4/28/15 5:19 AM

FORENSIC Biochemistry • The application of standard biochemical techniques and assays to

criminal cases • DNA Analysis of fingerprinting

Forensics • Means characteristic of, or suitable for a court of law

Physical Evidence • One cannot argue with physical evidence • so with DNA evidence

Person of Historical Significance

• Edmond Locard (1877-1966) o French professor o considered the father of criminalistics o built the world’s first forensic laboratory in France 1910

What are the Crime scene officers searching for at the scene of crime? • Evidence

LOCARD’S EXHANCGE PRINCIPLE • When a suspect comes in contact with an object of person, there is

a cross-transfer of evidence • Evidence Triangle • 2 Aspects of Exchange

o evidence could be left behind o evidence could be taken away

• from the crime scene… Basis of Scene of Crime Search

• Locard’s Principle is the cornerstone of Forensic science • Locard is advanced for his time • lOCARD PRINCIPLE CAN EVEN BE APPLIED TO dna Evidence • Some examples of interchange:

o blood- drops on floor, suspect clothing, etc. Case of Rape

• Alfa Raped Bravo when bravo was unconscious • Brave did not report the crime until two weeks later- no more

evidence • Bravo became pregnant

Ng’s Principle of Born Evidence • Evidence could be born • evidence could be alive • evidence could be running around • 2 aspects:

o not limited to the crime scene o the evidence can be collected even after a lapse of time

Mendel's Laws of Inheritance

Law Definition Dominance Some alleles are dominant while

others are recessive, an organism with at least one dominant allele will display the effect of the dominant allele

Segregation During gamete formation, the alleles for each gene segregate from each other so that each gamete carries only one allele for each gene

Independent Assortment Genes for different traits can segregate independently during the formation of gametes.

Principle of the union of nDNA

• Whenever the haploid nDNA of the sperm and ovum unite in a zygote, the totality of the united nDNA is a proof of such union.

• BASIS OF PARENTAGE STUDY United nDNA Principle

• Whenever the haploid nDNA of the sperm and ovum unite in a zygote, the totality of the united nDNA is a proof of such union

• Peter Ng (2014) Principle of Maternal mtDNA

• MtDNA is inherited along the maternal line and it is an evidence of the maternal lineage

• Peter Ng (2014) • BASIS OF MATERNAL STUDY • Y chromosome is inherited along the paternal line and it is an

evidence of the paternal lineage Maternal Analysis- mitochondrial dna Paternal Analysis- Y chromosome Both parents- full nuclear dna Methods for Human Identification

• DNA Profiling, or DNA fingerprinting o Is a technique that analyzes the unique attributes of a

person’s dna o The term DNA fingerprinting was coined to allude to the

traditional use of fingerprints as a means of human identification

o However, limited in differentiating between identical twins (fingerprints are phenotypical)

o IDENTICAL TWINS DO NOT SHARE CLASSICAL FINGERPRINTS

Uses of DNA Analysis • Identification of dead bodies • Evolution • Inherited diseases • Forensic cases • Paternity testing • Historial • Missing persons • Mass disasters • Military DNA Dog Tag • Convicted felon DNA databases

DNA in the Cell Nucleus • Human DNA • 99% of the DNA between two individuals is identical • DNA tests look at the particular regions of the DNA that don’t seem

to conserve any function—what’s commonly called “junk” DNA Basic Concepts

• PCR- methods of amplifying a specific region of the genome What type of genetic variation?

• Length variation o Short tandem repeats (STRs) o CTAGTCGTGATAGATAGATAGCGATCGT

• Sequence Variation o Singe nucleotide polymorphisms (SNPs) insertion/deletions o GCTAGTCGATGCTCA/T

30 LOCI REGONS • Short Tandem Repeats (STR’s)

Steps in DNA Analysis • CollectionàExtractionàQuantification àGenotyping àInterpretation

of Results à Database Storage and Searching Extraction methods

• Organic o SDS, DTT, EDTA and proteinase k

§ Lyse the cells and extract • Chelex

o Blood stain à incubate with water à incubate at high temperatures

• FTA Paper o Apply blood to paper and allow stain to dry o Can be stored for many many years

How to separate female from the male fragment in a rape case? • Centrifuge

o Chemicals lyse the female vaginal cells, but NOT the sperm § Sperm pellet § Female supernatant

Methods • Vntr (Variable number tandem repeats )and STR

o repeated sequences of 9-18 nucleotides • STR

o repeated sequences of • Capillary Electrophoresis Method

o currently, the FBI tests 13-16 different markers o Capillary Electropherogram

Just multiply all of the probabilities CODIS

• Combines DNA Index System DNA Technologies

• Three generation of DNA testing • Lineage Markers

o Maternal Analysis- mitochondrial dna o Paternal Analysis- Y chromosome o Both parents- full nuclear dna

• RFLP o you need a button-sized

• PCR o billions of copies

• Mitochondrial DNA Analysis o Mitochondrial DNA Analysis (mtDNA) can be used to examine

the DNA from samples o Maternal lineage

§ since during fertilization the tail will be removed and the mitochondria in the sperm is found in the neck, thus no paternal mitochondrial DNA

o HIGH MUTATION RATE DNA Analysis- Royal Family

• Y Chromosomal Analysis • Mitochondrial Chromosomal Analysis • Autosomal nDNA Analysis

