Vol. 174, No. 9JOURNAL OF BACTERIOLOGY, May 1992, p. 2771-27780021-9193/92/092771-08$02.00/0Copyright © 1992, American Society for Microbiology

Bacillus subtilis Early Sporulation Genes kinA, spoOF, and spoOAAre Transcribed by the RNA Polymerase Containing crH

MIMA PREDICH,1,2 GOPAL NAIR,1 AND ISSAR SMITH' 2*

Department of Microbiology, The Public Health Research Institute, 455 First Avenue, 1 * and Department of Microbiology,New York University Medical Center, 550 First Avenue,2 New York, New York 10016

Received 20 August 1991/Accepted 18 February 1992

The BaciUlus subtilis genes kinA (spoIIJ), spoOF, and spoOA encode components of the sporulation signaltransduction pathway. Recent work has suggested that these genes are transcribed by a minor form of RNApolymerase, Ea" (ur" is the product of spoOH, another early sporulation gene). We directly tested thishypothesis by performing in vitro transcription assays with reconstituted ErH and a set of plasmids containingthe kinA, spoOF, and spoOA promoter regions. We were able to obtain distinct transcripts of the expected sizeswith all three genes by using linearized or supercoiled templates. Furthermore, primer extension experimentsindicate that the transcription start sites for the three genes in vitro and in vivo are the same. In addition, wemeasured steady-state levels of kinA, spoOF, and spoOA mRNAs during growth in sporulation medium; all ofthem were increased at or near the beginning of the stationary phase.

Bacillus subtilis is a gram-positive soil bacterium that,under conditions of nutrient deprivation (43, 47) and highpopulation density (17), is able to commit itself to a devel-opmental pathway leading to the production of spores.Spores are morphologically and metabolically very differentfrom vegetative cells and also are more resistant to heat andorganic solvents than growing cells, so that sporulation canbe considered as a true differentiation process. Sporulationis only one of the processes that occur during the stationaryphase in B. subtilis; some of the others are the ability tomake extracellular enzymes and antibiotics, motility, andcompetence (that is, the ability to bind and take up exoge-nously added DNA). One of the major questions in the studyof sporulation concerns the initiation of this process. Whatthe environmental signals are, how they are sensed by thepresporulating cells, and how the cells respond to thosesignals are some of the most important questions concerningthe initiation of sporulation.

In the course of the last few years, it has become increas-ingly clear that many bacterial responses to environmentalconditions are governed by the so-called two-componentsystems (50, 51). Typically, the first component, now knownas the histidine kinase (HK), is autophosphorylated at aspecific histidine residue, in most cases in the carboxy-terminal portion of the protein, and this event converts HKinto a kinase that phosphorylates the second component, theso-called response regulator (RR), at a unique aspartateresidue in the amino-terminal part of the protein (50). Nota-bly, the first components (HKs) of various environmentallyresponsive two-component systems show significant aminoacid similarities in their carboxy-terminal portions, whereasthe second components (RRs) have extensive amino acidsimilarities in their amino-terminal regions (25, 38, 50, 51).This phosphorylation cascade ultimately results in the adap-tive bacterial response to changing environmental condi-tions. For example, the two-component system regulatingbacterial behavior in response to osmotic conditions iscomposed of EnvZ, an HK located in the cytoplasmicmembrane, with amino-terminal extensions into the periplas-

* Corresponding author.

mic space and the carboxy terminus extending into thecytoplasm (16). Under certain osmotic conditions, EnvZ willautophosphorylate and then transfer its phosphate group tothe cognate RR, OmpR (1, 22), which then acts as anactivator (or, in some cases, as a repressor) of transcriptionof the porin genes ompC and ompF (45). Similarly, atwo-component system governing bacterial chemotaxis iscomposed of the HK CheA (48), located in the cytoplasm,and an RR, CheY, which, upon phosphorylation by CheA(19, 41, 49), acts to change the direction of rotation of theflagella (29). Sporulation is, ultimately, a form of bacterialresponse to environmental changes; based on these similar-ities of various environmentally responsive systems in bac-teria, one could predict that a similar signal transductionmechanism is used during the initiation of sporulation.

In recent years, a number of B. subtilis genes whoseinactivation leads to the early block in sporulation have beenidentified. They include spoOA, spoOB, spoOE, spoOF,spoOH, spoOJ, and spoOK (reviewed in reference 46). Basedon their deduced amino acid sequence, SpoOA and SpoOFbelong to the family of RRs (15, 26, 55, 56, 63). Moreover,SpoOA is known to be a master regulator of all late growthprocesses (46). The spoOH gene, which has been extensivelystudied in our laboratory, codes for a minor u factor, cH (13,64), whereas the spoOK locus is actually an operon consist-ing of five genes that encode proteins with significant simi-larity to the membrane-bound oligopeptide permeases (34,40). Recent results suggest that SpoOE is a repressor ofsporulation (35). The function of the spoOJ gene product isunknown, and its deduced amino acid sequence is uninfor-mative (31). Another early sporulation gene, kinA (spoIIJ),was identified a few years ago, and its deduced amino acidsequence suggests that it belongs to the HK family ofproteins (2, 33). Work by Hoch's group has confirmed thishypothesis (33), and further studies have shown that thephosphoryl group from KinA is transferred, via SpoOF andSpoOB, to SpoOA (5). Phosphorylated SpoOA is thought toact as a transcriptional repressor of the abrB gene (52),whose product represses the early-acting sporulation genespoOH (58, 66). Moreover, SpoOA-PO4 also acts as a tran-scriptional activator of other, later-acting genes, namely,spoILA (54), spoIIE (62), and spoIIG (42), although in the

2771

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

2772 PREDICH ET AL.

latter cases, the relevant form of SpoOA (phosphorylatedversus unphosphorylated) has not been determined. It hasbeen postulated that accumulation of a critical concentrationof phosphorylated SpoOA is required for the commitment ofa cell to the sporulation pathway (5).Sequencing of the 5' untranscribed regions of the kinA,

spoOF, and spoOA genes has revealed putative promoters (2,15, 26, 27, 33, 55, 56, 63) that show significant similarity tothe promoter regions of four genes, spoVGpl (6, 64), spoILA(60), citGp2 (14, 53), and rpoDp3 (7, 37), which are known tobe transcribed by the minor form of RNA polymerase, E&rH(E stands for the core polymerase and er' is the product ofthe spoOH gene). Epistatic studies have shown that theexpression of kinA, spoOF, and spoOA genes is dependent onspoOH (2, 61). Moreover, inactivation of the spoOH geneleads to an early sporulation block (20), and none of thesporulation genes known to be transcribed by Ee (spoILAand spoVG) blocks sporulation at early stages when inacti-vated (28). Taken together, these data suggest that the earlysporulation genes kinA, spoOF, and spoOA, whose productsrepresent components of the sporulation signal transductionpathway, may be transcribed by Eo'.To address this question directly, we assayed reconsti-

tuted Ee" for its ability to transcribe kinA, spoOF, andspoOA genes in vitro. We used primer extension to confirmthat the transcription start sites used by Eo" in vitro are thesame as those observed in vivo and also to quantitatesteady-state levels of kinA, spoOF, and spoOA mRNAsduring growth in sporulation medium. Dinucleotide-primedin vitro transcription assays were used to confirm the tran-scription start sites of the three genes, as determined byprimer extension studies.

