradation is presented in Fig. 1. The countis ranging between 104 and 107 in the presenceof inhibitor I, while in the presence of inhibitor II,the count is rangingbetween 106 and 109. In theabsence of corrosion inhibitor, the ACE4 countdecreased ranging between 1.1� 101 and2.31� 102 was noticed, although initial load(2.1� 109) was same in all the systems. Theproliferation of bacteria is higher in the presence

Negative test

Indole productionStarch hydrolysisSucrose, galactose, adonitol, arabinose, cellobiose,inulin, sorbitol, mannose, lactose, melibiose, raffinose,rhamnose, mannitol, maltose

Inositol

ARTICLE IN PRESS


of inhibitor II compared to inhibitor I. It could beexplained that ACE4 utilizes the inhibitors asorganic source with inorganic nutrients from theBH media for their proliferation. It indicates thatinhibitor II enhanced the proliferation of the ACE4.

Corrosion inhibitor IFTIR spectrum of corrosion inhibitor I (Fig. 2a)

shows N–H stretching bands in the range of3200–3400 cm�1 and the N–H stretching occurs at2662 cm�1. It is due to the amine group present inthe inhibitor I. The unsaturated olefinic band oraromaticQC–H occurs at 3050 cm�1. The aromaticor unsaturated olefinic band is observed in therange of 1800–1750 cm�1. The strong band at1705 cm�1 is due to CQO stretching band, itindicates the presence of carboxylic acid group ininhibitor. The peaks at 1454 and 1279 cm�1 are dueto C–N asymmetric and symmetric stretchingbands. The peak at 933 cm�1 is substituted benzenering band or olefinic out-of-plane bending band.The peak at 734 cm�1 is due to aromatic planebending C–H band for the presence of benzene ringor olefinic out-of-plane bending C–H band.

In the presence of bacteria with corrosioninhibitor I (Fig. 2b), the N–H stretching bands areobserved in the range of 3200–3400 cm�1 and theunsaturated olefinic band (QC–H) occurs at3050 cm�1. The methyl (CH3) and methylene (CH2)protons are observed in the range of 2922 and2857 cm�1, respectively. The N–H stretching bandoccurs at 2677 cm�1. The olefinic (QC–H) overtoneband is observed between 1900 and 1950 cm�1. The

100

80

60

40

20

0

100

80

60

40

20

0

4000 3500 3000 2500 2000 1500 1000 500

Wavenumbers (cm-1)

% T

ran

smit

tan

ce

(a)

(b)

Figure 2. Fourier-transform infrared spectrum. (a) Cor-rosion inhibitor I (uninoculated system- control). (b)Inoculated with Bacillus cereus ACE4.

strong band at 1706 cm�1 is due to CQO stretchingband. The peaks at 1454 and 1267 cm�1 are due toC–N asymmetric and symmetric stretching bands.The peak at 933 cm�1 indicates the presence of pi-substituted benzene ring due to the substitutionreaction induced by bacteria and a peak at734 cm�1 is due to olefinic or aromatic C–H out-of-plane bending band. FTIR spectrum reveals thatthe substitution reaction occurs in benzene ring,which is due to the bacterial activity.

NMR spectrum of corrosion inhibitor I shows thecharacteristic band in Fig. 3a. The multiplet peaksat 7 ppm are due to aromatic C–H protons. Thesinglet peak at 5.37 ppm is due to olefinic proton.Two types of amine protons can be observed, andone as a quartet in 2.59–2.57 ppm. The amineproton peak is observed from 2.15 to 2.39 ppm. Thealiphatic methylene (CH2) peaks are noticed at 1.1and 1.2 ppm and the methyl proton peaks areobserved at 0.89 and 0.99 ppm. It reveals thepresence of olefinic protons and amine-basedcompounds in corrosion inhibitor I. In the presenceof bacteria (Fig. 3b), the two types of olefinicprotons can be observed at 5.35, 5.33 and5.28 ppm. The disappearance of aromatic protonsat 7 ppm reveals that bacteria consumed thearomatic compound and formed the olefinic com-pound via 5.33 and 5.35 ppm as a doublet peak and

10 9 8 7 6 5 4 3 2 1 0ppm

(a)

(b)

Figure 3. H1 NMR Spectrum: (a) corrosion inhibitor I(uninoculated system – control) and (b) inoculated withBacillus cereus ACE4.