Sibling Study

• compare the STR loci BIOCHEMISTRY OF CONNECTIVE TISSUE “I am fed up” Connective tissue

• forms the architectural framework of the body

Extracellular Matrix • Fibrous proteins

o Structural functions § keratins § collagens § elastins

o adhesive functions § fibronectin § laminin

o polysaccharide gel Structural proteins

• fibrous proteins • elongated molecules whose secondary structures are dominant

studctural motif Collagen

• from the greek word “to produce glue” • most abundant vertebrate connective tissue, 25% • major fibrous element

Collagen by the Diverse Forms and Functions (% weight)

• Cornea 64% • liver 4% • Cartilage 50% • lung 10% • Skin 74% • Aorta 12-14% • Cortical bone 23%

Tropocollagen is a Triple Heliz • Tropocollagen

o Basic unit of the collagen fiber o composed of 3 left-handed polypeptide chain

Collagen is rich in glycine and proline • Glycine- nearly 1/3 of all AA residues • proline about 1/4 of all AA residues

Collagend is rich in Modified aMINO aCIDS

• COMPRISED NEARLY 25% OF THE TOTAL aa • PROLINE and lysine residues are covalently modified to 4-

hydroxyproline and 5-hydroxylysine Hydroxylation of Proline

• Needs ascorbic acid Hydroxyproline

• OH group of hYP participates in interchain h-bonding in tropocollagen (added strength)

Formation of Hydroxylysine • Hyl seems to serve as attachment sites for polysaccharides

Ascorbic Acid • Essential to both proline hydroxylase and lysine hydroxylase • reducing agent to maintain the iron • lack of vitamin c à scurvy

Scurvy • severe vit c deficiency • without hyp and hyl collagen is not assembled properly • very weak blood vessels and skin

Collagen is a Glyciprotein • Hyl residues

o Covalently attached to CHO o Disaccharide:

§ Glu-Gal via alpha1,2 glycosidic bond The Primary Structure of Collagen is Unusual (Tropocollagen)

• (Gly-X-Y) Glycine

• Non polar • small

Every third residue is a glycine • Every third residue of each chain passes through the center will

only fit glyine Proline residues are also vital to tropocollagen structure

• Pyrrolidine rings repel each other by steric hindrance Interolecular Hydrogen Bonds Stabilize Tropocollagen

• Staggered peptide groups are oriented Five Major Types of Collagen

Type Molecular

Formula Composition Tissue

Distribution I Type I chains

(alpha1)2 alpha 2

remember this slide from handout Types I, II, III

• Fibrillar collagens • main types of collagen found in connective tissues • Type I- most common • froms collagen fibrils

o thin o cable-like o aggregate into larger bundles or collagen fibers

Type IV • Found exclusively in the basal lamina (basement membrane) • instead of forming fibrils, it assembles into a sheet-like meshwork

Covalent Cross-links increase the mechanical strength of collagen

• Tropocollagen molecules associate to form microfibrils • stabilize by both hydrogen bonds withon the triple helix and

covalent cross-links between tropocollagen tiple helics • cross-lins between lysine side side chains • Collagen Cross Links via Schiff’s Base • Collagen Cross links via Aldol (?) • Covalent cross-links increase the mechanical strength of collagen

o a collagen firbre 1mm thick can hold Stability of Collagen Helix Depends on Cooperative iNTERACTIONS

• Tm- temperature at which half of the helical structure is lost Dependence on Thermal Stability on Imino Acid Conten

• The higher the imino acid content, the more stable the helix • the stability of the helix depends on the locking effect of proline and

hydroxyproline Source Proline plus Ts Tm Body temp.

hydroxyproline Calf Skin 232 85 65 37 Denaturation of Collagen The Biological Assembly of Collagen Requires Many Steps

• Starts in the Rough ER o Synthesis of many chains

• Hydroxylation of proline and lysine residues by vit c. • Golgi Apparatus

o chain alignment in bundles of three formation of disulfide bonds between cysteine resides

o fORMATION OF TRIPLE-HELICLE PROCOLLAGEN o

• Formation of procollagen from 3 pro-chain o Completion of chiains o Packaging of procollagen into transport vesicles o Exocytosis into the extracellular matrix o Pro collagen will be cut by peptidase o Formation of Tropocollagen

§ Removal of N- and C- terminal propeptidases (extension peptidases)

§ Lateral assoc, of collagen molecules followed by covalent cross-linking

• The Collagen Biber is a Staggered Array of Tropocollagen moleculs o Each tropocollagen molecules along a row are not linked end-

to-end o holes- nucleation sites for bone 9ormation

Important Collagen Diseases • Scurvy

o Lack of Vit. C (severe Vit. C deficiency) o without Hyp and hyl, collagen is not assembled properly o WEAK collagen formed à weak tissues

• Ehler Danlos (Ehler’s- “Damn-loose”) o genetic disorder

o pateints have decreased of procollagen peptidase § proalpha1 will accumulate

ú C- and N- will not be cut, no formation of tropocollagen

o appreciabe mounts of procollagen (pro-alpha1 and pro-alpha2) are present in acid extracts of skin from patients

o hypermobility of joints o hyperflexibility of skin o Dermatosparaxis

§ similar condition in cattles • Menke’s Disease

o deficiency in copper results in defective crosslinking of collagen and elastin by the copper dependent enzyme lysyl oxidase

o Genetic disease characterized by lathyrytic symptoms due to the inability to form the proper substrate for lysyl oxidase

