binding of macrolide antibiotics leads to ribosomal ...cell reports report binding of macrolide...

Report

Binding of Macrolide Antibiotics Leads to RibosomalSelection against Specific Substrates Based on TheirCharge and Size

Graphical Abstract

Highlightsd Macrolide antibiotics induce ribosome stalling at Arg/Lys-

X-Arg/Lys motifs

d The size and charge of key residue side chains hinder peptide

bond formation

d Properties of the nascent protein affect the catalytic capacity

of the ribosome

Authors

Shanmugapriya Sothiselvam,

Sandro Neuner, Lukas Rigger,

Dorota Klepacki, Ronald Micura,

Nora Vazquez-Laslop,

Alexander S. Mankin

[email protected] (N.V.-L.),[email protected] (A.S.M.)

In BriefMacrolide antibiotics stall ribosomes at

the Arg/Lys-X-Arg/Lysmotif. Sothiselvam

et al. find that the charge and size of key

amino acid side chains in this motif make

peptide bond formation inefficient.

Antibiotics greatly magnify the problemof

these intrinsically difficult donor-

acceptor pairs.

Sothiselvam et al., 2016, Cell Reports 16, 1789–1799August 16, 2016 ª 2016 The Authors.http://dx.doi.org/10.1016/j.celrep.2016.07.018

Cell Reports

Report

Binding of Macrolide Antibiotics Leadsto Ribosomal Selection against SpecificSubstrates Based on Their Charge and SizeShanmugapriya Sothiselvam,1 Sandro Neuner,2 Lukas Rigger,2 Dorota Klepacki,1 Ronald Micura,2

Nora Vazquez-Laslop,1,* and Alexander S. Mankin1,*1Center for Biomolecular Sciences, University of Illinois, Chicago, IL 60607, USA2Institute of Organic Chemistry and Center for Molecular Biosciences, Leopold Franzens University, 6020 Innsbruck, Austria*Correspondence: [email protected] (N.V.-L.), [email protected] (A.S.M.)http://dx.doi.org/10.1016/j.celrep.2016.07.018

SUMMARY

Macrolide antibiotic binding to the ribosome inhibitscatalysis of peptide bond formation between specificdonor and acceptor substrates. Why particularreactions are problematic for the macrolide-boundribosome remains unclear. Using comprehensivemutational analysis and biochemical experimentswith synthetic substrate analogs, we find that thepositive charge of these specific residues and thelength of their side chains underlie inefficient peptidebond formation in the macrolide-bound ribosome.Even in the absence of antibiotic, peptide bond for-mation between these particular donors and accep-tors is rather inefficient, suggesting that macrolidesmagnify a problem present for intrinsically difficultsubstrates. Our findings emphasize the existence offunctional interactions between the nascent proteinand the catalytic site of the ribosomal peptidyl trans-ferase center.

INTRODUCTION

The ribosome is an incredibly complex and sophisticated proteinsynthesismachine that represents one of themajor antibiotic tar-gets in bacterial cells (Wilson, 2009). Although many ribosome-targeting inhibitors completely abolish protein synthesis, someof them interfere with translation in a context-specific manner.Macrolides, such as erythromycin (ERY) and its derivatives,represent the best-studied examples of inhibitors whose actioncritically depends on the amino acid sequence of the synthe-sized protein (Davis et al., 2014; Hardesty et al., 1990; Kannanet al., 2012, 2014; Starosta et al., 2010). Depending on the natureof the nascent chain and the structure of the drug, synthesis ofthe polypeptide can be arrested during very early rounds (Otakaand Kaji, 1975; Tenson et al., 2003), at the later stages oftranslation elongation (Davis et al., 2014; Kannan et al., 2014),or not at all (Kannan et al., 2012; Starosta et al., 2010). Althoughoptimizing clinical outcomes of antibiotic therapy hinges onachieving an understanding of the mode of drug action, a mech-

anistic explanation for the context specificity of macrolides islacking.Macrolide antibiotics target the large ribosomal subunit. The

drugs bind in the nascent peptide exit tunnel (NPET) at a shortdistance from the peptidyl transferase center (PTC). Binding ofthe antibiotic obstructs the NPET and restricts placement ofthe nascent chain in the tunnel and its progression from thePTC to the tunnel exit (Bulkley et al., 2010; Dunkle et al., 2010;Schl€unzen et al., 2001; Tu et al., 2005). When the newly synthe-sized peptide chain grows to around four amino acids, it reachesthe site of antibiotic binding (Arenz et al., 2014a, 2014b). Synthe-sis of some proteins by the drug-bound ribosome is interruptedat this stage, especially when the macrolide, like ERY, contains aC3-bound cladinose sugar that protrudes into the lumen of thetunnel (Bulkley et al., 2010; Dunkle et al., 2010; Schl€unzenet al., 2001). However, some nascent peptides are able tobypass the antibiotic, allowing their continued synthesis in spiteof the presence of a bulky drug molecule in the NPET (Hardestyet al., 1990; Kannan et al., 2012; Starosta et al., 2010). Ketolidedrugs, which lack a C3 cladinose, rarely inhibit translation atthe early stages, and synthesis of many proteins continuespast the initial rounds of protein elongation (Kannan et al.,2012, 2014).Although macrolides do not inhibit synthesis of many proteins

at the early rounds, translation of the majority of polypeptides bythe drug-bound ribosome is eventually interrupted at the laterstages of elongation (Davis et al., 2014; Kannan et al., 2014).Strikingly, abrogation of translation does not occur randomly,but, rather, drug-bound ribosomes become arrested at specific,well definedmRNA sites. Ribosome profiling analysis carried outin Gram-positive and Gram-negative bacteria treated with mac-rolides helped identify the major sites of late translation arrestand allowed for initial classification of problematic sequences(Davis et al., 2014; Kannan et al., 2014). Several amino acid mo-tifs conducive to macrolide-induced arrest emerged from thesestudies. One of the most prevalent motifs conforms to theconsensus R/K-X-R/K, where R and K represent arginine andlysine, respectively, and X represents any amino acid. In vitrobiochemical testing supported the conclusion drawn from theprofiling analysis that the ribosome stalls when the codonspecifying the middle amino acid (X) of the motif enters theP site. Accordingly, the first residue of the consensus (R or K)

Cell Reports 16, 1789–1799, August 16, 2016 ª 2016 The Authors. 1789This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

represents the penultimate amino acid of the nascent peptidechain, whereas the last consensus sequence residue (alsoR or K) corresponds to the A site-bound aminoacyl-tRNA (Daviset al., 2014; Kannan et al., 2014; Sothiselvam et al., 2014).

Importantly, the context specificity of antibiotic action is ex-ploited for the regulation of expression of resistance genes (re-viewed in Weisblum, 1995). The inducible macrolide resistancegenes remain silent in the absence of the antibiotic but are acti-vated in its presence. Activation relies on programmed ribosomestalling at a precise, evolutionarily defined site of the regulatoryupstream open reading frame (uORF) that precedes the resis-tance gene (Ramu et al., 2009; Subramanian et al., 2011; Weis-blum, 1995). The ribosomes arrested at the uORF alter thefolding of the mRNA, activating the expression of the down-stream resistance cistron. The structure of the antibiotic andthe sequence of the leader peptide are the two main factorsthat determine the site of programmed translation arrest (Arenzet al., 2014a, 2014b; Gryczan et al., 1980; Horinouchi and Weis-blum, 1980; Ramu et al., 2011; Vazquez-Laslop et al., 2008,2010). Strikingly, the R/K-X-R/K sequence, identified as one ofthe major motifs of macrolide-induced translation arrest (Daviset al., 2014; Kannan et al., 2014), is present in many of the regu-latory uORFs of macrolide resistance genes, including the well-studied ermDL ORF that controls expression of the ermD gene(Kwak et al., 1991; Kwon et al., 2006; Sothiselvam et al., 2014).In all tested regulatory uORFs with the R/K-X-R/Kmotif, the ribo-some stalls when the second codon of the consensus enters theribosomal P site (Almutairi et al., 2015; Sothiselvam et al., 2014).

Strikingly, in the stalled ribosome, the amino acid residues ofthe R/K-X-R/K motif are located at the PTC active site ratherthan being juxtaposed next to the antibiotic molecule bound inthe NPET (Arenz et al., 2014a, 2014b). Similarly, other stallingmotifs identified in ribosome profiling experiments were alsoconfined to the C-terminal residues of the nascent chain andthe incoming amino acid (Davis et al., 2014; Kannan et al.,2014). These observations led to the conclusion that, at leastat the late elongation stage, macrolides do not hinder translationby simply barricading the NPET but, rather, act as context-spe-cific PTC inhibitors (Kannan et al., 2014). Indeed, RNA chemicalprobing showed that binding of macrolides to the NPET of thevacant ribosome was sufficient to allosterically induce structuralchanges in the PTC (Sothiselvam et al., 2014). In agreement withthis view, translation of the 50 terminally truncated ermDL ORF,which encodes the peptide starting with the MRLR sequence,was efficiently arrested by macrolides at the Leu3 codon,when the nascent chain was only three amino acids long andhad only limited contacts with the drug. These results suggestedthat inhibition of translation elongation by macrolides does notnecessarily require blocking the progression of the nascentchain in the drug-obstructed NPET but, rather, that binding ofthe antibiotic allosterically renders the PTC more restrictive to-ward its substrates, thus predisposing the ribosome for transla-tion arrest when certain combinations of donors and acceptorsmeet at the catalytic center (Kannan et al., 2014; Sothiselvamet al., 2014).

Despite the importance of understanding the precise molecu-lar mechanisms of antibiotic action for the development of betterdrugs and for the exploration of ribosome functions, the basis for

macrolide specificity remains obscure. It is poorly understoodwhy certain combinations of donor and acceptor substrates,defined by the identified consensus sequences, are troublesomefor the drug-bound ribosome. In particular, for the translationarrest directed by the R/K-X-R/K sequence, one could envisionthat either the positive charge or the extended length of theside chains of the arginine and lysine residues of the motif couldbe the dominant factor contributing to stalling. It is also unclearwhether the binding of macrolide antibiotics to the ribosomecauses some normally ‘‘easy’’ substrates to become ‘‘difficult’’or whether the drugs simply exacerbate the challenging natureof intrinsically problematic substrates.To gain further mechanistic insight into the mode of action of

macrolide antibiotics, in this work we investigated the effect ofthe drug on the ability of the ribosome to catalyze the transferof the short nascent MRL peptide to acceptor substrates thatdiffer in their physicochemical properties. The lack of anextended nascent chain in this stalled complex allowed us tominimize the contribution of the context preceding the stallingmotif on translation arrest (Davis et al., 2014; Elgamal et al.,2014; Kannan et al., 2014; Starosta et al., 2014; Woolstenhulmeet al., 2013). We found that two factors, the length of the sidechains of the amino acid residues in the donor and acceptor sub-strates and, even more importantly, the positive charge of thecritical residues, contribute to macrolide-induced arrest. Inter-estingly, our results indicate that the model substrates that reactextremely slowly in the presence of antibiotic appear to be prob-lematic donor-acceptor pairs even for the drug-free ribosome.

RESULTS

Antibiotic-Mediated Translation Arrest at theMRLRORFIs Independent of the mRNA Sequence and tRNAStructureOur previous experiments showed that macrolide antibiotics ar-rest translation of the truncated ermDL gene (MRLR.) when theLeu3 codon is placed in the ribosomal P site and the Arg4 codonenters the decoding site (Sothiselvam et al., 2014). To testwhether macrolide-induced ribosome stalling is influenced bythe structures of mRNA or tRNA, we changed codons 2–4 ofthe truncated ermDL template to several different combinationsof synonymous triplets that not only alter the mRNA sequencebut also direct binding of different aminoacyl-tRNA isoacceptors(Figure S1A). Toeprinting analysis showed that these alterationsin mRNA sequence hadminimal effects on the efficiency of ERY-directed arrest (Figure S1A). Therefore, neither the mRNAsequence nor the structure of the tRNA body affect macrolide-dependent ribosome stalling at the truncated ermDL ORF, leav-ing the nature of the nascent peptide sequence as the likelyprimary determinant of translation arrest.

Only the Templates Encoding Arg or Lys in the Secondand Fourth Codons Are Conducive to ERY-InducedTranslation ArrestIn the ribosome stalled at the truncated ermDL template, theMRL tripeptide esterifies the P site tRNALeu, and the A site codonspecifies for Arg-tRNA. We wanted to understand how thechemical nature of the peptidyl donor and aminoacyl acceptor

1790 Cell Reports 16, 1789–1799, August 16, 2016

affects catalysis of peptide bond formation by the drug-boundribosome. First, we investigated the contributions of the secondand third amino acids of the peptidyl moiety of the donor sub-strate, MRL-tRNA, to macrolide-dependent translation arrest.Codons 2 and 3 of the MRLR ORF, which encode the penulti-mate and the C-terminal residues of the nascent peptide, weremutated to specify all other 19 amino acids, and ERY-inducedribosome stalling in these templates was analyzed by toeprint-ing. Most of the alterations of the penultimate amino acid(Arg2) abolished stalling. Only the Arg2-to-Lys replacementmaintained efficient translation arrest (Figure 1A). In contrast,the nature of the C-terminal residue was of much lesser impor-tance. Only changes of Leu3 to Trp or Pro showed a somewhatincreased bypass of the arrest site, whereas the majority of themutants directed ribosome stalling as readily as the wild-typesequence (Figure 1B).We then examined the role of the acceptor substrate. By

mutating the fourth codon of theMRLRORF,we directed bindingof aminoacyl-tRNAs linked to each of the 20 different aminoacids to the ribosomal A site. Similar to the effect observed forthe penultimate position of the nascent peptide, only the Arg4-to-Lys (and, to a much lesser extent, the Arg4-to-Trp) substitu-tion was conducive to ERY-induced stalling (Figure 1C). Thus,ERY promotes the formation of a stable stalled ribosome com-plex preferentially on those short templates where the secondand fourth codons specify either Arg or Lys.Because individual substitutions of Arg2 or Arg4 with Lys were

compatible with ERY-induced stalling, we also tested whethersimultaneous replacement of both Arg codons with Lys wouldstill support translation arrest. Indeed, we found that the majorityof the ribosomes that reached the third codon of the MKLK tem-plate became arrested (Figure S1B, black arrowheads, lane L). Inaddition, similar to the results obtained with the MRLR template,mutations of the Leu3 codon, sandwiched between the two Lyscodons in the MKLK template, had little effect on ERY-inducedarrest (Figure S1B). An exception was the MKPK sequence. Inthis template, drug-bound ribosomes could not reach the thirdcodon because they stalled at the Lys2 codon (Figure S1B,lane P), likely because of the reported propensity of macrolidesto inhibit peptide bond formation between a donor peptidewith a C-terminal lysine and prolyl-tRNA (Davis et al., 2014;Kannan et al., 2014).Altogether, our mutational studies showed that the antibiotic

bound in the ribosomal exit tunnel efficiently and specifically pre-vents the transfer of nascent tripeptides that have an Arg or Lysas their penultimate residues to an Arg or Lys acceptor(Figure 1D).