MATERIALS AND METHODS

Bacterial strains. IS414, a trpC2 pheAl derivative bearingthe pZL207 spoVG-lacZ fusion (65), was used to isolateDNA for primer extension studies. IS404, a trpC2 pheeAlstrain containing the spoOA204 mutation, was used for thepurification of the RNA polymerase core. IS591, containinga null mutation of the spoOH gene, was previously described(58).

Construction of plasmids for in vitro transcription assays.Plasmid pAN583 (kindly provided by A. Ninfa, Wayne StateUniversity) is a derivative of pTE103 (21), with the pUC19multiple cloning site positioned in front of the T7 terminator.This plasmid was used as a vector for transcription studiesso that we Would have the option of using linearized orsupercoiled templates for in vitro transcription experiments.Supercoiled templates are frequently better templates for invitro transcription (21, 57).

Plasmid pIS238 was constructed by subcloning the EcoRI(filled in)-BamHI 0.6-kb fragment from plasmid pCB1291(39), containing the spoVG promoter, into Sall (filled in)-BamHI-digested pAN583.

Plasmid pNL35 (kindly provided by A. Grossman, Mas-sachusetts Institute of Technology), containing the spoOAgene with 0.3 kb of upstream sequences, was constructed bysubcloning the 1.1-kb HindIII-EcoRI fragment from pJF1361(15) to HindIII-EcoRI-digested pUC18. To construct plas-mid pIS239 for in vitro transcription studies, pNL35 wasrestricted at the unique HindIII site, filled in with theKlenow fragment of DNA polymerase, and cut secondarilywith BglII; the 0.55-kb spoOA promoter-containing fragmentthus obtained was ligated with SmaI-BamHI-cut pAN583.The SacI-SphI fragment of plasmid pDG580 (kindly pro-

vided by Patrick Stragier), containing the entire kinA geneand 0.13 kb of upstream sequences (2), was filled in with theKlenow fragment of DNA polymerase and cloned initiallyinto SmaI-digested plasmid pKK223-3 (Pharmacia). Theresulting plasmid, with the correct orientation of the SacI-SphI fragment, pIS250, was subsequently cut with EcoRIand HindIII, and the 2.15-kb fragment, containing the entireoriginal SacI-SphI fragment, was cloned into the EcoRI-HindIII-digested pT7-1 (U.S. Biochemical Corp.) to obtainpIS2M. Finally, pIS244 was cut with AvaI, filled in with theKlenow fragment of DNA polymerase, and secondarily cutwith EcoRI; the 0.65-kb kinA promoter-containing fragmentthus obtained was cloned into the EcoRI-SmaI-cut pAN583to produce pIS240, which was used for in vitro transcriptionassays.

Plasmid pIS203 was constructed by cloning the EcoRIfragment from pIS70 (27), containing the entire spoOF gene,into pUB110. The 0.3-kb EcoRI-PstI spoOF promoter-con-taining fragment from pIS203 was then subcloned into theEcoRI-PstI-cut pAN583 to obtain pIS241, which was usedfor in vitro transcription studies.

Isolation of RNA polymerase core, cH, and M. B. subtilisRNA polymerase core was isolated by a combination ofheparin-agarose (11), Sephacryl, DNA-cellulose (23), andphosphocellulose (44) chromatography steps. (rH and eAwere prepared as previously described (8, 37) by usingplasmid pZOH7 (kindly provided by J. Healy and R. Losick,Harvard University) for e preparation and plasmid pCD2(kindly provided by R. H. Doi, University of California,Davis) for orA preparation.

In vitro transcription assays. Reconstitutions of Ee" andEoJ' were done by mixing RNA polymerase core with eH orrA as described previously (8, 37), except that the incubationtime was 30 min instead of 15 min. In vitro transcriptionassays were performed as described previously (58). Fordinucleotide-primed in vitro transcription assays, the con-centration of nonradioactive ribonucleoside triphosphateswas lowered 10-fold to give a final concentration of 6 ,M,and the indicated dinucleotides were added to the preincuba-tion mix at 250 p,M.The templates used were supercoiled or PstI-linearized

plasmids pAN583, pIS238, pIS239, pIS240, and pIS241 (seeabove). With linearized plasmids, the expected lengths oftranscripts were 120 nucleotides (nt) for pIS238, 280 nt (withEu') and 430 nt (with EcA) for pIS239, 530 nt for pIS240,and 150 nt for pIS241, whereas with supercoiled templatesall transcripts were expected to be 290 nt longer. After thecompletion of transcription reactions, samples were passedthrough prespun RNA Quick-Spin G-50 columns (Boeh-ringer) to remove unincorporated radioactive nucleotides.They were then mixed with the running dye and heated for 3min at 100°C. Samples were electrophoresed on polyacryl-amide gels and autoradiographed as described previously(58).For the determination of the in vitro transcription start

sites, transcription reaction mixtures four times the normalsize were incubated with nonradioactive ribonucleosidetriphosphates and supercoiled templates. Heparin was omit-ted, transcriptions were allowed to proceed for 2 h instead of10 min (as in the assay referred to above [58]), and thesamples were immediately treated twice with phenol, pre-cipitated with ethanol, and treated with RQI DNase(Promega). After another phenol extraction and ethanolprecipitation, the RNA was used for primer extensions (seebelow).RNA isolation and primer extensions. Total RNA was

J. BACTERIOL.

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TRANSCRIPTIONAL REGULATION OF EARLY spo GENES 2773

