Bactericidal/permeability-increasing (BPI) -like proteins in Giardia intestinalis

Dimitra Peirasmaki

Degree project in applied biotechnology, Master of Science (2 years), 2013Examensarbete i tillämpad bioteknik 45 hp till masterexamen, 2013Biology Education CentreSupervisors: Staffan Svärd and Elin Einarsson

1

Abstract

G. intestinalis is the most studied diplomonad since it is the most common cause of waterborne enteric disease in humans and other mammals. However, there are still genes found in the genome of the parasite that have not been studied yet and could give important information on the how the parasite reacts in certain environments. The purpose of this project was the study of some unidentified proteins found in the genome of G. intestinalis in order to identify and characterize them, taking into consideration that they might belong to the lipid-binding family proteins (LBP) called bactericidal/permeability proteins (BPI).

The results from this project show promising indications that the BPI-like proteins studied from G. intestinalis could belong to either the BPI or the LBP family of proteins. However, at this point nothing more can be said since there are no results that could prove that these proteins are in fact BPIs. In order to gain this type of information further experiments have to be performed.

2

Table of Contents

Abstract ......................................................................................................................... 1

1. Introduction .............................................................................................................. 4

1.1 Giardia intestinalis ................................................................................................ 4

1.2 Life cycle of G. intestinalis and transmission of Giardiasis ............................... 5

1.3 Morphology of G. intestinalis ............................................................................. 6

1.4 Human bactericidal/permeability-increasing protein ........................................... 7

1.4.1 Structure of human BPI ................................................................................. 7

1.4.2 The multiple activity of human BPI .............................................................. 8

1.4.2.1 Antimicrobial activity ............................................................................ 8

1.4.2.2 Endotoxin neutralizing activity .............................................................. 8

1.4.2.3 Opsonic activity ..................................................................................... 8

1.5 Human lipopolysaccharide binding protein ........................................................ 9

1.6 Correlation and differences between BPI and LBP ............................................. 9

1.7 Aim of the project ............................................................................................. 10

2. Materials and Methods .......................................................................................... 11

2.1 Construction of episomal vector for the transfection of Giardia intestinalis .... 11

2.1.1 Selection markers and C-terminal localization tag ...................................... 11

2.1.2 Cloning of genes of interest into the PHA-5 vector .................................... 11

2.2 Construction of vector for protein purification ................................................. 12

2.2.1 Selection markers and N-terminal localization tag ..................................... 12

2.2.2 Cloning of genes of interest into the pGEX vector ..................................... 12

2.3 DNA extraction from Giardia intestinalis ........................................................ 12

2.4 PCR amplification of genes ............................................................................... 13

2.5 Ligation ............................................................................................................. 14

2.6 Transformation of E. coli .................................................................................. 14

2.7 Plasmid mini-preparation .................................................................................. 14

2.8 Restriction digestion of DNA and PHA-5 vector (or pGEX vector) ................ 14

2.9 Sequencing of cloned plasmids ......................................................................... 15

2.10 Culture conditions for Giardia intestinalis ..................................................... 15

2.11 Plasmid big scale preparation for transfection of Giardia intestinalis ............ 15

3

2.12 Transfection of Giardia intestinalis using electroporation ............................. 16

2.13 SDS-PAGE electrophoresis ............................................................................. 16

2.14 Western Blotting .............................................................................................. 17

2.15 Fixation ............................................................................................................ 18

2.16 Immunofluorescence ....................................................................................... 18

2.17 RNA purification ............................................................................................. 19

2.18 cDNA synthesis ............................................................................................... 19

2.19 RT-qPCR (quantitative Real Time Polymerase Chain Reaction) .................... 20

2.19.1 Absolute Quantification (efficiency of reaction) ....................................... 20

2.19.2 Relative Quantification .............................................................................. 21

2.20 Protein purification .......................................................................................... 21

3. Results ..................................................................................................................... 23

3.1 Protein comparisons ........................................................................................... 24

3.2 Structural comparison of BPI-like proteins with human BPI and LBP ............. 24

3.3 Electroporation of Giardia intestinalis ............................................................. 25

3.4 Immunofluorescence of tagged proteins from stable transfectants ................... 25

3.5 Expression data of BPI-like proteins during encystation of G. intestinallis ...... 28

3.5.1 Western Blots for protein level expression of tagged proteins ...................... 29

3.6 Interaction experiments between Giardia intestinalis and bacteria .................. 29

3.6.1 RT-qPCR for RNA-level protein expression in Giardia intestinalis post interactions ........................................................................................................... 30

3.6.2 Western Blots for protein level expression in Giardia intestinalis post interactions ........................................................................................................... 32

3.6.3 Immunofluorescence for tagged proteins in G. intestinalis post interactions .............................................................................................................................. 33

3.6.4 Growth inhibition results for E. coli and B. subtilis post interaction with G. intestinalis............................................................................................................. 39

3.7 Protein purification ........................................................................................... 41

3.7.1 SDS-PAGE gels .......................................................................................... 42

3.7.2 Western blot ................................................................................................ 44

4. Discussion................................................................................................................ 45

5. References ............................................................................................................... 51

6. Acknowledgements ................................................................................................ 54

7. Appendix ................................................................................................................. 55

4

1. Introduction

1.1 Giardia intestinalis

Giardia intestinalis, also known as Giardia lamblia and Giardia duodenalis is a "teardrop" or "pear" shaped flagellate cosmopolitan protozoan parasite of humans and belongs in the family Hexamitidae (order Diplomonadida) and the genus Giardia (Cavalier-Smith T., 1993; Cavalier-Smith T., 2003) (figure 1).

Figure 1. G. intestinalis evolution tree shows that the parasite belongs to domain: Eukaryota, supergroup: Excavata, clade: Fornicata, phylum: Sarcomastigophora, class: Zoomastigophora, order: Diplomonada, family: Hexamitidae, subfamily: Giardiinae and genus: Giardia (http://tolweb.org; Adam RD. 1991). Van Leeuwenhoek, the inventor of microscope, was first to see Giardia through a home-made microscope in 1681, but a Czech scientist by the name of Lambl did a more extensive research in 1859 (Ford BJ. 2005). Since 1859, 51 species of Giardia have been identified, 1 of which has been isolated from fish, 14 from birds, 4 from amphibians, 2 from reptiles, 2 from humans and 28 from other mammals (Luján HD, Svärd SG. 2011). It is clear that the specificity of the host varies among the different Giardia species; for example G. muris infects mainly rats and mice (Wolfe MS. 1992), G. agilis infects amphibians , G. ardeae and G. psittaci infect birds (Ivanov AI. 2010), while G. intestinalis is one of the ten most important enteric parasites that affect humans worldwide. It is considered to be the most common intestinal pathogenic protozoa of humans, but at the same time it can affect other nonhuman species like beavers, cows, domestic dogs and cats (Ivanov AI. 2010). DNA sequence analysis has shown that there is a large number of different assemblages (genotypes) in G. intesinalis (from A to H). Briefly, assemblages A and B infect humans, while assemblages C and D infect dogs, E hoofed animals, F cats, G rodents and H seals (Jerlström-Hultqvist J. et al. 2010). G. intestinalis is responsible for a parasite infection called "giardiasis" (or commonly known as "Beaver Fever") (Amar CF. et al. 2002).

5

1.2 Life cycle of G. intestinalis and transmission of Giardiasis Giardiasis is caused by ingesting the parasite G. intestinalis and can be divided into two phases: acute and chronic. The acute phase is usually a short-lived period and is characterized by flatulence, abdominal distension with cramps and diarrhea, while in chronic giardiasis, malaise, weight loss and other features of malabsorption are very often among the symptoms (Ford BJ, 2005). G. intestinalis has a simple life cycle (figure 2) which consists of two different stages: the cyst stage (infective stage), which is basically a "resting stage", and the trophozoite stage (flagellated form) (Dawson SC. et al. 2010). When Giardia is in the cyst form, which resembles the bacterial endospore, has the ability to survive in hostile environments for really long periods of time. The cysts have been known to survive for months in cold water (Irshad M. et al. 2006). After a cyst is orally ingested, via contaminated food or water, it excysts in the small intestine of the host, due to the high concentration of bile salts and the acidic environment of the stomach that trigger the excystation, and forms two trophozoites (Thompson RCA. 2008). Each trophozoite divides by binary fission in the small intestine and is responsible for the symptoms of giardiasis. Some of the trophozoites are induced to encyst while they pass towards colon, where the pH is more basic and the concentration of bile salts lower. The life cycle of the parasite is completed after 72 hours post infection, when the cysts are passed in the feces; that way they can be possibly ingested by another host (Luján HD, Svärd SG. 2011). Giardiasis can be diagnosed by finding cysts or trophozoites in the feces while nitroimidazoles and benzimidazoles, such as metronidazole (15mg/kg/day for 5 days), tinidazole (50mg/kg for one single dose) and furazolidone (8mg/kg/day for 10 days), are the main drugs used to treat human infections (Adam RD. 1991; Ivanov AI. 2010).

Figure 2. Schematic view showing the life cycle of G.

intestinalis. After the cyst is ingested, it excysts in the small intestine, due to the gastric acid during their passage through the host's stomach which triggers it and forms two trophozoites. The trophozoites attach to the intestinal epithilium with their adhesive disc and divide by binary fission with a generation time of 6-12 hours in vitro. Some of the trophozoites are induced to encyst while they pass towards the lower part of the intestine (Ankarklev J. et al. 2010).

6

1.3 Morphology of G. intestinalis Both life cycle stages of G. intestinalis have a very distinct appearance. The trophozoites have an average length of 10-20 μm and a 5-15 μm width (Touz MC. 2006). They appear in a “teardrop” shape and they have two nuclei at the anterior end (figure 3). They also have four pairs of flagella which arise from the basal bodies clustered between the two nuclei (Ankarklev J. et al. 2010). The broad anterior end of the trophozoites contains a concave area which covers half the ventral surface. This area includes the adhesive or sucking disc that allows the parasite to attach to the surface of the host’s small intestine. The trophozoites also contain an axostyle (the structure at the base of the flagella) (which consists of two axonemes) or dark transverse rod, which may be a supportive element (Elmendorf HG. et al. 2003). There are also two curved median or parabasal bodies cross the axoneme and when it is observed under a microscope at an oblique angle they give the parasite a “smile” (Adam RD. 2001).

The cysts have an average length of 8-19 μm and a 7-10 μm width. They typically have an oval shape and contain 4 nuclei and remnants of the flagella and the axostyle (Touz MC. 2006) (figure 4). The 4 nuclei are usually located on one end (Ankarklev J. et al. 2010). The cysts have a characteristic, rigid outer cyst wall which is composed of proteins and carbohydrate. This extracellular cyst wall is of an extreme importance for the survival of the cysts and the parasite in general, since it allows the parasite to persevere in fresh water, resist the stomach acidic environment of the host, and "travel" all the way through till the gut where it will excyst (Touz MC. 2006).

Figure 3. Trophozoites have an average length of 15μm and a width of 10μm and have a flattened teardrop shape. (A) DIC microscopy view and (B) vental view of a trophozoite shows: N=nucleus, vd=vental disc, ba=bare area, afl = anterior flagella, pfl = posterolateraral flagella, cfl = caudal flagella, and vfl = ventral flagella (Dawson SC. et al. 2010).

Figure 4. A typical Giardia cyst has an average length of 8-19 μm and a 7-10 μm width (Touz MC. 2006).