Figure 1. Amino Acid Residues Critical for ERY-Dependent Trans-lation Arrest in the MRLR ORF(A–C) Toeprinting analysis of ERY-dependent ribosome stalling in the MRLR

ORFs. The codons specifying the residues of the RLR motif located in the

penultimate (!1) position of the MRL tripeptide (A), the peptide’s C-terminal

residue located in the PTC P site (B), or the amino acid to be placed in the A site

(C) weremutated to code for each of the other 19 canonical amino acids. Black

arrows indicate toeprint bands representing ERY-dependent translation arrest

at the third codon. Lanesmarked! represent the reactions with wild-type (WT)

template but lacking ERY. Gray arrows point to the toeprint bands corre-

sponding to the ribosomes, which bypassed the third codon and were

captured at the downstream Pro6 codon because of the presence of mupir-

ocin, an IleRS inhibitor. In the case of Ile mutations in the MRLR peptide

(lanes I), the Ile7 codon was replaced with the Trp codon, and mupirocin was

substituted with indlomycin, a TrpRS inhibitor. Symbols representing amino

acids conducive to ERY-dependent arrest are shown in bold. Sequencing

lanes are marked C, U, A, and G. The gels shown are representative of two

independent experiments.

(D) Representation of the ERY-stalled ribosome with the tripeptidyl MRL-

tRNALeu in the P site and aminoacyl-tRNA in the A site. Amino acid residues

critical for drug-dependent ribosome stalling are depicted by red spheres, and

the antibiotic molecule is indicated by a star.

See also Figures S1 and S2.

Cell Reports 16, 1789–1799, August 16, 2016 1791

The Presence of Arg or Lys in the Donor and AcceptorSubstrates Is Critical for Translation Arrest Prompted byDiverse Macrolide AntibioticsStalling peptides that regulate expression of erm genesoften exhibit strong selectivity toward macrolide antibioticscontaining C3 cladinose (e.g., ERY) but do not respond tocladinose-lacking ketolides (Vazquez-Laslop et al., 2011;Vazquez-Laslop et al., 2008). In contrast, both cladinose-containing macrolides as well as ketolides arrest translationof the truncated ErmDL (Sothiselvam et al., 2014). We asked

whether the identity of the second and fourth codons of theMRLR template, which is critical for ERY-induced arrest (Fig-ure 1), is also important for ribosome stalling directed by othermacrolide antibiotics. Therefore, we tested the response ofErmDL mutants to the fluoroketolide solithromycin (SOL) andthe cladinose-containing 15-member ring azithromycin (AZI)(Figure S2A).Similar to the effects observed with ERY, the mutation of Arg2

or Arg4 to Ala completely abolished arrest induced by SOL orAZI. Furthermore, similar to the effect on ERY-mediated arrest,altering the third codon (Leu) to Ala allowed for efficient arrestdirected by AZI or SOL (although this mutation caused someread-through of the SOL-bound ribosome) (Figure S2B). Weconcluded that the nature of the penultimate residue of theshort nascent peptide and the incoming amino acid are themost critical for arrest induced by a broad range of macrolideantibiotics.

Antibiotic Exacerbates the Difficulty of Peptide BondFormation between Intrinsically Problematic RibosomalSubstratesThe results presented above strongly suggest that the ribo-some with a macrolide antibiotic bound in the exit tunnel stallswhen it needs to catalyze the transfer of tripeptides MRX orMKX to an Arg or Lys acceptor. To substantiate thisconclusion, we followed the kinetics of peptide bond formationbetween the donor MRL-tRNA and different model acceptorsubstrates. For these experiments, we synthesized chemicallystable substrates mimicking the aminoacyl-tRNA acceptorend (Graber et al., 2010; Moroder et al., 2009; Table 1). Inthese aminoacyl-tRNA analogs with the general structureACCA-X, various amino acid residues (X) were linked to the30 carbon atom of the universal tRNA sequence ACCA via astable amide bond (Supplemental Information). Binding ofthese substrates to the ribosomal A site does not require theelongation factor EF-Tu or interaction with the mRNA codonin the decoding center, and their acceptor ability dependsexclusively on the nature of the amino acid residue. Inthe initial series of experiments, we used analogs thatcontained canonical amino acid residues that are eitherconducive to stalling (X = Arg or Lys) or abolish the arrest(X = Ala) (Table 1).The ribosome/mRNA/MRL-tRNA complex was prepared by

translating the MRL peptide from a synthetic tri-codonmRNA in the PURE cell-free translation system (Shimizuet al., 2001). Because the mRNA lacks a stop codon, theribosome stalls at the third codon carrying the tripeptidylMRL-tRNALeu bound in the P site and a vacant A site regard-less of the presence of ERY (Figure 2A). The stalled ribosomecomplexes were then mixed with high concentrations (0.7 mM)of the acceptor substrates, and the progression of the peptidyltransfer reaction was monitored by quantifying the amount ofunreacted MRL-tRNALeu resolved in Bis-Tris polyacrylamidegels (Figure 2B; Figure S3A). Upon addition of the ACCA-N-Ala acceptor substrate, irrespective of the presence of ERY,the reaction was completed within 30 s (the shortest incuba-tion time we could reliably measure with our experimentalsetup) (apparent rate constant kapp > 1.8 min!1) (Figures 2B

Table 1. Reactivity of Acceptor Substrate Analogs with the MRL-tRNA and MAL-tRNA Donors in the ERY-Bound and Drug-freeRibosome

Acceptor Substrate (a)

Donor Substrate

MRL MAL

No drugkapp (min-1)

ERYkapp (min-1)

No drugkapp (min-1)

ERYkapp (min-1)

L-arginine [6]

0.09 ± 0.15 0.01 ± 0.02 0.96 ± 0.23 0.87 ± 0.21

L-lysine [5]

0.15 ± 0.03 0.01 ± 0.01 0.74 ± 0.14 1.17 ± 0.23

L-ornithine [4]

0.08 ± 0.02 < 0.01 b) 1.03 ± 0.29 0.81 ± 0.22

L-aminoalanine [2]

> 1.8 * c) 0.61± 0.16 ND d) ND

6-azido-L-norleucine [7]

> 1.8 * 0.32 ± 0.08 > 1.8 * > 1.8 *

5-ethyl-L-norleucine [6]

> 1.8 * 0.31 ± 0.07 > 1.8 * > 1.8 *

6-hydroxy-L-norleucine [5]

> 1.8 * 0.34 ± 0.10 > 1.8 * > 1.8 *

L-norleucine [4]

> 1.8 * > 1.8 * > 1.8 * > 1.8 *

L-alanine [1]

> 1.8 * > 1.8 * > 1.8 * > 1.8 *

NH

NH2

NH2+

NH2

NH3+

NH2

NH3+

NH2

NH2

NH3+

N N+ N-

NH2

NH2

OH

NH2

NH2

NH2

ND, not determined.aAcceptor substrates conform to the general formula pACCA-N-X, where

X corresponds to different canonical or non-canonical amino acids. The

pACCA-N moiety of the substrates is represented by a sphere, and the

chemical structure of the aminoacyl residue is shown. The names of

the substrates whose side chain carries a positive charge are shown in

red, and the substrates with a neutral net charge of the side chain are

shown in green. The number of non-hydrogen atoms in the side chain

skeleton is indicated in brackets next to the substrate name.bThe reaction was too slow to accurately determine its kapp.cReaction rates with kapp exceeding 1.8 min!1 could not be measured in

the experimental setup used for the kinetics experiments. The kapp values

for the corresponding reactions are indicated as >1.8 and are marked by

an asterisk.


and 2C; Table 1). This indicates that both the drug-free andERY-bound ribosomes efficiently catalyze transfer of MRL tothe non-stalling Ala acceptor. In striking contrast, in the pres-ence of ERY, the majority of MRL-tRNALeu remained unreactedwith the ACCA-N-Arg or ACCA-N-Lys acceptors after 30 minof incubation (Figures 2B and 2C). Interestingly, although theabsence of the antibiotic caused the reaction with theseanalogs to accelerate nearly 10-fold (kapp = 0.9–1.5 min!1), itremained notably slower in comparison with the ACCA-N-Alasubstrate (Figures S3A and S3B; Table 1). The marked reduc-tion in the reaction rate between MRL-tRNA and ACCA-N-Argor ACCA-N-Lys acceptors in the absence of antibiotics wasnot manifested in the conventional toeprinting experiments(no-antibiotic lanes, Figures 1A–1C), likely because the puta-tive ribosome pausing was too transient to be captured bythis assay. Nevertheless, the results of biochemical testingclearly show that the transfer of the MRL donor to the Arg orLys acceptors is intrinsically difficult for the ribosome andthat the presence of the antibiotic in the exit tunnel dramati-cally intensifies the problem, essentially halting peptide bondformation.

Figure 2. Arg and Lys Are Poor Acceptors ofthe MRL Peptide in the Stalled Ribosome(A and D) Schematic depicting the experimental

design. ERY-bound ribosomes carrying MRL-

tRNALeu (A) or MAL-tRNALeu (D) in the P site and an

empty A site are reacted with the model A site

substrates ACCA-N-Arg and ACCA-N-Lys (red

circles) or ACCA-N-Ala (green circle). Antibiotic

bound in the NPET is represented by a star.

(B and E) Gel electrophoresis analysis of the 35S-

labeled MRL-tRNALeu (B) or MAL-tRNALeu (E)

(marked by peptidyl-tRNA drawings) remaining

unreacted upon addition of ACCA-N-Ala, ACCA-

N-Lys, or ACCA-N-Arg. The band corresponding

to fMet-tRNAfMet present in the reaction is indi-

cated by a triangle. Gels are representative of at

least two independent experiments.

(C and F) Results of the quantification of the

amount of unreacted MRL-tRNALeu (C) or MAL-

tRNALeu (F) in the gels shown in (B) and (E),

respectively. The amount of unreacted peptidyl-

tRNA at the 0 time point was set as 100%. Error

bars show deviation from the mean in two inde-

pendent experiments for each donor substrate.

See also Figure S3.

The Positive Charge of the A SiteSubstrates Is the PredominantFactor that Makes Them PoorAcceptors of the MRL PeptideArg and Lys are unique among the 20canonical amino acids because theycontain the longest side chains, whichare positively charged at physiologicalpH. We considered that the size, thecharge, or the combination of these twofeatures could make it difficult for theribosome to use Arg-tRNA or Lys-tRNA

as acceptors of the MRL peptide, hence leading to translationarrest. To dissect the contribution of length and charge of theacceptor’s side chain to antibiotic-mediated ribosome stalling,we prepared a new series of synthetic substrate analogs thatvaried in the length of the side chain and in the presence orabsence of the positive charge (Table 1). We then tested theacceptor activity of these substrates in the same experimentalsetup we used before with the Ala, Lys, or Arg acceptor analogs.In the presence of ERY, the transfer of theMRL peptide to ACCA-N-6-azido-L-norleucine, ACCA-N-6-hydroxy-L-norleucine, orACCA-N-6-ethyl-L-norleucine, whose side chain skeletonsrange in length from five to seven non-hydrogen atoms butlack the net positive charge, occurs with the apparent rateconstant kapp of "0.3 min!1 (Figure 3; Table 1). Remarkably,shortening the uncharged side chain to four carbon atoms (inACCA-N-norleucine) significantly accelerated the reaction, mak-ing it too fast to accurately determine the rate constant in ourexperiments (kapp > 1.8 min!1) (Figure 3; Table 1). Likewise, inthe absence of the antibiotic, all uncharged acceptor substratesreacted with kinetics too rapid to be accurately measured (Fig-ure S3B; Table 1). These results showed that the length of the


acceptor side chain contributes to the arrest mechanismbecause macrolides notably slow down the transfer of theMRL peptide with acceptors having extended side chains.Nevertheless, the reaction of the MRL peptide with electroneu-tral acceptors still proceeded at a considerable rate, indicatingthat the extended length of the acceptor side chain is insufficientto support formation of a stable stalled complex.

Introduction of the positive charge to the side chain on theacceptor substrate exhibited a more dramatic effect on the rate

of reaction with the MRL donor. Replacement of the terminalmethyl group of norleucinewith a positively charged amino groupin ACCA-N-ornithine resulted in a precipitous drop of the MRLtransfer rate, essentially abolishing the reaction in the presenceof ERY (kapp < 0.01 min!1) (Figure 3; Table 1). In addition, consis-tent with what was observed for Arg and Lys acceptors, even inthe absence of ERY, the transfer of the MRL peptide to ACCA-N-ornithine was rather inefficient (kapp = 0.08 ± 0.02 min!1) (Fig-ure S3B; Table 1). These results clearly indicate that the majorobstacle for catalysis of the transfer of the MRL peptide to theacceptor in thePTCof themacrolide-bound ribosome is imposedby the charge of the A site amino acid. However, in agreementwith the notion of the importance of the size of the side chain,ACCA-N-aminoalanine, with a positively charged side chain asshort as two non-hydrogen atoms, reacted faster than any ofthe other tested positively charged acceptors (kapp = 0.61 ±0.16min!1) (Figure 3; Table 1) butmuchslower thananyof the un-charged substrates with a side chain shorter than five atoms.The sluggish transfer of the MRL peptide to the positively

charged substrates ACCA-N-Lys, ACCA-N-Arg, and ACCA-N-ornithine critically depends on the presence of Arg (or Lys) inthe penultimate position of the nascent chain. The non-stallingdonor peptide MAL swiftly reacted with the acceptor substratescontaining Ala, Lys, or Arg residues irrespective of the presenceof antibiotic (kapp R 0.74 min!1) (Figures 2D–2F; Figures S3Cand S3D; Table 1). Consequently, removal of the long, positivelycharged side chain of the penultimate residue of the donor sub-strate allows for efficient peptidyl transfer even to positivelycharged A site substrates. Thus, it appears that the simultaneouspresence of the charged long side chains in the penultimate po-sition of the donor substrate and in the aminoacyl acceptor pre-sent the obstacle for catalysis of peptide bond formation by themacrolide-bound ribosome.One possiblemodel that follows from our findings is that a sim-

ple electrostatic repulsion between the penultimate residue ofthe peptidyl donor and the aminoacyl moiety of the acceptormay be sufficient to hamper the catalysis of the peptidyl transferreaction in the macrolide-bound ribosome. If this were the case,then simultaneous replacement of the positively charged resi-dues encoded in codons 2 and 4 of the MRLR ORF with nega-tively charged amino acids would be comparably detrimentalfor translation. We tested this hypothesis in a straightforwardtoeprinting experiment exploiting two new templates in whichthe second and the fourth codons of the MRLR ORF weremutated to specify peptides MDLD and MELE, which carrynegatively charged amino acids in the critical positions (Figure 4).However, neither of these peptides were able to direct efficientarrest of the macrolide-bound ribosome. Thus, it is not the sim-ple repulsion of two equivalent charges but the explicit presenceof positive charges at the extended side chains of the penulti-mate residue of the P site peptidyl donor and of the A site amino-acyl acceptor that obstructs peptide bond formation in theribosome with a macrolide antibiotic bound in the NPET.