A c

1 2 3 456 1 2 34 5 6 1 2 3 4 5 6

FIG. 1. kinA, spoOA, and spoOF RNA levels during growth.Total RNA was isolated from the wild-type strain, IS414, grown inNSM, at 70 and 40 min before the end of vegetative growth (To) andat To, T,1, and T12 (lanes 1 through 5, respectively) and from theAspoOH (IS591) strain at To (lane 6). Samples of 10 p,g of RNA fromeach time point were subjected to primer extension (see Materialsand Methods). The primers used were kinA-I (A), spoOA-I (B), andspoOF-I (C). The expected sizes of the primer extension productswere 115 and 265 nt (with spoOA-I) and 123 nt (with kinA-I andspoOF-I). DNA size standards run on the same gels (not shown)indicated that the observed primer extension products were of thecorrect size.

isolated from cultures growing in nutrient sporulation me-

dium (NSM) as described before (27), and concentrationswere estimated by the orcinol reaction (12). Primer exten-sions were performed as described previously (24) with 10,ug of RNA per reaction, which is in the linear range of theprimer extension RNA quantitation method (58).The primers used were complementary to kinA, spoOA,

and spoOF mRNAs; their sequences were 5' GAG GCCAAG ACT GCA TGA ATA TCG GTT TTT 3' (kinA-I); 5'TTC TAT ATA TTC ACT TAA CAG GCT TAC CAG 3'(spoOA-I); 5' ATA CCC TCT AAA AAA ATC ATA ATCACC AAT 3' (spoOA-II), and 5' GCC TTC TITTl ATT GAACAC TTC ATT TAG CAA 3' (spoOF-I). Primers specific forkinA and spoOF were complementary to the sequences frompositions +123 to +94 of corresponding mRNAs, whereasthe spoOA-I primer was complementary to the +115 to +86region of the spoOA mRNA (transcribed from the spoOAp2)and spoOA-II primer was complementary to the +133 to+104 sequence of the spoOA mRNA transcribed from theorA-like spoOApl. (In all cases, + 1 refers to the transcriptionstart site.) The same primers were also used for the double-stranded dideoxy sequencing of plasmids pIS239, pIS240,and pIS241.

RESULTS

Expression of kinA, spoOF, and spoOA mRNAs duringgrowth and determination of their start sites. To monitorsteady-state levels of kinA, spoOF, and spoOA mRNAsduring growth in NSM, we isolated total RNA from a

wild-type strain (IS414) and from an isogenic sti ain contain-ing a deletion of the spoOH gene (IS591) at different timepoints. Samples of 10 ,ug of each RNA were used in primerextension experiments to quantitate RNA levels (Fig. 1).

Steady-state levels of kinA mRNA show a maximum an

hour before the stationary phase (To) and a decrease after-ward. This pattern of expression is consistent with the earlyrole for KinA in sporulation.The levels of spoOF mRNA are slightly different from

those of kinA: the level is fairly low at the mid-log phase,increases at the late-log and early stationary phases (TO), andthen decreases. This pattern ofspoOF expression is, as in the

case of kinA, consistent with its requirement for events thatoccur early in the sporulation process.

Finally, during the mid-log phase spoOA mRNA is ex-pressed at significant levels from two promoters: an up-stream or'-like promoter, Pl, and a downstream e'-likepromoter, P2* Similar results with S1 nuclease protectionhave been obtained by other workers (9). Subsequently,spoOA expression fromp, decreases and is almost undetect-able by the end of vegetative growth (TO), whereas theexpression from P2 is substantially increased at the late-logand early stationary phases, with a maximum at To and adecrease after T+1.Moreover, in the AspoOH strain, spoOA mRNA tran-

scribed from the or'likep, promoter is still observed, but nokinA, spoOF, or spoOA (transcribed from the er'-like P2promoter) mRNAs are detectable, thus providing additionalevidence for the hypothesis that E1 transcribes thesegenes.To map transcriptional start sites of the spoOA (for both

promoters), kinA, and spoOF genes, we performed primerextensions on in vivo RNA and electrophoresed these ex-tension products, along with double-stranded dideoxy se-quencing ladders of the plasmids pNL35, pIS244, andpIS203. The results of this experiment (Fig. 2), indicate thatthe spoOAp1 and spoOAp2 transcription start sites are slightlydifferent from those postulated previously (9, 15), althoughthe or factors responsible for their utilization were correctlyidentified as or' and e1, respectively (9). We also confirmedthe transcriptional start site for spoOFp2, which had beendetermined previously (27). However, we found no evidenceto support the existence of the previously reported upstreamor'-like spoOFpl promoter. The discrepancy in the two setsof experiments could be due to the fact that we utilizedprimer extension assays in the studies reported here, with 10,ug of RNA. The previous experiments, with S1 nucleaseprotection, showed a minor RNA species initiating at therA-like Pi promoter, only with 150 ,ug of RNA (27). How-

ever, we did not observe any transcript corresponding to thispromoter when spoOF was transcribed in vitro with Eor.The sequences of spoOAp2, spoOFp2, and kinA promoters,together with the sequences of other Ee"-transcribed genesand the consensus Ee' promoter, are shown in Fig. 3 alongwith the transcriptional start sites determined from the datain Fig. 2. The sequence of spoOApl, taken from reference9, is 5' CCCTCTTCACTTCTCAGAATACATACGGTAAAATATACAA 3', where the -35 and -10 promoterregions and the transcription start site, as determined above,are underlined. The actual initiation nucleotide remainsundetermined with spoOApl, since we were unable to getgood in vitro primer extension or dinucleotide priming datawith this promoter (see below).To provide further evidence for Ee' transcription of

spoOF, the conserved G at position -13 relative to thetranscriptional start site shown in Fig. 3 was changed to an Aresidue by site-directed mutagenesis. The mutated promoterwas fused with a lacZ construct (3), which was then inte-grated into the B. subtilis chromosome. The mutation causeda several-hundredfold decrease in spoOF expression (datanot shown).An identical change in the spoVG promoter had a similar

effect on expression of this gene (64). However, we did notobserve allele-specific suppression with spoOH81 and theG-to-A mutation, as reported previously for the homologousmutation in the spoVG promoter (10, 64). This may haveresulted from the contexts in which the essential G's in thetwo promoters are located.

