Bio 2.7Gene Expression

Proteins

lActin = 374 amino acids

The human insulin protein is composed of 51 amino acids,

It is a dimer of an A-chain and a B-chain, which are linked together by disulfide bonds.The largest known proteins are the titins, a component of the muscle sarcomere, with a molecular mass of almost 3,000 kDa and a total length of almost 27,000 amino acids.

Protein Synthesis

DNA: ATGCGTGCAATGTTTACGCGTTGA TACGCACGTTACAAATGCGCAACT mRNA AUGCGUGCAAUGUUUACGCGUUGA Protein:

DNA vs RNABasesStrandsLengthSugarLocationlongevity

Degeneracy & RedundancyDegeneracy occurs in biology when dissimilar structures carry out the same job. In protein synthesis the genetic code shows degeneracy because of the fact that several different codons code for the same amino acid.Redundancy refers to situations where structures are unneeded or unnecessarily repeated. Because the genetic code is degenerate it also becomes partly redundant we dont need 6 codons for isoleucine, one would suffice

Why is redundancy retained?If an error occurs in transcription and the wrong base is inserted then there is a chance that the correct amino acid is still put in and the protein will still function normally. Eg mutation of CUU to CUC still results in the amino acid leu (this is sometimes called third base wobble

ConsiderWhat would be the consequences if RNA polymerase was inhibited?

Class Ideas 2013:- Lowered rate of transcription b/c RNA polymerase is necessary to match complementary RNA nucleotides with the template DNA in order to produce mRNA. Lack of mRNA means less translation, less polypeptide, less protein. Less protein is important because proteins such as haemoglobin are necessary for life (haemoglobin transports the oxygen required in respiration.add other structural protein examples and functional examples especially enzymes in order to secure the grade at the E level)

Metabolic Pathways

Metabolic PathwaysMetabolism = complete set of chemical reactions necessary for life.Metabolic Pathway = A sequence of chemical reactions that lead from some precursor to a product, product of each reaction is starting material for the nextMetabolite = reactants, intermediates, and products > 2000 known metabolic reactions, each catalyzed by a distinct enzymeanabolic pathway = building a complex molecule catabolic pathway = complex molecule simpler molecule

Final phenotype (physical appearance) of an organism is determined by the presence, absence or exact amount of each metabolic product

Insert BZ simple pathway here

Catabolic Metabolism of Phenylalanine One of the most well known metabolic pathwaysPhenylalanine is an essential amino acid (obtained in the diet, not made by the body)It is normally catabolised into a range of substances including the skin pigment melaninDeficiencies in enzymes controlling the reactions this can lead to build up of poisonous metabolites (causing a range of syndromes) and/or failure to complete some processes eg no melanin = albinism

Phenyalanine Metabolism Simple Version

Ammonia is a toxic waste product of metabolism. It is converted into the less toxic waste product urea via the urea cycleThe end product in a metabolic cycle becomes the starting product so that the cycle can repeat. Eg in the urea cycle ornithine is the end product and becomes the start product so that more ammonia can be broken down

Mutations

MutationsA mutation is a change in DNA that is not immediately and properly repaired. Mutations occur spontaneously 1 per 106 108 cell divisions. Mutations are usually recessive and usually harmful e.g. CF, sickle cell disease. Some mutations beneficial, e.g. the population in Limone in Italy has a high tolerance to high cholesterol. Some mutations are neutral (or silent), especially those that do not alter the amino acid sequence.

A mutation in a body cell cancer, cell death.A mutation in a germ cell offspring with a mutation.A mutation in a zygote cell chimaera, some cells express the mutation, others dont.

Mutagens & CarcinogensMutagens increase the rate of mutations.

Carcinogens cause cancer. Mutagens include:ionising radiationUV raysX-rayschemicals, e.g. benzene, asbestos, tobacco tarviruses and microorganisms, e.g. HIV, hepatitis Bethanol/diet, e.g. high fat diet.