7

1.4 Human bactericidal/ permeability-increasing protein

The human immune system is the main shield that protects the human body against diseases. The skin and the mucosa create the first lane of defense of the human body against any kind of microbial factors. However, these physical barriers are quite sensitive and as a result susceptible to many forms of injuries, which can make it easy for possible microbial factors to enter and cause infection (Gubern C. et al. 2006; Schultz H. et. al. 2001). The innate immune system is responsible to rapidly respond to that kind of incursion in order to prevent a further invasion and consequently an infection. This kind of response from the innate immune system includes the phagocytosis by the neutrophils and the macrophages, which also produce nitric oxide (NO) which is toxic for the microbial factors and eventually it kills them (Gubern C. et al. 2006; Levy O. 2000). It has been shown that the granules of neutrophils produce a large number of antimicrobial proteins which play an important part in the way the innate immune system reacts and how affective it can become. One of these endogenous antimicrobial proteins is a protein called "bactericidal/permeability-increasing protein" (BPI) and constitutes the 0.5-1% of the total protein the neutrophils produce (Elsbach P. 1998; Gubern C. et al. 2006).

1.4.1 Structure of human BPI

The human BPI is a single chain cationic protein with a molecular weight around 55kDa and a boomerang-like shape (figure 5). The BPI consists of 2 domains which are nearly superimposable (Elsbach P. 1998). Each domain contains a

phosphatidylcholane molecule which encourages the belief that the apolar

pockets in each domain represent the sites where the BPI binds to lipids and possibly to the lipid A portion of lipopolysaccharides (LPS). The 2 domains of the protein

consist from barrels as well as β-sheet forms. BPI also contains a disulfide bond, necessary for the correct formation of the dimer (Lennartsson A. et al. 2005). The BPI has a high concentration of basic (mainly lysine) residues in the amino-terminal half of the molecule.

Figure 5. (A) Ribbon diagram of human BPI showing its boomerang-like shape. The NH2-terminal domain (light blue) and the COOH-terminal domain (darker blue) are shown, while at the same time is illustrating the two phosphatidylcholane molecules (red) and the disulfide bond (yellow). (B) A 70° rotating view of the (A) diagram is shown. (Beamer LJ. et al. 1997)

8

1.4.2 The multiple activity of human BPI

The BPI has multiple actions; the N-terminal of the protein is responsible for both the antimicrobial and endotoxin-neutralizing properties of the protein while the C-terminal gives the protein the ability to opsonize Gram-negative bacteria (GNB) (Levy O. 2000).

1.4.2.1 Antimicrobial activity

The BPI possesses a cytotoxic activity against the GNB and that is the reason why it is consider to be a "natural antibiotic". BPI selectively targets GNB due to the fact that the protein has the ability to bind to LPS, a phosphorylated glycolipid, and more specifically to the lipid A portion of the LPS which is a region in polysaccharides of great importance since it is responsible for the endotoxic properties of LPS (Niemetz et al. 1977; Schultz et al. 2007). The outer membrane of the GNB is rich in LPS which makes it easy for the protein to bind. Another factor that contributes to this kind of activity of the protein is the high concentration of basic residues in the N-terminal of the molecule. It is this cationicity of the molecule that is responsible for its targeting against the negatively charged bacterial envelope of the GNB. The positively charged residues that exist in the N-terminal of the BPI bind to the negatively charged LPS disturbing the cations that normally stabilize the outer membrane of the bacteria. Also, it is believed that hydrophobic interactions of the BPI's apolar lipid-binding pockets with the LPS's acyl-chains take place which is considered to contribute to the disruption of the outer membrane of the GNB (Levy O. 2000). It has been shown that the main effects of BPI against the GNB is the inhibition of their growth rate, the increase in the permeability of their membrane, the inhibition of cell division and the activation of bacterial phospholipid (PL) hydrolysis as well, which can be strengthen by the presence of antimicrobial peptides that belong to the cathelicidin and defensin families. In order for BPI to cause a more aggressive result and kill the bacteria, it has to enter their inner membrane (Elsbach P. 1998; Levy O. 2000).

1.4.2.2 Endotoxin neutralizing activity

BPI, as it was described previously, is notable for its ability to bind with a great specificity to LPS and for that reason it acts as a recognition molecule for the immune system. At the same time it has been shown that when tested in vitro the molecule is able to neutralize the endotoxin (LPS) in different kind of biologic fluids and as a result to decrease the inflammatory effects of LPS and GNB (Levy O. 2000; Schultz et al. 2001).

1.4.2.3 Opsonic activity

The C-terminal of the molecule displays an opsonic activity after it has been observed that when bacteria are exposed to high concentrations of BPI (10-100 nM) are more susceptible to phagocytosis from the neutrophils (Levy O. 2000; Schultz et al. 2001).

9

1.5 Human lipopolysaccharide-binding protein

The lipopolysaccharide-binding protein (LBP) is a plasma protein that belongs to the family of lipid-binding proteins and is produced by hepatocytes during the acute phase response of the innate immune system and is secreted into the bloodstream (Beamer et al. 1998; Elsbach P. 1998; Krasity BC. 2011). LBP binds to LPS and after it amplifies the signal of it,

delivers it to CD14-LPS receptor which exists on the surface of the macrophages and other cells of the immune system (Beamer et al. 1998; Elsbach P. 1998). That way, LBP plays an important role in the acute mobilization of neutrophils to the infected sites of a tissue. From a structural point of view, LBP demonstrates a boomerang-like shape in the N-terminal of which the LPS-binding site occurs (Gonzalez M. 2007) (Figure 6). 1.6 Correlation and differences between BPI and LBP

Both BPI and LBP are members of a family of lipid-binding proteins and for that reason they share many common characteristics but on the other hand they exhibit some differences too, with the most important to be related to their function. Both proteins are some of the most important components of the innate immune system since they are involved in the defense against bacterial pathogens. These two proteins share a common architecture and conserved residues, most of which are apolar, something that is related to their ability to bind to LPS. When it comes to structure both proteins have a characteristic boomerang-like shape, where the N-terminal possesses the LPS binding activity, and a conserved disulfide bond. The two proteins share a 45% sequence identity (Gonzalez M. 2007; Lennartsson A. et al. 2005). An alignment of the BPI and LBP sequences has shown an obvious evolutionary relationship between the proteins (Beamer et al. 1998). Both proteins present a high-affinity for the LPS-binding, however the affinity of LBP is almost 70-fold lower than of BPI, something that can be explained from the fact that there is a higher number of basic residues that occupy the N-terminal in the human BPI than in LBP. That difference in the affinity of the LPS-binding can justify why the LBP does not demonstrates any antimicrobial activity as BPI does (Elsbach P. 1998; Gonzalez M. 2007). Thus, these two proteins have completely opposite functions; LBP is a plasma protein that induces the inflammatory immune response to LPS, whereas BPI neutralizes the toxic effects of LPS (Beamer LJ. et al. 1997;

Figure 6. Prediction of the structure of human LBP (PDB: P18428) showing its boomerang-like shape. The NH2-terminal domain (blue) and the COOH-terminal domain (yellow-orange).

10

Beamer LJ. et al. 1998). Finally, human BPI has a higher pI (approximately 9.4) than human LBP (approximately 6.3) (Krasity BC. 2011).

In general and despite the differences that occur between the two proteins it is believed that they share a common ancestor which was a single-domain protein whose gene was duplicated, though the two-domain structure is common (Krasity BC. 2011). 1.7 Aim of the project

The purpose of this project was to study BPI-like proteins found in the genome of Giardia intestinalis. During this project, G. intestinalis was transfected with these BPI-like proteins in order for them to be tested, by performing interaction experiments between G. intestinalis and bacteria, to study their expression levels and how they may change during those kind of interactions and take more general information about these proteins by studying where they localize in the parasite giving us a better view of their purpose for the survival of the parasite and probably of their function in the cell. Since there is the possibility that these proteins could belong to the lipid-binding protein family, the purification of these proteins was essential in order to have a better understanding of their function.

11

2. Materials and Methods

2.1 Construction of episomal vector for the transfection of Giardia

intestinalis

2.1.1 Selection markers and C-terminal localization tag

The plasmid that was used for the transfection of G. intestinalis is an already existing vector (PHA-5 vector) created from members in the lab and is typically been used for the transformation of this parasite (figure 7).

The vector carries the puromycin N-acetyl-transferase (PAC) gene which has been cloned between the NcoI and XhoI sites and was used as the selection marker during the transfection.

Also, the vector contains a 3xHA tag which was used as a "target" during the localization experiments.

2.1.2 Cloning the genes of interest into the PHA-5 vector

The genes selected for cloning and tagging into the PHA-5 vector were extracted from genomic DNA of G. intestinalis (see Appendix for used primers) and amplified by PCR. The PCR products were analyzed on a 0.7% agarose gel dissolved in 1xTAE buffer which confirmed that their size was the correct one. The products were later purified using the "GeneJET PCR Purification Kit (250)" (Thermo Scientific) and digested with the restriction enzymes MluI and NotI. The digested products were purified once again and ligated into the vector for transformation.

Figure 7. The pPAC-3xHA-C (PHA-5) vector, used for the transfection of G. intestinalis, containing the PAC gene and 3xHA tag.

12

2.2 Construction of vector for protein purification

2.2.1 Selection markers and N-terminal localization tag

The plasmid that was used for the transformation of E. coli (BL21) is an already existing vector (pGEX vector) bought from GE Heathcare and is typically used for the transformation and expression of protein in E. coli in order to be purified.

The vector carries the ampicilin (AmpR) gene which was used as the selection marker during the transformation and also, contains a GST tag which was used as a "target" during the protein purification experiments (figure 8).

Moreover, the vector contains the lac operon which was used for the over-expression of the proteins that were purified. For the induction of the operon Isopropyl-β-D-thio-galactoside (IPTG) was used.

2.2.2 Cloning the genes of interest into the pGEX vector

The genes selected for cloning and tagging into the pGEX vector were extracted from genomic DNA of G. intestinalis (see Appendix for used primers) and amplified by PCR. The PCR products were analyzed on a 0.7% agarose gel dissolved in 1xTAE buffer which confirmed that their size was the correct one. The products were later purified using the "GeneJET PCR Purification Kit (250)" (Thermo Scientific) and digested with the restriction enzymes BamHI and NotI. The digested products were purified once again and ligated into the vector for transformation.

2.3 DNA extraction from Giardia intestinalis

Cells from a confluent tube of G. intestinalis were harvest by centrifuge at 2500rpm for 5 minutes. The supernatant was removed and the cell pellet was washed in 1ml of cold PBS to remove any media components by centrifuge at 2500rpm for 5 minutes once again. The pellet was resuspended in 500µl of lysis buffer including 50mM EDTA, 1% SDS and 10mg/ml Proteinase K. The resuspended pellet was later

Figure 8. The pGEX vector, used for the transformation of E. coli, containing the AmpR gene and GST tag.