VOL. 174, 1992

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

2774 PREDICH ET AL.

n GATC PD A

TTGTACAT

+1 CGT

A|C

G A T C P'- A

GTATGATc

+1 CATTTTC/AG

DATGTATGTT

+1 ATGAcGAAT

FIG. 2. Transcriptional start sites of spoOA, kinA, and spoOF genes. The start sites were determined by primer extensions (see Materialsand Methods) on in vivo RNA isolated at To from strain IS414 (wild type) grown in NSM with spoOA-II (A), spoOA-I (B), kinA-I (C), andspoOF-I (D) as primers. The same primers were used in the dideoxy method of sequencing (the adjacent G, A, T, and C lanes) ondouble-stranded DNA with plasmids pNL35 (A and B), pIS244 (C), and pIS203 (D). Transcriptional start sites are indicated as +1. Thesequences shown are complementary to the sense strand and were read directly from the gels.

In vitro transcription of kinA, spoOF, and spoOA by recon-stituted Ed". Next, we assayed reconstituted Eor' and EcrAfor their ability to transcribe the kinA, spoOF, and spoOAgenes in vitro. First, we tested PstI-linearized pIS238,pIS239, pIS240, and pIS241 (containing promoters forspoVG, spoOA, kinA, and spoOF, respectively) with E alone,aH alone, Ee, and EoA (Fig. 4). The expected distincttranscripts of the correct sizes were observed when PstI-linearized pIS238 (120 nt), pIS239 (280 nt), pIS240 (530 nt),and pIS241 (150 nt) were used as templates for Ecr but notwhen E alone, EoA, or e alone was used. Furthermore, aunique transcript of the expected size for the E&L spoOApromoter (430 nt) was observed when PstI-linearized pIS239was used as a template for EoA. No transcripts wereobserved with EoiA and PstI-linearized pIS238, pIS240, andpIS241. Similarly, pAN583 (the vector) showed no specifictranscripts when incubated with Ea' or EcrA (data notshown). Similar results were obtained with supercoiledtemplates, except that each transcription was 290 baseslonger, as expected (data not shown). These results repre-

-35 REGION SPACER

sent the strongest evidence so far that these three genes areindeed transcribed by the Eo' form of RNA polymerase.Comparison of in vivo and in vitro transcriptional start

sites. To compare in vivo and in vitro transcriptional startsites of kinA, spoOF, and spoOA (forp2 promoter) genes, weperformed primer extensions on in vivo and Ecr-made invitro RNAs alongside double-stranded dideoxy sequencingladders of the plasmids pIS239, pIS240, and pIS241. In allcases (Fig. 5), in vivo and in vitro transcription start sites areidentical. However, the transcription start site for the Eu"spoOA promoter, as determined from this experiment, isslightly different from that determined in the experimentshown in Fig. 2. Instead of the CATGTAj start determinedin that experiment (Fig. 2B), the + 1 seems to be at theupstream G, i.e., CAT-iTAG in the experiment illustrated inFig. 5A. With kinA, the start site determined in the experi-ment shown in Fig. 2C was TCATACTAGG. In the experi-ment of Fig. SB, the start site is at the preceding A, i.e.,TCATACTAGG. The start site of spoOF in both sets ofexperiments (Fig. 2D and 5C) is at the same position:

-10 REGION

GCT T CAGAAAAAATCGTGGGC TTflAATGAGGGATGG A

AAT TTTTTGTGTCATTGGCGAA TT-CATTCCGTCGAAATCAG_T ACATAGGATATAA-CAA AA AGGAAAATCAAAC-AAG GTA ATGCGGTTTTGT *CGA GAATACTCATTTTCTAGCC

GA T A CA C TMACT CT T CT TQ^A T G A T C T A T TOACT CAT TWT T T T C A A~tC T C AAT A A A C A T G T AWA T A C T A GA

CONSENSUS GATTETAA *--TG*T*T*.. A*TA*A -

FIG. 3. Promoter sequences of the genes transcribed by Ee' and the consensus Eu'' promoter. Sequences are from the followingreferences: citGp2 (14), rpoDp3 (7), spoVGpl (4), spoIL4 (59), spoOFp2 (27), spoOAp1 (15, 26), kinA (2, 33), andftsAp2 (16a, 36). Expressionof all promoters has been shown to be dependent on intact spoOH in vivo (2, 7, 14, 59, 61, 65). Transcription from the citGp2, rpoDp3,spoVGpl, and spoIL4 promoters by Ee has been demonstrated in vitro (6, 7, 53, 60). The transcriptional start sites for spoOAp2, spoOFp2,and kinA were determined in vivo and in vitro in this study (Fig. 2 and 6). Bases are shaded when 7 of 8 nt are identical. In the consensus

sequence, non-shaded bases indicate that at least four of eight promoters contain this base at this position. The ultimate 3' nucleotide (shaded)indicates the position of the initiating nucleotide from the above-mentioned references and from the data in Fig. 2 for kinA, spoOF, and spoOA.

P CT AGAcT

TTATAT

+1 GTTTTC

spoVG -P1rpoD -P3cOG P2

ftsA 4P2spof -P2spoA -P2SPO_J

J. BACTERIOL.

ro*

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TRANSCRIPTIONAL REGULATION OF EARLY spo GENES 2775

2492

369

246

A492

369

246

123

1 2 3 4 1 2 3

FIG. 4. In vitro transcription assays on linearized templates. B.subtilis core RNA polymerase alone (lane 1 in all three panels andlane 5 in panel A) or mixed with &' (lane 3 in all three panels andlane 7 in panel A) or with cr& (lanes 4 and 8 in panel A, lane 4 in panelB, and lane 2 in panel C) or er alone (lanes 2 and 6 in panel A andlane 2 in panel B) was incubated with PstI-linearized templates for10 min at 37°C. Transcriptions were initiated by the addition ofribonucleoside triphosphate mix, including [a-32P]CTP. After 1 minat room temperature, heparin was added, incubation was continuedfor 10 min at 37°C, and samples were chased nonradioactivenucleotides for 5 min. The radioactive transcripts were purified fromunincorporated [a-32P]CTP on G-25 RNA columns (Boehringer) asdescribed in Materials and Methods and analyzed by acrylamide gelelectrophoresis (6% acrylamide-urea) and then autoradiography.Templates (lanes): (A) 1 through 4, PstI-linearized pIS238; (A) 5through 8, PstI-linearized pIS239; (B) 1 through 4, PstI-linearizedpIS240; (C) 1 through 3, PstI-linearized pIS241. The band in lane 7of panel A, comigrating with the band in lane 8 of the same panel, ismost likely due to the presence of low levels of eA in the B. subtilisRNA polymerase core preparation. A band with the same electro-phoretic mobility was also observed in lane 5 (RNA polymerase corealone) after longer exposure. The migrations ofDNA size standards(123-bp ladder) are indicated. When the vector, pAN538, wasincubated with core polymerase and 0A or cr', no transcripts wereobserved (data not shown).