• Alport’s Syndrome o both x-linked and autosomal genetic disorders affecting

structure of the type IV collagen fibers, the manor collagen found in the basement membrane of the renal glomeruli (related to laminin as discussed later)

o signs include hematuria leading eventually to end stage renal failure

• Epidermolysis bullosa o keratin defects characterized by skin blistering

sequence abnormalities

• Osteogenesis imperfecta o Brittle bone disease o genetic disorders characterized by bone fragility and

associated connective tisse involvement o result form mutaion of col1 a1 and col1a2 that encode

proalpha1 and proalpha2 of type 1 collagen o Humped-back

§ typical of OI §

• Willam’s Beuren • Alpha 1 antityrpsin • Lathyrism

o disease of animals caused by ingestion of seeds of lathyris odoratus (sweet pea)

o toxic agent- beta-aminopro Elastin

• Protein with rubber-like elastic properties whose fibers can stretch to several times their normal length without tearing

• abundant in lungs, walls or large blood vessels (aorta), elastic ligaments

• small amounts in skin, tendons, loose connective tissues • irregular/random coil conformation • devoid of regular secondary structure • Distinctive amino acid composition

o 1/3 residues are glycine o predominantyl of small, non-polar residues (alanine, valine,

leucine, isoleucine) o > 1/3 alanine and valine, rich in proline, little

hydroxyproline o NO HYDROXYLYSINE

• Primary structure of elastin consists of alternating hydrophobic segments (2 or 3 alanine residues and lysine-rich segments)

• Lysinonorleucine • Desmosine

o Unique to elastin and responsible for its yellow color o results from the condensation of 3 allysine and one lysine side

chain o from condensation of 3 allysine and one lysine side chains

• Elastin fibers are at least 5 times as stretchy as a rubber band of the same cross sectional area

Collagen Elastin Many different genetic types One genetic type

t

Elastin-Associated Disorders

• Willams Beurn Syndrome- deletion in the elastin gene o rigid heart heart valve

• Atherosclerosis o Cross linking in elastin increases with age o reduced elasticity of arterial walls o increased incidence of obstruction to blood flow in elderly

patients • Alpha 1 antitrypsin deficiency

o Antitrypsin for Degradation for elastin o Abraham Lincoln

§ rumored to have Marfan syndrome • Marfan’s Syndrome

o Measure arm length vs height § If arm length > height, consider Marfan’s syndrome

o Lens can easily be dislocated o Michael Phelps

§ rumored to have Marfan’s syndrome Alpha- Keratin

• Mechanically durable and chemically unreactive protein • principle component in the outer epidermal layer, hair, horn, nails,

and feathers • major proteins of hair and fingernails, animal skin • form dimers- pair of alpha keratin chains • alpha keratin chains form microfibrils

Triple helix No triple helix, random coil Gly-X-Y repeating structure No repeating structure

pRESENCE of hydroxylysine No hydroxylysine Carbohydrat- containing No carb Intramolecular aldol cross links Intamolecular desmosine crosslins

Presence of extention peptides No extension peptides

o 2 dimers coiled to form a 4 molecule protofibril (basic structure of keratin)

o 8 protofibirls à microfibril (basic hair structure) • rich in cysteine- form disulfide bonds between 2 adjcent

polypeptide • PERMING

o reduction of disulfide bonds Silk Fibroin

• Beta-pleated sheet structure utilized in fibers spun by silkworms • strong and relatively inextensible

o nearly fully extended polypeptide chain Fibrous Adhesive Proteins in Extracellular Matrix

• Fibronectin o Adhesive glycoprotein o dimer- 2 similar subunits (2,500aa) JOINED BY A PAIR OF

DISULFIDE BONDS NEAR THEIR CARBOXYL END o globular domains separated by regions of flexible polypeptide

chains o 3 FORMS:

§ plasma fibronectin- circulates in blood, enhance blood clotting, wound healing, and phagocytosis

§ cell surface fibronectin § matrix fibronectin- adhesive

o cell adhesion- contributes to the organization of the matrix o cell migration- guide cell migration during embryogenesis

• Laminin o Like a cross o extracellular glycoprotein o large complex of 3 very long polypeptide chains (1500 AA) o consists of functional domains

§ type IV collagen § heparin sulfate § laminin receptor proteins

o functions to anchor cells to the basal lamina enabling epithelial cells to attach to underlying connective tissue

o Basal Lamina

BRAIN METABOLISM

• Soma o contains the nucleus o responsible for the chemical processing of the neuron o where neurotransmitters are produced o Dendrites:

§ receive incoming information o Axon:

§ carry information away from the soma to the synaptic site (connection between neuron-neuron, muscle, or gland)

§ proximal ú expanded portion ú axon hillock ú spatial and and temporal summation

o Ramon Cajel § received Nobel Prize for research on narrow gaps

between neurons • Composition of Neuronal Membrane

o consists a large portion of lipid o proteins

§ have a rapid turnover rate o least amount is carbohydrates o lipids have no metabolic role