13

incubated at 56°C for at least 1 hour and mixed occasionally by vortexing. 20µl RNase A were added and the mixture was incubated for 20 minutes at room temperature. To the tube we added 275µl of Phenol (pH 8), 275µl of Chisam (24:1 chloroform:isoamyl alcohol) and mixed carefully by vortexing for 20 seconds. The sample was centrifuged for 10 minutes at 13000rpm. The aqueous phase of the tube (upper phase) was removed and an equal volume of Chisam was added in it. After vortexing for 20 seconds and centrifuging the tube for 10 minutes at 13000rpm the aqueous phase was precipitated with an equal volume of isopropanol and followed by a 10 minute incubation at room temperature. The tube was centrifuged for 10 minutes at 13000rpm, the supernatant was removed and the pellet was washed with 1ml of 70% cold ethanol and then centrifuged for 5 minutes at 13000rpm at 4°C. The supernatant was removed and the pellet was air-dried and dissolved ddH2O (20-300µl depending on the amount of start material). The final concentration of genomic DNA was measured by Nanodrop 2.4 PCR amplification of genes

All designed primers were dissolved to 200µM and for each one of them a 1:10 dilution was made to get the concentration 20µM. A primer mix of the forward and the reverse primer from the 20µM tube was made, which gave a primer mix of 10µM, that we used in the final PCR reaction. For the cloning the proof-reading polymerase, Phusion Hot-Start II High-Fidelity polymerase (Finnzymes), was used for the amplification of the genes. The mastermix (final volume of 40µl) for the one PCR reaction included:

FOR 1 REACTION ADDED 8µl of 5x Phusion® HF Reaction Buffer (Finnzymes) 4µl of dNTPs (stock 2mM) 0.6µl of Phusion Hot-Start II DNA polymerase (Thermo Scientific) 2µl of the primermix (10µM) 4µl of DNA template 21.4µl of dH2O

The general PCR conditions used were: PCR CONDITIONS Initialization step: 98°C for 30 seconds

Denaturation step: 98°C for 10 seconds

Annealing step: 59°C for 30 seconds

Elongation step: 72°C for 45 seconds

Final elongation: 72°C for 10 minutes

Final hold: 4°C for ∞

x 35 cycles

14

After the end of the PCR program, 5µl of the products were visualized on a 1% agarose gel dissolved in 1xTAE buffer. The agarose gel ran at 100V for 30-40 minutes after ethidium bromide 0.5μg/ml was added to the liquid agarose. The PCR products were purified, digested with the required digestion enzymes and stored at -20 °C.

2.5 Ligation

The ligation mixture used for the ligation of the purified DNA insert into the vector included:

FOR 1 REACTION ADDED: 20-100ng of linear vector DNA 1:1 to 5:1 (molar ratio over vector) of insert DNA 1.5µl of 10x Buffer for T4 DNA ligase (Fermentas) 0.5µl of T4 ligase (Fermentas) 0.75µl of 10mM ATP

The mixture was incubated overnight at 16°C.

2.6 Transformation of E. coli

The transformation of competent E. coli cells (DH5α) was performed with heat-shock. The transformation of competent cells of E. coli was performed by thawing the cells on ice from -80°C and aliquoting 100μl per reaction. To 100µl of competent E. coli cells (DH5α), 3-5µl of the ligation mix, containing the vector and DNA insert (~10-100ng DNA vector/100µl), was added. Next, the cells sit on ice for 15-30 minutes and were heat shocked for 1 minute at 42°C. The cells were placed on ice again for 2 minutes before 900 µl of LB were added to the tube and incubated at 37°C and shaking for 1 hour. Thereafter, the cells were plated out on selective LA plates supplemented with 50µg/ml ampicilin. Finally, the plates were incubated overnight (approximately 16 hours) at 37°C.

2.7 Plasmid mini-preparation

A single colony of the transformed E. coli was picked and inoculated in 5ml LB media containing 50µg/ml ampicilin at 37°C for approximately 16 hours and shaken at 200rpm for aeration. The plasmid from the overnight culture was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific) according to the manufacturer's instructions.

2.8 Restriction digestion of DNA and PHA-5 vector or (pGEX vector)

The mixture of the digestion of the vector pPAC-3xHA-C (PHA-5) with the "Fast Digest" enzymes MluI (or BamHI for pGEX vector) and NotI contained:

15

FOR 1 REACTION ADDED: 1µg of template (PCR product or plasmid) 3µl of 10x Fast Digest Green Buffer (Thermo Scientific) 1µl (1u) Fast Digest MluI (or BamHI for pGEX vector) (Thermo Scientific) 1µl (1u) Fast Digest NotI (Thermo Scientific) Water, nuclease-free to 30µl (final concentration 30µl)

The reaction mixture was incubated for 1 hour at 37°C

For the plasmid an additional digestion was performed by adding 1µl (1u) of the FastAP™ thermosensitive Alkalane Phosphatase (1u/µl) (Fermentas) in order to dephosphorylate the vector and avoid self ligation of it. Once again, the mixture was incubated for 1 hour at 37°C. The digested product was visualized on agarose gel (0.7% for the PCR products and 1% for the plasmid). Thereafter, the PCR products were purified with GeneJET PCR Purification Kit (250) (Thermo Scientific) as mentioned above, while the plasmid was gel purified to remove the DNA insert using the "QIAquick® Gel Extraction Kit (250)" (QIAGEN). 2.9 Sequencing of cloned plasmids

To verify the correct sequences of the cloned plasmids, samples of the plasmids were sent for sequencing at Uppsala Genome Center. All the samples contained 450ng of plasmid together with efficient sequencing primers (4pmol/tube) and water to a final volume of 18µl. 2.10 Culture conditions for Giardia intestinalis

All G. intestinalis cultures were cultivated in polystyrene screw cap tubes (Nunc) in 10 ml of TYDK media at 37°C. 250 ml of basal media contained: 7.5g Peptone, 2.5g Glucose, 0.5g NaCl, 0.05g L-ascorbic acid, 0.25g K2HPO4, 0.15g KH2PO4, 0.5g L-Cysteine and 2.5ml Ferric ammonium citrate solution (2.2mg/ml). The pH was set to 6.8 using 5M NaOH and thereafter the media was filter sterilized using 0.45μm filter-units (Corning). Next, 25ml filter sterilized bile (12.5mg/ml) was added to the sterile media. To complete the media, 10% bovine serum (heat inactivated) was added to it. The basal media was stored at 4°C. 2.11 Plasmid big scale preparation for transfection of Giardia

intestinalis

The plasmid preparation were scaled up in order to obtain a sufficient amount of plasmid (around 20-30µg) for the transfection of G. intestinalis. As in the mini-preparations (see section 2.7), a single colony of the transformed E. coli was picked and inoculated in 30ml LB media containing 50µg/ml ampicilin at 37°C for approximately 16 hours and shaken at 200rpm for aeration. The plasmid from the overnight culture was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific) by making a few modifications in order to obtain a bigger volume of plasmid.

16

2.12 Transfection of Giardia intestinalis using electroporation

A nearly confluent tube of G. intestinalis (approximately 1×107 cells) placed on ice for 15 minutes so that the Giardia cells will detach from the tube and the cells were collected by centrifuge the tube at 2500rpm for 5 minutes. The pellet was resuspended in 300µl of TYDK and placed to a 4mm gap electroporation "Gene Pulser® Cuvette" (BIO-RAD) and placed on ice. To the cuvette, 20µg of the episomal plasmid was added, mixed with pipette and electroporated immediately.

The settings used for the electroporator "Gene Pulser" (BIO-RAD) were: pulse in 350V, capacitance in 960µF and resistance in 800Ω.

After the electroporation the cuvettes were incubated on ice for 10 minutes and later the electroporated cells were transferred to culture tubes with 10 ml of warm TYDK media. The electroporated cells were grown at 37°C for 24 hours before 50μg/ml of puromycin, which was the selection drug, was added. Every week, fresh media and selective drug was given to the transfected cells until they become confluent, allowing the cells to be passed as wild type cells. In order to avoid contamination during the cell cultivation, 100μg/ml of gentamicin was added to the culture tubes. The transformed stains of G. intestinalis were frozen in 1ml of TYDK media containing 10% of DMSO (Dimethyl Sulfoxide) (Sigma-Aldrich) and they were stored in -80 °C as a stock. 2.13 SDS-PAGE electrophoresis In order to prepare the sample for western blotting, the cultured cells of transformed E. coli or transfected G. intestinalis were centrifuged at 3000rpm for 5 minutes at 4°C. The supernatant was discarded and the cell pellet was washed in cold PBS and centrifuged again at 3000rpm for 5 minutes at 4°C as before (the washing was repeated 2 times). The final cell pellet was resuspended in 1ml of RIPA buffer containing: 1% NP-40, 0.1% SDS, 50mM Tris-HCl (pH 7.4), 150mM NaCl, 0.5% Sodium Deoxycholate and 1mM EDTA, mixed with protease inhibitor cocktail (Roche). The cell suspension was lysed by mixing gently and placing on ice for 15 minutes. Next, the samples were centrifuged at 13000rpm for 5 minutes at 4°C and the supernatant was transferred to a new vial. A protein assay (BIO-RAD) of the supernatant was performed according to the manufacturer's instructions, were a protein concentration of 3-5µg/µl was the preferred for PAGE. In the protein samples, 2x SDS-PAGE sample buffer was added to yield a 1x sample buffer concentration and they were boiled for 10 minutes. Thereafter, 10μl of the boiled samples were loaded on the SDS-PAGE gel.

17

FOR A 10% SDS-AGE GEL:

Stacking (upper) gel

3.4 ml Water 0.63 ml Upper Tris buffer (1/4) pH= 6.8

50 ul SDS 50 ul APS

0.83 ml Acrylamide buffer (30%) 5 ul TEMED

5 ml

Separating (lower) gel

4 ml Water 2.5 ml Upper Tris buffer (1/4) pH= 8.8 100 ul SDS 100 ul APS 3.3 ml Acrylamide buffer (30%)

4 ul TEMED 10 ml

After the boiled samples and the PageRuler™ prestained protein ladder (ThermoScientific) been loaded, the gel ran at 100V between 30-50 minutes in 1X Running buffer. 2.14 Western Blotting

After the proteins were separated, the SDS-PAGE gel was transferred to Polyvinylidene Flouride (PVDF) membrane (Pall Life Sciences) by placing the membrane on top of the gel stacked between pads and filter-papers. The stack was placed in 1x Transfer Buffer and the transfer was performed at 35mV overnight at 4°C with continuous stirring. The membrane was blocked using 3% non-fat dry milk in phosphate buffered salane (PBS) containing 0.1% Polyoxyethylenesorbitan monolaurate, Tween20 (Sigma-Aldrich) to reduce unspecific binding of the antibodies. The membrane was blocked for one hour followed by washing three times for five minutes each in PBS-T. The membrane was incubated with Anti-HA antibody (product no. H 9658, Sigma-Aldrich) as the primary antibody which was diluted 1:10000 in PBS with 1% BSA and 0.1% Tween20 for two hours. Thereafter the membrane was washed as previously followed by an hour incubation with the secondary antibody, Anti-mouse coupled with horseradish peroxidase (HRP) (product no. P0161, Dako) diluted 1:10000 in 3% non-fat milk dissolved in PBS with 0.1% Tween20. After one hour of incubation the membrane was washed as before with PBS

18

containing 0.1% Tween20. Blots were developed using ECL Plus detection system (Amersham ECL Plus detection kit, GE Healthcare) according to the manufacturer's instructions.

2.15 Fixation

In order to prepare the samples for the fixation, one confluent tube of Giardia was used and put on ice for 10 minutes and centrifuged at 2500rpm for 5 minutes. The cell pellet was washed in PBS and centrifuged again at 2500rpm for 5 minutes. Next, the cell pellet was resuspended in 1ml of ice-cold HBS-glucose buffer (Hepes Buffered Salane; HBS) to wash away media components and centrifuged again at 2500rpm for 5 min. Thereafter, 15µl drops of cells were placed on poly-L-lysine coated "Diagnostic Microscope Slides" (Thermo Scientific) with 10 wells. The cells were allowed to attach to the surface of the slide at 37°C for 5 minutes in a humidity chamber.

The G. intestinalis cells were fixed according to the paraformaldehyde (PFA) fixation protocol.