TACATACAAIA. This is within 1 nt of the previouslyreported +1 position of the Eo'-like spoOF promoter, thedownstream A, as determined by in vivo Si nuclease map-ping (27). A possible explanation for the slight differences inthe primer extension experiments may be that the transcrip-tion actually initiates at a few different, neighboring bases inclose proximity to the proposed transcription start site. Totest this hypothesis and also to confirm the results of theprimer extension experiments, we performed a set of dinu-cleotide-primed in vitro transcription assays (see Materialsand Methods) with E&Z and PstI-linearized pIS239, pIS240,and pIS241 with dinucleotides corresponding to those foundin the vicinity of the postulated transcription start sites.

In these experiments, the normal level of ribonucleosidetriphosphates was reduced 10-fold, so that little or notranscription would be observed (compare Fig. 6A, lanes 1and 2, and 6B, lanes 2 and 3). Various dinucleotides wereadded at a concentration that would allow transcription if afunctional dinucleotide were present. The results of thedinucleotide priming with the spoOA promoter (Fig. 6A)show that UpA is the best primer and that ApG and GpC aremoderately effective. This suggests that the initiating nucle-otides are within the sequence GTAGC, which contains thetwo G's that were possible initiating nucleotides in theexperiments shown in Fig. 2B and 5A. We have no expla-nation for the fact that UpC also primes synthesis (Fig. 6A,

AT C 1 2 CGATC1 2_-i _ t t ,>tt:.|2

FIG. 5. Comparison of the in vivo and in vitro transcription startsites of spoOA, kinA, and spoOF RNAs. B. subtilis RNA polymerasecore mixed with &' was incubated with supercoiled plasmids pIS239(A), pIS240 (B), and pIS241 (C) for 10 min at 37°C, and thennonradioactive ribonucleoside triphosphate mix was added. Theincubations were continued for 2 h at 37°C, phenol extracted,ethanol precipitated, purified on G-25 RNA columns (Boehringer),treated with RQI DNase (RNase free; Promega) for 15 min on ice,phenol extracted, ethanol precipitated, and, together with in vivoRNA, subjected to primer extension analysis with spoOA-I (A),kinA-I (B), and spoOF-I (C) as primers. The primer extensionproducts obtained with in vitro-synthesized RNAs (lanes 1) and invivo RNAs (lanes 2) are shown together with the dideoxy-sequenc-ing reactions with the same primers performed on double-strandedDNAs of plasmids used for in vitro transcriptions: A, pIS239 (spoOApromoter); B, pIS240 (kinA promoter); C, pIS241 (spoOF promoter).In panel A, two identical sequencing reactions are shown on thesides to illustrate the uneven migration of the sequencing reactionsamples.

lane 3), because there are no TpC sequences in the vicinityof the + 1 site of spoOAp2. spoOF dinucleotide primingstudies (Fig. 6B) show that UpA is a much better primer thanis ApU (lanes 5 and 4, respectively), suggesting that theactual start site is TACATACAATA, which was the resultobtained with in vivo S1 nuclease mapping (27). Dinucle-otide priming studies with the kinA promoter indicate thatUpA is the best primer, which is consistent with an initiatingnucleotide of TAGG (data not shown).The results of the studies (Fig. 6) are consistent with the

idea that the transcription does indeed initiate at a fewdifferent bases close to the putative transcription start site,support the assignment of transcription start sites within 1 or2 bases as determined by primer extension experiments,and, in the case of spoOF, agree with the transcriptional startsite determined by other methods.

DISCUSSION

The results presented here suggest strongly that earlysporulation genes kinA, spoOA, and spoOF are transcribed bya minor form of RNA polymerase, Eer. Consistent with thetime course of expression of the spoOH mRNA and itsprotein product, c (58), steady-state levels of spoOA andspoOF mRNAs increase at the late-log and early stationaryphases, whereas the expression of kinA mRNA follows aslightly different pattern, the main difference being an earlier(T_1) peak in its levels. This difference is not surprising,since the levels of mRNA of other Eoa'-transcribed genes,spoIL4, spoVGp1, and citGp2 (53), are different from eachother and from the levels of kinA, spoOF, and spoOA RNAs.This difference in the patterns of RNA accumulation sug-gests that expression of the genes of the E&e regulon iscontrolled by factors in addition to e" levels (18, 58).

Inactivation ofspoOH results in an early sporulation block

VOL. 174, 1992

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

2776 PREDICH ET AL.

A

1 2 3 4 5 6 7 8 9 10 11 12 13

- 6OOnt

- 300nt

200nt

- 200nt

1 OOnt

1 2 .3 4 5 6 7 8 9 10 11 12 13

FIG. 6. Dinucleotide-primed in vitro transcription assays. Themigration of DNA size standards (100-bp ladder) is indicated (lanes13). (A) B. subtilis core RNA polymerase mixed with e (lanes 1through 12) was incubated with the PstI-linearized pIS239 in theabsence of dinucleotides (lanes 1 and 2) or in the presence of 250 F.Mdinucleotides UpC (lane 3), CpA (lane 4), ApU (lane 5), UpG (lane6), GpU (lane 7), UpA (lane 8), ApG (lane 9), GpC (lane 10), ApA(lane 11), and GpG (lane 12) for 10 min at 37°C. Transcriptions were

initiated by the addition of [a-32P]CTP and undiluted (lane 1) or

10-fold diluted (lanes 2 through 12) ribonucleoside triphosphatemixes to a final concentration of 60 or 6 ,uM, respectively. After 1min at room temperature, heparin was added; incubations werecontinued for 10 min at 37°C, and then samples were chased withnonradioactive nucleotide for 5 min. The radioactive transcriptswere purified from unincorporated [a-32P]CTP on G-25 RNA col-umns (Boehringer) as described in Materials and Methods andanalyzed by acrylamide gel electrophoresis (6% acrylamide-urea)and then autoradiography. (B) B. subtilis core RNA polymerasealone (lane 1) or mixed with aA (lane 2) or &e (lanes 3 through 12)was incubated with PstI-linearized pIS241 in the absence of dinu-cleotides (lanes 1 through 4) or in the presence of 250 ,uM dinucle-otides ApU (lane 5), UpA (lane 6), ApC (lane 7), CpA (lane 8), ApA(lane 9), CpU (lane 10), UpG (lane 11), and GpC (lane 12) for 10 minat 37°C. Transcriptions were initiated by the addition of undiluted(lanes 1 through 3) or 10-fold-diluted (lanes 4 through 12) ribonucle-oside triphosphate mixes to give final concentrations of 60 and 6 p.Mrespectively, and equal concentrations of [a-32P]CTP. The remain-der of the reaction was done as described for panel A. The exposureof lanes 1 through 3 is about 3 times longer than that of the remaining10 lanes.