ARTICLE IN PRESS

90

70

50

30

10

% T

rans

mit

tanc

e

140

100

60

20

3000 2000 1000

Wavenumbers (cm−1)

(a)

(b)

Figure 5. Fourier-transform infrared spectrum: (a) Cor-rosion inhibitor II (uninoculated system – control) and (b)Inoculated with Bacillus cereus ACE4.


5.28 ppm singlet peak. The amine proton peak isobserved in the range of 1.85–2.51 ppm as amutiplet peak and aliphatic peak is noticed at1.58 and methyl protons can be noticed at 0.28and 0.97.

HPLC spectrum for corrosion inhibitor I ispresented in Fig. 4. In control system (uninoculatedsystem), five peaks can be noticed, which indicatesthe presence of five components in the inhibitor I(Fig. 4a). The peak areas of the five componentsare ranging between 5.9 and 579.2mV s. Thehighest peak (area, 592.5mV s) alone can benoticed in the presence of ACE4 inoculated system(Fig. 4b). It indicates that bacteria consume all thecomponents within 30 days, except a component at3.910 retention time; whereas 86% of concentra-tion reduction (61.61mV s) can be noticed.

Corrosion inhibitor IIFT-IR spectrum of corrosion inhibitor II shows

(Fig. 5a) the presence of the N–H stretching bandsin the range of 3250–3400 cm�1. It is due to theamine group present in the inhibitor and thearomatic C–H stretching band is observed at3050 cm�1. The methyl (CH3) and methylene (CH2)aliphatic saturated C–H stretching bands areobserved at 2922 and 2856 cm�1, respectively.The N–H stretching band can be noticed at2662 cm�1. The aromatic overtone band or olefinic(QC–H) is observed in the range of 1900–

1800 cm�1. The CQO stretching band is observedat 1700; it is due to the presence of carboxylic acidgroup. The peak at 1554 cm�1 is due to aromaticCQC stretching band and the peak at 1456 cm�1 isdue to aromatic C–C stretching band. The C–Nasymmetric stretching is observed at 1397 cm�1 andC–N symmetric stretching is observed at 1304 cm�1.

40

30

20

10

3.53

0

4.90

3

3.91

0

7.15

3

9.31

3

3.85

0

0

0 5 10 15

Vol

tage

(m

V)

Time (min.)

(a)

(b)

Figure 4. HPLC spectrum for corrosion inhibitor I: (a)Corrosion inhibitor I (uninoculated system – control) and(b) inoculated with Bacillus cereus ACE4.

The peak at 1078 cm�1 is due to aromatic C–O–Cdelocalization band. The peak at 968 cm�1 is due tothe substituted benzene ring. The aromatic bend-ing band occurs at 722 cm�1.

In the FT-IR spectrum of corrosion inhibitor II inbacterial inoculated system, (Fig. 5b) the N–Hstretching band can be observed in the range of3250–3500 cm�1. The olefinic (QC–H) stretchingband is observed at 3050 cm�1. The aliphaticmethyl (CH3) and methylene (CH2) C–H stretchingbands are observed at 2919 and 2854 cm�1,respectively. The N–H stretching band is observedat 2662 cm�1. The CQO stretching band is ob-served at 1716 cm�1, whereas the N–H plane-bending band can be observed at 1641 cm�1. TheCQC stretching band at 1549 cm�1 and C–Cstretching band at 1400 cm�1 are also observed.The C–N asymmetric band occurs at 1400 cm�1 andthe symmetric stretching band occurs at1227 cm�1. The olefinic C–C stretching band canbe noticed at 1048 cm�1 and olefinic (QC–H) out-of-plane bending band is observed at 730 cm�1. Thedisappearance of peak at 968 and 722 cm�1

(benzene ring out-of-plane bending band) is dueto the consumption of aromatic compound by thebacterial activity. The NMR spectrum of corrosioninhibitor II is shown in Fig. 6a. The aromatic protonpeak is observed at 7 ppm as a singlet peak. Theolefinic (QC–H) proton peak occurs at 5.32 ppm.The amine protons are observed at 3, 2.79 and2.29–1.9 ppm and the aliphatic methylene (CH2)protons peak is observed at 1.59 and 1.29 ppm.