§ for integrity of membrane o myelin sheath

§ glycolipids § sphingolipids

• Neurotoxins o can interfere neuronal sodium-gated channels o only a few would actually affect potassium-gated channels o Cationic Guanidino group interact with Anionic Carboxylate

group located at the mouth of the Na channel on its extracellular side

§ tetrodotoxin- paralytic poison from puffer fssh

§ saxitotoxin- from marine flagellates (red tide) § batrachotoxin- steroidal alkaloid from arrow-poison frog

ú specifically binds to voltage gated Na channels ú renders axone membrane highly permeable to Na ú can be reversed via tetrodotoxin

§ scorpion toxins- depolarize by binding to their Na channels

ú does not compete with tetrodotoxin § textraethylammoniun- binds and blocks potassium

channels ú only neurotoxin affecting K channels

• Axon o Surrounded by the myelin sheath o formed from Schwann cells (PNS) o insulators o have gaps without myelin sheath (Nodes of Ranvier)

§ where electrical activity is confined § where salutatory conduction occurs

ú hastens nerve transmission § have direct contact to the surrounding ECF

o Charles Scott Sherington (?) § described the synaptic transmission

o formed from Oligoendrocytes (CNS) • Myelin Proteins

o Myelin Associated GlycoProteins § very important § part of superfamily of immunoglobulins § stabilization of the glial axon junction § lost early in multiple sclerosis

ú lost as MS plaques o Po

§ abundant in PNS § absent in CNS

o Collexin 32 o Peripheral Myelin Protein- 22

§ can undergo point mutation

§ can cause disease Charcot Marie Tooth ú progressive neuropathy ú mostly the hands, legs, feet, are affected

• Unmyelinated Axon o Nerve transmission is slower vs myelinated axon

• Multiple Sclerosis o Lost of myelin sheath in the brain and spinal cord o slows down the action potential

§ action potential is disseminated § there is discontinuation of transmission

o autoimmune disease or infectious o activated T cells enter the brain and initiate the

inflammatory lesion o intrathecal production of oligoclonal Igs o Predisposing factors:

§ Disturbance of lipid and fatty acid metabolism § decreased PUFA and EFA § disturbance in FA elongation § primary increased activation of Phospholipase A1

ú production of lysophospholipid • one FA

§ disruption in muscle control, speech, and visual senses • ENERGY METABOLISM OF THE BRAIN

o Brain § 2% of body mass § 20% oxygen demand § 60% cardiac output § requires 120 grams of glucose per day (15% energy

consumed) ú primarily due to synaptic sites and astrocytes

(responsible ofr uptake of glucose) § Sodium Potassium ATPase pump

ú Goes against the concentration gradient ú 3 Na out, 2 K in ú maintains membrane potential ú even if brain is at rest, still active

§ has very insignificant Glycogen reserves § amino acids can NEVER be source of glucose

ú only in muscle and kidney can gluconeogenesis occur

§ ketone bodies can be a source of fuel during prolonged starvation

ú still needs glucose to replenish intermediates of TCA

ú from acetone, acetoacetate, beta-acetylbutyrate ú conversion of acetoacetate to acetyl CoA (from

succinyl CoA) o Glutaminergic Neuron

§ Produces glutamate from glutamine (from astrocyte) § phosphate-activated glutaminase (PAG) is most

active here § represents a presynaptic neuron § Lactate à pyruvate via NAD (pyruvate dehydrogenase)

ú pyruvate enters the TCA cycle ú produces oxaloacetate ú oxaloacetate à alpha-KG

§ glutamate dehydrogenase is also most active here o Astrocyte

§ produces alpha KG § alpha KG à Glutamate § Glutamine Synthase is most active here

ú transferred to glutaminergic neuron o GABA-ergic Neuron

§ Inhibitory neuron § GABA from Glutamate § alpha ketoglutaric acid (from TCA cycle) § glutamate decarboxylase is most active here

*glutamate is the most abundant excitatory neurotransmitter *GDH is active in all three neurons

*Lactate from astrocyte can be transferred to Glutaminergic (presynaptic) neuron and oxidized to pyruvate, transaminated to alanine, then back to astrocytes *transamination produces the glutamate (via glutamate-glutamine-lactate-alanine shuttle) Amino Acid Metabolism

• GABA shunt o Exclusive to the BRAIN o ALPHA KG à GLUTAMATE (via GDH and NADPD) o GLUTAMATE à GABA o GABA à SUCCINATE SEMI-ALDEHYDE (via transamination) o SUCCINATE SEMIALDEHYDE à SUCCINATE ( via oxidation)

*above steps BYPASS alpha KG, substrate level phosphorylation in TCA *GABA is the most powerful inhibitory neurotransmitter

• AA Shuttle o presynaptic neuron produces glutamate o glutamate goes to astrocytes to be converted to glutamine

• Glutamate-Glutamine BCAA Shuttle

o Forms Branched-Chain AA o Branched Chain keto acids from astrocytes to presynaptic

neuron § coupled to alpha KG- glutamate § BCAA Transferase converts BCKA to BCAA (in the

cytosol of the presynaptic neuron) § BCAA Transferase converts BCAA to BCKA (in the

mitochondrion of the astrocytes) • Resting Potential

o Depolarization § Decreasing the charge difference (-60mV to -40) § opening of sodium channels