Beneficial Human MutationsLactase persistence+ more listed here

Beneficial Mutation ExampleTolerance to high cholesterol levels in humansIn the small village of Limone, about 40 villagers have extraordinarily high levels of blood cholesterol, with no apparent harmful effects on their coronary arteries.The village has a population of 980 inhabitants and was, until recently, largely isolated from the rest of the world, with sheer cliffs behind the village, the lake in front of them, and no road access.The village of Limone, on the shore of Lake Garda, Italy

High blood cholesterol and dietary fat are implicated in the formation of plaques in the coronary arteries and in the development of cardiovascular disease.Beneficial Mutation ExampleThe 40 villagers possess a point mutation which alters the protein produced by just one amino acid. This protein is ten times more effective at mopping up excess cholesterol. No matter how much excess cholesterol is ingested, it can always be disposed of. All carriers of the mutation are related and have descended from one couple who arrived in Limone in 1636.Generally, the people of Limone live longer and show a high resistance to heart disease.

Single Gene Mutations(aka point mutations)Substitution is when one base is replaced by another. Missense substitutions result in the wrong a.a. Nonsense substitutions result in a stop codon.Insertion is when one base is inserted. Deletion is when one base is removed.Inversion is when the order of 2 bases is swapped. A point mutation is a mutation in a single nucleotide or change to a triplet.A reading frame shift can be the result of an insertion, deletion, or both (a partial reading frame shift).E.g. Sickle cell disease: single substitution of TA in the b chain of the Hb protein (HBB) on chromosome 11. The protein precipitates in low O2 conditions, resulting in the sickle shape of the RBCs.

* Iron ToxicityThe therapeutic dose for iron deficiency anaemia is 36mg/kg/day. Toxic effects begin to occur at doses above 1020mg/kg of elemental iron. Ingestions of more than 50mg/kg of elemental iron are associated with severe toxicityApproximately 3 grams is lethal for a 2 year old

SymptomsThe first indication of iron poisoning by ingestion is a pain in the stomach, as the stomach lining becomes ulcerated. This is accompanied by nausea and vomiting. The pain then abates for 24 hours as the iron passes deeper into the body and damages internal organs, particularly the brain and the liver, and metabolic acidosis develops. The body goes into shock and death from liver failure.

TreatmentLater stage treatment consists of cleaning the iron from the blood, using a chelating agent such as deferoxamine. If this fails then dialysis is the next step.

Weet bixHow much weet bix would kill you? (from iron toxicity)

2 year old: lethal dose = 3g Iron per weetbix: 1.5mg (0.0015g). Dose = 3/0.0015 = 2000 weet-bix

70kg Adult: Severe toxicity @ 50mg/kgDose = (50 x 70) / 0.0015 = 2.3 million weet bix

Cystic FibrosisInherited genetic disease symptoms include excess mucous production in lungs, gutPrevents pancreatic enzymes reaching small intestine.SOLUTION?Lungs: coughingGut: Oral enzymesSOURCE?Pigs more issues

Cause

The cystic fibrosis transmembrane conductance regulator (CFTR) gene is found at the q31.2 locus of chromosome 7, is 230,000 base pairs long, and creates a protein that is 1,480 amino acids long.

The product of this gene (the CFTR) is a chloride ion channel important in creating sweat, digestive juices and mucus.

The most common mutation, F508, is a deletion () of three nucleotides[38] that results in a loss of the amino acid phenylalanine (F) at the 508th position on the protein.

This mutation accounts for two-thirds (66-70%[16]) of CF cases worldwide and 90% of cases in the United States; however, there are over 1500 other mutations that can produce CF.[

Although most people have two working copies (alleles) of the CFTR gene, only one is needed to prevent cystic fibrosis. CF develops when neither allele can produce a functional CFTR protein. Thus, CF is considered an autosomal recessive disease.

http://en.wikipedia.org/wiki/Cystic_fibrosis#Management

Gene Environment InteractionsThe ultimate expression of genes (phenotype) is a combination of the genotype (genetic potential) and the effects of the external environment (abiotic and biotic factors).

How might the following affect an organism?food and water availabilitypHlightaltitudetemperaturepresence of other organisms of the same speciespredation (in daphnia..next slide)

Examples

Ceriodaphnia 100x, 2x digital 'good' image Ceriodaphnia 40x, 2x digital 'good' image Note, though the image is a similar size, this is a much larger species

Resting egg pouch (ephippium) and the juvenile daphnid that just hatched from it

*Actin: Its amino acid sequence is also one of the most highly conserved of the proteins as it has changed little over the course of evolution, differing by no more than 20% in species as diverse as algae and humans.*Most proteins are at least 100aa. Can be as small as 10?? (confirm)*http://www.ansci.cornell.edu/usdagen/intronexon.html***