ARTICLE IN PRESS

Table 2. GC-MS data of pure corrosion inhibitor II

Retention time(min)

Compound

0.90 1-Hexadecanol1.00 3-Nonen-2 one1.07 1-Octadecyne,1.10 Cyclohexane, 1-methyl 2-propyl1.24 2.propennic acid octyl ether1.35 Benzene, 1,2,3,5-tetramethyl1.720 Tetradecane, 1-chloro1.55 Benzene, 1,2 diethyl

11.22 N-Hexadecanoic acid13.16 Oleic acid13.35 Pyridine, 2-tridecyl15.14 Pyridine, 2-tridecyl15.94 Phenol,2,6-di(t-butyl)-

4(cyclohexancylidene) amino14.30 Pyridine, 2-tridecyl

100

90

80

70

60

50

40

30

20

10

00 5 10 15 20 25 30

Time (min)

Rel

ativ

e ab

unda

nce

Figure 7. GC-MS spectrum of pure corrosion inhibitor II.

10 9 8 7 6 5 4 3 2 1 0ppm

(a)

(b)

Figure 6. H1 NMR Spectrum:(a) Corrosion inhibitor II(uninoculated system – control) and (b) Inoculated withBacillus cereus ACE4.

100

90

80

70

60

50

40

30

20

10

00 2 4 6 8 10 12 14 16 18 20 22 24 26 28

Time (min)

Rel

ativ

e ab

unda

nce

Figure 8. GC-MS spectrum of corrosion inhibitor IIinoculated with ACE4.


A methyl proton (CH3) peak can be noticed at0.87 ppm. In the NMR spectrum of corrosion inhi-bitor II in bacterial inoculated system (Fig. 6b), twotypes of olefinic protons are observed. The singletpeak at 6.1 ppm is for olefinic protons; formed fromthe decomposition of aromatic ring and the olefinicproton peaks can be observed as singlet peak at5.33 ppm. The amine proton peaks are observed at2.82 ppm, and ranging between 2.02 and 2.19 ppm.The aliphatic methylene proton peaks are observedat 1.5 and 1.28 ppm and the methyl proton peak isobserved at 0.91 ppm.

The GC retention data of the inhibitor IIcorrespond to structural assignations performedafter NIST (library search) with a database andby mass spectra interpretation are presented inTable 2. From the GC-MS analysis (Fig. 7), it wasobserved that the corrosion inhibitor (uninoculatedsystem) consists of aliphatic hydrocarbons, includ-ing cyclohexane, octadecyne, n-hexodecanoic acid,nonen, tetradecane, and aromatic carbons, includ-ing benzene 1,2-diethyl, pyridine and phenol. Themajor component is oleic acid. In the presence ofACE4 (Fig. 8), it utilizes the aliphatic componentsincluding nonen-2 one, 1-octadecyne, cyclohexane,hexodecanoic acid, propenoic acid and aromaticcompounds like benzene, 1,2-diethyl, phenol. Thenew compounds can be observed at 7.23 retention

ARTICLE IN PRESS


time which indicates the presence of phenyl 2,4-di-tet-butyl due to the decomposition or degradationof aromatic compounds (Table 3). The findingsuggests that the strain ACE4 has the high pre-ference to degrade both aliphatic and aromaticcomponents.

The present study reveals that the isolate has thecapacity to degrade both the aromatic and alipha-tic hydrocarbon in the corrosion inhibitors I and II inpetroleum product pipeline. Videla et al. (2000)also noticed microbial degradation of film-forminginhibitor and observed that Pseudomonas sp.isolated from injection water, degraded severalaromatic compounds and generated energy for its

Table 3. GC-MS data of corrosion inhibitor II after 30days of inoculation with strain ACE4

Retention time (min) Compound

Strain ACE40.90 1-Hexadecanol7.23 Phenyl, 2,4-di-tet-butyl9.14 Heptacosane

14.32 Oleic acid17.18 Oleic acid eico ester19.52 Oleic acid, 9-octacenyl ester

Table 4. Corrosion rates of API 5LX with corrosion inhibito

S .no. System Immersionperiod (h)

1 500ml diesel+2% water 80160240

2 500ml diesel+2% water+ACE4 80160240

3 500ml diesel+2% water+corrosioninhibitor I (10 ppm)

80

160240

5 500ml diesel+2% water+corrosionInhibitor II (10 ppm)

80

160240

4 500ml diesel+2%water+ACE4+corrosion inhibitor I(10 ppm)

80

160240

5 500ml diesel+2% water+corrosioninhibitor II (10 ppm)+ACE4

80

160240

metabolic activity. They also suggested thatdimethylamine, imidazoline, morpholine, cyclohexylamine and quaternary ammonium compoundsare biodegradable.