ú sodium goes in § reversal of charges § opening of postassion channels

ú potassium moves out o Repolarization

§ Increasing the charge difference § overshoot

• Nernst potential o Membrane resting potential due to ions o delta psy- potential difference o R- gas constant (2x10 ^ -5) o T- absolute temperature o F- Faraday’s constant (96000) o z- charge of ion concerned o natural log of concentration of ions outside over inside

*POTASSIUM IS THE GREATEST CONTRIBUTOR TO THE MEMBRANE POTENTIAL

• ACTION POTENTIAL o 1. Na opens and Na ions goes in o 2. Charge reversal o 3. K channels opens and K goes out o 4. Repolarization and Hyperpolarization

• SYNAPSE o 3 elements:

§ presynaptic neuron ú releases the neurotransmitters

§ postsynaptic neuron ú where you find the receptors

§ synaptic cleft o Electrical synapse

§ Synaptic cleft is narrower vs chemical synapse § direct opening of the fluid channel § Action potential is sufficient in depolarization of

postsynaptic neuron o Chemical

§ AP arrives at the axon of the presynaptic neuron

§ Neurotransmitters are released into the cleft where it binds to the receptors in the postsynaptic neuron

§ ie. AcH of the myoneural junction o Ionotropic receptors

§ Voltage-gated ú opening and closing of the Sodium or potassium

channels § Stretch-gated

ú opening of pores due to the deformation of the membrane

o Metabotropic receptors § Monomeric transmembrane protein

ú Has it’s amino and in the cleft, it’s carboxyl group inside the cell

• NEUROTRANSMITERS vs NEUROHORMONES o Hormones

§ Long distance via the bloodstream § Effects are long-lived § Oxytocin § Vasopressin

DOPAMINE (BOTH hormone ad transmitter)

• o Transmitters

§ Short-lived effect NAME BIOLOGICAL

EFFECTS HUMAN-SCALE EFFECTS

GnRH Gonadotropin Releasing Hormine

CRH Corticotropin releasing hormone

TRH Thyrotropin Releasing Hormone

• Neurotransmitter

o Synthesized within neuron o be released from the pre to post o affects postsynaptic area o exogenous sources are still considered neurotransmitter

as long as it mimics the endogenous neurotransmitters o mechanisms exists to inactivate or remove the

transmitter from the receptor: § reuptake § degradation (enzymatic) § diffusion

• Cholinergic Synapse o AP will open voltage gated Calcium channels o movement of presynaptic vescicles containing AcH o release of contents of vesicles to cleft o AcH binds to receptors in postsynaptic neuron o Nicotinic AcH receptor- ionotropic, faster

§ attached to two alpha subunits o Muscarinic AcH receptor- metabotropic

§ slow-acting AcH receptors § activation of G-protein (second messengers pathway) § G-alpha is directly bound to the potassium channels § efflux of potassium gives rise to long

hyperpolarization (ie. slows down the cardiac rate) o AcH metabolism

§ Packed into the vesicles § Calcium (from AP) triggers the release of the vesicles

into the cleft § Acetylcholinesterase- degrades AcH for reuptake § Curare binds to the alpha subunit of the AcH receptor § Neurotoxins prevents the degradation of the AcH

promoting longer effects o AcH Agonists

§ § Nicotine- tobacco alkaloid, locks channels open

§ Decamethonium- binds nicotinic AcH receptor and locks channels open, permanent depolarization

§ Succinycholine- slowly hydrozyled by AchE persistent end plate depolarization, short-lived

ú Prozac- prevents reuptake of AcH o *Anti-anxiety drugs make the receptors more sensitive (?)

o AcH Antagonist

§ Atropine- atropa belladonna, blocks AchAT muscarinic receptors

§ D-tubocurarine- arrow poison, curare, paralytic, blocks AcH binding site of receptor

§ Botulinus toxin- C, botulinum, inhibits Ach release, Botulism

§ Snake Venom and anti-psychotic drugs o Acetylcholinesterase inhibitors

§ Prolongs the effects of AcH § contains a serine residue § AA need

ú serine (200 position) ú histidnie (440 position) ú glutamic acid

§ Diisopropyl fluoriposphate (DIFP)- irreversibly inhibits AchE by forming a stable enzyme

ú adduct that cannot hydrolyze AcH, permanent depolarization

§ Sarin- military nerge gas, paralyzes by cholinergic impulse bloacked, death by suffocation

§ Physostigmine- plant alkaloid; prevents binding of Ach to receptor

§ Parathion- insecticide; electrophilic P forming a stable enzyme product

• Myasthenia Gravis o Acquired autoimmune neuromuscular disease o muscle weakingess due to decreased neuromuscular

transmission

o >90% found to possess antibodies to the nicotinic AchR o drooping of eyelids at midday o immunoglobulins prevent the AcH binding to the postsynaptic

receptors § sodium channels cannot open § AP is not elicited

• Direct Neurotransmitter o Presynaptic action potential à depolarization of synaptic

terminal à voltage sensitive calcium channels open à calcium enters synaptic terminal à release of chemical neurotransmitter

• Indirect Neurotransmitter o Via 2nd messengers (usually cAMP) o usually via metabotropic

Excitatory Inhibitory Changes permeability of postsynaptic neuron, stimulates membrane depolarization

Changes iion permeability, blocks generation of AP in postsynaptic neuron

Opens channel proteins to admit Cl- increased conductance, hyperpolarization

Neurotransmitters Based on Chemical Structure Amino acids glutamate

glycine aspartate

Biogenic amines Gamma amiobutyrate dopa dopamine norepinephrine epinephrine seroonine histamine