DISCUSSION

In our experiments, we interrogated one of the most com-mon problematic motifs for the macrolide-bound ribosome,

Figure 3. The Positive Charge and Extended Size of the AcceptorAmino Acid Side Chain Prevent Efficient Peptide Bond Formationwith the MRL Peptide in ERY-Bound Ribosomes(A and B) Kinetics of the reaction of the MRL-tRNALeu in the P site of ERY-

bound ribosomes (as illustrated in the schematic in Figure 2A), with acceptor

substrate analogs carrying non-canonical amino acids. The quantification of

the amount of unreacted MRL-tRNALeu is from the gels shown in Figure S5.

The amount of unreacted MRL-tRNALeu at the 0 time point was set as 100%.

Error bars show deviation from the mean calculated from two independent

experiments. The 30-min time point for the ACCA-N-aminoalanine substrate

was assayed in a single experiment. The reactivity plots of the substrate

analogs with canonical amino acids (Arg, Lys, and Ala) are those from Fig-

ure 2C and are shown here by dashed lines for comparison.


R/K-X-R/K, and found that specific physicochemical propertiesof substrates participating in peptide bond formation are thema-jor contributing factors to drug-induced translation arrest.During translation elongation, macrolides act as inhibitors of

peptide bond formation between specific combinations of PTCdonor and acceptor substrates (Kannan et al., 2014). Thismode of action is possibly mediated by allosteric changes inthe PTC induced by the drug (Sothiselvam et al., 2014). In addi-tion, direct interactions between the nascent chain and the anti-

biotic in the NPET may also modulate antibiotic action (Arenzet al., 2014a, 2014b; Vazquez-Laslop et al., 2010) and may attimes allow the drug-bound ribosome to bypass a problematicmotif (S.S., unpublished data). Such influence of the contextlikely explains why, in macrolide-treated cells, no significantincrease in ribosome density is observed at some of the R/K-X-R/K sequences (Davis et al., 2014; Kannan et al., 2014). Ouruse of the shortest known peptide capable of directing macro-lide-dependent ribosome stalling, MRL (Sothiselvam et al.,2014), allowed us to significantly simplify the system by mini-mizing the influence of the N-terminal context on the drug-induced arrest. Furthermore, the small size of the stalling peptidemade it possible to probe the contribution of each of its residues(with the exception of the N-terminal formyl-methionine) to trans-lation arrest.Strikingly, in the context of the short donor substrate, the

physicochemical characteristics of only one of its residues, thepenultimate amino acid, are critical. The properties of the C-ter-minal amino acid, which directly participates in peptide bond for-mation, are of lesser importance. Our comprehensive mutationalanalysis showed that the simultaneous presence of Lys or Argresidues in the penultimate position of the peptide and in theacceptor substrate is sufficient for preventing fast peptidebond formation in the macrolide-bound ribosome. Subsequentbiochemical studies that utilized different peptidyl donors (MRLand MAL) and a series of synthetic acceptors showed that thepositive charge of the critical amino acid residues and the sizeof their side chains are the key factors that render peptidebond formation inefficient in the drug-bound ribosome. The posi-tively charged, long side chain acceptors of the MRL peptide(ACCA-N-Arg, -Lys, or -ornithine) reacted extremely slowly,whereas shortening of the positively charged side chain(ACCA-N-aminoalanine) or removal of the charge increased thereaction rate, with the most dramatic acceleration achievedwith short uncharged acceptor substrates (Figure 3). Impor-tantly, substituting the electroneutral Ala for Arg in the penulti-mate position of the donor (MAL) had a similar effect.Although the contribution of the size of the side chain in natural

substrate analogs could be generally concealed because of thedominance of the charge effect, it might nevertheless play a rolein the effects of the drugs on cellular translation. Indeed,although, in our in vitro experiments, both ACCA-N-Lys andACCA-N-Arg reacted too slowly to accurately distinguish the dif-ference in their reactivity, ribosome profiling analysis showed amore pronounced enrichment of Arg-containing sequences ofthe R/K-X-R/Kmotif in the sites of macrolide-induced translationstalling (Davis et al., 2014; Kannan et al., 2014). Because the gua-nidinium group of Arg and the ε-amino group of Lys are bothcompletely protonated at physiological pH, it is generallypossible that the longer side chain of Arg (six atoms) comparedwith Lys (five atoms) accounts for a more severe translationarrest at the Arg-containing motifs.Our findings provide an explanation for a long-known fact: that

translation of poly(A) RNA, encoding poly-lysine, is efficiently in-hibited by erythromycin and results in accumulation of short (di-to penta-lysine) peptides (Mao and Robishaw, 1971; Otaka andKaji, 1975; Vazquez, 1966). Because the poly(Lys) sequenceconforms to the R/K-X-R/K motif, it is not surprising that its

Figure 4. Simultaneous Replacement of the First and Last AminoAcids of the R/K-X-R/KMotif to the Negatively Charged Amino AcidsPrevents ERY-Dependent Translation ArrestToeprinting analysis of ERY-dependent ribosome stalling at the templates

encodingMDLD andMELE peptides. The full sequences of theWT andmutant

ermDL ORF and the encoded peptides are shown above the gel. The penul-

timate (!1) amino acid residue of the nascent chain in the drug-stalled ribo-

some, the P site, and the A site residues are marked above the peptide

sequence. Black arrows indicate ERY-dependent translation arrest at the Leu

codon. Gray arrows indicate the toeprint bands representing ribosomes

captured at the downstream Pro5 codon because of the presence of mupir-

ocin in the reaction mixture, which inhibits the Ile-tRNA formation. Sequencing

lanes are marked. The shown gel is representative of two independent ex-

periments.


synthesis would be interrupted by macrolides at the very earlyrounds because the drugs should block the transfer of evenvery short nascent chains carrying Lys in the penultimate posi-tion to the incoming Lys-tRNA.

Our results show that the interplay of the penultimate residueof the nascent peptide and the incoming amino acid has a dra-matic effect on macrolide-induced arrest at the R/K-X-R/K sites.The nature of the C-terminal residue of the donor peptide that re-sides in the PTC P site appears to be far less significant, at leastin the case of ERY-induced arrest with the minimal peptide (Fig-ure 1B). Nevertheless, from the somewhat varying relative inten-sity of the arrest bands in the toeprint gels (Figure 1B), it could beinferred that the C-terminal residue does modulate, to someextent, the efficiency of peptide bond formation in the macro-lide-bound ribosome. The influence of the C-terminal peptideresidue could account for the varying extent of enrichment ofdifferent R/K-X-R/K sequences at the sites of ERY-induced ar-rest observed in ribosome profiling experiments (Kannan et al.,2014). Furthermore, the nature of the tunnel-bound antibiotic af-fects the importance of the C-terminal residue of the nascentchain for translation arrest. Although Leu3-to-Ala replacementhad only a negligible effect on the transfer of the MRL peptideto Arg-tRNA in the ERY- or AZI-bound ribosome, the same mu-tation notably diminished translation arrest when the fluoroketo-lide SOL was bound (Figure S2). This result is reminiscent of ourrecent finding that the nature of the C-terminal residue of anotherstalling regulatory peptide, ErmBL, which conforms to a differentstalling motif, XDK (Kannan et al., 2014), determines whethermacrolides or ketolides are recognized as the stalling cofactor(Gupta et al., 2016).

Several scenarios could account for the slow transfer of apeptidyl donor with a positively charged penultimate residueto a positively charged acceptor in the ERY-bound ribosome.One possibility is that electrostatic repulsion between theincoming amino acid and the penultimate nascent peptide res-idue, possibly exacerbated by direct steric hindrance and aclose proximity of the charges located at the ends of theextended side chains, prevents proper accommodation of theaminoacyl-tRNA acceptor in the PTC A site (Arenz et al.,2014a, 2014b; Gupta et al., 2016; Ramu et al., 2011). This couldlead to either an aberrant placement of the stably bound ami-noacyl-tRNA or to rapid dissociation of Arg- or Lys-tRNAfrom the A site. It is also possible that binding of the positivelycharged substrate to the A site displaces the peptidyl-tRNA inthe P site when its penultimate position is occupied by a posi-tively charged residue. Finally, both the donor and acceptorsubstrates could be mutually misaligned in the PTC activesite, which would be detrimental for efficient peptide bondformation.

Although the charge of the amino acids in the donor andacceptor substrates plays the key role in macrolide-induced ar-rest, only positively charged residues were detrimental for pep-tide bond formation. Simultaneous replacement of both of thecritical residues with negatively charged amino acids was notconducive to translation arrest (Figure 4). It is thus obviousthat the polarity of the charge of the donor and acceptor iscentral to the mechanism of stalling. In agreement with thisconclusion, although R/K-X-R/K is one of the most predominant

macrolide stalling motifs in Gram-positive and Gram-negativebacteria (Davis et al., 2014; Kannan et al., 2014), no particularenrichment of the D/E-X-D/E sequences at the sites of drug-induced translation arrest has been noted. The strict polarityrequirement suggests that electrostatic interactions of the sub-strates with additional charged group(s) in the ribosome or its li-gands could be involved in the mechanism of stalling. It isconceivable that the positive charge at the end of the extendedside chain of the (!1) residue of the peptidyl donor or aminoacylacceptor could interact with the electronegative phosphategroup of one of the neighboring 23S rRNA nucleotides. Thegenerally electronegative potential of the NPET could be alsoa contributing factor (Lu et al., 2007). Alternatively, the proton-ated 30 dimethyl-amino group of the macrolide molecule couldinfluence the placement of the positively charged substratesin spite of the "8-A distance that separates it from the PTCactive site.The rate of the catalytic step of peptide bond formation in the

drug-free ribosome depends on the nature of the reacting sub-strates (Bourd et al., 1982; Johansson et al., 2011; Monro et al.,1968; Muto and Ito, 2008; Wohlgemuth et al., 2008). However,this difference in reactivity is normally masked by the slowrate of aminoacyl-tRNA binding and accommodation, which isthe rate-limiting step of translation elongation (Wintermeyeret al., 2004). It is conceivable, however, that, if the general cat-alytic capacity of the PTC is decreased, then formation of pep-tide bonds between certain generally sluggish substrates couldslow down sufficiently to become rate-limiting. From this stand-point, it is remarkable that, even in the absence of antibiotic, thereaction of the MRL peptide with the acceptor analogs carryingpositively charged amino acids with extended side chains wasnotably slower that the reaction with electroneutral acceptors(Table 1). This observation hints that peptide bond formation be-tween substrates conforming to the R/K-X-R/K motif is intrinsi-cally slow. Therefore, macrolide antibiotics do not convert wellbehaved substrates into slow reactants. Rather, the drugsamplify the problem of the substrates that are inherently difficult,making peptide bond formation rate-limiting. We are fully aware,however, that the use of the artificial acceptor substrates maysignificantly aggravate the difference in their reactivity (Brunelleet al., 2006; Katunin et al., 2002). Furthermore, the kinetic pa-rameters obtained in the cell-free setting with the use of modelsubstrates reflect only the general trend in relative substratereactivity rather than the actual kinetics of transpeptidation,which should be much faster when the full-length tRNA deliversthe acceptor amino acid to the PTC A site (Wohlgemuth et al.,2008). Indeed, the lack of pronounced ribosome stalling at theR/K-X-R/K motif in the absence of antibiotic (Davis et al.,2014; Kannan et al., 2014; Li et al., 2012; Mohammad et al.,2016) suggests that, even for these slow substrates, the rateof transpeptidation in the living cell is not rate-limiting. There-fore, it is possible that inhibition of translation by macrolideantibiotics reveals a general but concealed phenomenon ofthe dependence of the rate of peptidyl transfer on the interplayof the penultimate residue of the nascent chain and theincoming amino acid.Other sequence motifs conducive to macrolide action that do

not conform to the R/K-X-R/K consensus are also confined to


amino acid residues residing at or near the PTC. The features ofthose substrates that make them difficult for the drug-boundribosome are currently unknown. Interestingly, however, one ofthe identified macrolide motifs (XPX) (Davis et al., 2014; Kannanet al., 2014) includes proline, a particularly slow participant inpeptide bond formation (Johansson et al., 2011), especially inspecific contexts (Doerfel et al., 2013; Ude et al., 2013). There-fore, our conclusion that macrolides exacerbate the problematicnature of the inherently difficult sequences could expand beyondthe specific example of the R/K-X-R/K motif explored in this pa-per. Further exploration of the context specificity of macrolideaction might reveal new hidden features of the general mecha-nisms of protein synthesis.

EXPERIMENTAL PROCEDURES

ReagentsErythromycin, azithromycin, and mupirocin were from Sigma-Aldrich, solithro-

mycin was provided by Dr. Fernandes (CEMPRA Pharmaceuticals), and indol-

mycin was from Santa Cruz Biotechnology. The reverse transcriptase used in

the toeprinting analysis was purchased from Sigma-Aldrich. All DNA primers

(listed in Table S1) were synthesized by IDT.

The synthesis of ACCA-N-X substrates is described in the Supplemental

Experimental Procedures.

Toeprinting AssayLinear DNA templates (0.5–1 pmol) encoding the ORF of interest preceded by

the T7 promoter sequence were generated by PCR using the primers indicated

in Table S1. To capture the ribosomes that escaped ERY-dependent arrest at

theRLR sequence, an Ile codon (Ile6) was introduced after the Pro5 codon, and

all reactions were carried out in the presence of 50 mMmupirocin, an IleRS in-

hibitor. In the templates where the codons of the motif were mutated to specify

Ile, the Ile6 codonwas replacedwith aTrp codon, and, in these cases, reactions

were carried out in the presence of indolmycin, an inhibitor of TrpRS.

Templates were used to direct coupled transcription-translation in the

PURExpress cell-free system (New England Biolabs). The reactions were per-

formed in a total volume of 5 ml and, where indicated, were supplemented with

antibiotics (50 mM final concentration). Following 10-min incubation at 37#C,

the primer extension reaction was initiated by addition of the primer NV1 (Table

S1) and 3 U of reverse transcriptase. The resulting cDNA products, along with

sequencing reactions, were separated in a 6% sequencing gel and visualized

with a Typhoon imager (GE Healthcare).

In Vitro Peptidyl Transfer ReactionSynthetic mRNAs (synthesized by Thermo Fisher) encoding MRL peptide

(ATAAGGAGGAAAAAATATGAGACUU, the coding sequence is underlined)

or MAL peptide (ATAAGGAGGAAAAAATATGGCACUU) were used for in vitro

translation in the PURE system. The 5-ml reactions containing 75 pmol of the

mRNA template were supplemented with 1 mCi [35S]-methionine (specific ac-

tivity, 1,175 Ci/mmol) and, where indicated, 50 mMERY. Following 7-min incu-

bation at 37#C, thiostrepton was added to the final concentration of 50 mM to

prevent further rounds of translation. The synthetic acceptor substrate

ACCA-N-X, dissolved in water, was then added to a final concentration of

0.7 mM. Aliquots (5 ml) were withdrawn at different times and immediately

mixed with an equal volume of SDS-containing tricine sample buffer (Bio-

Rad). Reaction products were resolved in 16% Bis-Tris polyacrylamide gel

as described previously (Vazquez-Laslop et al., 2008). Gels were fixed, dried,

exposed to a phosphorimaging screen, and visualized with a Typhoon imager

(GE Healthcare).

