barcode wales: dna barcoding the flora of wales natasha de vere, tim rich, col ford, sarah trinder,...
TRANSCRIPT
Barcode Wales: DNA barcoding the flora of Wales
Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris Moore, Danielle Satterthwaite, Helena Davies, Joe Moughan, Addie
Griffith, Laura Jones, Joel Allainguillaume, Mike Wilkinson, Kevin Walker, Tatiana Tatarinova, Hannah Garbett, Les Baillie, Jenny Hawkins
DNA barcoding
• DNA based species identification
• Once reference barcodes are established will always be able to identify that species
• Internationally agreed regions of DNA used: rbcL & matK for plants
• Open science
>Cotoneaster_cambricus
AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCACCTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTATGGACTGACGGTCTTACCAGTCTTGATCGTTACAAAGGTCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTGTTTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGAATCCCTACTGCTTATGTTAAAACTTTCCAGGGCCCGCCTCATGGTATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCCCTCTATTGGGATGTACTATAAAACCAAAATTGGGGTTATCCGCTAAGAATTACGGTAGAGCAGTTTATGAATGTC
What do they eat?
Is this legal?What pollen is it carrying?
What’s in this?
Barcode Wales: Cod Bar Cymru
• DNA barcode the native flowering plants and conifers of Wales
• Develop applications that utilise this research platform
Sample collection
• 1143 native flowering plants and conifers
• 4272 individuals sampled, 3637 herbarium, 635 freshly collected
• All specimens verified by taxonomic expert
• Herbarium vouchers and full collection details for all samples
DNA barcoding protocol • DNA extraction: Qiagen kits,
modified for herbarium material
• Amplification: rbcL 5 & matK 23 primer combinations
• Sanger sequencing• Manual editing, multiple
alignment• Sequences uploaded onto
BOLD & GenBank – publically available
de Vere N, Rich TCG, Ford CR, Trinder SA, Long C, et al. (2012) DNA Barcoding the Native Flowering Plants and Conifers of Wales. PLoS ONE 7(6): e37945.
Recoverability
rbcL matK rbcL & matKNo. of spp. sequenced (1143) 1117 (98%) 1031 (90%) 1025 (90%)No. of spp. with > 1 individual sequenced
1041 (91%) 814 (71%) 808 (71%)
Mean no. of individuals per spp.
3 2 2
Mode of individuals per spp. 3 3 3Range of individuals per spp. 1 - 9 1 - 8 1 - 8Total no. of individuals sequenced
3304 2419 2349
In total 5,723 barcode sequences obtained for the 1143 species
Effect of herbarium specimen age
Spearman Rank Correlation:rbcL rho = 0.993***matK rho = 0.986***
Relative discrimination808 species with multiple individuals sequenced for both rbcL & matK
69
75
5756
74
68
99
1009899
9695
rbcL & matK discrimination
Scale n Mean discrimination % (SD)
10x10 km 253 82 (3)
2x2 km 1116 93 (6)
Species lists generated for each square, discrimination assessed by presence of a barcode gap
Roots, shoots and pollen
• Root analysis• Identification at
single pollen grain resolution
• Identification of pollen products
Gives a feeling “of Youthful Exuberance!”
Honey and drug discovery
• Collect honey from throughout the UK.
• Test antibacterial properties of honey against MRSA and Clostridium difficile.
• DNA barcode honey using next generation DNA sequencing (454).
• Identify plant derived phytochemicals that increase antimicrobial activity.
MRSA – prelim results
DNA barcoding and phylogenetics
ML tree for rbcL,RAxML (GTR+CAT)1000 bootstraps, on the CIPRES supercomputer cluster
56% of species form monophyletic groups
44% with bootstrap support >70%
DNA barcoding and phylogenetic ecology
ML tree for rbcL, threatened species traced using Mesquite
What’s next?
• Barcode UK• Barcode Alien• Phylogeny for the
UK flora• Development of
bioinformatic tools• Diet analysis of
endangered species • Pollinator services
Thank you!
• Funding from Welsh Government, National Botanic Garden of Wales, National Museum Wales, Countryside Council for Wales
• Sponsorship from the people of Wales• www.gardenofwales.org.uk• Science at the Garden of Wales on Facebook