Purine derivatives ATP

ADP AMP Adenosine

Peptides BIG GROUP even in small quantities, can exert great effects

• CATECHOLAMINES

• Glutamate Transmission

o MOST abundant excitatory neurotransmitter o NMDA receptor o Aminohydroxy-Methylisoxaxol-Propionic receptor o Kinate (?) receptor o overexcitatory is the background behind epilepsy

• GABA and Glutamate Metabolism

o 3 types of receptors § GABA-A

ú ionotropic Cl- channels § GABA-B

ú metabotropic K channels § GABA-C

ú like GABA-A, but slower in response o alchohol binds to GABA receptors

§ prolongs the “quieting effect” of GABA

• DOPAMINE PATHWAY o BOTH a neurotransmitter and neurohormone o effect is in the basal ganglia (movement) o effect is in the frontal and prefrontal area (cognition) o effect in the nucleus accumbens and striatium (pleasure) o COCAINE prevents the reuptake of dopamine

§ direct § dopamine stays longer in the synaptic cleft

§ intense feeling of pleasure § can develop dependency

o OPIATES (heroine and morphine) § indirect § Binds to another neuron, decreasing GABA thus

dramatically increases the concentration of the dopamine; goes to reward pathway leading to intense feeling of pleasure

• CATECHOLAMINE METABOLISM o Urinary metabolite: VMA ( increased levels may indicate

adrenal medulla tumours) • SEROTONIN

o Plays a role in patients with suicidal tendencies o 500-hyrdoxytryptamine

• NEUROPEPTIDES o Substance P- excitatory, “slow pain system” o opiod peptides (endorphins)- endogenous, morphine-like

effects o even small amounts can exert great effects

• OPIODE PEPTIDES o ALL have a YGGF tetrapeptide o Essential for narcotic effects

COMMON NUTRITIONAL DISORDERS IN THE PHILIPPINES

• Imbalance • Specific Deficiency

Vitamin A

• trans configuration double bonds • generic term to describe all retinoids with biologic activity of all-

trans retinol • Metabolically active:

o retinoic acid (epithelial) o retinaldehyde (in the eye)

• Vitamin Precursors

o available to the human body as carotenoid pigments- cryptoxanthines

o considered as pro0vitamin only § NO Vitamin A Activity

o Beta Carotene- MOST EFFECTIVE pro vitamin § since it will only be broken down in the small intestine

and gives rise to TWO moles of retinol o metabolism

§ please refer to vit. A handouts § Retinyl esters à retinol –retinyl esters § beta carotene à retinal à retinily esters § retinyl esters à chylomicron à retinly esters *liver) +

retinol binding protein + transtheyretin à RBP cell surface

o funtions § medisates the visual process (retinol) § dark adaptation § supports growth and maintenance of epithelial tissues

(retinoic acid for preservation) ú paraocular glands (cuboidal) ú respiratory tract (pseudostratifed columnar with

goblet cells and cilia) ú gastrointestinal tract (tall columnar with

microvilli) ú genitourinary tract (transitional)

§ supporting growth and maintenance of epithelial tissues like the skin (elascticity, over-the-counter, TERATOGENIC)

o Deficiency § Etiologic factors

ú poor storage during fetal life ú absence of Vit A in the diet ú poor absorption of pro-vitamin A (low fat diet)

• chronic gastroenteritis • malabsorption syndroimes

§ Early Symptoms

ú Nyctalopia or night blindedness • impairment of dark adaptation • due to the functional failure of the retina in

the proper regeneration of rhodopsin • more common in children

ú Photophopbia • eyelids are tightly closed

ú Xerosis conjunctivae (since the conjunctivae epithelium is also maintained by vit A)

• first clinical sign • thickening, loss of luster, frequent blinking • Bitot spots

o dry, grayish foamy plaques o triangular or irregularly circular o situated lateral to the cornea o keratinized epithelial debris

• REVERSIBLE ú Xerophthalmia/ Corneal xerosis

• cornea appears hazy or opaque with bluish milky appearance

• due to cellular infiltration ú Corneal Ulcers

• small erosions with opaque areola • aquaeous humor, iris and lens can escape

ú Keratomalacia • cornea becomes soft and gelatinous • metaplasia and degeneration of corneal

epithelium producing opacities • IRREVERSIBLE

ú infection ú cutaneous changes ú xerosis of the skin

• generalized dryness with branny desquamation

ú Renaderma/ Follicular Hyperkeratosis

• horny papules mainly in the back of arms, thighs, and buttocks

• made of keratin ú Diagnosis

• thorough eye examination • biophysical examination

o dark adaptation test • biochemical tests

o plasma carotene level § < 20mcg % (low) § <10 mcg % (deficient)

o abnormal absorption test for vitamin ú Prevention

• RNI must be followed ú Treatment

• Day 1 o 110 MG RETINOL PALMITATE o 66 mg retinol acetate orally o 55mg retinol acetate IM injection

• Day 2 ú Best Food Sources

• butter • whole milk • fortified margarine • egg yolk

o Trace Essential Elements § Iron

ú adult human body contains from 3-5 grams of iron

ú Dietary iron forms: • heme iron absorbed into mucosal cells as

intact porphyrin complex • non heme iron ionized by gastric juice,

reduced to ferrous and diluted with solubilizing substances (ascorbic acid, sugars, sulfur-containing AAs)