Following the paraformaldehyde (PFA) fixation protocol, 15µl of 4% PFA was added to the droplets and incubated at 37°C for 20 minutes. The fixative was removed using vacuum suction and 15µl of 0.1M Glycine which was dissolved in PBS was added to the wells to quench any remaining traces of fixative. The fixative was removed once again using vacuum suction and the wells were washed 5 times with PBS before 15µl of 0.1% Triton-X dissolved in PBS were added and incubated for 30 minutes at 37°C. Once again, the fixative was removed using vacuum suction and the wells were washed 5 times with PBS. Finally, 15µl of 2% BSA dissolved in PBS and 0.05% Triton-X (blocking buffer) were added and the slide was incubated over-night at 4°C in a humidity pan.

2.16 Immunofluorescence

After the overnight incubation, the blocking solution was removed by vacuum suction and 15µl of anti-HA direct monoclonal antibody (Alexa Fluor labeled MonoHA) diluted 1:250 times in the blocking buffer were added and incubated for 2 hours at room temperature. Next, the antibody was removed using vacuum suction and the wells were washed 5 times with PBS before 15µl of the secondary anti-mouse antibody conjugated to Alexa 488 diluted 1:200 times in the blocking buffer were added and incubated for 1 hour at room temperature. The antibody was removed using vacuum suction and the wells were washed 5 times with PBS. In the final step of the fixation, 3µl of mounting media Vectashield containing the DNA stain 4',6'-diamidino-2-phenyldole (DAPI) were added and a cover slip was placed over the wells and sealed with nail varnish. The slide was stored at 4°C or -20°C in darkness. The transfected cells were examined with a Zeiss Axioplan2 fluorescence microscope and the images were processed using the software Axiovision Rel. 4.8.

19

2.17 RNA purification

In order to prepare the samples for RNA purification, cells from a confluent tube of G. intestinalis were centrifuged at 2500rpm for 5 minutes and the pellet was washed in 1 ml of cold PBS. The cells were pelleted again by centrifuge at 2500rpm for 5 minutes and the pellet was resuspended in 1 ml of Trizol® Reagent (Invitrogen). The cells left to stand for 5 minutes in room temperature and then placed on ice. Next, 0.2ml of chloroform per 1ml of Trizol Reagent were added and after the sample tubes were cap securely, they mixed by vortexing for 15 seconds and incubated at room temperature for 2-3 minutes. Thereafter, the samples were centrifuged at 13000rpm for 15 minutes at 2-8°C. The centrifugation caused the mixture to separate into a lower red, phenol-chloroform phase and a colorless upper aqueous phase (RNA remains exclusively in the aqueous phase). The upper aqueous phase was transferred carefully without disturbing the inter-phase into fresh tube and precipitated by mixing with 0.5ml of isopropyl alcohol per 1ml of Trizol Reagent. The samples were incubated at 15-30°C for 10 minutes and centrifuged at 13000rpm for 10 minutes at 2-4°C. The RNA precipitate, often invisible before centrifugation, formed a gel-like pellet on the side and bottom of the tube. The supernatant was completely removed and the RNA pellet was washed twice with 1ml of 75% cold ethanol by vortexing and centrifuge at 13000rpm for 5 minutes at 2-8°C.The RNA pellet was air-dried for 5-10 minutes and dissolved in 20-30µl of DEPC-treated water. The final concentration of the RNA was measured by Nanodrop and the tubes containing the RNA were stored in -20°C.

2.18 cDNA synthesis

The cDNA synthesis was performed using the "RevertAid H Minus First Strand cDNA Synthesis Kit" (Thermo Scientific).

To prepare the samples for the cDNA synthesis first removal of the genomic DNA from the RNA samples was necessary in order to avoid any contamination.

FOR 1 REACTION ADDED

1µg of RNA 1µl of 10x Reaction Buffer with MgCl2 (Thermo Scientific) 1µl (1u) of DNase I, RNase-free (1u/µl) (Thermo Scientific). Water, nuclease-free to 10µl (final concentration of 10µl)

The samples were firstly incubated at 37°C for 30 minutes. To the samples 1µl of 50mM of EDTA (Fermentas) was added and incubated at 65°C for 10 minutes. The first strand of cDNA was synthesized by RT-PCR.

20

FOR 1 REACTION ADDED IN THE INDICATED ORDER 5µg of total RNA 1µl of Random Hexamer Primer (0.2µg/μl) 4 μl of 5x Reaction Buffer 1 μl of RiboLock RNase Inhibitor (20u/μl) 10 of mM dNTP mix 1μl of RevertAid H Minus Reverse Transcriptase (200u/μl) (final concentration of 20μl)

The reaction samples were mixed gently and centrifuged before put them in the PCR machine. For the random hexamer primed synthesis the reaction samples were incubated for 5 minutes at 25°C followed by 60 minutes at 42°C. The reaction was terminated by heating at 70°C for 5 minutes. The final cDNA was stored at -20°C.

2.19 RT-qPCR (quantitative Real Time Polymerase Chain Reaction)

The first step of the qPCR was to for the absolute quantification was to make a melting curve (association curve) which was used to test the efficiency of the designed primers (see Appendix for used primers). 2.19.1 Absolute Quantification (efficiency of reaction)

In order to prepare the samples for the absolute quantification, dilution of standard cDNA from wild type Giardia was used, where the cDNA was diluted 1:10, 1:100, 1:1000 and 1:10000 times. The forward and reverse designed primers (100µM) were mixed to create a mix stock of 10 µM, which was diluted to a primer mix stock of 1µM. Next, 2.5 µl of the primer mix (1µM) were mixed with 12.5 µl of "Maxima SYBR Green/ROX qPCR Master Mix" (Thermo Scientific) per well. Those 15 µl of the master mix were added into the MicroAmp™ 96-well plate (AB Applied Biosystems) by reverse pipetting and 10 µl of DNA per well were added later. All samples were in quadruplicates for optimal results. The a 96-well plate was sealed and placed in the qPCR machine (7300 Real Time PCR system) (AB Applied Biosystems) in the correct orientation for analysis. The thermal profile used was:

Procedure Temperature Time Stage 1: Initial 50°C 2 minutes

Stage 2: Hot Start 95°C 10 minutes Stage 3:

Annealing 95°C 15 seconds X 40 60°C 1 minute

Stage 4: Melting curve

95°C 15 seconds 60°C 30 seconds 95°C 15 seconds

21

2.19.2 Relative Quantification

In order to prepare the samples for the absolute quantification, dilution of standard cDNA from wild type Giardia was used, where the cDNA was diluted 1:50 times. The forward and reverse designed primers (100µM) were mixed to create a mix stock of 10 µM, which was diluted to a primer mix stock of 1µM. Next, 2.5 µl of the primer mix (1µM) were mixed with 12.5 µl of "Maxima SYBR Green/ROX qPCR Master Mix" (Thermo Scientific) per well. Those 15 µl of the master mix were added into the MicroAmp™ 96-well plate (AB Applied Biosystems) by reverse pipetting and 10 µl of DNA per well were added later. All samples were in quadruplicates for optimal results. The a 96-well plate was sealed and placed in the qPCR machine (7300 Real Time PCR system) (AB Applied Biosystems) in the correct orientation for analysation. The thermal profile used was:

Stages Temperature Time Stage 1: Initial 50°C 2 minutes

Stage 2: Hot Start 95°C 10 minutes Stage 3:

Annealing 95°C 15 seconds X 40 60°C 1 minute

2.20 Protein purification

For the protein purification of the GST tagged protein, overnight culture of E. coli (BL21) transformed with the pGEX fusion construct had to set up containing 100 µg/ml ampicilin as a selection drug. The next day, the overnight culture was diluted 1:10 times in fresh LB medium containing 100 µg/ml ampicilin. The cells grew at 37°C till they reach an OD 600 =0.6-0.8 which represents the mid-log phase. When the OD600 reached the desired level, the bacterial culture was induced by adding 0.5mM isopropyl-β-D-thio-galactoside (IPTG) and allow them to grow for an additional 4 hours at 28°C. After the 4 hour incubation, the cells were harvested at 4°C at 4500 rpm for 25 minutes. Due to problems of solubilization of the protein, in this step of the protein purification, the "Rapid GST inclusion body solubilization and renaturation kit" (Cell Biolabs) was used according to the manufacturer's instructions. After the bacterial cell lysis and the inclusion body solubilization and renaturation, 50µl of Gluthione Sepharose™ 4B beads (50%) (GE Healthcare) was added per 1ml of cell extract containing the GST fusion protein. The beads were incubated overnight at 4°C with end-over-end rotation. The beads were washed three times with 1xPBS and one time in the elution buffer (50mM Tris pH 7.5, 150mM NaCl, 1mM EDTA and 1mM DTT) in order to equilibrate them. After the washing, the beads were incubated overnight at 4°C with end-over-end rotation in the elution buffer containing the enzyme PreScission™ protease (GE Healthcare) (20µl/1ml of elution buffer). After the overnight incubation, the beads were centrifuged at 4°C at 13000rpm for 5 minutes and the supernatant (which contains the purified GST fusion protein) was

22

collected. Thereafter the beads were washed again one more time with the elution buffer and after one more centrifugation at 4°C at 13000rpm for 5 minutes, the supernatant was collected again.

In order to concentrated the collected supernatant and as a result the GST purified fusion protein, the Vivaspin® 6 Centrifugal Concentrator columns (GE Healthcare) were used according to the manufacturer's instructions.

23

3. Results

In the G. intestinalis genome there are at least 19 proteins that have been found to contain a BPI domain (table 1). The proteins can be found in 3 different assemblages (A, B and E) corresponding to 4 different isolates (WB, AS, GS and P15). This project focuses in the WB isolate which belongs to assemblage A, since it affects mainly humans and also is the most well-studied isolate from Staffan's Svärd group, where the project took place.

Isolate Annotation Locus tag Assemblage

WB

Hypothetical protein GL50803_102575 Assemblage A Hypothetical protein GL50803_111973 Assemblage A Hypothetical protein GL50803_112630 Assemblage A Hypothetical protein GL50803_112914 Assemblage A Hypothetical protein GL50803_112938 Assemblage A Hypothetical protein GL50803_113130 Assemblage A Hypothetical protein GL50803_113165 Assemblage A Hypothetical protein GL50803_16293 Assemblage A

AS Hypothetical protein AS175 Assemblage A

P15

Hypothetical protein GLP15_230 Assemblage E Hypothetical protein GLP15_712 Assemblage E Hypothetical protein GLP15_2478 Assemblage E Hypothetical protein GLP15_2725 Assemblage E Hypothetical protein GLP15_3045 Assemblage E Hypothetical protein GLP15_3522 Assemblage E Hypothetical protein GLP15_4118 Assemblage E Hypothetical protein GLP15_5002 Assemblage E

GS Hypothetical protein GL50581_1015 Assemblage B Hypothetical protein GL50581_890 Assemblage B

Table 1. The 19 BPI-like proteins found in G. intestinalis categorized by assemblage and isolate.

3.1 Protein comparisons

In the beginning of the project multiple alignments of these BPI-like porteins were performed in order to get a better understanding of the different assemblages and the different isolates which could possibly give us a first idea of the relation between them.

24

Figure 9. Phylogenic analysis based on the amino acid sequences of 16 BPI-like proteins found G.

intestinalis genome where the WB isolate is demonstrated with red, P15 isolate with green and GS isolate with blue.

Figure 10. Phylogenic analysis based on the nucleotide sequences of 16 BPI-like proteins found G.

intestinalis genome where the WB isolate is demonstrated with red, P15 isolate with green and GS isolate with blue.

Figure 11. Phylogenic analysis based on the promoter region (-150 +0) sequences of 16 BPI-like proteins found G. intestinalis genome where the WB isolate is demonstrated with red, P15 isolate with green and GS isolate with blue.

From the phylogenic analysis above, is clear that the genes that belong in the same isolate share many similarities (figure 9 and 10), while there is also the possibility of recombination during evolution between the isolates WB and P15 (figure 11).