(20), whereas neither of the previously described Ee'-transcribed sporulation genes (spoIIA, spoVG [28]) blockssporulation that early when inactivated. These data, togetherwith epistatic studies (2, 61) and sequence information (2, 15,26, 33, 55, 56, 63), suggested that some early sporulationgenes are transcribed by E&; based on the data presentedhere, we now know three such genes.Based on the studies of spoOH, kinA, spoOA, and spoOF

expression (2, 9, 27, 58, 61), recent experiments implicatinga spoOA requirement for transcription of stage II genesspoIlA (59) and spoIIG (42), and the results presented in thiscommunication, the following scenario for the early sporu-lation events seems plausible. During exponential growth,SpoOA is present in relatively low amounts and mainly in theunphosphorylated form, which enables AbrB to repressspoOH expression. During late phases of logarithmic growthand the early stationary phase, nutrient deprivation in the

medium is sensed intracellularly (by an unknown mecha-nism) by KinA, which is expressed during the vegetativephase. The immediate result of this event is the activation ofKinA by autophosphorylation. This activation allows KinAto function as a kinase of SpoOF (33). Subsequently, thephosphate is transferred from SpoOF, via SpoOB, to SpoOA(5). Phosphorylated SpoOA then presumably acts to repressthe synthesis of AbrB, a repressor of spoOH expression (58,66). Maximum spoOH expression requires spoOA, spoOB,spoOF, and kinA (46a, 58) and presumably reflects therequirement for spoOA-PO4 to downregulate abrB. Sincetranscription of spoVG, also repressed by AbrB (66), doesnot require kinA (12a), it is possible that other kinases orother modes of SpoOA phosphorylation not requiring ahistidine kinase (28a) also play a role in the activation ofspoOA for AbrB downregulation. In the absence of AbrB,spoOH expression becomes derepressed, which is probablyrequired for the increased expression of the genes of the EX'regulon (including kinA, spoOA, spoOF, and spoIlA). Recentexperiments have shown that the ftsAIZ operon has aEe1-like promoter that is turned on at the beginning ofsporulation and requires spoOH (16a, 36). Thus, Ee' is alsoessential for stage II events. The differential expression ofthe genes belonging to the EaH regulon, as mentionedabove, suggests that some other factors, possibly activatorsand/or repressors, act in addition to ;R to regulate theirexpression. In addition, posttranscriptional regulation of &Hlevels may also play a role (18). A good candidate for apositive transcription factor is SpoOA, which is now knownto be required as a transcriptional activator of at least twostage II genes, spoILA (54) and spoIIG (42), and it has alsobeen shown to bind to the promoter region of the spoIIEgene (62). In addition, results of epistatic studies indicatethat, unlike the case with spoVG (66), SpoOA may act as atranscriptional activator ofspoOF and spoOA genes (3, 61). Inall cases, the form of SpoOA (phosphorylated versus unphos-phorylated) involved in transcriptional activation is notknown, although it has been reported that SpoOA-PO4 isrequired to activate spoIL4 transcription (54). Therefore, theresult of the flow of phosphate from KinA to SpoOA isincreased expression of spoOH, spoOF, and, most impor-tantly, spoOA; their increased expression is probably re-quired for the proper transcription of stage II genes andultimately for the commitment of the cell to sporulation.

This transphosphorylation cascade, ultimately resulting inthe high levels of transcriptional activator, is, in manyaspects, similar to the nitrogen assimilation (Ntr) two-com-ponent system in Escherichia coli (30). First, it is activatedby nitrogen deprivation, whereas sporulation can be trig-gered by the same signal (43, 47). Second, signaling involvesa transfer of the phosphate group, ultimately leading to theactivation of a transcriptional regulator: NRI-P in case of thenitrogen assimilation system (32) and SpoOA-P (5) in sporu-lation. Third, the targets for these activators are often thegenes transcribed by minor forms of RNA polymerase: Eu54in the nitrogen assimilation system (30) and Ea& in sporula-tion. Fourth, in both systems, phosphorylation of RRs, NRI,and SpoOA ultimately results in the increase in their ownexpression. In the case of NRI-P, this autocatalytic loop isdirect, namely, NRI-P directly activates the transcription ofits own gene (30), whereas SpoOA-P acts indirectly byrepressing the spoOH repressor, AbrB (52, 58), but may alsofunction directly, like NRI-P, as a transcriptional activatorof its own gene (61). Finally, in both systems increasedlevels of the activated transcriptional regulators serve toincrease the expression of the downstream genes, which

J. BACTE1RIOL.

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TRANSCRIPTIONAL REGULATION OF EARLY spo GENES 2777

require higher levels of these proteins, i.e., the stage II genes

in the case of SpoOA-P and the Ntr regulon in the case ofNRI-P (30). This comparison further strengthens the obser-vation about high conservation of the function, as well as thestructure, of the bacterial two-component systems used toregulate different bacterial responses to changes in theexternal environment.

ACKNOWLEDGMENTS

We thank Jeannie Dubnau, David Dubnau, Uma Bai, Ines Man-dic-Mulec, and Charles Moran, Jr., for helpful discussions. AnnabelHoward provided expert secretarial assistance. We thank CharlesMoran, Jr., and A. L. Sonenshein for gifts of dinucleotides.

This work was supported by Public Health Service grantGM19693 to I.S. from the National Institutes of Health. M.P. was

supported by Public Health Service training grant 5T32-AI67180from the National Institutes of Health, awarded to the Departmentof Microbiology, New York University Medical Center. Computeranalysis was performed on a VAX 11/750 purchased with funds fromNational Science Foundation grant PCM-8313516, awarded to thePublic Health Research Institute.

REFERENCES1. Aiba, H., T. Mizuno, and S. Mizushima. 1989. Transfer of

phosphoryl group between two regulatory proteins involved inosmoregulatory expression of the ompF and ompC genes inEscherichia coli. J. Biol. Chem. 264:8563-8567.

2. Antoniewski, C., B. Saveili, and P. Stragier. 1990. The spoIIJgene, which regulates early developmental steps in Bacillussubtilis, belongs to a class of environmentally responsive genes.