Inhibitor efficiency

Rotating cage test

The inhibition efficiency (IE) of corrosion inhibi-tors I and II is presented in Table 4. The corrosionrate of API 5 LX in control system (withoutinoculum) is ranging between 0.04 and 0.07mm/year up to 240 h. In the presence of microbes andabsence of corrosion inhibitor (system-II), thecorrosion rate is higher in the range between 0.08and 0.12mm/yr than in the absence of microbes.Inhibitor I gives inhibition efficiency ranging be-tween 90% and 93% while inhibitor II gives theefficiency ranging between 56% and 88% up to 240 hin the absence of bacteria. In the presence ofinhibitor I along with bacteria, the inhibitionefficiency is between 66% and 76%, while addinginhibitor II with bacteria the efficiency reduces andit is ranging between 31% and 40% up to 240 days.

rs in different system

Weight loss (mg) Corrosion rate(mm/yr)

Inhibitionefficiency (%)

5.75 0.04 —20.25 0.07 —29.85 0.07 —

10.36 0.08 —29.15 0.11 —49.51 0.12 —

0.381 0.003 93

2.06 0.008 902.61 0.001 91

2.53 0.019 56

8.41 0.031 8812.78 0.031 57

3.49 0.026 66

7.24 0.027 7511.69 0.029 76

2.53 0.052 31

8.41 0.064 4012.78 0.075 38

ARTICLE IN PRESS


The present observation reveals that bacteriareduces the efficiency of inhibitors I and II about22% and 35%, respectively.

Surface analysis

The FTIR spectrum of the surface film on themetal surface exposed to corrosion inhibitors I andII with ACE4 is shown in Fig. 9. In the presence ofbacteria with corrosion inhibitor I (Fig. 9a), thepeak shown is noted in the range of 2954 and2923 cm–1, which are assigned to the presence of–CH– aliphatic stretching. New peaks are noticed at1463 and 1378 cm–1 and are due to CH def for CH3

group and a peak at 1020 cm�1 indicates thepresence of stretching for –C–O–C– group. A peakat 884 cm�1 indicates the di-substituted benzeneand another peak at 559 cm–1 indicates the pre-sence of iron peak. The absence of peaks at 1705(CQO), 1454 (CQN), 1279 (C–N), 933 and 734 forsubstituted benzene ring bond are noticed whencompared to corrosion inhibitor I (Fig. 2a). In thepresence of corrosion inhibitor II with ACE4 (Fig. 9b)the new peaks at 1464, and 1378 cm–1 are due toCH def for CH3 group. The peak at 1021 cm–1

indicates the presence of stable –C–O–C– group,and di-substituted benzene at 884. The peak at

4000

Tra

nsm

itta

nce,

%

3000 2000 1500 1000 400

Wavenumber , cm−1

(b)

(a)

Figure 9. Surface film on the metal surface in thepresence of corrosion inhibitors with ACE4: (a) Corrosioninhibitor I with ACE4 and (b) corrosion inhibitor II withACE4.

534 cm–1 indicates the presence of iron peak.Although complex is formed on the metal surface,due to the degradation of inhibitor/diesel at theinterface act as humic substance, resulting in thehigh supply of electron to the metal surface andaccelerates the corrosion. It can be inferred thatthe corrosion inhibitor coordinated with Fe2+

through the –C–O–C- and carbonyl oxygen resultingin the formation of Fe2+-corrosion inhibitors com-plex on the metal surface. The absence of peakat 1554 (CQC), 1456 (–C–C–), 1397 (C–N), 1304(C—N), 968 and 722 di-substituted benzene isnoticed when compared to corrosion inhibitor II(Fig. 5a).