3.2 Structural comparison of BPI-like proteins with human BPI and LBP

Using the protein structure homology-modeling server SWISS-MODEL (http://swissmodel.expasy.org) for the structure prediction of some of the BPI-like proteins of interest in G. intestinalis and also for the human BPI and LBP protein, the following structures were obtained (figure 12). In the following figure examples of two BPI-like proteins are shown and order to obtain these structures the protein sequences had to be given to the server. These protein sequences were obtained from

25

the Protein Data Bank (PDB) (http://www.rcsb.org) for the human BPI, the Universal Protein Resource (UniProt/Swiss-Prot) (http://www.uniprot.org) for the human LBP and the Giardia Genomics Resource (GiardiaDB) (http://giardiadb.org) for the BPI-like proteins from G. intestinalis.

Figure 12. Structure prediction of human BPI (PDB ID: 1BP1, Chain: A), human LBP (Swiss-

Prot ID: P18428) and the two BPI-like proteins GL50803_113130 and GL50803_111973 which belong to assemblage A and to the WB isolate. Note that the N-terminal of the proteins is colored blue while the C-terminal is colored yellow-orange. For the protein GL50803_111973 the sequence identity with the human BPI is 13.737% and for the GL50803_113130 is 12.727%.

From figure 12 it can be seen the structure similarities between human BPI and LBP with the BPI-like proteins and especially the similarities that occur between the N-terminal of all proteins.

3.3 Electroporation of Giardia intestinalis

After the electroporation of G. intestinalis cells was performed there were surviving cells, but in order to make sure that the plasmid transfected into the parasites was still present and that a stable transfectant was established, a period of approximately three weeks of selection had to pass. During this project, 7 stable transfectants were established. Each transfectant was electroporated with one of the 7 BPI-like proteins that belong to assemblage A and isolate WB (see table 1). 3.4 Immunofluorescence of tagged proteins from stable transfectants

After the establishment of stable transfectants the next step of this project was to find where the transfected proteins localize in the parasite. In order to be able to do that, the proteins that were selected and transfected at the C-terminal were also tagged by the epitope tag 3xHA. All immunofluorescence pictures (figure 13,14, 15 and 16), for 4 out of the 7 transfectants, were taken by a fluorescent microscope, where the tagged proteins are stained with the direct anti-HA antibody in green while the nuclei were

26

stained with DAPI in blue. All pictures were taken with the 100x oil-immersion objective. An ER pattern was observed where BPI-like proteins localize.

Figure 13. Localization of the HA-tagged GL50803_102575 protein using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue. Picture A represents the phase contrast for picture B and picture C represents the phase contrast for picture D.

27

Figure 14. Localization of the HA-tagged GL50803_112630 protein using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue.

Figure 15. Localization of the HA-tagged GL50803_113130 protein using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue.

28

Figure 16. Localization of the HA-tagged GL50803_113165 protein using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue.

3.5 Expression data of BPI-like proteins during encystation of Giardia intestinalis

Figure 17. Variation of expression in BPI-like proteins during encystation process of G.

intestinalis.

According to the FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values collected from Giardia RNA-seq experiments, the expression of the BPI-like proteins increases during the encystation process and riches the highest point at 22 hours of encystation. For genes GL50803_113130 and GL50803_102575 there is an up-regulation when the parasite is in a cyst form, while for genes GL50803_111973, GL50803_113165, GL50803_112630, GL50803_112914 and

0 50 100 150 200

GL50803_102575

GL50803_112938

GL50803_112914

GL50803_112630

GL50803_113165

GL50803_111973

GL50803_113130

FPKM values during encystation

FPKM values during encystation Cysts

FPKM values during encystation 22h

FPKM values during encystation 7h

FPKM values during encystation 90min

FPKM values during encystation Troph

29

GL50803_112938 a down-regulation is observed when the parasite is in a cyst form (figure 17).

3.5.1 Western Blots for protein level expression of tagged proteins

Standard Western blot technique was used in order to analyze the protein expressions of 4 out of the 7 stable transfectants. Wild-type WB isolate was included as a control (figure 18). The tagged proteins were separated by 10% SDS-PAGE gels and transferred to a PVDF membrane by electroblotting.

Figure 18. Western blot analysis of 3xHA tagged proteins. The second lane includes the wild-type WB isolate as a control, while lane 3 includes the transfectant with the GL50803_113130 tagged protein, lane 4 includes the transfectant with the GL50803_113165 tagged protein, lane 5 includes the transfectant with the GL50803_102575 tagged protein and lane 6 includes the transfectant with the GL50803_112630 tagged protein. Lane 1 and 9 contain the "pageruler prestained protein ladder" (Thermo Scientific).

This analysis shows that GL50803_113130 is the most highly expressed gene under the cultural conditions that have been chosen.

3.6 Interaction experiments between Giardia intestinalis and bacteria

Another part of the project was the interaction of G. intestinalis with Gram-negative and Gram-positive bacteria in order to monitor changes in the expression and the localization of the tagged proteins in the parasite and also changes in the growth rate of the bacteria. The main purpose of these interaction experiments was to see how both parasites and bacteria could possibly react when they exist in the same environment. These experiments are quite important for the purpose of the project not only because it could give us more information on whether these BPI-like proteins could belong to the BPI family or not, but also for general information about G. intestinalis since by nature the parasite co-exists with many bacteria that are included in the normal-flora of the intestine. For these interaction experiments 3 kinds of

30

bacteria were used; Escherichia coli (E. coli), Bacillus subtilis (B. subtilis) and Pseudomonas aeruginosa (P. aeruginosa).

3.6.1 RT-qPCR for RNA-level protein expression in Giardia intestinalis post interactions

One of the first experiments that was performed during the interaction of G. intestinalis with E. coli, B. subtilis and P. aeruginosa was an RT-qPCR in order to analyze changes in the RNA-level protein expression of G. intestinalis. In these experiments the parasite interacted with one of the bacteria each time in different dilutions and for different periods of time. In details, the parasite interacted with 50µl of lysed (after sonication) overnight culture of bacteria, 50µl of a 1:10 dilution of the overnight culture of bacteria used and 50µl of a 1:100 of the overnight culture of bacteria used. The time points selected in these experiments was 90 minutes and 6 hours for the interactions with E. coli (figure 19) and 90 minutes, 6 hours and 24 hours for the interactions with B. subtilis and P. aeruginosa (figure 20 and figure 21 respectively). Wild-type WB without interacting with any bacteria was used as a control (time point: 0 hours).

An up-regulation of the expression of the BPI-like proteins can be observed while the parasite interacts with the bacteria reported above. The genes GL50803_102575, GL50803_112630 and GL50803_113130 seem to present the highest expression in an RNA level during the interactions.

Figure 19. RT-qPCR for RNA-level protein expression in G. intestinalis while it is interacting with 50µl of E. coli for 90 minutes and 6 hours.

31

Figure 20. RT-qPCR for RNA-level protein expression in G. intestinalis while it is interacting with 50µl of B. subtilis for 90 minutes, 6 and 24 hours.

Figure 21. RT-qPCR for RNA-level protein expression in G. intestinalis while it is interacting with 50µl of P. aeruginosa for 90 minutes, 6 and 24 hours.

32

3.6.2 Western Blots for protein level expression in Giardia intestinalis post interactions

During the interaction experiments the 4 transfectants of G. intestinalis interacted with 50µl of a 1:1000 dilution of a lysed (after sonication) overnight culture of B. subtilis and P. aeruginosa for 24 hours. After the 24 hour incubation of the parasite with the bacteria, the bacteria were removed and the parasites were collected in order to use them for a Western blot analysis, where the expression of their protein would be analyzed (figure 22).

Figure 22. Western blot analysis of 3xHA tagged proteins post interaction with bacteria. The first lane includes the wild-type WB isolate as a control, while lane 2 includes the transfectant with the GL50803_113165 tagged protein, lane 3 includes the transfectant with the GL50803_113165 tagged protein while it interacts with B. subtilis, lane 4 includes the transfectant with the GL50803_113165 tagged protein while it interacts with P. aeruginosa. The fifth lane includes the transfectant with the GL50803_113130 tagged protein, lane 6 includes the transfectant with the GL50803_113130 tagged protein while it interacts with B. subtilis, lane 7 includes the transfectant with the GL50803_113130 tagged protein while it interacts with P. aeruginosa. The ninth lane includes the transfectant with the GL50803_112630 tagged protein, lane 10 includes the transfectant with the GL50803_112630 tagged protein while it interacts with B. subtilis, lane 11 includes the transfectant with the GL50803_112630 tagged protein while it interacts with P.

aeruginosa. The twelfth lane includes the transfectant with the GL50803_113165 tagged protein, lane 13 includes the transfectant with the GL50803_113165 tagged protein while it interacts with B. subtilis, lane 14 includes the transfectant with the GL50803_113165 tagged protein while it interacts with P. aeruginosa. Lane 8 contains the "pageruler prestained protein ladder" (Thermo Scientific)..

No up-regulation of the BPI-like proteins expression was observed, however there is the possibility of protein secretion in the growth media during these interactions. Wild-type WB gives no signal during the western-blot since it does not have the 3xHA tag.

33

3.6.3 Immunofluorescence for tagged proteins in G. intestinalis post interactions

At the same time, during the experiment 3.6.2, a sample of each one of the transfectants was taken in order to fix them and analyze any possible changes in the localization of the BPI-like proteins after their interaction with the bacteria (figure 23, 24, 25 and 26).

No change in the localization pattern of the BPI-like proteins has been observed. The localization remains in ER membrane.

34

Figure 23. Localization of the HA-tagged GL50803_102575 protein after the interaction of G.

intestinalis with E. coli, B. subtilis and P. aeruginosa, using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue. Picture A and B present the parasite while it does not interact with any bacteria, picture C and D present the parasite while it interacts with E. coli, picture E and F present the parasite while it interacts with B. subtilis and picture G and H present the parasite while it interacts with P. aeruginosa.

35

Figure 24. Localization of the HA-tagged GL50803_112630 protein after the interaction of G.

intestinalis with E. coli, B. subtilis and P. aeruginosa, using fluorescence microscopy. Left panel

36

shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue. Picture A and B present the parasite while it does not interact with any bacteria, picture C and D present the parasite while it interacts with B. subtilis, picture E and F present the parasite while it interacts with E. coli and picture G and H present the parasite while it interacts with P. aeruginosa.

37

Figure 25. Localization of the HA-tagged GL50803_113130 protein after the interaction of G.

intestinalis with E. coli, B. subtilis and P. aeruginosa, using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue. Picture A and B present the parasite while it does not interact with any bacteria, picture C and D present the parasite while it interacts with B. subtilis, picture E and F present the parasite while it interacts with E. coli and picture G and H present the parasite while it interacts with P. aeruginosa.

38

39

Figure 26. Localization of the HA-tagged GL50803_113165 protein after the interaction of G.

intestinalis with E. coli, B. subtilis and P. aeruginosa, using fluorescence microscopy. Left panel shows the phase contrast while the right panel shows the merged of localized HA-tagged protein in green and DAPI stained nuclei in blue. Picture A and B present the parasite while it does not interact with any bacteria, picture C and D present the parasite while it interacts with B. subtilis, picture E and F present the parasite while it interacts with E. coli and picture G and H present the parasite while it interacts with P. aeruginosa.