ú Mucosal transferrin • carries iron from the intestinal lumen into

the mucosal cells • combines with apoferritin inside the

mucosal cells to ferritin ú Serum transferrin

• carries ferric iron from mucosal cells to the tissues

• transport is affected by the size of body stores and quantity of iron in the diet

• usually saturated to about 30% (Total Iron-binding Capacity)

• If iron is not needed o transferrin is saturated o less iron transferred from mucosal

cells • If iron is needed

o transferrin less saturated o more iron transferred from mucosal

cells to transferrin BIOCHEMISTRY OF VISION Parts of the Eye

• Aqueous- anterior chamber Vitreous humour- posterior chamber

*3rd visual cell, responsible for us waking up early even without sunlight called INHERENTLY PHOTO-SENSITIVE GANGLION CELLS

• Retina pigmented epithelium Cornea

• Stroma- made up of collagen type 1 (90%) type 2 (2%) Type 6 (17%)

o Also made up of passive collagen § Fibrin-associated collagen type XII and XIV § Non- fibrillar collagens type XIII and xviii

o KERATOCYTES o EXTRACULLAR GROUND SUBSTANCES

§ leucine-rich proteoglycans ú decorin- dermatan SO4, PROTEOGLYCAN ú Control interfibriallar spacing and the lamellar

adhesion progperties of corneal colllagens ú lumican, mimecan, keratocan- involved in

regulaton of fibril diameter

Clearness and Transparency of the Cornea

• Arrangement of collagen molecules • Maintenance of stromal deturgescence (Dehydrated) • soluble (NOT secreted) Vascular endothelial growth factor

receptors – 3 (sVEGFR3); or else it’s the tyrosine-kinase transmembrane receptors which stimulate the formation of blood vessels in the cornea

*VASCULAR ENDOTHELIAL factors DEGFC DEFG will stimulate formation of blood vessels, but cornea has the unique immune and angiogenic privilege. Collagen of Stroma

• constritue more than 70% of the dry weight of the cornea • collagen fibrils are of uniform 25-35 nm diameter

o are arrainged in flash bundles called lamellae (Limbus to Limbus)

Sodium-Potassium ATPase pumps are present (as in most cells)

*Paul boyer- BINDING chains mechanism and Gensis Ku- for Na K pump (?)

• Energy source of cornea o GLUCOSE- since eye is a special nervous tissue and nervous

tissue as we all know uses glucose primarily as energy source

§ 30% EMP § 65% HMP

o cornea is exposed to atmospheric atmosphere, so HMP provides NAD for the maintenance of reduced form of glutathione reductase will react with ROS.

o METABOLICALLY ACTIVE *lens and cornea is not provided with blood vessels, aqueous humour carries the necessary nutrients and metabolic by-products

LENS

• composition- water and proteins (crystallins) • no blood supply • metabolism- active through aquous humour • state- clear and crystalline state • unlike other

cells in the lens have NO turnover, the cells in your eye since birth will be the same cells until your last breath. Lens fibers

Proteins of Lens

• Crystalines o alpha (heat-shock protein; chaperones, used so that the

newly formed proteins would be folded into native conformation; attachment of carbohydrate moieties will determine the native conformation of the protein: Pompeii’s disease- glycogen storage disease of the alpha 1 glycosidase enzyme)

§ found in many tissues with protein synthesis § mutation of which will affect not only the

*synthetic form of the myozyme was used in a Filipino, that’s when they come to know the native form of the protein via carbohydrate moieties *LENS must be maintained in it’s UNAGGRETATED STATE OF THE LENS

HMP Shunt- provides NAD and EMP

Energy Source of the Lens: GLUCOSE

• 85% by EMP • 10% by HMP • 3% by TCA

*by age 40, senile cataract will occur, cataracts are the only disease of the lens *diabetic cataract can also cause cataracts CATARACT

• disease of the lens • opacities • cause:

o loss of normal osmolarity o change in lens protein solubility

• kinds:

o senile o diabetic

• Treatment- lens replacement *you can opt for a bionic eye which would endow you with a vision more than 20/20

• Senile cATARACT o cause- architectural arrangement of lens proteins altered o breakdown of proteins molecules

§ starts at C-terminal § deamination § aspartyl residues racemization

o Changes include: § thiolation (cysteine), glycation, carbamylation, cys-

methylation , phosphorylation and acetylation (asparagine); also proteolysis, leading to truncation and the release of crystalline fragments*s

DIABETIC CATARACT *formation of sorbitol causes it’s accumulation in the lens *fructose metabolism- major pathway ( in the liver) via fruktokinase and minor pathway (in the muscle) via hexokinase

RETINA

• Energy source: Glycosis o via EMP (anaerobic)

• although most of the retina is supplied by blood vessels, in the fovea it is devoid of blood vessels, thus the need for EMP (anaerobic) metabolism of glucose

• Visual Cells: o rods and cones (and a third visual cell: inherently

photosensitive ganglion cells) o vascular

§ fovea centralis- no blood vessels o mitochondria

§ outer segments of rods and cones- no mitochondria o Enzyme

§ active lactate dehydrogenase

Light Conduction

*specialized cell not found in the figure: Muller cells, goes to the layer, responsible for the deturgescence of the layers. Rods and Cones Visual Pigments