Electrochemical study

Figure 10 shows the polarization curve for API5LX in diesel–water systems in the presence and inthe absence of bacterium ACE4 and corrosioninhibitors. The data collected from polarizationare presented in Table 5. The corrosion currentfor control system I (only 120 ppm chloride) is9.88� 10�7 A/cm2 and the ba value is 980mV/decade. The anodic curve also shows passivationand it indicates that corrosion is lesser than theother systems. In the presence of bacteria (systemII), the corrosion current is 1.81� 10�6 A/cm2,while in the presence of corrosion inhibitors I andII, the corrosion currents are 1.87� 10�6 and1.88� 10�5 A/cm2, respectively. Inhibitor II en-hances the corrosion current about one order fromthe bacterial system (control system II) and twoorders from the control system I (only chloride).The bc value for inhibitor II along with bacteria is

0

(a)

(b)

(c)

(d)

− 0.25

− 0.50

− 0.75

− 1.00

10− 9 10− 8 10− 7 10− 6 10− 5 10− 4 10− 3

I (Amp /cm2 )

E (

Vol

ts)

Figure 10. Polarization curves for API 5LX in diesel watersystem, in the presence/absence of ACE4 for differentsystems: (a) 500ml diesel+2% water, (b) 500ml diesel+2%water+ACE4, (c) 500ml diesel+2% water+ACE+corrosioninhibitor I (10 ppm) and (d) 500ml diesel+2% water+ACE+corrosion inhibitor II (10 ppm).

ARTICLE IN PRESS

Table 5. Corrosivity of the various systems

Systems Ecorr (mV) ba (mV/decade) bc (mV/decade) Icorr A/cm2

500ml diesel+2% water �579 980 80 9.88� 10�7

500ml diesel+2% water+B. cereus ACE4 �457 228 90 1.81� 10�6

500ml diesel+2% water+B.cereusACE4+corrosion inhibitors I

�562 136 142 1.87� 10�6

500ml diesel +2% water+B.cereusACE4+corrosion inhibitors II

�700 167 460 1.88� 10�5

Table 6. Impedance parameters for API 5 LX carbon steel in various systems

S. no. Systems Rs (faraday) Rct (kOCm2)

1 500ml diesel+2% water 51O cm2 9.982 500ml diesel+2% water+B. cereus ACE4 163O cm2 7.673 500ml diesel+2% water+B. cereus ACE4+corrosion inhibitors I 3.08 kO cm2 7.584 500ml diesel+2% water+B. cereus ACE4+corrosion inhibitors II 0.84 kO cm2 2.06

− 7500

− 5000

− 2500

25002500 5000 7500 10000

0

0Z' (ohm)

Z''

(ohm

)

(a)

(b)

(c)

(d)

Figure 11. Impedance curves for API 5LX in diesel watersystem, in the presence/absence of ACE4 for differentsystems: (a) 500ml diesel+2% water, (b) 500ml diesel+2%water+ACE4, (c) 500ml diesel+2% water+ACE+corrosioninhibitor I (10 ppm) and (d) 500ml diesel+2% water+ACE+corrosion inhibitor II (10 ppm).


higher than the other systems. These curves revealthat the corrosivity of the systems inhibitors I and IIare higher than of the control. The nature of thecurve for API 5LX in the presence of sodium chlorideshows slight passivation. In the second system(ACE4 with 1% BH broth), ACE4 increases thecathodic current (cathodic depolarization) andslightly enhances the anodic current when com-pared to system I. It can be explained that the bio-degraded products dissolve in water and supplyelectron to metal surface, which accelerates thecathodic reduction process. The end products ofacid slightly influence the anodic process also. Inthe presence of inhibitor I, the dissolved amineproton in water may decrease the cathodic current,whereas the anodic current is increased by themetabolic products of the bacteria dissolved in thecontaminated water. Besides, it can be concludedthat the dissolved products of inhibitor II enhanceboth the anodic and cathodic reactions. It may bedue to the higher degradation of inhibitor II than ofinhibitor I.

Rs and Rct values were derived from theimpedance measurements and are presented inTable 6 and Fig. 11. The Rs values for control systemand bacterial system (sodium chloride) are rangingbetween 51 and 163O cm2. In the presence ofinhibitors I and II, the Rs values are 3.08 and0.84 kO cm2, respectively. The Rs value of inhibitorI is higher than of inhibitor II. It may be due to thesolubility of degraded components of inhibitor indiesel/water system. The high solution resistanceindicates the stability of the product, which may bethe reason for the failure in GC-MS analysis. The Rctvalues for control system is 9.98 kO cm2; which is

higher than of other systems. It supports thepolarization and weight-loss results. In the pre-sence of bacterial system, the resistance is7.67 kO cm2; while adding inhibitors, the Rct valuesare ranging between 2.06 and 7.58 kO cm2. Thereduction of Rct value of inhibitor II supports thepolarization study and it can be explained that dueto the degradation of inhibitor, the efficiencydecreased. In the presence of chloride system,the nature of the curve (451 slope) reveals that the