3.6.4 Growth inhibition results for E. coli and B. subtilis post interaction with G.

intestinalis

During the interaction experiments, wild type G. intestinalis WB interacted with 50µl of a 1:1000 dilution of an overnight culture of E. coli, B. subtilis and P. aeruginosa for a total of 24 hours. During the interaction, a sample of each one of the bacteria was taken and plated in an LA petri dish in order to monitor the change in their growth rate during different time points (0 hours, 3 hours, 6 hours and 24 hours) (figure 27, 28 and 29). The bacteria were also grew in TYDK growth media without any parasites and used as control for the growth curve.

0,00E+00

1,00E+09

2,00E+09

3,00E+09

4,00E+09

5,00E+09

6,00E+09

7,00E+09

E.coli in TYDK 0 hrs

E.coli in TYDK 3hrs

E.coli interact.

3hrs

E.coli in TYDK 6hrs

E.coli interact.

6hrs

E.coli in TYDK 24hrs

E.coli interact.

24hrs

E. coli interacting with Giardia intestinallis

40

Figure 27. Graphical presentation of the number of E. coli in each time point (3 hours, 6 hours and 24 hours) during the interaction of the bacteria with G. intestinalis and the number of E. coli in the same time points (3 hours, 6 hours and 24 hours and also 0 hours which represents the initial amount of bacteria added for the interaction) in TYDK media (G. intestinalis growth media) without any parasites.

Figure 28. Graphical presentation of the number of B. subtilis in each time point (3 hours, 6 hours and 24 hours) during the interaction of the bacteria with G. intestinalis and the number of B. subtilis in the same time points (3 hours, 6 hours and 24 hours and also 0 hours which represents the initial amount of bacteria added for the interaction) in TYDK media (G.

intestinalis growth media) without any parasites.

1,00E+00

1,00E+01

1,00E+02

1,00E+03

1,00E+04

1,00E+05

1,00E+06

1,00E+07

1,00E+08

1,00E+09

1,00E+10

B.subtilis in TYDK 0

hrs

B.subtilis in TYDK

3hrs

B.subtilis interact.

3hrs

B.subtilis in TYDK

6hrs

B.subtilis interact.

6hrs

B.subtilis in TYDK 24hrs

B.subtilis interact.

24hrs

B. subtilis interacting with Giardia intestinallis

1,00E+00

1,00E+02

1,00E+04

1,00E+06

P. aeruginosa interacting with Giardia intestinallis

41

Figure 29. Graphical presentation of the number of P. aeruginosa in each time point (3 hours, 6 hours and 24 hours) during the interaction of the bacteria with G. intestinalis and the number of P. aeruginosa in the same time points (3 hours, 6 hours and 24 hours and also 0 hours which represents the initial amount of bacteria added for the interaction) in TYDK media (G.

intestinalis growth media) without any parasites.

A growth inhibition to all 3 bacteria can be observed, however the growth inhibition of E. coli during the interaction experiments with the parasite, is higher than the one of the other bacteria.

3.7 Protein purification

One of the most important experiments in this project is a series of experiments that started lately and have not been completed yet and are related with the protein purification of one of the BPI-like proteins. To begin with, the first step in this series of experiments was to find which one of the 3 out of the 7 tagged proteins (GL50803_102575, GL50803_112630, GL50803_113130) can be used in a better way for the protein purification and can be possibly used for other experiments too. In order to know which protein is the most suitable, the first stages of protein purification were performed, including the induction of each protein (4 hour induction at 28°C with 0.5 mM of IPTG) and the sonication of the bacteria in order to lyse the bacterial cells and the separation of the pellet (broken cells) with the supernatant in order to start the purification. During this first stages of purification, samples of all the 4 BPI-like proteins were used for a 10% SDS-PAGE gel (figure 30). Due to problems of solubilization of the protein of interest and the formation of inclusion bodies (lane 11, 12 and 13 of figure 30) a solubilization and renaturation kit was used (material and methods part 2.20) in order to solve this problem. This solubilization protocol managed to solubilize the BPI-like protein by using detergent. In order to find the most suitable amount of detergent for the solubilization of the GL50803_113130 fusion protein, different dilutions of the detergent were used and the results of the efficiency of the solubilization are shown in figure 31. After the first experiment was performed and finally the protein GL50803_113130 was chosen for the big-scale protein purification and the solubilization problem was solved, another SDS-PAGE gel was made after the purification of the protein was completed (figure 32).

In the final SDS-PAGE gel of the purified protein GL50803_113130 (figure 32) a band with a molecular weight of 55 kDa was expected, however something like this is not observed. On the opposite, a band at 80 kDa is observed representing the BPI-like protein with the GST tag and a band at 37 kDa which could represent a part of the purified protein (possibly one of the two terminals) that has been unspecifically cut (figure 32 and 33). Possible degradation products of the protein can also be seen at 55 kDa in figure 33.

42

3.7.1 SDS-PAGE gels

Figure 30. A 10% SDS-PAGE gel showing the uninduced samples, samples post induction and the samples after the sonication both in the supernatant and the pellet. The first three lanes present the uninduced proteins GL50803_113130, GL50803_113165 and GL50803_102575 respectively, while lanes 4, 5 and 6 present the induced proteins GL50803_113130, GL50803_113165 and GL50803_102575 respectively, lane 8, 9 and 10 present the proteins GL50803_113130, GL50803_113165 and GL50803_102575 respectively that were taken from the supernatant (soluble part) after the sonication and finally the lanes 11, 12 and 13 present the proteins GL50803_113130, GL50803_113165 and GL50803_102575 respectively that were taken from the pellet (insoluble part) after the sonication. Lane 7 contains the "pageruler prestained protein ladder" (Thermo Scientific).

43

Figure 31. Solubilization of GL50803_113130 protein by testing different dilutions of detergent. Lane 2: uninduced cell pellet, lane 3: induced E. coli lysate, lane 4 and 5: cell pellet and supernatant respectively of the induced protein in which only detergent was added (0 dilution). Lanes 6 and 7: cell pellet and supernatant respectively of the induced protein in which only 2 fold dilution of the detergent was added. Lanes 8 and 9: cell pellet and supernatant respectively of the induced protein in which only 8 fold dilution of the detergent was added. Lanes 10 and 11: cell pellet and supernatant respectively of the induced protein in which only 32 fold dilution of the detergent was added. Lanes 12 and 13 include the cell pellet and supernatant respectively of the induced protein in which no detergent was added. Finally, the 8 fold dilution of the detergent was chosen for the solubilization of the GL50803_113130 fusion protein. Lane 1 and 14: "pageruler prestained protein ladder" (Thermo Scientific).

Figure 32. Purification of the GL50803_113130 G. intestinalis protein from transformed E. coli (BL21). A 10% SDS-PAGE gel showing in lanes 2, 3, 5 and 6 the purified GL50803_113130 protein and lane 7 the glutathione beads used for the binding of the protein after the addition of the PreScission protease. The difference between the samples 2, 3, 5 and 6 is that samples in lanes 2 and 3 include a 5X SDS-PAGE non-reducing agent sample loading buffer (lane marker sample buffer) (Thermo Scientific) and the samples have not been boiled in order to make sure the protein is in its native state, while samples in lanes 5, 6 and 7 include a reducing agent sample buffer and have been boiled for 5 minutes too. The difference between samples in lanes 2 and 3 and 5 and 6 is that samples in lane 2 and 5 contain smaller concentration of the protein (1 mg/ml) than the protein in lanes 3 and 6 (1.5 mg/ml). Lane 1 and 4 contain the "pageruler prestained protein ladder" (Thermo Scientific).

44

3.7.2 Western blot

Figure 33. Purification of the GL50803_113130 G. intestinalis protein from transformed E. coli (BL21). A western blot showing in lanes 1, 2, 4 and 5 the purified protein. The difference between the samples 1, 2, 4 and 5 is that samples in lanes 1 and 2 include a 5X SDS-PAGE non-reducing agent sample loading buffer (lane marker sample buffer) (Thermo Scientific) and the samples have not been boiled in order to make sure the protein is in its native state, while samples in lanes 4 and 5 include a reducing agent sample buffer and have been boiled for 5 minutes too. Lanes 6 and 7 present the glutathione beads that were taken after the purification process. The beads were centrifuged and the supernatant is being represented from lane 6 while the from lane 7.

45

4.Discussion

The genome of G. intestinalis is the most studied genome in the order of diplomonads and has been used as a model system for the study of other pathogenic diplomonads and for general eukaryotic processes like for example cell differentiation (Svärd SG. et al. 2001). However, there are still many unstudied genes whose function and purpose is still unknown. Some of these unknown, "hypothetical" proteins are the ones that we studied in this project. Human BPI and human LBP proteins are well-studied proteins associated with the human immune system. Both BPI and LBP proteins have been found in the past not only in humans but also in rabbits, rats, mice and cows, but there is no study yet that provides evidence of the existence of these proteins in G. intestinalis. This, makes the purpose of this project even more important since an indication and much more, a proof of their existence in the parasite would add important information in the genome data base of G. intestinalis and would give us further information for this model organism.

Both amino acid and nucleotide sequence alignments of the studied proteins (figure 9 and 10) show that there are with no doubts conserved regions among the proteins that belong in the same isolate and as a result in the same assemblage. However, the alignment of the promoter region (-150 +0) (figure 11) shows proteins coming from different isolates to cluster together, something that can indicate that there is a possible evolutionary conservation among the promoter regions of the different isolates and assemlages (Down TA. 2003). What is more, the results from the promoter region alignment could also hint recombination between the genes from the two different isolates of WB and P15 and the presence of syntenic orthologs, meaning that there might be conserved genes along the chromosomes of the different isolates. This could explain possible differences and similarities among the different isolates and it could give further information on their evolution.

From a structure point of view and according to figure 12, it is clear that even the fact that the sequence identity of the BPI-like proteins of G. intestinalis with the human BPI varies from 11% to 13 %, there is structure similarity that exceeds the 90%. More specifically, the N-terminal of the BPI-like proteins is the one that seems to be more similar to the human BPI and LBP than the C-terminal, something that makes this information even more important if it is considered that the N-terminal is the terminal that has the antimicrobial activity in the human BPI and at the same time the more conserved region between the human BPI and LBP protein. However, from this figure no evidence can be obtain on whether the BPI-like proteins are more likely to belong to the BPI family than the LBP family and vice versa.

For that reason, the electroporation of G. intestinalis with these BPI-like proteins was necessary in order to obtain more information on their localization in the cell and possibly on their function. From the immunofluorescence pictures (figures 13, 14, 15 and 16) the same pattern of localization, among the different proteins, can be observed, something that indicates that all 4 proteins could possibly have the same

46

function. This similarity in the localization of the proteins is another addition to the previous similarities shown in the sequence alignments and in the structure among the proteins. This pattern of localization is a typical pattern for ER proteins, meaning for proteins that localize in the Endoplasmic reticulum (ER) membrane of the cell (figure 33) (Faso et. al. 2011). The ER constitutes the entire secretory system in Giardia and is one of the main organelles of the membrane transport system in the parasite. The secretory transport system plays an essential role in the life-cycle of Giardia. It is known that when the parasite is in the trophozoite form, it secretes specific soluble and membrane-bound proteins via ER and membrane transportation (Faso et. al. 2011; Luján HD. et al. 2011); something that is essential for the survival of the parasite. If it is assumed that the BPI-like proteins of G. intestinalis do belong to the BPI family, which are antibacterial proteins, it means that the parasite has to export these proteins in the outer environment in order for the BPI to act against the bacteria. The only way for this to happen is to localize these BPI proteins in the ER membrane so that to be able to transport them. The same would happen if the BPI-like protein of G. intestinalis belong to the LBP family proteins, since the parasite would have to transport them in the outer environment in order for the proteins to bind to the LPS and deliver it to CD14-LPS receptor which exists on the surface of the macrophages. What is more, in a close-up of the immunofluorescence pictures (figure 13, 14, 15 and 16) it can be seen that the BPI-like proteins localize under the form of small vesicles (visible small green dots in the immunofluorescence pictures), which would be essential for the proteins in order to be able to be transported outside the cell. These results, strengthen the assumption that these BPI-like proteins could actually do belong to the BPI or the LBP family. During the analysis of the transfectants in the fluorescent microscope, it was noticeable that not all transfectants expressed the proteins in the same way since there was a strong disparity of the fluorescence intensity among the cells. For example, approximately only the 30% of the total population of transfectants with the GL50803_102575 tagged protein expressed the protein, 50% of the total population with the GL50803_112630 and GL50803_113165 tagged protein expressed the protein, while almost 80% of the total population with the GL50803_113130 tagged protein expressed the protein. In addition to this observation, the results of the western blot analysis for the protein-level expression in the transfectants (figure 18) confirm

Figure 33. A three-dimensional reconstruction (volume image) of a confocal image showing the morphology and the distribution of the nuclei and four organelles in a trophozoite of G. intestinalis. Pictures A and D show the endoplasmic reticulum (ER) (light blue) and the mitosomes or encystation-specific vesicles (ESVs) (red) respectively, while picture B shows the peripheral vesicle (PV) organelles (green) and picture C a shows all previous organelles in one. Note that in every picture the two nuclei are shown (dark blue) (Faso et.

al 2011).