Quantification of the peptidyl-tRNA bands was performed using ImageJ

(Schneider et al., 2012). Because the reactions contain excess of [35S]-methi-

onine and fMet-tRNAMet is continuously regenerated in the reaction, the fMet-

tRNAMet band served as the loading control and normalization factor. The

normalized peptidyl-tRNA band at t = 0, which represents the total amount

of unreacted peptidyl-tRNA before addition of the A site substrates, was set

at 100%. The progress of the reaction was monitored by quantifying the

amount of unreacted peptidyl-tRNA at experimental time points. The data

were fitted to one phase exponential decay model in GraphPad PRISM using

the equation

Y= ðY0! PLÞ&expð! k&XÞ+PL;

where Y is the amount of unreacted peptidyl-tRNA (percent) at any given time

point, Y0 is the initial amount of unreacted peptidyl-tRNA at t = 0, PL (plateau)

is the Y value at infinite times (calculated in PRISM), k is the rate constant, and

X is the time in minutes. The error range of the apparent rate constants shown

in Table 1 represents the SEM.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Supplemental Experimental Procedures,

three figures, and one table and can be found with this article online at

http://dx.doi.org/10.1016/j.celrep.2016.07.018.

AUTHOR CONTRIBUTIONS

S.S., N.V.L., and A.S.M. conceived the project, designed the experiments,

analyzed the data, and wrote themanuscript. S.S. performed the experiments.

D.K. performed some experiments. R.M. conceived and designed the synthe-

sis of the acceptor substrates. S.N. and L.R. carried out the synthesis and

chemical analysis of the acceptor substrates.

ACKNOWLEDGMENTS

We thank Emanuel Ehmki for contribution to chemical synthesis, Axel Innis and

Daniel Wilson for stimulating discussions, Prabha Fernandes for providing sol-

ithromycin, and Lisa Smith for editing the manuscript. This work was sup-

ported by grant GM104370 from the National Institute of General Medicine,

NIH (to A.S.M. and N.V.L.) and grants P27947 and I1040 from Austrian Science

Fund FWF (to R.M.). The work in the A.S.M. laboratory is supported in part by

grants from pharmaceutical companies Melinta Therapeutics and Cempra

Pharmaceuticals.

Received: April 5, 2016

Revised: June 6, 2016

Accepted: July 4, 2016

Published: August 4, 2016

REFERENCES

Almutairi, M.M., Park, S.R., Rose, S., Hansen, D.A., Vazquez-Laslop, N.,

Douthwaite, S., Sherman, D.H., and Mankin, A.S. (2015). Resistance to keto-

lide antibiotics by coordinated expression of rRNA methyltransferases in a

bacterial producer of natural ketolides. Proc. Natl. Acad. Sci. USA 112,

12956–12961.

Arenz, S., Meydan, S., Starosta, A.L., Berninghausen, O., Beckmann, R.,

Vazquez-Laslop, N., and Wilson, D.N. (2014a). Drug sensing by the ribosome

induces translational arrest via active site perturbation. Mol. Cell 56,

446–452.

Arenz, S., Ramu, H., Gupta, P., Berninghausen, O., Beckmann, R., Vazquez-

Laslop, N., Mankin, A.S., and Wilson, D.N. (2014b). Molecular basis for eryth-

romycin-dependent ribosome stalling during translation of the ErmBL leader

peptide. Nat. Commun. 5, 3501.

Bourd, S., Victorova, L., and Kukhanova, M. (1982). On substrate specificity of

the donor site of the Escherichia coli ribosomal peptidyl transferase center.

Synthesis of dipeptides from 30-terminal fragments of aminoacyl-tRNA.

FEBS Lett. 142, 96–100.

Brunelle, J.L., Youngman, E.M., Sharma, D., and Green, R. (2006). The interac-

tion between C75 of tRNA and the A loop of the ribosome stimulates peptidyl

transferase activity. RNA 12, 33–39.


Bulkley, D., Innis, C.A., Blaha, G., and Steitz, T.A. (2010). Revisiting the struc-

tures of several antibiotics bound to the bacterial ribosome. Proc. Natl. Acad.

Sci. USA 107, 17158–17163.

Davis, A.R., Gohara, D.W., and Yap, M.N. (2014). Sequence selectivity of mac-

rolide-induced translational attenuation. Proc. Natl. Acad. Sci. USA 111,

15379–15384.

Doerfel, L.K., Wohlgemuth, I., Kothe, C., Peske, F., Urlaub, H., and Rodnina,

M.V. (2013). EF-P is essential for rapid synthesis of proteins containing

consecutive proline residues. Science 339, 85–88.

Dunkle, J.A., Xiong, L., Mankin, A.S., and Cate, J.H. (2010). Structures of the

Escherichia coli ribosome with antibiotics bound near the peptidyl transferase

center explain spectra of drug action. Proc. Natl. Acad. Sci. USA 107, 17152–

17157.

Elgamal, S., Katz, A., Hersch, S.J., Newsom, D., White, P., Navarre, W.W., and

Ibba, M. (2014). EF-P dependent pauses integrate proximal and distal signals

during translation. PLoS Genet. 10, e1004553.

Graber, D., Moroder, H., Steger, J., Trappl, K., Polacek, N., and Micura, R.

(2010). Reliable semi-synthesis of hydrolysis-resistant 30-peptidyl-tRNA conju-

gates containing genuine tRNA modifications. Nucleic Acids Res. 38, 6796–

6802.

Gryczan, T.J., Grandi, G., Hahn, J., Grandi, R., and Dubnau, D. (1980). Con-

formational alteration of mRNA structure and the posttranscriptional regula-

tion of erythromycin-induced drug resistance. Nucleic Acids Res. 8,

6081–6097.

Gupta, P., Liu, B., Klepacki, D., Gupta, V., Schulten, K., Mankin, A.S., and Vaz-

quez-Laslop, N. (2016). Nascent peptide assists the ribosome in recognizing

chemically distinct small molecules. Nat. Chem. Biol. 12, 153–158.

Hardesty, B., Picking, W.D., and Odom, O.W. (1990). The extension of poly-

phenylalanine and polylysine peptides on Escherichia coli ribosomes. Bio-

chim. Biophys. Acta 1050, 197–202.

Horinouchi, S., and Weisblum, B. (1980). Posttranscriptional modification of

mRNA conformation: mechanism that regulates erythromycin-induced resis-

tance. Proc. Natl. Acad. Sci. USA 77, 7079–7083.

Johansson, M., Ieong, K.W., Trobro, S., Strazewski, P., Aqvist, J., Pavlov,

M.Y., and Ehrenberg, M. (2011). pH-sensitivity of the ribosomal peptidyl trans-

fer reaction dependent on the identity of the A-site aminoacyl-tRNA. Proc.

Natl. Acad. Sci. USA 108, 79–84.

Kannan, K., Vazquez-Laslop, N., and Mankin, A.S. (2012). Selective pro-

tein synthesis by ribosomes with a drug-obstructed exit tunnel. Cell 151,

508–520.

Kannan, K., Kanabar, P., Schryer, D., Florin, T., Oh, E., Bahroos, N., Tenson, T.,

Weissman, J.S., and Mankin, A.S. (2014). The general mode of translation in-

hibition by macrolide antibiotics. Proc. Natl. Acad. Sci. USA 111, 15958–

15963.

Katunin, V.I., Muth, G.W., Strobel, S.A., Wintermeyer, W., and Rodnina,

M.V. (2002). Important contribution to catalysis of peptide bond forma-

tion by a single ionizing group within the ribosome. Mol. Cell 10,

339–346.

Kwak, J.H., Choi, E.C., and Weisblum, B. (1991). Transcriptional attenuation

control of ermK, a macrolide-lincosamide-streptogramin B resistance deter-

minant from Bacillus licheniformis. J. Bacteriol. 173, 4725–4735.

Kwon, A.R., Min, Y.H., Yoon, E.J., Kim, J.A., Shim, M.J., and Choi, E.C. (2006).

ErmK leader peptide : amino acid sequence critical for induction by erythro-

mycin. Arch. Pharm. Res. 29, 1154–1157.

Li, G.W., Oh, E., and Weissman, J.S. (2012). The anti-Shine-Dalgarno

sequence drives translational pausing and codon choice in bacteria. Nature

484, 538–541.

Lu, J., Kobertz, W.R., and Deutsch, C. (2007). Mapping the electrostatic poten-

tial within the ribosomal exit tunnel. J. Mol. Biol. 371, 1378–1391.

Mao, J.C.-H., and Robishaw, E.E. (1971). Effects of macrolides on peptide-

bond formation and translocation. Biochemistry 10, 2054–2061.

Mohammad, F., Woolstenhulme, C.J., Green, R., and Buskirk, A.R. (2016).

Clarifying the Translational Pausing Landscape in Bacteria by Ribosome

Profiling. Cell Rep. 14, 686–694.

Monro, R.E., Cerna, J., and Marcker, K.A. (1968). Ribosome-catalyzed pep-

tidyl transfer: substrate specificity at the P-site. Proc. Natl. Acad. Sci. USA

61, 1042–1049.

Moroder, H., Steger, J., Graber, D., Fauster, K., Trappl, K., Marquez, V., Pola-

cek, N., Wilson, D.N., and Micura, R. (2009). Non-hydrolyzable RNA-peptide

conjugates: a powerful advance in the synthesis of mimics for 30-peptidyl

tRNA termini. Angew. Chem. Int. Ed. Engl. 48, 4056–4060.

Muto, H., and Ito, K. (2008). Peptidyl-prolyl-tRNA at the ribosomal P-site reacts

poorly with puromycin. Biochem. Biophys. Res. Commun. 366, 1043–1047.

Otaka, T., and Kaji, A. (1975). Release of (oligo) peptidyl-tRNA from ribosomes

by erythromycin A. Proc. Natl. Acad. Sci. USA 72, 2649–2652.

Ramu, H., Mankin, A., and Vazquez-Laslop, N. (2009). Programmed drug-

dependent ribosome stalling. Mol. Microbiol. 71, 811–824.

Ramu, H., Vazquez-Laslop, N., Klepacki, D., Dai, Q., Piccirilli, J., Micura, R.,

and Mankin, A.S. (2011). Nascent peptide in the ribosome exit tunnel affects

functional properties of the A-site of the peptidyl transferase center. Mol.

Cell 41, 321–330.

Schl€unzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R.,

Yonath, A., and Franceschi, F. (2001). Structural basis for the interaction of an-

tibiotics with the peptidyl transferase centre in eubacteria. Nature 413,

814–821.

Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. (2012). NIH Image to

ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675.

Shimizu, Y., Inoue, A., Tomari, Y., Suzuki, T., Yokogawa, T., Nishikawa, K., and

Ueda, T. (2001). Cell-free translation reconstituted with purified components.

Nat. Biotechnol. 19, 751–755.

Sothiselvam, S., Liu, B., Han, W., Ramu, H., Klepacki, D., Atkinson, G.C., Bra-

uer, A., Remm, M., Tenson, T., Schulten, K., et al. (2014). Macrolide antibiotics

allosterically predispose the ribosome for translation arrest. Proc. Natl. Acad.

Sci. USA 111, 9804–9809.

Starosta, A.L., Karpenko, V.V., Shishkina, A.V., Mikolajka, A., Sumbatyan,

N.V., Schluenzen, F., Korshunova, G.A., Bogdanov, A.A., and Wilson, D.N.

(2010). Interplay between the ribosomal tunnel, nascent chain, and macrolides

influences drug inhibition. Chem. Biol. 17, 504–514.

Starosta, A.L., Lassak, J., Peil, L., Atkinson, G.C., Virumae, K., Tenson, T., Re-

mme, J., Jung, K., and Wilson, D.N. (2014). Translational stalling at polyproline

stretches is modulated by the sequence context upstream of the stall site.

Nucleic Acids Res. 42, 10711–10719.

Subramanian, S.L., Ramu, H., and Mankin, A.S. (2011). Inducible resistance

to macrolide antibiotics. In Antibiotic Drug Discovery and Development,

T.J. Dougherty and M.J. Pucci, eds. (New Yoork, NY: Springer Publishing

Company).

Tenson, T., Lovmar, M., and Ehrenberg, M. (2003). Themechanism of action of

macrolides, lincosamides and streptogramin B reveals the nascent peptide

exit path in the ribosome. J. Mol. Biol. 330, 1005–1014.

Tu, D., Blaha, G., Moore, P.B., and Steitz, T.A. (2005). Structures ofMLSBK an-

tibiotics bound tomutated large ribosomal subunits provide a structural expla-

nation for resistance. Cell 121, 257–270.

Ude, S., Lassak, J., Starosta, A.L., Kraxenberger, T., Wilson, D.N., and Jung,

K. (2013). Translation elongation factor EF-P alleviates ribosome stalling at pol-

yproline stretches. Science 339, 82–85.

Vazquez, D. (1966). Antibiotics affecting chloramphenicol uptake by bacteria.

Their effect on amino acid incorporation in a cell-free system. Biochim. Bio-

phys. Acta 114, 289–295.

Vazquez-Laslop, N., Thum, C., andMankin, A.S. (2008). Molecular mechanism

of drug-dependent ribosome stalling. Mol. Cell 30, 190–202.

Vazquez-Laslop, N., Ramu, H., Klepacki, D., Kannan, K., and Mankin, A.S.

(2010). The key function of a conserved and modified rRNA residue in the ribo-

somal response to the nascent peptide. EMBO J. 29, 3108–3117.


Vazquez-Laslop, N., Klepacki, D., Mulhearn, D.C., Ramu, H., Krasnykh, O.,

Franzblau, S., and Mankin, A.S. (2011). Role of antibiotic ligand in nascent pep-

tide-dependent ribosomestalling. Proc.Natl. Acad.Sci.USA108, 10496–10501.

Weisblum, B. (1995). Insights into erythromycin action from studies of its activ-

ity as inducer of resistance. Antimicrob. Agents Chemother. 39, 797–805.

Wilson, D.N. (2009). The A-Z of bacterial translation inhibitors. Crit. Rev. Bio-

chem. Mol. Biol. 44, 393–433.

Wintermeyer, W., Peske, F., Beringer, M., Gromadski, K.B., Savelsbergh,

A., and Rodnina, M.V. (2004). Mechanisms of elongation on the ribo-

some: dynamics of a macromolecular machine. Biochem. Soc. Trans.

32, 733–737.

Wohlgemuth, I., Brenner, S., Beringer, M., and Rodnina, M.V. (2008). Modula-

tion of the rate of peptidyl transfer on the ribosome by the nature of substrates.

J. Biol. Chem. 283, 32229–32235.

Woolstenhulme, C.J., Parajuli, S., Healey, D.W., Valverde, D.P., Petersen,

E.N., Starosta, A.L., Guydosh, N.R., Johnson, W.E., Wilson, D.N., and Buskirk,

A.R. (2013). Nascent peptides that block protein synthesis in bacteria. Proc.