J. Bacteriol. 172:86-93.3. Bai, U., M. Lewandoski, E. Dubnau, and I. Smith. 1990.

Temporal regulation of the Bacillus subtilis early sporulationgene spoOF. J. Bacteriol. 172:5432-5439.

4. Banner, C. D. B., C. Moran, Jr., and R. Losick. 1983. Deletionanalysis of a complex promoter for a developmentally regulatedgene from Bacillus subtilis. J. Mol. Biol. 168:351-365.

5. Burbulys, D., K. Trach, and J. A. Hoch. 1991. Initiation ofsporulation in B. subtilis by a multicomponent phosphorelay.Cell 64:545-552.

6. Carter, H. L., III, and C. P. Moran, Jr. 1986. New RNApolymerase a factor under spoO control in Bacillus subtilis.Proc. Natl. Acad. Sci. USA 83:9438-9442.

7. Carter, H. L., III, L. Wang, R. H. Doi, and C. P. Moran, Jr.1988. rpoD operon promoter used by o-'-RNA polymerase inBacillus subtilis. J. Bacteriol. 170:1617-1621.

8. Chang, B.-Y., and R. H. Doi. 1990. Overproduction, purifica-tion, and characterization of Bacillus subtilis RNA polymeraseoA factor. J. Bacteriol. 172:3257-3263.

9. Chibazakura, T., F. Kawamura, and H. Takahashi. 1991. Dif-ferential regulation of spoOA transcription in Bacillus subtilis:glucose represses promoter switching at the initiation of sporu-

lation. J. Bacteriol. 173:2625-2632.10. Daniels, D., P. Zuber, and R. Losick. 1990. Two amino acids in

an RNA polymerase or factor involved in the recognition ofadjacent base pairs in the -10 region of a cognate promoter.Proc. Natl. Acad. Sci. USA 87:8075-8079.

11. Davison, B. L., T. Leighton, and J. C. Rabinowitz. 1979.Purification of Bacillus subtilis RNA polymerase with heparin-agarose. J. Biol. Chem. 254:9220-9226.

12. Dawson, R. M. C., D. C. Elliott, W. H. Elliott, and K. M. Jones.1959. Data for biochemical research. Oxford University Press,Oxford.

12a.Dubnau, E., and I. Smith. Unpublished data.13. Dubnau, E., J. Weir, G. Nair, H. L. Carter III, C. P. Moran, Jr.,

and I. Smith. 1988. Bacillus sporulation gene spoOH codes foroy3O (ar"). J. Bacteriol. 170:1054-1062.

14. Feavers, I. M., V. Price, and A. Moir. 1988. The regulation ofthe fumarase (citG) gene of Bacillus subtilis 168. Mol. Gen.Genet. 211:465-471.

15. Ferrari, F. A., K. Trach, D. LeCoq, J. Spence, E. Ferrari, and

J. A. Hoch. 1985. Characterization of the spoOA locus and itsdeduced product. Proc. Natl. Acad. Sci. USA 82:2647-2651.

16. Forst, S., and M. Inouye. 1988. Environmentally regulated geneexpression for membrane proteins in Escherichia coli. Annu.Rev. Cell Biol. 4:21-42.

16a.Gonzy-Treboul, G., C. Karmazyn-Campelli, and P. Stragier.Developmental regulation of transcription of the Bacillus sub-tilisftsAZ operon. J. Mol. Biol., in press.

17. Grossman, A. D., and R. Losick. 1988. Extracellular control ofspore formation in B. subtilis. Proc. Natl. Acad. Sci. USA85:4369-4373.

18. Healy, J., J. Weir, I. Smith, and R. Losick. 1991. Posttranscrip-tional control of a sporulation regulatory gene encoding tran-scription factor &e in Bacillus subtilis. Mol. Microbiol. 5:477-487.

19. Hess, J. F., R. B. Bourret, and M. I. Simon. 1988. Histidinephosphorylation and phosphoryl group transfer in bacterialchemotaxis. Nature (London) 336:139-143.

20. Hoch, J. A., and J. L. Mathews. 1973. Chromosomal location ofpleiotropic negative sporulation mutations in Bacillus subtilis.Genetics 73:215-228.

21. Hunt, T. P., and B. Magasanik. 1985. Transcription of glnA bypurified Escherichia coli components: core RNA polymeraseand the products ofglnF, glnG and glnL. Proc. Natl. Acad. Sci.USA 82:8453-8457.

22. Igo, M. M., A. J. Ninfa, and T. J. Silhavy. 1989. A bacterialenvironmental sensor that functions as a protein kinase andstimulates transcriptional activation. Genes Dev. 3:598-605.

23. Johnson, C. W., C. P. Moran, Jr., and R. Losick. 1983. TwoRNA polymerase sigma factors from Bacillus subtilis discrimi-nate between overlapping promoters for a developmentallyregulated gene. Nature (London) 302:800-804.

24. Kenney, T. J., P. A. Kirchman, and C. P. Moran, Jr. 1988. Geneencoding o` is transcribed from a e-A.like promoter in Bacillussubtilis. J. Bacteriol. 170:3058-3064.

25. Kofoid, E. C., and J. S. Parkinson. 1988. Transmitter andreceiver modules in bacterial signalling proteins. Proc. Natl.Acad. Sci. USA 85:4981-4985.

26. Kudoh, J., T. Ikeuchi, and K. Kurahashi. 1985. Nucleotidesequences of the sporulation gene spoOA and its mutant genes ofBacillus subtilis. Proc. Natl. Acad. Sci. USA 82:2665-2668.

27. Lewandoski, M., E. Dubnau, and I. Smith. 1986. Transcriptionalregulation of the spoOF gene of Bacillus subtilis. J. Bacteriol.168:870-877.

28. Losick, R., P. Youngman, and P. J. Piggot. 1986. Genetics ofendospore formation. Annu. Rev. Genet. 20:625-669.

28a.Lukat, G. S., W. R. McCleary, A. M. Stock, and J. B. Stock.1992. Phosphorylation of bacterial response regulator proteinsby low molecular weight phosphodonors. Proc. Natl. Acad. Sci.USA 89:718-722.

29. Macnab, R. M. 1987. Motility and chemotaxis, p. 732-759. InF. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M.Schaechter, and H. E. Umbarger (ed.), Escherichia coli andSalmonella typhimurium: cellular and molecular biology. Amer-ican Society for Microbiology, Washington, D.C.