47

the fact that the transfectants do not express the different protein in the same way or at least in the same degree. To be more specific, they confirm that the expression of GL50803_113130 is higher than the others, while the expression of GL50803_102575 is the lowest. These kind of differences is a result of the variability of the copy numbers of the plasmid in the cells and/or the regulation of the protein expression in the cells, meaning that some of the cells might up-regulate the expression of the protein while some others might down-regulate it.

Taking into consideration that these BPI-like proteins that we study could belong to the BPI family and act against Gram-negative bacteria, the next experiment was to put G. intestinalis parasites in the same environment with Gram-negative and Gram-positive bacteria in order to see if the expression of the protein changes while this happens. In this case, up-regulation of the gene expression could indicate that the parasite reacts positively to the bacteria, meaning that the presence of the bacteria triggers the parasite to increase the production of this specific genes. The bacteria E. coli and P. aeruginosa are Gram-negative bacteria while B. subtilis is a Gram-positive. In these interaction experiments different number of bacteria (dilutions) were used since we wanted to observe how the parasite reacts to lower and higher concentrations of bacteria or even if some of them can become lethal to the parasite. As it is shown in figures 19, 20 and 21, the parasite up-regulates the expression of the BPI-like proteins under the presence of bacteria. Depending on the dilution of the bacteria, the parasite seems to be triggered in an earlier or later time point. For example in figure 19, G. intestinalis reacts very early (90 minutes) when E. coli is present but when B. subtilis (figure 20) or P. aeruginosa are present, it is triggered later (6 and 24 hours of interaction) or with higher concentration of bacteria. This, is something expectant since E. coli, as a Gram-negative bacteria, has a high amount of LPS in the outer membrane and it is easier for the parasite to be triggered faster. P. aeruginosa also has a fair amount of LPS in the outer membrane since it also belongs to the Gram-negative bacteria, but its efficiency in terms of cell activation is far lower than the efficiency of E. coli LPS (Raoust E. et al. 2009). B. subtilis is a Gram-positive bacteria which means that contains a very small amount of LPS or it completely lacks of it. However B. subtilis contains other major membrane components such as peptidoglycan, lipoteichoic acids (LTA), and bacterial lipoproteins (LP) which can act as non-endotoxin pyrogens (substances that cause fever) (Rockel C. et al. 2012) and can be possibly recognized from the BPIs or LBPs and as a result from the BPI-like proteins of G. intestinalis.

During the interaction experiments, a western blot analysis was performed but the results were inconclusive (figure 22) since there is no visible change in the protein expression for the GL50803_102575, GL50803_112630, GL50803_113165 transfectants, while there is a down-regulation for GL50803_113130 transfectant. That could be due to possible error during the evaluation of the protein concentration before the western blot analysis or it could mean that the parasite does not react against the LPS but against some other lipids, like for example the ones that constitute

48

the LP or the peptidoglycans, and in that case the parasite could bind easier to Gram-positive and not the Gram-negative bacteria like human BPI and human LBP do. In this point it is important to remember that these BPI-like proteins that we study belong to a different species than human BPIs and LBPs and their function is still unknown or even opposite to the ones isolated from humans. However, another possible explanation of these results could be that the BPI-like proteins are secreted during the interaction experiments and as a result they got "lost" in the supernatant-media growth. In order to make sure that something like this happened, a further evaluation of the supernatant during these interaction experiments has to be performed. WB does not give any signal in the western blot analysis, which means it works good as a control since it does not contain the 3xHA tag. The expected molecular weight of the proteins is also correct since all BPI-like proteins have a molecular weight around 55 kDa and the 3xHA tag at 3 kDa, which means that the total molecular weight of BPI-like proteins is approximately 58 kDa.

Another experiment in the series of experiments during the interaction of G. intestinalis with bacteria is the immunofluorescence. Changes in the expression of the genes during the interaction, would also possibly mean changes, small or big, in the localization of the protein. For example, change in the size of the vesicles (if the vesicles became bigger) would be an indication that the protein is ready to be exported from the cell towards the environment and act against the bacteria. However, something like that is not visible in figures 23, 24, 25 and 26, since the localization pattern is almost the same as the ones in the controls, where the parasite did not interact with any kind of bacteria. However, in some of these pictures (figures 23F, 23H, 24D, 24F, 24H, 25D, 25F and 26F) is visible that around the region of the two nuclei, the fluorescence is stronger and follows the size and the structure of the nuclei. This, could indicate that the parasite is stimulated and changes (possibly up-regulates) the expression of the BPI-like genes, since this is the region where translation and transcription of the proteins take place.

The final experiment related to the interactions between G. intestinalis and bacteria are shown in figures 27, 28 and 29 which represent the results from the petri-dishes for the bacteria during their interaction with the parasite. The bacteria were present with the parasite for a total of 24 hours. At the time-points of 3, 6 and 24 hours a sample of bacteria was collected and plated in a LA petri dish. The results of these petri dishes show that all 3 bacteria: E. coli, B. subtilis and P. aeruginosa (figures 27, 28 and 29 respectively) present growth inhibition comparing to the growth they normally have when they do not interact with the parasite. An indication that the bacteria die would be completely incorrect since there is an obvious growth of their number. The bacteria, both the ones included as control and the ones that were used under the presence of G. intestinalis, were grown in TYDK media, which is the typical growth media for Giardia. From the results it can be seen that the growth of E. coli and P. aeruginosa used as controls is not affected by the choice of media (presented as "E. coli in TYDK" and "P. aeruginosa in TYDK" in the figure

49

respectively), while B. subtilis presents a drop in the growth for the first 3 hours comparing to the original bacterial culture added at 0 hours. This indicates that the media choice is not the most suitable for this bacterium and that it might need time to adjust to this new growth media conditions. These results show that G. intestinalis definitely has an effect in the growth of the bacteria but further experiments (like for example live/dead staining) which measure changes in the cell viability would give more conclusive results on whether or not the bacterial cells die.

The final and most recent experiment done in this project has to do with the protein purification of one of the BPI-like proteins. The first step in this process was to choose the most suitable of the proteins in order to be purified. For this purpose, 3 proteins were tested (figure 30) and they were induced for 4 hours at 28°C with 0.5mM of IPTG. The induced cultures were sonicated in order to lyse the bacterial cells and after they were centrifuged, the supernatant was separated from the pellet in order to be able to see the degree of the protein solubilization. From the results of the SDS-PAGE analysis (figure 30) it was clear that the protein GL50803_113130 was the one that could be induced more comparing with the others, under the conditions chosen. The expected molecular weight of the GST tagged BPI-like proteins is approximately 80 kDa since the proteins have a molecular weight of 55-56 kDa and the GST tag of 25 kDa. Also, from figure 18 this protein is the one that presents a higher expression than the other proteins. At this point, the protein GL50803_113130 was chosen as the one that would be purified of the total BPI-like proteins studied in this project and that could potentially be used for further experiments. However, from figure 30 it is noticeable that there were problems with the solubilization of the protein since the highest amount of the protein after the sonication, remained in the pellet. This is a typical form of inclusion bodies produced by E. coli during the over-expression of the protein. The inclusion bodies are packed denaturated molecules that form particles (Singh SM. et al. 2005). Inclusion bodies consist a major problem during protein purification since the proteins that end up in inclusion bodies have no bioactivity. Thus, they have to solubilized, refold and after that purified (Singh SM. et al. 2005). These proteins can be solubilized with a high concentration of denaturants such as urea and under the presence of reducing agents and detergents. In order to be able to solubilize the protein for purification, a solubilization kit was used (methods and materials part 2.20) which used detergent. After the proper amount of detergent that was necessary for the solubilization of the protein was tested (figure 31), the process for the big scale purification of the protein continued. From the figures 32 and 33 is clear that the GST tag has not been completely cleaved from the protein, as it would be expected, since the molecular weight of the protein seems to be around 80 kDa (molecular weight of BPI-like protein: 55-56 kDa, molecular weight of GST tag: 25 kDa). This could indicated either inefficiency of the PreScission protease to cleave the tag from the total protein, or that a higher concentration of PreScission protease was needed. The structure of the protein could also be a reason of this happening, since the GST could be ''hidden'' in the protein structure and not easily accessible from the protease. Also it seems (lanes 2 and 3 from figure 32) that the protein eluted is not 100% pure since there are other products with higher molecular weight. What is more, lanes 5 and 6 from figure 32 show a product with a molecular weight at 37 kDa. These products with the lower molecular weight could be a result of degradation of the BPI-like protein since they can be noticed also in figure 30 and 31 or it could indicate that after the PreScission protease cleaved the protein from the beads, the

50

pure protein was again cleaved and a part of it is being represented by the band at 37 kDa. Possibly this part of the protein could be one of its terminals, maybe the N-terminal. This can be confirmed by figure 33 too since there is an absence of this band at 37 kDa which means that it does not contain the GST tag while possible degradation products can be seen at 55 kDa. The molecular weight of the PreScission protease can be seen at 45 kDa (figure 32 and 33). The GST tag can be seen at 25 kDa (figure 32 and 33). Another problem during the protein purification was the difficulty of the protein to be eluted from the glutathione sepharose beads which can be seen in figure 32 (lane 7). This could be a result of unspecific binding of the protein to the beads and again inefficiency of the PreScission protease since the GST remains uncleaved in the beads (25 kDa). Possible degradation products can also be seen in the glutathione sepharose beads as well. In order to test the activity of the purified GL50803_113130 protein, the protein was mixed with 5X SDS-PAGE non-reducing agent sample loading buffer (lane marker sample buffer) (Thermo Scientific). However, as it can be seen in lane 2 and 3 in figure 32, no difference in the molecular weight of the protein is been presented, comparing with the weight of the protein mixed with a reducing agent (lane5 and 6 in figure 32). This means, either that the purified protein is not active or it could be the protein that in figure 32 seems to have a molecular weight around 90 kDa (the band above 80 kDa). The results from this project show promising indications that BPI-like proteins studied above from G. intestinalis could belong to either the BPI or the LBP family of proteins. The only indication that these BPI-like proteins could belong to the LBP family and not to the BPI family is the pI of these BPI-like proteins which is around 5 (according to the SIB Bioinformatics Resource Portal ExPASy), which is closer to the pI of the human LBP (approximately 6.3) than the pI of the human BPI protein (approximately 9.4). However, at this point in order to gain more information and be certain in which family they belong, a series of experiments should be performed and the first of them is the optimization of the protein purification, if possible. However, the already purified protein which still contains the GST tag could also be used for further experiments since it could still be active, and the cleavage of the tag would not be necessary in this case. Further experiments that could help to distinguish on whether these proteins are BPIs or not, would be a live/dead staining of bacteria under the presence of the purified protein. This experiment would give clear results on whether the protein kills the bacteria since the permeabilized membrane would be stained while the live cells would still be intact. Also, an ELISA assay for testing the LPS binding ability of the purified protein would be extremely helpful in order to prove that these BPI-like proteins belong to the lipid-binding family proteins.