ARTICLE IN PRESS


diffusion controlled reaction, while in the presenceof bacteria, small semicircle along with straightline indicates the presence of adsorbed biofilm,followed by diffusion control reaction. In thepresence of inhibitor I, the curve shows twocapacitive loops: the first capacitive loop isrelatively small when compared to the second.The first capacitive loop is well defined with highfrequency range. The low frequency part of thediagram is not clearly defined. The high frequencypart represents the formation of intact part of theadsorbed film (Ashassi-Sorkhabi et al., 2002),whereas the low frequency data points are asso-ciated with the Faradic process occurring on thebare metal through defects and pores in theadsorbed inhibitor layer. But in the presence ofinhibitor II, only activation control (anodic reac-tion) can be noticed. It reveals that the degradedproduct of inhibitor I adsorbs on the metal surfaceand influences the electrochemical behavior ofmetal. Hence, the selection of good non-biode-gradable inhibitor or good biocide is an importantcriterion for petroleum product pipelines.

Generally, bacteria utilize energy from theenvironment by consumption of carbon and phos-phorous in the ratio 40:1; if these consume excess,these release out in the form of glucose-6-phosphate and fructose-6-phosphate (Malonyet al., 1990). In the present study, bacterium wasinoculated in inhibitor degradation and corrosioninhibition studies along with BH broth. In thepresent study, 1% of BH broth was added incorrosion inhibition and degradation study, respec-tively, because inorganic nutrients are also neededfor bacterial physiological activity. Since organicand inorganic nutrient sources are needed forbacterial physiology, BH broth was added withbacteria for corrosion evaluation study. Though 1%BH broth consists of 10 ppm phosphate and 10 ppmnitrate, the effect of nutrient on the metal surfaceshould also be considered as an important factor.Cohlen (1976) suggested that phosphates caninfluence the anodic reaction in aerated solution,whereas the phosphate film was formed by reactionwith dissolved oxygen. Because the ferrous phos-phate has some solubility in water, the corrosionreaction is not totally eliminated but is ratherreduced to manageable degree (Pryor and Cohen,1953). Franklin et al. (1990, 2000) investigated theeffect of biofilm on mild steel surface in thepresence of phosphate and other anions (chlorideand sulfate). They found that bacterial biofilmenhanced the propagation of pits, probably be-cause of the uptake of phosphate by the micro-organisms. Bento et al. (2004) concluded that thedissolved oxygen has an important role in the

phosphate-induced passivity of mild steel in thepresence of filamentous fungi, Hormoconis resinae,Paecilomyces variotii, Aspergillus fumigatus, thebacterium Bacillus subtilis and the yeast Candidasilvicola. The anodic and cathodic potentiostaticpolarization curves after 30 and 60 days ofincubation showed regions corresponding to activedissolution, although the condition in the sterilemedium used in the experiments favored passiva-tion of the metal. The film in the presence ofchloride ion in Bushnell Hass medium showed aquite different beaviour. No passivation region wasobserved in polarization curves and the high anodiccurrents registered were associated with thedissolution of iron. But in the present study, inthe presence of 120 ppm chloride without BHbroth, passivation was noticed. It indicatesthat the impact of bacterial physiology on metalsurface is lesser when compared to the othersystems. The higher corrosion rate in thepresence of BH broth with ACE4 may be due tothe adsorption of both inorganic nutrients withACE4. Since bacteria cannot be separated fromnutrients, the physiological activity of bacteriaaccelerates the corrosion rate in the presence oforganic inhibitor. In the present study, due to thepresence of organic and inorganic nutrients, bac-teria may degrade both inhibitor and diesel forenergy purpose and the degraded products ofinhibitor/diesel on metal surface determine theelectrochemical behavior of API 5 LX. The presentinvestigators feel that the nature of the polariza-tion may also depend on the degraded products inwater and the role of microbes on carbon steel.Hence, the degradation should be avoided byemploying non- degradable corrosion inhibitor tocontrol corrosion.