Natl. Acad. Sci. USA 110, E878–E887.


Cell Reports, Volume 16

Supplemental Information

Binding of Macrolide Antibiotics Leads

to Ribosomal Selection against Specific

Substrates Based on Their Charge and Size

Shanmugapriya Sothiselvam, Sandro Neuner, Lukas Rigger, Dorota Klepacki, RonaldMicura, Nora Vázquez-Laslop, and Alexander S. Mankin

- - 2

� ��

��+)52'��'-#4'&�40��+)52'��25)�+/&5%'&�2+$030.'�34#--+/)�+/�4*'�� +3�/04�&'1'/&'/4�0/�4*'�.��02� 4��3425%452'�#/&� +&'/4+49�0(� 4*'�4*+2&�#.+/0�#%+&�+3�/04�3+)/+(+%#/4�(02��"�&'1'/&'/4�2+$030.'�34#--+/)�+/�4*'�� ,CD��+9EI9B79�C:�H<9�K=@8�HMD9�%*$*�'*��5B8�H<9�'*�G�K=H<�GMBCBMACIG�7<5B;9G�=B�H<9�7C8CBG�7CFF9GDCB8=B;�HC�H<9�7F=H=75@�5A=BC�57=8�F9G=8I9G�C:�H<9�GH5@@=B;�ACH=:�,<9�KH�*$*�G9EI9B79�=G�897C898�6M�H*&�G��F;��$9I�� F;�� !B� H<9� AIH5BHG� % %�� H<9� G5A9� G9EI9B79� =G� 897C898� 6M� �F;��$9I �$9I��F;��% ��F;��$9I��F;��%��F;��$9I��$9I��F;��%��,<9�D9BI@H=A5H9� � �� 5A=BC� 57=8� F9G=8I9� C:� H<9� B5G79BH� 7<5=B� =B� H<9� 8FI;GH5@@98�F=6CGCA9�� H<9� (� G=H9�� 5B8� H<9� �� G=H9� F9G=8I9G� 5F9� A5F?98� 56CJ9� H<9� D9DH=89�G9EI9B79��CHHCA��,C9DF=BH=B;�5B5@MG=G�C:��*1�89D9B89BH�F=6CGCA9�GH5@@=B;�CB�H<9�KH�5B8�AIH5BH�%*$*�'*�G��@57?�5FFCKG� =B8=75H9� HF5BG@5H=CB�5FF9GH�5H� H<9�$9I�� 7C8CB� �6@57?� 6CL� =B� H<9� G9EI9B79� CB� H<9� G=89� C:� H<9� ;9@� 5B8� =B� H<9� HCD�D5B9@�� F5M� 5FFCKG� DC=BH� HC� H<9� HC9DF=BH� 65B8G� ;9B9F5H98� 6M� H<9� F=6CGCA9G��K<=7<� 6MD5GG98� H<9� $9I�� 7C8CB� 5B8� K9F9� 75DHIF98� 5H� H<9� 8CKBGHF95A� (FC�7C8CB� �;F5M� 6CL�� 8I9� HC� H<9� DF9G9B79� C:� AID=FC7=B�� 5B� !@9*+� =B<=6=HCF�+9EI9B7=B;� @5B9G� 5F9� A5F?98� �9@G� 5F9� F9DF9G9BH5H=J9� C:� HKC� =B89D9B89BH�9LD9F=A9BHG��,C9DF=BH=B;�5B5@MG=G�C:��*1�89D9B89BH�F=6CGCA9�GH5@@=B;�CB�H<9�%#0#�'*�G�$5B9G�A5F?98�5G�VV�5B8�V�W�F9DF9G9BH�H<9�F957H=CBG�K=H<�H<9�%*$*�H9AD@5H9� D9F:CFA98� K=H<CIH� 5B8� K=H<� �*1�� F9GD97H=J9@M� ,<9� 7CAD@9H9� '*��9B7C8=B;�H<9�D9DH=89�GH5FH=B;�K=H<�H<9�%#$#�G9EI9B79�=G�G<CKB�56CJ9�H<9�;9@G��FFCKG�5F9� 5G� =B� �� 9L79DH� H<5H� =B� H<9� 75G9�C:� H<9� !@9��AIH5H=CB� =B� H<9�%#0#�D9DH=89� �@5B9�A5F?98� V!W�� H<9� !@9�� 7C8CB�K5G� F9D@5798�K=H<� H<9�,FD� 7C8CB�5B8�AID=FC7=B� K5G� GI6GH=HIH98� K=H<� =B8C@AM7=B�� ,FD*+� =B<=6=HCF� +9EI9B7=B;� @5B9G�5F9�A5F?98��9@G�5F9�F9DF9G9BH5H=J9�C:�HKC�=B89D9B89BH�9LD9F=A9BHG�

- - 3

��

��+)52'��'-#4'&�40��+)52'��+(('2'/4�.#%20-+&'�#/4+$+04+%3�3*07�3+.+-#2�3'/3+4+6+49� 40� 4*'� .54#4+0/3� 0(� 4*'� �� .04+(�� <9A=75@� GHFI7HIF9G� C:�A57FC@=89G��*1�5B8��2!�5B8�C:�?9HC@=89�+'$� ��,C9DF=BH=B;�5B5@MG=G�C:�8FI;89D9B89BH� F=6CGCA9� GH5@@=B;� 8IF=B;� HF5BG@5H=CB� C:� H<9� D9DH=89G� K=H<� 5@5B=B9�GI6GH=HIH=CBG� =B� H<9�*$*�ACH=:� ,<9� D9BI@H=A5H9� � �� 5A=BC� 57=8� F9G=8I9� C:� H<9�B5G79BH�7<5=B�=B�H<9�8FI;GH5@@98�F=6CGCA9��H<9�(�G=H9��5B8�H<9��G=H9�F9G=8I9G�5F9�A5F?98� 56CJ9� H<9� D9DH=89� G9EI9B79� �@57?� 5FFCKG� =B8=75H9� �*1�� 2!� CF� +'$�89D9B89BH� HF5BG@5H=CB� 5FF9GH� 5H� 7C8CB� �� ,<9� HC9DF=BH� 65B8G� F9DF9G9BH=B;�F=6CGCA9G� 75DHIF98� 5H� H<9� 8CKBGHF95A� (FC�� 7C8CB� 8I9� HC� H<9� DF9G9B79� C:�AID=FC7=B��5B�!@9*+�=B<=6=HCF��5F9�=B8=75H98�6M�;F5M�5FFCKG�+9EI9B7=B;�@5B9G�5F9�A5F?98��9@G�5F9�F9DF9G9BH5H=J9�C:�HKC�=B89D9B89BH�9LD9F=A9BHG��

- - 4

��

��

�+)52'��'-#4'&�40��+)52'��+$030.'�%#4#-9:'&�2'#%4+0/�0(�4*'�.0&'-��3+4'� 35$342#4'3� 7+4*� ��4�� #/&� �� 02� ��4�� #/&� �� +/� 4*'�#$3'/%'� 0(� ��"�� 9@�9@97HFCD<CF9G=G�5B5@MG=G�C:� H<9� 3��+4� @569@98�%*$H*&�$9I��CF�%�$H*&�$9I��F9A5=B=B;�IDCB�F957H=CB�C:�H<9�F=6CGCA9A*&�D9DH=8M@H*&�� 7CAD@9L� K=H<� H<9� =B8=75H98� 5779DHCF� GI6GHF5H9� 5B5@C;G� =B� H<9�56G9B79�C:��*1��@@� H<9�GI6GHF5H9G�7CB:CFA�HC�H<9�;9B9F5@�GHFI7HIF9��&0�K<9F9� 0� F9DF9G9BHG� H<9� 5A=BC� 57=8� ,<9� H=A9� C:� =B7I65H=CB� K=H<� H<9� 5779DHCF�GI6GHF5H9G� =G� =B8=75H98� 56CJ9� H<9� ;9@� @5B9G� �5FHCCBG� CB� H<9� G=89� C:� H<9� ;9@G�=B8=75H9� H<9� 65B8� 7CFF9GDCB8=B;� HC� 3��+4� @569@98� %*$H*&�$9I� �� CF� %�$H*&�$9I��,F=5B;@9�DC=BHG�HC�H<9�65B8�F9DF9G9BH=B;�:%9HH*&�:%9H�DF9G9BH�=B�H<9�F957H=CB��9@G�5F9�F9DF9G9BH5H=J9�C:�5H�@95GH�HKC�=B89D9B89BH�9LD9F=A9BHG��)I5BH=:=75H=CB� C:� H<9� IBF957H98� %*$H*&�$9I� �� CF� %�$H*&�$9I� �� CJ9F� H<9�7CIFG9�C:�H<9�H=A9�:FCA�H<9�7CFF9GDCB8=B;�;9@G�,<9�5ACIBH�C:�D9DH=8M@H*&�$9I�5H��A=B�K5G�G9H�5G� ��FFCF�65FG�G<CK�89J=5H=CB� :FCA�H<9�A95B�65G98�CB�HKC� =B89D9B89BH� 9LD9F=A9BHG� ,<9� 9LD9F=A9BH� K=H<� H<9� ��&5A=BC5@5B=B9�GI6GHF5H9�K5G�D9F:CFA98�CB@M�CB79�

- - 5

� ��!�� *'.+%#-�39/4*'3+3�0(��#.+/0�#%+&�%0/,5)#4'3��,<9��5A=BC�57=8�7CB>I;5H9G�7CBH5=B=B;��5N=8C$BCF@9I7=B9��<M8FCLM�BCF@9I7=B9��BCF@9I7=B9��5A=BCC7H5BC=7�57=8��'��75@@98�=B�H<9�D5D9F�X9H<M@BCF@9I7=B9X��&@9�H��:CF�7CBG=GH9B7M��CF�$��8=5A=BCDFCD=CB=7�57=8��5D��75@@98�=B�H<9�D5D9F�X5A=BC�5@5B=B9X��@5��:CF�7CBG=GH9B7M��K9F9�GMBH<9G=N98�5G�CIH@=B98�=B��%*'.'��5B8�89G7F=698�69@CK��@@�H<9�CH<9F��5A=BC�57=8�7CB>I;5H9G�K9F9�GMBH<9G=N98�:C@@CK=B;�H<9�DFC798IF9G�89G7F=698�6M�%CFC89F�9H�5@��

�%*'.'��+MBH<9G=G�C:�GC@=8�GIDDCFHG�5B8�*&�5A=BC�57=8�7CB>I;5H9G�*957H=CB�7CB8=H=CBG��#�� 9EI=J��AC75A=BC�57=8'�H�� 9EI=J��!(��=B��8=A9H<M@:CFA5A=89��FH��<��FH�� <��$�� 9EI=J� C:� 58=D=7� 57=8� 6=G�D9BH5:@ICFCD<9BM@�9GH9F�� 9EI=J� �%�(� =B� ��8=A9H<M@:CFA5A=89�DMF=8=B9�� J�J��FH�� <��%��O��9EI=J��K�K��5A=BC:IB7H=CB5@=N98�DC@MGHMF9B9�GIDDCFH� �� %!,3(#!1%�� IGHCA�(F=A9F� +IDDCFH,%� �� A=BC�� O�� 9EI=J� �K�K�� DMF=8=B9��8=A9H<M@:CFA5A=89�� FH�� 85M�� &�� 5IHCA5H98� *&�� GC@=8D<5G9� GMBH<9G=G�� 89DFCH97H=CB�� 5B8�DIF=:=75H=CB��AC7��:@ICF9BM@�A9H<CLM75F6CBM@��@@C7��5@@M@CLM75F6CBM@��H��9BNCHF=5NC@ M@��!(��8==GCDFCDM@9H<M@5A=B9��%�(��8=A9H<M@5A=BC�DMF=8=B9��*'.+%#-�39/4*'3+3�0(�30-+&�35110243��%.%1!,� 1%-!1+2� *95;9BHG� K9F9� DIF7<5G98� =B� H<9� <=;<9GH� 5J5=@56@9� EI5@=HM� :FCA�7CAA9F7=5@� GIDD@=9FG� �+=;A5�@8F=7<�� 7FCG�� !*!+� �=CH97<� �A6 �� 5B8� IG98� K=H<CIH�:IFH<9F� DIF=:=75H=CB� 'F;5B=7� GC@J9BHG� :CF� F957H=CBG� K9F9� 8F=98� CJ9FB=;<H� CJ9F� :F9G<@M�57H=J5H98�AC@97I@5F�G=9J9G��P��,<9�F957H=CBG�K9F9�75FF=98�CIH�IB89F�5F;CB�5HACGD<9F9� �5B8� ��GD97HF5�K9F9� F97CF898�CB�5��FI?9F��*0��% N�GD97HFCA9H9F��<9A=75@�G<=:HG� �:�� 5F9� F9DCFH98� F9@5H=J9� HC� H9HF5A9H<M@G=@5B9� �,%+�� F9:9F9B798� HC� H<9� F9G=8I5@�DFCHCB� G=;B5@� C:� H<9� 89IH9F5H98� GC@J9BH� �%+'8�� DDA� :CF� �&%*� GD97HF5� 5B8�� DDA� :CF� �� GD97HF5�� ,<9� :C@@CK=B;� 566F9J=5H=CBG� K9F9� IG98� HC� 89BCH9�

- - 6

AI@H=D@=7=H=9G�� G� �� G=B;@9H�� 8� �� 8CI6@9H�� H� �� HF=D@9H�� A� �� AI@H=D@9H�� 6� �� 6FC58� +=;B5@�5GG=;BA9BHG� K9F9� 65G98� CB� �'+1� 5B8� �� +)�� 9LD9F=A9BHG� %+�9LD9F=A9BHG� K9F9� D9F:CFA98� CB� 5� �=BB=;5B� $�)� �8J5BH5;9� %�0� =CB� HF5D�=BGHFIA9BH5H=CB� �,<9FAC� �=G<9F� +7=9BH=:=7�� K=H<� 5B� 9@97HFCGDF5M� =CB� GCIF79� +5AD@9G�K9F9�5B5@MN98�=B�H<9�DCG=H=J9�CF�B9;5H=J9=CB�AC89�*957H=CB�7CBHFC@�K5G�D9F:CFA98�J=5�5B5@MH=75@� H<=B@5M9F� 7<FCA5HC;F5D<M� �,$��%57<9F9M&5;9@��K=H<� :@ICF9G79BH� =B8=75HCF�+DCHG�K9F9�:IFH<9F�J=GI5@=N98�IG=B;�79F=IA�AC@M685H9�CF�5B=G5@89<M89�GH5=B=B;�F95;9BHG��C@IAB�7<FCA5HC;F5D<M�K5G�75FF=98�CIH�CB�G=@=75�;9@��A9G<��IGHCA�(F=A9F�+IDDCFH,%� �� A=BC� K5G� DIF7<5G98� :FCA� �� 95@H<75F9� �9F=J5H=N98� 5A=BC� 57=8G��AC7$&@9��&��' � �5@GC� 75@@98� �AC7$$MG�&��' �� AC7$&@9��'H��%+�' ��AC7$&@9' �5B8��AC7$��C7' � �5@GC� 75@@98��AC7$��C7' ��K9F9� DIF7<5G98�:FCA��1)2��)/3%#(��-"��+C@=8�GIDDCFHG��7CBH5=B=B;�CH<9F�5A=BC�57=8G��$$MG��$'FB��$�@I��9H7��K9F9�DF9D5F98�5G�89G7F=698�6M�%CFC89F�9H�5@��&��)�B�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��!9)$/$�./1,%4#).8, !-)./��$%/78� ��'��$)-%3(/7831)38,��!$%./2).%� ��-'�� AC7�DFCH97H98� $�5N=8CBCF@9I7=B9� � �� A;�� AAC@�� K5G� 8=GGC@J98� =B� �%�� A$��:C@@CK98� 6M� 588=H=CB� C:� ��69BNCHF=5NC@ M@��H9HF5A9H<M@IFCB=IA�<9L5:@ICFCD<CGD<5H9�� ,-��A;��AAC@�� <M8FCLM69BNCHF=5NC@9�<M8F5H9�� '�H��A;��AAC@��5B8��8==GCDFCDM@9H<M@5A=B9� ��!(��T$��AAC@��:H9F��A=BIH9G� C:� 57H=J5H=CB�� 5A=BC��3�8=.6IHM@5A=BC�A9H<M@9B94��89CLM��8=A9H<CLMHF=HM@��589BCG=B9�� 9=9FA5BB�9H� 5@�� A;�� AAC@�� =B� �A$��%��K5G�58898�5B8�H<9�A=LHIF9�K5G�GH=FF98�CJ9FB=;<H�5H�FCCA�H9AD9F5HIF9�,<9B��H<9�GC@J9BH�K5G�9J5DCF5H98��H<9�F9G=8I9�8=GGC@J98�=B�� @��5B8�K5G<98�7CBG97IH=J9@M�K=H<�<5@:G5HIF5H98�5EI9CIG�&5 �'��GC@IH=CB��7=HF=7�57=8�GC@IH=CB��5B8�G5HIF5H98�5EI9CIG�&5�@�GC@IH=CB�,<9�CF;5B=7�@5M9F�K5G�8F=98��&5�+'��9J5DCF5H98��5B8�H<9�7FI89�DFC8I7H�K5G�DIF=:=98�J=5�+='��7<FCA5HC;F5D<M�M=9@8=B;� ��A;�C:�7CADCIB8��-'��5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F��A�� 5F�� A�� 5F��5B8��@�� G�� & ��8�� "�� 5F��G�� 8�� "�� &�&@9�� G�� 5B8� �� A�� 5B8� '� ��AC7�� A�� AC7��5B8�� \��&@9��G�� L'� ��%,�� A�� &�� A�� 5B8�&�� H�� "�� &�� A�� &�� 5B8��L� �� A�� &�� &%*� ��% N��@�� ]� �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7�� L'� ��%,�� \�� &@9�� 5B8� &�� &�� AC7�� &�� +!%+��A�N��3%� 4��75@78�:CF�� & '�� :CIB8� ��&��)�.�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��!9)$/�$�./1,%4#).8, !-)./��$%/78� ��$)-%3(/7831)38,��$)/7/��0%.3!&,4/1/0(%.8,/78�(%78, ��!$%./2).%��-'��,C�5�GC@IH=CB�C:�7CADCIB8��-'�� A;�� AAC@�� =B��%�� A$��5B8�DMF=8=B9�� A$��K5G�58898��%�(��A;�� AAC@��5B8�6=G�D9BH5:@ICFCD<9BM@��58=D5H9� � ��A;��AAC@��,<9�A=LHIF9�K5G�GH=FF98�:CF�CB9�<CIF�:C@@CK98�6M�9J5DCF5H=CB�C:�H<9�GC@J9BHG�,<9�7FI89�DFC8I7H�K5G�

- - 7

DIF=:=98� J=5�+='�� 7<FCA5HC;F5D<M� �� @��579HCB9�� M=9@8=B;� ��A;� C:� 7CADCIB8��-'��5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F�� A�� 5F�� A�� 5F�� 5B8��@��8�� "�� 5F��8�� "�� &�� 8�� "�� A�� A�� &�&@9��5B8� ��A�� '� ��AC7��A�� 5B8� ��AC7��A�� \��&@9��G�� '� ��%,�� H�� "� �� &�� A�� 5B8� &�� A�� &�� 5B8� �� G�� ''�� ''�� A�� &�� 5B8�''�� ''� 5B8� �� L�� &@9�� A�� &�� A�� &�� &%*� �� % N�� @�� ]� � �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7�� L'� ��\��&@9�� &�� AC7�� &�� ''�� ''�� ''�� ''�� L� � �� +!%+� �A�N�� 3%� 4�� 75@78� :CF� �� & ' �� :CIB8� ��1��-/#��,%��2/,)$�2400/13��-'��CADCIB8��-'�� A;��AAC@��K5G�8=GGC@J98�=B�8FM��%��A$��5B8�DMF=8=B9�� T$��K5G�58898�,C�H<=G�GC@IH=CB�� 5A=BC:IB7H=CB5@=N98� GIDDCFH� �� %!,3(#!1%��423/-� �1)-%1� �400/13�� -)./�� A;�� K5G� 58898�� 5B8� H<9� GIGD9BG=CB� K5G� 5;=H5H98� :CF� �� <FG� 5H� FCCA�H9AD9F5HIF9�+I6G9EI9BH@M��H<9�6958G�K9F9�7C@@97H98�CB�5��Q7<B9F�:IBB9@�5B8�K5G<98�K=H<��%��A9H<5BC@�� 5B8�� @�� CF� 75DD=B;� C:� IBF957H98� 5A=BC� ;FCIDG�� H<9� 6958G�K9F9� HF95H98�K=H<�5�A=LHIF9�C:� GC@IH=CB�� %�D<9BCLM�579H=7�5B<M8F=89� =B�, �� A$��5B8�GC@IH=CB��%��A9H<M@�=A=85NC@9��%�28-7C@@=8=B9�=B�, �� A$��5B8�5;=H5H98�:CF� ��A=B�5H�FCCA�H9AD9F5HIF9�,<9�GIGD9BG=CB�K5G�:=@HF5H98�5;5=B��H<9�6958G�K9F9�K5G<98�K=H<�, ��A9H<5BC@�5B8�� @��5B8�8F=98�IB89F�J57IIA�$C58=B;�C:�H<9�GIDDCFH��-'��K5G��TAC@�;��&��)�B�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��'�H9FH�"438,$)-%38,2),8,/78�$�./1,%4#).8, !-)./��$%/78� ��'��$)-%3(/7831)38,��!$%./2).%��-'��@ICF9BM@A9H<CLM75F6CBM@��3%13�6IHM@8=A9HM@G=@M@�<M8FCLM$�BCF@9I7=B9�� A;��AAC@��K5G�8=GGC@J98�=B��%��A$��:C@@CK98�6M�588=H=CB�C:��69BNCHF=5NC@ M@��H9HF5A9H<M@IFCB=IA� <9L5:@ICFCD<CGD<5H9� � �,-�� A;�� AAC@�� <M8FCLM69BNCHF=5NC@9� <M8F5H9� � '�H�� A;�� AAC@�� 5B8� ��8==GCDFCDM@9H<M@5A=B9� ��!(�� T$�� AAC@�� :H9F� �� A=BIH9G� C:� 57H=J5H=CB�� 5A=BC��3�8=.6IHM@5A=BC�A9H<M@9B94��89CLM��8=A9H<CLMHF=HM@��589BCG=B9�� 9=9FA5BB� 9H� 5@�� A;�� AAC@�� =B� � A$� �%�� K5G� 58898� 5B8� H<9�A=LHIF9�K5G�GH=FF98�CJ9FB=;<H�5H� FCCA� H9AD9F5HIF9�,<9B�� H<9�GC@J9BH�K5G�9J5DCF5H98��H<9�F9G=8I9�8=GGC@J98� =B�� @��5B8�K5G<98�7CBG97IH=J9@M�K=H<�<5@:G5HIF5H98�5EI9CIG�&5 �'�� GC@IH=CB�� 7=HF=7� 57=8� GC@IH=CB�� 5B8� G5HIF5H98� 5EI9CIG� &5�@� GC@IH=CB� ,<9�CF;5B=7� @5M9F� K5G� 8F=98� �&5�+'�� 9J5DCF5H98� 5B8� H<9� 7FI89� DFC8I7H� K5G� DIF=:=98� J=5�+='��7<FCA5HC;F5D<M�M=9@8=B;��A;�C:�7CADCIB8��-'��5G�K<=H9�:C5A�� &%*��% N��@��]�� G�� &��G�� G�� A�� 5F�� A�� 5F�� A�� 5F�� 5B8��@��6�� &��8�� "�� 5F��G�� 8��

- - 8

��"�� &�&@9��A�� G�� A�� 5B8�'� ��AC7�� H�� "�� \��AC7��5B8� ��%,��G�� L�'� ��%,��5B8�'� ��&@9�� A�� &�� A�� A�� &�� A�� &�� A�� L ��&@9�� A�� &�� A�� &�� G�� L� ��,��%+��G�� L+=� ��,��%+�� &%*� �� % N�� @�� ]� �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7��\��&@9��5B8��L�'� ��5B8�&�� AC7��'� ��&@9��5B8�� 5B8�� &�� 5B8� � ��&@9�� L� � ��,��%+�� 5B8� �� 5B8� �� &�� 5B8� � ��&@9�� &�� &�� L� +=� �� +!%+� �A�N�� 3%� 4�� 75@78� :CF�� &�'�+=�� :CIB8� ��&��)�.�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��'�H9FH�"438,$)-%38,2),8,/78�$�./1,%4#).8, !-)./��$%/78� ��$)-%3(/7831)38,��$)/7/��0%.3!&,4/1/0(%.8,/78�(%78, ��!$%./2).%� ��-'�� ,C� 5� GC@IH=CB� C:�7CADCIB8��-'�� A;��AAC@�� =B��%��A$��5B8�DMF=8=B9��A$��K5G�58898� �%�(� �� A;�� AAC@�� 5B8� 6=G�D9BH5:@ICFCD<9BM@�� 58=D5H9� � �� A;�� AAC@��,<9�A=LHIF9�K5G�GH=FF98�:CF�CB9�<CIF�:C@@CK98�6M�9J5DCF5H=CB�C:�H<9�GC@J9BHG�,<9�7FI89�DFC8I7H�K5G�DIF=:=98�J=5�+='��7<FCA5HC;F5D<M�� @��579HCB9��M=9@8=B;� ��A;�C:�7CADCIB8��-'��5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� 8�� "�� 5F��8�� "�� 5F�� A�� 5F��5B8��@��8�� "�� 5F��6�� &�� 8�� "�� A�� A�� 5B8� &�&@9�� A�� '� ��AC7��5B8� ��AC7�� A�� A�� \��&@9�� G�� L'� ��%,�� A�� &�� H�� "� �� '� ��&@9�� A�� H�� "��&�� G�� ''�� ''�� G�� ''�� ''�� A�� L� ��&@9��5B8��''�� ''��5B8�&�� A�� &�� G�� L� ��,��%+�� G�� L+=� �� &%*� �� % N�� @�� ]� � �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7�� &�� \�� &@9�� 5B8� �L'� ��%,�� &�� AC7��'� ��&@9��5B8��''�� ''��''�� ''�5B8�CF�� &@9��5B8�CF� &�� L� � ��,��%+�� ''�� ''�5B8�CF�� &@9��5B8�CF�&�� 5B8� ��L� � �� L� +=� �� +!%+� �A�N�� 3%� 4�� 75@78� :CF� �� &�' �+=�� :CIB8� ��1��-/#��3��,%��2/,)$�2400/13� ��-'��CADCIB8��-'�� A;�� AAC@��K5G�8=GGC@J98�=B�8FM��%��A$��5B8�DMF=8=B9�� T$��K5G�58898�,C�H<=G�GC@IH=CB��5A=BC:IB7H=CB5@=N98�GIDDCFH��%!,3(#!1%��423/-��1)-%1��400/13��-)./�� A;��K5G�58898��5B8� H<9�GIGD9BG=CB�K5G�5;=H5H98� :CF��<FG�5H� FCCA�H9AD9F5HIF9�+I6G9EI9BH@M��H<9�6958G�K9F9�7C@@97H98�CB�5��Q7<B9F�:IBB9@�5B8�K5G<98�

- - 9

K=H<��%��A9H<5BC@�� 5B8�� @�� CF� 75DD=B;� C:� IBF957H98� 5A=BC� ;FCIDG�� H<9� 6958G�K9F9� HF95H98�K=H<�5�A=LHIF9�C:� GC@IH=CB�� %�D<9BCLM�579H=7�5B<M8F=89� =B�, �� A$��5B8�GC@IH=CB��%��A9H<M@�=A=85NC@9��%�28-7C@@=8=B9�=B�, �� A$��5B8�5;=H5H98�:CF� ��A=B�5H�FCCA�H9AD9F5HIF9�,<9�GIGD9BG=CB�K5G�:=@HF5H98�5;5=B��H<9�6958G�K9F9�K5G<98�K=H<�, ��A9H<5BC@�5B8�� @��5B8�8F=98�IB89F�J57IIA�$C58=B;�C:�H<9�GIDDCFH��-'��K5G��TAC@�;��&��)�B�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,�$�./1,%4#).8, !-)./��$%/78� ��'��$)-%3(/7831)38,��!$%./2).%� ��-'�� AC7� DFCH97H98� $�5N=8CBCF@9I7=B9��A;��AAC@��K5G�8=GGC@J98�=B��%��A$��:C@@CK98�6M�588=H=CB�C:� ��69BNCHF=5NC@ M@��H9HF5A9H<M@IFCB=IA� <9L5:@ICFCD<CGD<5H9� � �,-�� A;�� AAC@�� <M8FCLM69BNCHF=5NC@9� <M8F5H9� � '�H�� A;�� AAC@�� 5B8��8==GCDFCDM@9H<M@5A=B9� ��!(��T$��AAC@��:H9F� H<F99�A=BIH9G�C:�57H=J5H=CB��5A=BC��3�8=.6IHM@5A=BC�A9H<M@9B94��89CLM��8=A9H<CLMHF=HM@��589BCG=B9�� 9=9FA5BB� 9H� 5@�� A;�� AAC@�� =B� � A$� �%�� K5G� 58898� 5B8� H<9�A=LHIF9�K5G�GH=FF98�CJ9FB=;<H�5H� FCCA� H9AD9F5HIF9�,<9B�� H<9�GC@J9BH�K5G�9J5DCF5H98��H<9�F9G=8I9�8=GGC@J98� =B�� @��5B8�K5G<98�7CBG97IH=J9@M�K=H<�<5@:G5HIF5H98�5EI9CIG�&5 �'�� GC@IH=CB�� 7=HF=7� 57=8� GC@IH=CB�� 5B8� G5HIF5H98� 5EI9CIG� &5�@� GC@IH=CB� ,<9�CF;5B=7� @5M9F� K5G� 8F=98� �&5�+'�� 9J5DCF5H98� 5B8� H<9� 7FI89� DFC8I7H� K5G� DIF=:=98� J=5�+='��7<FCA5HC;F5D<M�M=9@8=B;� ��A;�C:�7CADCIB8��-'�5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F�� A�� 5F�� A�� 5F�� 5B8��@��G�� &��8�� "�� 5F��G�� 8�� "� �� &�&@9�� A�� A�� A�� '� ��AC7�� 5B8� �� A�� \�� &@9�� 5B8� �� AC7�� G�� L'� ��%,�� A�� &�� A�� 5B8�&�� A�� _��&@9��5B8�&�� A�� &�� A�� L ��&@9��A�� &�� H�� "�� &@9�� &%*��% N��@��]� �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7��\��&@9��5B8��L'� ��%,�� &�� AC7�� &�� &�� 5B8�� &@9�� &�� &@9�� &@9�� &�� &�� &�� &@9�� +!%+��A�N��3%� 4��75@78�:CF�� &�'�� :CIB8� ��&��)�.�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,�$�./1,%4#).8, !-)./��$%/78� ��$)-%3(/7831)38,��$)/7/��0%.3!&,4/1/0(%.8,/78�(%78, ��!$%./2).%� ��-'��,C�5�GC@IH=CB�C:� 7CADCIB8��-'� ��A;��AAC@�� =B��%�� A$�� 5B8� DMF=8=B9� � �� A$�� K5G� 58898� �%�(� �� A;�� AAC@�� 5B8�6=G�D9BH5:@ICFCD<9BM@��58=D5H9��A;�� AAC@��,<9�A=LHIF9�K5G�GH=FF98�:CF�CB9�<CIF�:C@@CK98� 6M� 9J5DCF5H=CB� C:� H<9� GC@J9BHG� ,<9� 7FI89� DFC8I7H� K5G� DIF=:=98� J=5� +='��7<FCA5HC;F5D<M�� @��579HCB9��M=9@8=B;��A;�C:�7CADCIB8��-'�5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F��A�� 5F�� A�� 5F��5B8��@��8�� "�� 5F��A�� &�� 8�� "�� A�� A�� &�&@9�� A�� A�� '� ��AC7��

- - 10

� �� A�� 5B8� �� AC7�� A�� \�� AC7�� G�� L'� ��%,�� A�� &�� A�� 5B8�&�� A�� ''�� ''�� A�� ''�� ''�� A�� '��5B8�''�� ''�5B8�&�� A�� &�� A�� L� ��&@9��E�� &�� H�� &@9�� &%*��% N��@��]� �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� 5F�� '� �� \�� &@9�� 5B8� �L'� ��%,�� &�� X�� AC7�� &�� ''�� ''�� ''�� ''�� &@9�� L� ''�� ''�� &@9�� 5B8�� &�� &@9�� &�� &�� &@9�� +!%+� �A�N�� 3%� 4�� 75@78� :CF�� &�' �� :CIB8� ��1��-/#��,%��2/,)$�2400/13��-'��CADCIB8��-'��A;��AAC@��K5G� 8=GGC@J98� =B� 8FM� �%�� A$�� 5B8� DMF=8=B9� �� T$�� K5G� 58898� ,C� H<=G� GC@IH=CB��5A=BC:IB7H=CB5@=N98�GIDDCFH��%!,3(#!1%��423/-��1)-%1��400/13��-)./��A;�� K5G� 58898�� 5B8� H<9� GIGD9BG=CB� K5G� 5;=H5H98� :CF� �� <FG� 5H� FCCA� H9AD9F5HIF9�+I6G9EI9BH@M�� H<9� 6958G�K9F9� 7C@@97H98� CB� 5� �Q7<B9F� :IBB9@� 5B8�K5G<98�K=H<� �%��A9H<5BC@��5B8�� @��CF�75DD=B;�C:�IBF957H98�5A=BC�;FCIDG��H<9�6958G�K9F9�HF95H98�K=H<� 5� A=LHIF9� C:� GC@IH=CB� �� %� D<9BCLM� 579H=7� 5B<M8F=89� =B� , �� A$�� 5B8�GC@IH=CB��%��A9H<M@� =A=85NC@9��%�28-7C@@=8=B9�=B�, �� A$��5B8�5;=H5H98�:CF� ��A=B� 5H� FCCA� H9AD9F5HIF9� ,<9� GIGD9BG=CB� K5G� :=@HF5H98� 5;5=B�� H<9� 6958G� K9F9�K5G<98� K=H<� , �� A9H<5BC@� 5B8� � ��@�� 5B8� 8F=98� IB89F� J57IIA� $C58=B;� C:� H<9�GIDDCFH��-'�K5G��TAC@�;��&��)�B�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��!-)./�/#3!.!-)$/ ��$%/78� ��'��$)-%3(/7831)38,��!$%./2).%� �� :@ICF9BM@�A9H<CLM75F6CBM@�5A=BCC7H5B=7� 57=8� �� A;�� AAC@�� K5G� 8=GGC@J98� =B��%�� A$�� :C@@CK98� 6M� 588=H=CB� C:��69BNCHF=5NC@ M@��H9HF5A9H<M@IFCB=IA�<9L5:@ICFCD<CGD<5H9�� ,-��A;�� AAC@�� <M8FCLM69BNCHF=5NC@9�<M8F5H9�� '�H��A;�� AAC@��5B8��8==GCDFCDM@9H<M@5A=B9� ��!(��T$��AAC@��:H9F��A=BIH9G� C:� 57H=J5H=CB�� 5A=BC��3�8=.6IHM@5A=BC�A9H<M@9B94��89CLM��8=A9H<CLMHF=HM@��589BCG=B9� �� 9=9FA5BB� 9H� 5@�� A;�� AAC@�� =B� � A$��%��K5G�58898�5B8�H<9�A=LHIF9�K5G�GH=FF98�CJ9FB=;<H�5H�FCCA�H9AD9F5HIF9�,<9B��H<9�GC@J9BH�K5G�9J5DCF5H98��H<9�F9G=8I9�8=GGC@J98�=B�� @��5B8�K5G<98�7CBG97IH=J9@M�K=H<�<5@:G5HIF5H98�5EI9CIG�&5 �'��GC@IH=CB��7=HF=7�57=8�GC@IH=CB��5B8�G5HIF5H98�5EI9CIG�&5�@�GC@IH=CB�,<9�CF;5B=7�@5M9F�K5G�8F=98��&5�+'��9J5DCF5H98�5B8�H<9�7FI89�DFC8I7H�K5G� DIF=:=98� J=5� +='�� 7<FCA5HC;F5D<M� M=9@8=B;� �� A;� C:� 7CADCIB8� �� 5G� K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F��A�� 5F�� A�� 5F��A�� &��8�� "�� 5F�� G�� 8�� "�� &��'��A�� A�� A�� '� ��AC7��5B8� �� A�� \��'��5B8� ��AC7�� G�� '� ��%,��A�� &�� A�� &�� 5B8� �� A�� &�� 5B8� � ��'�� A�� &�� 5B8� � ��'�� 6F�� L� ��'�� A��

- - 11

�L� �� &%*��% N��@��]� �� &�� '� ��AC7��\�� '�� 5B8� �L'� ��%,�� &�� AC7��&�� 5B8�� &�� 5B8�� '��5B8�� &�� 5B8�� '�� '�� '�� 5B8�� &�� &�� 5B8� � ��'�� +!%+� �A�N�� 3%� 4�� 75@78� :CF� �� &�'�� :CIB8� �� &��)�.�"438,!-)./�-%3(8,%.% ��&��&,4/1%.8,�-%3(/78#!1"/.8,��!-)./�/#3!.!-)$/ ��$%/78� ��$)-%3(/7831)38,��$)/7/��0%.3!&,4/1/0(%.8,/78�(%78, ��!$%./2).%��,C�5�GC@IH=CB�C:�7CADCIB8��A;��AAC@�� =B��%�� A$��5B8�DMF=8=B9� � ��A$��K5G�58898��%�(� ��A;��AAC@�� 5B8� 6=G�D9BH5:@ICFCD<9BM@�� 58=D5H9� ��A;�� AAC@�� ,<9�A=LHIF9� K5G�GH=FF98� :CF� CB9� <CIF� :C@@CK98� 6M� 9J5DCF5H=CB� C:� H<9� GC@J9BHG� ,<9� 7FI89� DFC8I7H� K5G�DIF=:=98� J=5� +='�� 7<FCA5HC;F5D<M� �� @��579HCB9�� M=9@8=B;� �� A;� C:� 7CADCIB8��5G�K<=H9�:C5A�� &%*��% N��@��]��G�� &��G�� G�� A�� 5F��A�� 5F�� A�� 5F��8�� "�� 5F��6F�� &�� 8�� "�� A�� A�� 5B8� &��'��A�� '� ��AC7�� A�� 5B8� ��AC7�� A�� \��'��G�� L'� ��%,��A�� &�� A�� 5B8�&�� G�� ''�� ''�� G�� ''�� ''�� A�� '��5B8�''�� ''�5B8�&�� A�� &�� A�� '�� A�� L� �� &%*��% N��@��]� �� &�� 5F�� 5F�� 5F�� 5F�� 5F�� '� ��AC7��\��&@9��5B8� �L'� ��%,�� &�� AC7�� &�� ''�� ''�� ''�� ''�� '�� ''�� ''�� L� ��'�� '�� &�� '�� &�� L� ��+!%+��A�N��3%� 4��75@78�:CF�� &�' �� :CIB8� ��1��-/#�� 2/,)$� 2400/13� �� CADCIB8� �� A;�� AAC@�� K5G� 8=GGC@J98� =B� 8FM� �%�� A$�� 5B8� DMF=8=B9� �� T$�� K5G� 58898� ,C� H<=G�GC@IH=CB�� 5A=BC:IB7H=CB5@=N98� GIDDCFH� �� %!,3(#!1%��423/-� �1)-%1� �400/13�� -)./�� A;�� K5G� 58898�� 5B8� H<9� GIGD9BG=CB� K5G� 5;=H5H98� :CF� �� <FG� 5H� FCCA�H9AD9F5HIF9�+I6G9EI9BH@M��H<9�6958G�K9F9�7C@@97H98�CB�5��Q7<B9F�:IBB9@�5B8�K5G<98�K=H<��%��A9H<5BC@�� 5B8�� @�� CF� 75DD=B;� C:� IBF957H98� 5A=BC� ;FCIDG�� H<9� 6958G�K9F9� HF95H98�K=H<�5�A=LHIF9�C:� GC@IH=CB�� %�D<9BCLM�579H=7�5B<M8F=89� =B�, �� A$��5B8�GC@IH=CB��%��A9H<M@�=A=85NC@9��%�28-7C@@=8=B9�=B�, �� A$��5B8�5;=H5H98�:CF� ��A=B�5H�FCCA�H9AD9F5HIF9�,<9�GIGD9BG=CB�K5G�:=@HF5H98�5;5=B��H<9�6958G�K9F9�K5G<98�K=H<�, ��A9H<5BC@�5B8�� @��5B8�8F=98�IB89F�J57IIA�$C58=B;�C:�H<9�GIDDCFH��K5G��TAC@�;��

- - 12

&��)�B�"438,!-)./�-%3(8,%.% ��&�5@@M@CLM75F6CBM@��&��&,4/1%.8,�-%3(/78#!1"/.8,�$��$)!-)./01/0)/.8, !-)./��$%/78� ��'��$)-%3(/7831)38,��!$%./2).%� ��#1�� @@M@CLM75F6CBM@��:@ICF9BM@A9H<CLM75F6CBM@$��8=5A=BCDFCD=CB=7� 57=8� ��A;�� TAC@��K5G� 8=GGC@J98�=B� �%�� A$�� :C@@CK98� 6M� 588=H=CB� C:� ��69BNCHF=5NC@ M@��H9HF5A9H<M@IFCB=IA� <9L5:@ICFCD<CGD<5H9� � �,-�� A;�� TAC@�� <M8FCLM69BNCHF=5NC@9� <M8F5H9� � '�H�� A;�� TAC@�� 5B8� ��8==GCDFCDM@9H<M@5A=B9��!(�� T$�� TAC@�� :H9F� �� A=BIH9G� C:� 57H=J5H=CB�� 5A=BC��3�8=.6IHM@5A=BC�A9H<M@9B94��89CLM��8=A9H<CLMHF=HM@��589BCG=B9��9=9FA5BB�9H�5@�� A;�� TAC@�� =B� � A$� �%�� K5G� 58898� 5B8� H<9� A=LHIF9� K5G� GH=FF98�CJ9FB=;<H� 5H� FCCA� H9AD9F5HIF9� ,<9B�� A$� C:� K5H9F� K5G� 58898� 5B8� GH=FF=B;� K5G�7CBH=BI98�:CF�:IFH<9F� ��A=BIH9G��@@�JC@5H=@9G�K9F9�9J5DCF5H98��H<9�F9G=8I9�8=GGC@J98�=B�� @�� 5B8� K5G<98� 7CBG97IH=J9@M� K=H<� <5@:G5HIF5H98� 5EI9CIG� &5 �'�� GC@IH=CB�� 5B8�G5HIF5H98�5EI9CIG�&5�@�GC@IH=CB�,<9�CF;5B=7�@5M9F�K5G�8F=98��&5�+'��9J5DCF5H98�5B8�H<9�7FI89�DFC8I7H�K5G�DIF=:=98�J=5�+='��7<FCA5HC;F5D<M��9@IH=B;�K=H<�5�;F58=9BH�:FCA� �HC��C:�A9H<5BC@�=B�8=7<@CFCA9H<5B9��M=9@8=B;��A;�C:�7CADCIB8��#1�5G�K<=H9�:C5A�� &%*��% N��8��%+'��]��G�� &��G�� G�� A�� 5F��A�� 5F��A�� 5F�� A�� 5F�� A�� 5F�� G�� A�� 5@@M@��A�� 5@@M@��A�� A�� 5@@M@�� A�� \�� 5D�� AC7�� G�� L�'%9��%,��5B8� �� A�� &�� A�� &�� A�� AC7��L� �� A�� &�� A�� &�� A�� &�� A�� &�� DDA��+!%+��A�N��3%� 4��75@78�:CF�� &�' �� :CIB8� ��1��,,/#��-/#��!0�� 2/,)$� 2400/13� ��#1�� CADCIB8� ��#1� ��A;�� TAC@��5B8�6=G�D9BH5:@ICFCD<9BM@��58=D5H9��A;��TAC@��K9F9�8=GGC@J98�=B�8FM��%�� A$��5B8�DMF=8=B9�� A$��5B8�H<9B��%�(��A;��TAC@��K5G�58898�HC�:CFA��#1� =B� G=HI� �:H9F� �� <CIFG� C:� 5;=H5H=CB� 5H� FCCA� H9AD9F5HIF9�� 5A=BC:IB7H=CB5@=N98�GIDDCFH��%!,3(#!1%��423/-��1)-%1��400/13��-)./�� A;��K5G�58898��5B8�H<9�GIGD9BG=CB�K5G�:IFH<9F�5;=H5H98�:CF��85MG�5H�FCCA�H9AD9F5HIF9�+I6G9EI9BH@M��H<9�6958G�K9F9�7C@@97H98�CB�5��Q7<B9F�:IBB9@�5B8�K5G<98�K=H<��%��A9H<5BC@�5B8�� @��CF� 75DD=B;� C:� IBF957H98� 5A=BC� ;FCIDG�� H<9� 6958G� K9F9� HF95H98� K=H<� 5� A=LHIF9� C:�GC@IH=CB�� %�D<9BCLM�579H=7� 5B<M8F=89� =B�, �� A$�� 5B8� GC@IH=CB�� %��A9H<M@� =A=85NC@9��%�28-7C@@=8=B9� =B�, �� A$��5B8�5;=H5H98� :CF� ��A=B�5H� FCCA�H9AD9F5HIF9� ,<9� GIGD9BG=CB� K5G� :=@HF5H98� 5;5=B�� H<9� 6958G� K9F9� K5G<98� K=H<� , ��579HCB=HF=@9�5B8�� @��5B8�8F=98�IB89F�J57IIA�$C58=B;�C:�H<9�GIDDCFH��#1�K5G��TAC@�;�� 43/-!3%$�28.3(%2)2�/.�2/,)$� 2400/132��,<9��D��AC=9HM�K5G�5GG9A6@98�CB�5B�� 4#,%)#� �#)$� �8.3(%2)9%1� :C@@CK=B;� GH5B85F8� GMBH<9G=G� DFCHC7C@G� IG=B;� ��3�,F==GCDFCDM@G=@M@�CLM4A9H<M@��,'%��DFCH97H98�BI7@9CG=89�D<CGD<CF5A=8=H9G��(=HG7<�9H�5@�� %=7IF5�� 5B8� H<9� 56CJ9� 89G7F=698� GC@=8� GIDDCFHG� � �9HF=HM@5H=CB� � �� G��8=7<@CFC579H=7�57=8� ��8=7<@CFC9H<5B9��7CID@=B;�� G��D<CGD<CF5A=8=H9G�� %�=B�579HCB=HF=@9�� T$��K9F9�57H=J5H98�K=H<�69BNM@H<=CH9HF5NC@9��%�=B�579HCB=HF=@9��

- - 13

T$��75DD=B;��L� ��G��5D��5D�� 5D��D<9BCLM579H=7�5B<M8F=89��%�=B�, ��5D��A9H<M@� =A=85NC@9��%��GMA7C@@=8=B9��%�� =B�, ��CL=85H=CB��G�� !�� %�� =B� , ��DMF=8=B9� �'� �� &I7@9CG=89� D<CGD<CF5A=8=H9G��69BNM@H<=CH9HF5NC@9��5B8�75DD=B;�GC@IH=CBG�K9F9�8F=98�CJ9F�57H=J5H98�AC@97I@5F�G=9J9G��P��CJ9FB=;<H��%01/3%#3)/.�/&�3(%� ��0��!-)./�!#)$�#/.*4'!3%2��CF�7CB>I;5H9G�GMBH<9G=N98�CB�GC@=8� GIDDCFH� ��#1��,,8,� $%01/3%#3)/.� �:CF� GIDDCFHG� ��-'�� -'�� -'�� 5B8��-'��4��89DFCH97H=CB�GH5FHG�8=F97H@M�K=H<�+H9D��,<9�GC@=8�GIDDCFH�K5G�HF5BG:9F98�=BHC�5B� �DD9B8CF:� HI69�� 8F=98� =B� <=;<� J57IIA� 5B8� DIF;98� K=H<� 5F;CB� �FM� 5B8� 89;5GG98�8=7<@CFCA9H<5B9� � ��A$��K5G�58898�� :C@@CK98�6M� 6CF5B9�8=A9H<M@5A=B9� 7CAD@9L� ��A;��:H9F� H9B�A=BIH9G�(8�(3(<4�� A;��K5G�58898�,<9�F957H=CB�K5G�5;=H5H98�5B8�?9DH�IB89F�5F;CB�:CF��<CIFG�,<9�GC@=8�GIDDCFH�K5G�:=@H9F98�5B8�HF95H98�K=H<�5�GC@IH=CB�C:�GC8=IA� 8=9H<M@8=H<=C75F65A5H9� �� =B� �%�� L� �� A$�� 5B8� K5G<98� K=H<� �%�� 5B8�8=7<@CFCA9H<5B9�+H9D� �� -/#� $%01/3%#3)/.� ,<9� GC@=8� GIDDCFH�K5G� HF95H98� K=H<� 5� GC@IH=CB� C:� �� D=D9F=8=B9� =B� 579HCB=HF=@9� � ��A$�� A=B�� K5G<98� K=H<� 579HCB=HF=@9� 5B8� 8F=98� �75B� 69�8CB9� =B� H<9� ��!� GMBH<9G=G� 7C@IAB��+H9D� �� #8,� $%01/3%#3)/.� !.$� #,%!5!'%� &1/-� 3(%�2/,)$� 2400/13� !B� 5B� �DD9B8CF:� HI69�� H<9� 6958G� K9F9� HF95H98� K=H<� 9EI5@� JC@IA9G� C:�A9H<M@5A=B9� =B� 9H<5BC@� �� %�� A$�� 5B8� A9H<M@5A=B9� =B� �'� �� A$�� K9F9�58898� �:H9F� �� <� G<5?=B;� 5H� FCCA� H9AD9F5HIF9� H<9� GID9FB5H5BH� K5G� :=@H9F98� 5B8�9J5DCF5H98� HC� 8FMB9GG� +H9D� �� !.$� ��3��,%� $%01/3%#3)/.� ,<9�C6H5=B98� F9G=8I9�K5G� HF95H98�K=H<�,��[�� '� =B�, �� %�� A$��CJ9FB=;<H�5H� FCCA�H9AD9F5HIF9� ,<9� F957H=CB�K5G� EI9B7<98� 6M� H<9� 588=H=CB� C:� HF=9H<M@5AACB=IA�579H5H9��,�� %��D �� A$��:H9F�F98I7=B;�H<9�JC@IA9�C:�H<9�GC@IH=CB��=H�K5G�5DD@=98�CB�5�G=N99L7@IG=CB�7<FCA5HC;F5D<M�7C@IAB��%!,3(#!1%�� =(F9D�� 9G5@H=B;��L� ��7A��+9D<589L��M�9@I5H=B;�K=H<� �'�� H<9�7CB>I;5H97CBH5=B=B;� :F57H=CBG�K9F9�7C@@97H98��9J5DCF5H98�HC�8FMB9GG��5B8�H<9�F9G=8I9�K5G�8=GGC@J98�=B� �'�� A$��B5@MG=G�C:� H<9�7FI89�DFC8I7HG�K5G�D9F:CFA98�6M�5B=CB9L7<5B;9�7<FCA5HC;F5D<M�CB�5��=CB9L��&�(57�(� ��7C@IAB��L��AA��5H��R��@CK�F5H9�� A$�A=B ��9@I9BH��AA�,F=G[ �@��D ��%�IF95��9@I9BH��A%�,F=G[ �@��D ��%�&5�@'��%�IF95��;F58=9BH��U��=B��K=H<=B��A=B�CF��U��=B��K=H<=B��A=B��-.�89H97H=CB�5H��BA��41)&)#!3)/.� /&� 3(%� ��0��!-)./� !#)$� #/.*4'!3%2� ,<9� 7FI89� 7CB>I;5H9� K5G�DIF=:=98�CB�5�G9A=DF9D5F5H=J9��=CB9L��&�(57�(� ��7C@IAB� ��L��AA��5H�� R��K=H<�:@CK�F5H9�C:��A$�A=B ��:CF�9@I9BHG�G99�56CJ9��F57H=CBG�7CBH5=B=B;�H<9�7CB>I;5H9�K9F9� @C5898�CB�5�� +9D(5?�(@IG�75FHF=8;9��/5H9FG�%=@@=DCF9��K5G<98�K=H<�� U� ��%� ��H�& �� '�

U�� '�� 5B8� 9@IH98� K=H<� �'�� &� � � �� CB>I;5H97CBH5=B=B;�:F57H=CBG�K9F9� 9J5DCF5H98� HC� 8FMB9GG� 5B8�8=GGC@J98� =B� �'� � �A$�� ,<9�EI5@=HM� C:� H<9�DIF=:=98�7CB>I;5H9�K5G�5B5@MN98�6M�5B5@MH=75@�5B=CB9L7<5B;9�7<FCA5HC;F5D<M�5B8�H<9=F�AC@97I@5F� K9=;<HG� K9F9� 7CB:=FA98� 6M� $��+!� A5GG� GD97HFCA9HFM� 1=9@8G� K9F9�89H9FA=B98� 6M� -.� D<CHCA9HF=75@� 5B5@MG=G� C:� 7CB>I;5H9� GC@IH=CBG� ,<9� :=B5@� 7CADCIB8�K5G�8=GGC@J98� =B�K5H9F� HC� 57<=9J9�O��A%�7CB79BHF5H=CB� :CF� GHC7?� GC@IH=CBG� 5B8� @5H9F�IG98�:CF�GC5?=B;��<5F57H9F=N5H=CB�C:�*&�U5A=BC�57=8� 7CB>I;5H9G� =G� DF9G9BH98� =B� H<9� :=;IF9�69@CK�K<=7<� G<CKG��B=CB9L7<5B;9� ($�� HF579G� �HCD�� C:�� & &@9&�� & &@9' �� & &@9�� 5B8� �� & &@9�H� 5B8� H<9� 7CFF9GDCB8=B;� $�U�+!� A5GG� GD97HF5��6CHHCA�� ($��7CB8=H=CBG��=CB9L��&�(57�7C@IAB��Z��AA��R�� A$�A=BU ��U��

- - 14

6I::9F��=B�6I::9F��K=H<=B��A=B��6I::9F��,F=G �@��A%��IF95��%��D ��6I::9F��,F=G �@��A%��IF95��%��&5�@'��%��D ��

- - 15

� �� 12+.'23�53'&�+/�4*'�$+0%*'.+%#-�'81'2+.'/43�

Primer name Primer sequence

T7 TAATACGACTCACTATAGGG

NV1 GGTTATAATGAATTTTGCTTATTAAC

MRLR-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGAGACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MALR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGGCACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MCLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGTGCCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MDLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGATCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MELR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGAACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MFLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGTTTCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MGLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGGTCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MHLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGCACCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MILR –W-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GATTCTTCGTTTCCCATGGACTTTGAACCAGTAAGTGATAG

MKLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MLLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGCTTCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MMLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GATGCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MNLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAACCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MPLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGCCACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MQLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GCAGCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MSLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGTCACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MTLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GACACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MVLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGTACTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MWLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GTGGCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MYLR –I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATA TGTATCTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRAR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAGCACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRCR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGATGCCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRDR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAGATCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRER-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT

- - 16

GAGAGAACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG MRFR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGATTTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRGR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAGGTCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRHR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACACCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRIR-W-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAATTCGTTTCCCATGGACTTTGAACCAGTAAGTGATAG

MRKR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAAAACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRMR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAATGCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRNR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAAACCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRPR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACCACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRQR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACAGCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRRR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACGGCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRSR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGATCACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRTR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAACACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRVR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGAGTACGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRWR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGATGGCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRYR-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGATATCGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLA-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTGCATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLC-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTTGCTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLD-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTGATTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLE-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTGAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLF-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTTTTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLG-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTGGTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLH-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTCACTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLI-W-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTATTTTCCCATGGACTTTGAACCAGTAAGTGATAG

MRLK-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLL-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTCTTTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLM-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTATGTTCCCAATTACTTTGAACCAGTAAGTGATAG

- - 17

MRLN-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTAACTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLP-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTCCATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLQ-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTCAGTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLS-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTTCATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLT-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTACATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLV-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTGTATTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLW-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTTGGTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLY-I-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGACTTTATTTCCCAATTACTTTGAACCAGTAAGTGATAG

MRLR-Mut-rev GGTTATAATGAATTTTGCTTATTAACGATAGAATTCTATCACTTAC TGGTTCAAA

MDLD-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGATCTTGATTTCCCAATTACTTTGAACCAGTAAGTGATAG

MELE-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GGAACTTGAATTCCCAATTACTTTGAACCAGTAAGTGATAG

RLR-V1-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GCGCCTGCGATTCCCAATTACTTTGAACCAGTAAGTGATAG

RLR-V2-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GCGACTACGCTTCCCAATTACTTTGAACCAGTAAGTGATAG

RLR-V3-fwd TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAGGTTGCGGTTCCCAATTACTTTGAACCAGTAAGTGATAG

MKAK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGGCAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKCK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGTGCAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKDK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGGATAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKEK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGGAAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKFK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGTTTAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKGK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGGGTAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKHK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGCACAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKIK-W-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGATTAAATTCCCATGGACTTTGAACCAGTAAGTGATAG

MKKK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGAAGAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKLK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGCTTAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKMK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGATGAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKNK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGAACAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKPK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGCCAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

- - 18

MKQK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGCAGAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKRK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGCGTAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKSK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGTCAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKTK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGACAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKVK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGGTAAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKWK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGTGGAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

MKYK-I-fwd

TAATACGACTCACTATAGGGCTTAAGTATAAGGAGGAAAAAATAT GAAGTATAAATTCCCAATTACTTTGAACCAGTAAGTGATAG

�'('2'/%'3��9=9FA5BB��+��%=7IF5��*�&5H=J9�7<9A=75@�@=;5H=CB�C:�<M8FC@MG=GF9G=GH5BH��^& 7MGH9=B9

AC8=:=98�*&��411��1/3/#��4#,��#)$��(%-�� %=7IF5��*�+A5@@�=BH9F:9F=B;�*&�G�5B8�H<9=F�7<9A=75@�GMBH<9G=G��.'%6��(%-��.3��$��U

��%CFC89F�� +H9;9F��"��F569F��5IGH9F��#��,F5DD@��#��%5FEI9N��.��(C@579?��&��/=@GCB��

&��%=7IF5��*�&CB<M8FC@MN56@9�*&�D9DH=89�7CB>I;5H9G��5�DCK9F:I@�58J5B79�=B�H<9�GMBH<9G=G�C:�A=A=7G�:CF��^D9DH=8M@�H*&��H9FA=B=��.'%6��(%-��.3��$��U��

�(=HG7<��+��/9=GG��(��"9BBM��$��+HIHN��/I��0�*9@=56@9�7<9A=75@�GMBH<9G=G�C:�C@=;CF=6CBI7@9CH=89G��*&��K=H<��^�3�,F==GCDFCDM@G=@M@�CLM4A9H<M@��^�HCA�DFCH97H98�D<CGD<CF5A=8=H9G��%,5%3)#!��()-)#!��#3!��U��

�

binding of macrolide antibiotics leads to ribosomal ...cell reports report binding of macrolide...

Documents