• Rods: o Rhodopsin

• Cones: o Red, green, or blue

outer segment- no organelles, where discs are found inner segment- where the organelles are found

• *Growth is from innerà outer • *turnover happens from segment to segment, since outer segment

is destroyed by cis-retinal upon reaction with light Transduction of Light

activation of rhodopsinà metarhodopsin II isomerization in the retinal pigmented epithelium recycles the retinal Rhodopsin is similar to the beta-adrenergic receptors (epinephrine)

The retinal will be isomerized to all-trans which will straighten the molecule. This will spread the helices outward

spreading of the helices via straightening of the retinal

Association of the chromophore to opsin (formation of Schiff base)

• sources:

TRANSDUCIN

• classical type of G protein • Trimeric: alpha, beta, gamma • Dissociation when activated, which will activate 3’5’-cGMP

Phosphodiesterase PHOSPHODIESTERASE (PDE6)

• hetermotretrameric protein

• cGMP opens the ligand-gated sodium channels (in the outer

segment), which allows entry of sodium channels • ion channels in the inner segment is not controlled by light,

responsible for transport of Na and Ca in exchange for K • when exposed to light, the cGMP levels decrease and closes the

ligand-gated sodium channels ( in the outer segment) • Na ions in the cell decreases, causing Hyperpolarization (reverse

impulsion) Deactivation of the Phototransduction Cascade

• GTPase Activating protein (GAP) S-subunit • Gunaylate Cyclase Activating protein (GCAP) • Deactivation of Metarhodopsin II

o recoverin and arrestin

CONES

• color vision- trichromatic • Three types of cells defines by visiual pigments;

o cyanopsin- blue- 420nm o iodopsin- green- 535 nm o porphyrhodopsin- red- 565 nm

Color Vision is Trichromatic:

• Deuteronopria- absence of iodopsin (green) (medium) • Protonopia- absence of prophyropsin (red) (long) • tritanopia- absence of cyanopsin (blue) (short)

*John Dalton was` color-blind (deuteronopia), his last will and testament was to pluck his eyes out and to find what was wrong with it. It was kept in a museum for many years. A scientist used recombinant dna to discover that john Dalton was color-blind

• Genes of Visual Pigments: o Rhodopsin- Chromosome 3 o Blue pigment- Chromosome 7 o Red and Green pigment- Chromosome X

4/28/15 5:19 AM

ISOLATION, EXTRACTION, CHARACTERIZATION AND AMPLIFICATION OF DNA human Genomic DNA

• 23 pairs of chromosomes • 3 billion base pairs • ~30-50k GENES • ~5% codings (exons) and 95% non coding (introns) • Exons are expressed, introns are not • Isolation and extraction of geniomic DNA

o from cheek cells and hair follicles • Amplification of DNA by PCR • Agarose gel electrophoresis of amplified PCR samples and staining • Analysis

Isolation and Extraction of DNA • All cells contiain identical set of DNA • Basic procedure include isolation and lysi of cells, precipitation and

extraction of DNA • InstaGene matrix chelate ions (cofactors of enzymes which may

degrade the DNA) Extraction

• Cheek cell DNA o Saline mouthwash collection

• Hair follicle DNA o Hair trimmed 2cm from bublb protease

• Pre-incubation at 56 degrees Celsius, 10 min o Know the significance of the temperature

• Incubation at 100 degrees Celsius, 5 min o Know the significance of the temperature

• Centrifugation at 6000X g, 5 min • Supernatant collection

Quantification of Exracted DNA • Optical density readin at 260 • 1 OD reading = 50 ug/ml • dilution factor (100) • OD reading at 280 (DNA) and 260 (protein) (?)

• GET THE RATIO TO DETERMINE THE PURITY (1.5, more dna than protein)

PCR • Cheek cell /hair DNA template • Master mix:

o dNTPs, Taq polymerase, buffer (Mg++ as cofactor) • Forward and reverse primer (tartrazine dye-yellow): 50~bp • Thermocycler:

o 94 degrees Celsius (denaturation) o 60 degrees Celsius (annealing) o 72 degrees Celsius (extension)

Target Sequence: Alu • Stands for restriction enzyme Alu

o Small, repetitive DNA elements of ~300 bp repeated almost 500,000x (SINEs), an INTRON

o Randomly inserted over million of years o simply a measure of molecular genetic variation o PV92 region of chromosome 6

Target Sequence • 641 base pairs- absence of Alu segment • 941 base pairs- presence of Alu segment

Agarose Gel Electrophoresis • Separates DNA fragments based on size • Agarose 1% • 1XTAE running buffer covers entire gel (Tris buffer) • Loading dye included in samples monitor migration of DNA

(samples and standards) • Fragments move toward anode • Gel stained with Fast Blast

PCR of PV92 Region of Chromosome 16 • Alu is dimorphic • Alu sequence inserted within intron (641 bp)

o Geetic variations • Alu insert within PV92 region of Chromosome 16

PV92 Genotype DNA SIZE and PCR

Products Homozygous (+/+) 941 pb Heterozygous (+/-) Homozygous (-/-)

Empty Lanes or Unamplified sAMES

4/28/15 5:19 AM