Conclusions

The performance of an organic film-formingcorrosion inhibitor was assesse towards its corro-sion inhibitive efficiency in controlling the corro-sion of API 5LX steel in petroleum productcontaining bacterial contaminant B.cereus ACE4.The dominating isolate Bacillus cereus ACE4(AY912105) was identified in petroleum productpipeline by 16S DNA. This isolate has the capacityto degrade the aromatic and aliphatic carbonpresent in the corrosion inhibitor. It reduces thecorrosion inhibition efficiency of inhibitor by about35%. The present study reveals that non-degradablecorrosion inhibitor is needed for petroleum productpipeline to avoid the microbial degradation ofcorrosion inhibitors.

ARTICLE IN PRESS


Acknowledgments

The authors thank N. Muthukumar for his help intaking Fourier transform infrared spectroscopy(FTIR) and nuclear magnetic resonance spectro-scopy (NMR) and related discussions. Dr. K. Pitch-umani and Mr. Vijayakumar of the School ofChemistry, Madurai Kamaraj University for theirhelp in GC-MS analysis. The authors are grateful toS. Mohanan, P. Subramanian and S. Ponmariappanfor their help in field collection at petroleumproduct pipeline, North West India.

References

Ashassi-Sorkhabi, H., Nabavi-Amri, A.S., 2002. Polariza-tion and impedance methods in corrosion inhibitionstudy of carbon steel by amines in petroleum-watermixtures. Electrochimica Acta. 47, 2239–2244.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,Seidelman, J.G., Struhl, K.E., 1988. Current Protocolsin Molecular Biology. Wiley, New York.

Altschul, S.F., Warren, G., Miller, W., Myers, E.W.,Lipman, D.J., 1990. Basic local alignment search tool.J. Mol. Biol. 215, 403–410.

Bento, F.M., Gaylarde, C.C., 2001. Biodetrioration ofstored diesel oil: studies in Brazil. Int. Biodeterior.Biodeg. 47, 107–112.

Bento, F.M., Englert, G.E., Gaylarde, C.C., Muller, I.L.,2004. Influence of aqueous phase on electrochemicalbiocorrosion tests in diesel/water systems. Mater.Corrosion 55 (8).

Bento, F.M., Beech, I.B., Gaylarde, C.C., Englert, G.E.,Muller, I.L., 2005. Degradation and corrosive activitiesof fungi in a diesel–mild steel–aqueous system. WorldJ. Microbiol. Biotechnol. 21, 135–142.

Burger, E.D., 1998. Method for inhibiting microbiologi-cally influenced corrosion. US Patent 5,753,180.

Cohlen, M., 1976. The breakdown and repair of inhibitivefilms in neutral solution. Corrosion 32 (12), 461–465.

Holt, J.G., Kreig, N.R., Sneath, P.H.A., Stanely, J.T.,1994. In: Williams, S.T. (Ed.), Bergey’s Manual ofDeterminative Bacteriology. Williams and WilkinsPublishers, Maryland.

Franklin, M.J., White, D.C., Isaacs, H.S., 1990. Interna-tional Congress on Microbially Influences Corrosion andBiodeterioration, Tennessee, USA, vol. 3, pp. 35–41.

Franklin, M.J., White, D.C., Little, B., Ray, R., Pope, R.,2000. Spatial and temporal relationships betweenlocalized corrosion and bacterial activity on iron-containing substrata. Biofouling 15, 13–23.

Freiter, E.R., 1992. Effect of a corrosion inhibitor onbacteria and microbiologically influenced corrosion.Corrosion 48 (4), 266–276.

Graves, J.W., Sullivan, E.H., 1996. Internal corrosion ingas gathering system and transmission lines. Mater.Prot. 5, 33–37.

Hamilton, W.A., 1985. Sulphate-reducing bacteria andanaerobic corrosion. Annu. Rev. Microbiol. 39,195–217.

Jana, J., Jain, A.K., Sahota, S.K., Dhawan, H.C., 1999.Failure analysis of oil pipelines. Bull. Electrochem. 15,262–265.

Jan-Roblero, J., Romero, J.M., Amaya, M., Le Borgne, S.,2004. Phylogenetic characterization of a corrosiveconsortium isolated from a sour gas pipeline. Appl.Microbiol. Biotehnol. 64, 862–867.

Jones, D.A., Amy, P.S., 2002. A thermodynamic inter-pretation of microbiologically influenced corrosion.Corrosion 58, 638–645.