51

5. References

Adam RD. (2001). Biology of Giardia lamblia. Clin Microbiol Rev 14:447-475. Adam RD. (1991). The Biology of Giardia spp. Microbiol Rev. 55:4, 706-732. Amar CF, Dear PH, Pedraza-Diaz S, Looker N, Linnane E, and McLauchlin J. (2002). Sensitive PCR-restriction fragment length polymorphism assay for detection and genotyping of Giardia intestinalis in human feces. J. Clin. Microbiol. 40:446–452. Ankarklev J, Jerlström-Hultqvist J, Ringqvist E, Troell K, Svärd SG. (2010). Behind the smile: cell biology and disease mechanisms of Giardia species. Nature Reviews Microbiology. 8:413-422. Beamer LJ, Carroll SF and Eisenberg D. (1997). Crystal structure of human BPI and two bound phospholipids at 2.4 Ångstrom resolution. Science. 20:276(5320), 1861–1864

Beamer LJ, Carroll SF and Eisenberg D. (1998). The BPI/LBP family of proteins: A structural analysis of conserved regions. Protein Science. 7:906–914.

Cavalier-Smith T. (1993). Kingdom protozoa and its 18 phyla. Microbiol Rev. 57:953-994.

Cavalier-Smith T. (2003). Protist phylogeny and the high-level classification of protozoa. Eur. J. Protistol. 39:338-348.

Dawson SC. and House SA. (2010). Imaging and analysis of the microtubule cytoskeleton in Giardia. Methods in Cell Biology. 97:307–339.

Down TA. (2003). Computational localization of promoters and transcription start sites in mammalian genomes. 113-130. Elmendorf HG., Dawson SC., and McCaffery JM. (2003). The cytoskeleton of Giardia lamblia. Int J. Parasitol 33:3-28.

Elsbach P. (1998). The bactericidal/permeability -increasing protein (BPI) in antibacterial host defence. Journal of Leukocyte Biology. 64:14-18.

Faso C. and Hehl AB. (2011). Membrane trafficking and organelle biogenesis in Giardia lamblia: Use it or lose it. International Journal for Parasitology. 41: 471-480.

Ford BJ. (2005). The discovery of Giardia. Microscope. 53:4, 147-153. Gonzalez M., Gueguen Y., Destoumieux-Garzón D., Romestand B, Fievet J, Pugniére M., Roquet F., Escoubas JM., Vandenbulcke F., Levy O., Saune´ L., Bulet P., and Bachére E. (2007). Evidence of a bactericidal permeability increasing protein in an invertebrate, the Crassostrea gigas Cg-BPI. PNAS. 104 :45, 17759–17764.

52

Guber C., López-Bermejo A., Biarnés J., Vendrell J., Wifredo Ricart W. and Fernández-Real JM. (2006). Natural antibiotics and insulin sensitivity: The role of bactericidal/permeability-increasing protein. Diabetes. 55:216-224. Irshad M. Sulaiman and Vitaliano Cam. (2006). The biology of Giardia parasites. Foodborne Parasite. Ortega, Ynes R. 16:15-32. Ivanov AI. (2010). Giardia and Giardiasis. Bulgarian Journal of Veterinary Medicine. 13:2, 65−80. Jerlström-Hultqvist J., Ankarklev J. and G. Svard SG. (2010). Is human giardiasis caused by two different Giardia species?. Gut Microbes. 1:6, 379-382. Krasity BC., Troll JV., Weiss JP., and McFall-Ngai MJ. (2011). LBP/BPI proteins and their relatives: Conservation over evolution and roles in mutualism. Biochem Soc Trans. 39:4, 1039–1044. Lennartsson A., Pieters K., Vidovic K. and Gullberg U. (2005). A murine antibacterial ortholog to human bactericidal/ permeability-increasing protein (BPI) is expressed in testis, epididymis, and bone marrow. Journal of Leukocyte Biology. 77:369-377. Levy O. (2000). A neutrophil-derived anti-ifective molecule: bactericidal/permeability-increasing protein. Anticrobial Agents and Chemotherapy. 44:11, 2925-2931. Luján HD, Svärd SG, editors.(2011). Giardia: a model organism. 4.

Niemetz J. and Morrison DC. (1977). Lipid A as the biologically active moiety in bacterial endotoxin (LPS)- initiated generation of procogulant activity by peripheral blood leukocytes. Blood. 49:947-956.

Raoust E., Balloy V., Garcia-Verdugo I., Touqui L., Ramphal R. and Chignard M. (2009). Pseudomonas aeruginosa LPS or flagellin are sufficient to activate TLR-dependent signaling in murine alveolar macrophages and airway epithelial cells. PLoS One. 4:10, e7259.

Rockel C. and Hartung T. (2012). Systematic review of membrane components of gram-positive bacteria responsible as pyrogens for inducing human monocyte/macrophage cytokine release. Front. Pharmacol. 3: 56.

Schultz H and Weiss JP. (2007). The bactericidal/permeability-increasing protein (BPI) in infection and inflammatory disease. Clin. Chim. Acta. 384:1-2, 12-23.

Schultz H., Weiss JP., Carroll SF. and Gross W. (2001). The endotoxin-binding bactericidal/permeability-increasing protein (BPI): a target antigen of autoantibodies. Journal of Leukocyte Biology. 69: 505-512.

53

Singh SM. and Panda AK. (2005). Solubilization and refolding of bacterial inclusion body proteins. Journal of Bioscience and Bioengineering. 99:4, 303-10.

Svärd SG., Hagblom P. and Palm JE. (2001). Giardia lamblia - a model organism for eukaryotic cell differentiation. FEMS microbiology letters. 218:1, 3-7.

Thompson RCA. (2008). Giardiasis: modern concepts in control and management. Annales Nestlé. 66:23-29.

Touz MC. (2006). The unique endosomal/lysosomal system of Giardia lamblia. Molecular Regulation of Endocytosis. 11:277-298. Wolfe MS. (1992). Giardiasis. Clinical Microbiology Reviews. 5:1, 93-100.

54

6. Acknowledgments

I would like to thank my professor Staffan Svärd with all my heart for the opportunity he gave to me to be a part of his group for the last year by giving me the chance to work in this interesting project and for always being willing and finding time to help with any way possible.

I would also like to express my gratitude to my supervisor Elin Einarsson for always being positive, patient and willing to teach me everything she could.

Furthermore, I would like to express my deepest appreciation for the whole "Giardia" group for creating the best workplace I could ever ask for, full with people who care and respect each other and are always willing to spend some of their time and help anyone who need it.

A special thank you goes to my master program "buddies" for making the "being away from home" experience so much easier and of course Ariana Cabrera and Sara Campos for making the office hours so more fun.

Last but not least, I would also like to thank my friends and family for their endless love and support all the way through my studies for the last 6 years and especially for the last 2 that I live so far away from them.

55

7. Appendix

Name of Primer Direction Primer Sequence

pPAC-GL50803_102575-3xHA-C frwd Forward ACGCGTAATAATATGGTAAAAAGATACACAGC pPAC-GL50803_102575-3xHA-C rev Reverse GCGGCCGCCAAGTGAAGTACTGATTCTTCTCA

pPAC-GL50803_112938-3xHA-C frwd Forward ACGCGTCCTCATGACAGTGAAACAGAG

pPAC-GL50803_112938-3xHA-C rev Reverse GCGGCCGCCAAGCAAAGTACTGGTTTTTCT

pPAC-GL50803_112914-3xHA-C frwd Forward ACGCGTCCTCATGACAGTGAAACAGAG

pPAC-GL50803_112914-3xHA-C rev Reverse GCGGCCGCCAAGCAAAGTACTGGTTCTTCT

pPAC-GL50803_112630-3xHA-C frwd Forward ACGCGTTACTAAATTGGGCTCGACAA

pPAC-GL50803_112630-3xHA-C rev Reverse GCGGCCGCGAAAAATATCGATTCTTCTCGA

pPAC-GL50803_113165-3xHA-C frwd Forward ACGCGTAGTAAGTTAAAATACGTCCATTTA

pPAC-GL50803_113165-3xHA-C rev Reverse GCGGCCGCCAAGCGAAGTATTGGTTCTT

pPAC-GL50803_111973-3xHA-C frwd Forward ACGCGTGCCTATTTAAGCTTTTAGTGAAT

pPAC-GL50803_111973-3xHA-C rev Reverse GCGGCCGCCAGGCAAAGTAGTGATTCTTCT

pPAC-GL50803_113130-3xHA-C frwd Forward ACGCGTCAGAATGAGCGTAAGAGGTATGC

pPAC-GL50803_113130-3xHA-C rev Reverse GCGGCCGCGCAAAATACCGATTCTTCTCGA Table 2. List of all primers used for the construction of episomal vector for transfecting Giardia

intestinalis from 5' to 3' end. The restriction sites are highlighted.

Name of Primer Direction Primer Sequence

GL50803_102575 frwd Forward GATGACCCCACCTGTCCCTAT GL50803_102575 rev Reverse GCCCAGACGAGTATATGACATTC

GL50803_112938 frwd Forward GGGCTACTCTATCATTCCTGACG GL50803_112938 rev Reverse GTTATGGGTATCTCTGGAAACGC

GL50803_112914 frwd Forward CGATAACAAGATAGTGGCAGACC GL50803_112914 rev Reverse TGACCGACCAATCTGGGATAGTA

GL50803_112630 frwd Forward AATGTGCTCTTCTCTTCTGCGG GL50803_112630 rev Reverse AACTTGGTCGTTGTTAAACCCG

56

GL50803_113165 frwd Forward GATAGTGGCAGACCAGGGTGG GL50803_113165 rev Reverse TCTAACCGACCAATCTGGGACA

GL50803_111973 frwd Forward CCTCACGGGGGCACTTTC GL50803_111973 rev Reverse CAACAGTTTAGAAGCAGAGGTGGA

GL50803_113130 frwd Forward CGTGCTCTTCTCTTCTGCGG GL50803_113130 rev Reverse TGGTCATTGGCAAACCCG

Table 3. List of all primers used for the qPCR for RNA level protein expression in Giardia

intestinalis from 5' to 3' end.

Name of Primer Primer Primer Sequence

pGEX- GL50803_102575-6P-3 frwd Forward GGATCCATGCTGGTCTTATTACTTCTCTCC pGEX- GL50803_102575-6P-3 rev Reverse GCGGCCGCTCAAGTGAAGTACTGATTCTTCTCA

pGEX- GL50803_113165-6P-3 frwd Forward GGATCCATGCTGATTTCTATAGTGCTCTCCA pGEX- GL50803_113165-6P-3 rev Reverse GCGGCCGCTCAAGCGAAGTATTGGTTCTTTTC

pGEX- GL50803_113130-6P-3 frwd Forward GGATCCATGCTAATACTACTACTATTTTCTA pGEX- GL50803_113130-6P-3 rev Reverse GCGGCCGCTTAAGCAAAATACCGATTC

Table 4. List of all primers used for the construction of pGEX vector for transformation of E. coli from 5' to 3' end. The restriction sites are highlighted.