Little, B., Ray, R., 2002. A perspective on corrosioninhibition by biofilms. Corrosion 58, 424–428.

Malony, P.C, Ambudkar, S.V, Anantharam, V., Sonna, L.V.,Veradhachamy, A., 1990. Microbail. Rev. 54, 1–17.

Maruthamuthu, S., Mohanan, S., Rajasekar, A., Muthuku-mar, N., Ponmarippan, P., Subramanian, P., Palanis-wamy, N., 2005. Role of corrosion inhibitor onbacterial corrosion in petroleum product pipelinesInd. J. Chem. Tech. 12 (5), 567–575.

Muthukumar, N., Mohanan, S., Maruthamuthu, S., Subra-manian, P., Palaniswamy, N., Raghavan, M., 2003. Roleof Brucella sp. and Gallionella sp. in oil degradation andcorrosion. Electrochem. Comm. 5, 421–427.

Papavinasam, S., Review, R.W., Attard, M., Demoz, A.,Sun, H., Donini, J.C., Michaelian, K.H., 2000. Labora-tory methodologies for corrosion inhibitor selection.Mater. Perform. 39 (8), 58.

Poupin, P., Truffaut, N., Combourieu, B., Besse, P.,Sancelme, M., Veschambre, H., Delort, A.M., 1998.Appl. Environ. Microbiol. 64 (1), 159.

Pope, D.H., Pope, R.M., 1998. Guide for the monitoringand treatment of microbiologically induced corrosionin the natural gas industry. GRI report GRI-96/0488.Gas Research Institute, Des PlainesIll.

Prasad, R., 1998. Selection of Corrosion Inhibitors toControl Microbiologically Influenced Corrosion, COR-ROSION/98, paper no. 276, NACE International,Houston, TX.

Pryor, M.J., Cohen, M., 1953. The inhibition of thecorrosion inhibitor of iron by some anodic inhibitors.J. Electrochem. Soc. 100 (1), 203–215.

Rajasekar, A., Maruthamuthu, S., Muthukumar, N.,Mohanan, S., Subramanian, P., Palaniswamy, N.,2005. Bacterial degradation of naphtha and itsinfluence on corrosion. Corro. Sci. 47, 257–271.

de Schiapparelli, E.R., de Meybaum, B.R., 1980. Micro-bial contamination and corrosion of aircraft integralfuel storage tanks. Eval. Risk Control Mater. Perform.19 (10), 47.

Romero Dominguez, J.R., Garcia Caloca, G., MendozaFlores, J., lbarra Nunez, E.M., 1998. Study on thePresence of Pseudomonas fluorescens on the Efficacyof Three Corrosion Inhibitors (in Spanish), 3rd NACELatin American Region Corrosion Congress, Cancun,Q.Roo, Mexico, Book of abstracts, pp. 51–52.

Shennan, J.L., 1988. Control of microbial contaminationof fuels in storage. In: Houghton, D.R., Smith, R.N.,

ARTICLE IN PRESS


Eggins, H.O.W. (Eds.), Biodeterioration. Elsevier,Barking, pp. 248–254.

Videla, H.A., Characklis, W.G., 1992. Biofouling andmicrobially influenced corrosion. Int. Biodeterior.Biodeg. 29, 195–212.

Videla, H.A., Gdmez de Saravia, S.G., Guiamet, P.S.,Allegreti, P., Furlong, J., 2000. Microbial degradationof film-forming inhibitors and its possible effects onCorrosion inhibition performance corrosion/2000,paper no.00386 (Houston, TX, NACE International,2000).

Von Wolzogen Kuhr, C.A.H., Vander Klugt Water, I.S.,1934. The graphitization of cat iron as an electro-

chemical process in anaerobic solid. Water 18,147–165.

Voordouw, G., Shen, Y., Harrington, C.S., Telang, A.J.,Jack, T.R., Westlake, D.W.S., 1994. Quantitativereverse sample genome probing of microbial commu-nities and its application to oil field productionwaters. Appl. Envir. Microbiol. 60, 760c.

Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J.,1991. 16S ribosomal DNA for phylogenetic study.J. Bacteriol. 173, 697–703.

Zhu, X.Y., Lubeck, J., Kilbane, J.J., 2003. Characteriza-tion of microbial communities in gas industry pipe-lines. Appl. Environ. Microbiol. 69, 5354–5363.

biodegradation of corrosion inhibitors and their influence on

Documents