30. Magasanik, B. 1988. Reversible phosphorylation of an enhancerbinding protein regulates the transcription of bacterial nitrogenutilization genes. Trends Biochem. Sci. 13:475-479.

31. Mysliwiec, T. H., J. Errington, A. B. Vaidya, and M. G.Bramucci. 1991. The Bacillus subtilis spoOJ gene: evidence forinvolvement in catabolite repression of sporulation. J. Bacte-riol. 173:1911-1919.

32. Ninfa, A. J., and B. Magasanik. 1986. Covalent modification oftheglnG product, NR,, by the glnL product, NR,,, regulates thetranscription of the glnALG operon in Escherichia coli. Proc.Natl. Acad. Sci. USA 83:5909-5913.

33. Perego, M., S. P. Cole, D. Burbulys, K. Trach, and J. A. Hoch.1989. Characterization of the gene for a protein kinase whichphosphorylates the sporulation-regulatory proteins SpoOA andSpoOF of Bacillus subtilis. J. Bacteriol. 171:6187-6196.

34. Perego, M., C. F. Higgins, S. R. Pearce, M. P. Gallagher, andJ. A. Hoch. 1991. The oligopeptide transport system of Bacillussubtilis plays a role in the initiation of sporulation. Mol. Micro-

VOL. 174, 1992

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

2778 PREDICH ET AL.

biol. 5:173-185.35. Perego, M., and J. A. Hoch. 1991. Negative regulation of

Bacillus subtilis sporulation by the spoOE gene product. J.Bacteriol. 173:2514-2520.

36. Piggot, P. J. Personal communication.37. Qi, F.-X., and R. H. Doi. 1990. Localization of a second sigH

promoter in the Bacillus subtilis sigA operon and regulation ofdnaE expression by the promoter. J. Bacteriol. 172:5631-5636.

38. Ronson, C. W., B. T. Nixon, and F. M. Ausubel. 1987. Con-served domains in bacterial regulatory proteins that respond toenvironmental stimuli. Cell 49:579-581.

39. Rosenbluh, A., C. D. B. Banner, R. Losick, and P. C. Fitz-James.1981. Identification of a new developmental locus in Bacillussubtilis by construction of a deletion mutation in a cloned geneunder sporulation control. J. Bacteriol. 148:341-351.

40. Rudner, D. Z., J. R. LeDeaux, K. Ireton, and A. D. Grossman.1991. The spoOK locus of Bacillus subtilis is homologous to theoligopeptide permease locus and is required for sporulation andcompetence. J. Bacteriol. 173:1388-1398.

41. Sanders, D. A., B. L. Gillece-Castro, A. M. Stock, A. L.Burlingame, and D. E. Koshland. 1989. Identification of the siteof phosphorylation of the chemotaxis response regulator pro-tein, CheY. J. Biol. Chem. 264:21770-21778.

42. Satola, S., P. A. Kirchman, and C. P. Moran, Jr. 1991. SpoOAbinds to a promoter used by c'X RNA polymerase duringsporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA88:4533-4537.

43. Schaeffer, P., J. Millet, and J. Aubert. 1965. Catabolic repres-sion of bacterial sporulation. Proc. Natl. Acad. Sci. USA54:704-711.

44. Shorenstein, R. G., and R. Losick. 1973. Comparative size andproperties of the sigma subunits of ribonucleic acid polymerasefrom Bacillus subtilis and Escherichia coli. J. Biol. Chem.248:6170-6173.

45. Slauch, J. M., and T. J. Silhavy. 1989. Genetic analysis of theswitch that controls porin gene expression in Escherichia coliK-12. J. Mol. Biol. 210:281-292.

46. Smith, I. 1989. Initiation of sporulation, p. 185-210. In I. Smith,R. A. Slepecky, and P. Setlow (ed.), Regulation of prokaryoticdevelopment. American Society for Microbiology, Washington,D.C.

46a.Smith, I., E. Dubnau, M. Predich, U. Bai, and R. Rudner. Earlyspo gene expression in Bacillus subtilis: the role of interrelatedsignal transduction systems. Biochimie, in press.

47. Sonenshein, A. L. 1989. Metabolic regulation of sporulation andother stationary-phase phenomena, p. 109-130. In I. Smith,R. A. Slepecky, and P. Setlow (ed.) Regulation of prokaryoticdevelopment. American Society for Microbiology, Washington,D.C.

48. Stock, A. M., T. Chen, D. Welsh, and J. Stock. 1988. CheAprotein, a central regulator of bacterial chemotaxis, belongs to afamily of proteins that control gene expression in response tochanging environmental conditions. Proc. Natl. Acad. Sci. USA85:1403-1407.

49. Stock, A. M., D. C. Wylie, J. M. Mottonen, A. N. Lupas, E. G.Ninfa, A. J. Ninfa, C. E. Schutt, and J. B. Stock 1988.Phosphoproteins involved in bacterial signal transduction. ColdSpring Harbor Symp. Quant. Biol. 53:49-57.

50. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Proteinphoshporylation and regulation of adaptive response in bacteria.

Microbiol. Rev. 53:450-490.51. Stock, J. B., A. M. Stock, and J. M. Mottonen. 1990. Signal

transduction in bacteria. Nature (London) 344:395-400.52. Strauch, M., V. Webb, G. Spiegelman, and J. A. Hoch. 1990.

The SpoOA protein of Bacillus subtilis is a repressor of abrBgene. Proc. Natl. Acad. Sci. USA 87:1801-1805.

53. Tatti, K. M., H. L. Carter III, A. Moir, and C. P. Moran, Jr.1989. Sigma H-directed transcription of citG in Bacillus subtilis.J. Bacteriol. 171:5928-5932.

54. Trach, K., D. Burbulys, M. Strauch, J.-J. Wu, R. Jonas, C.Hanstein, P. Kallio, M. Perego, T. Bird, G. Spiegelman, C.Fogher, and J. A. Hoch. 1991. Control of the initiation ofsporulation in Bacillus subtilis by a phosphorelay. Res. Micro-biol. 142:815-823.

55. Trach, K. A., J. W. Chapman, P. J. Piggot, and J. A. Hoch.1985. Deduced product of the stage 0 sporulation gene spoOFshares homology with the spoOA, ompR and sfrA proteins. Proc.Natl. Acad. Sci. USA 82:7260-7264.

56. Trach, K. A., J. W. Chapman, P. J. Piggot, D. LeCoq, and J. A.Hoch. 1988. Complete sequence and transcriptional analysis ofthe spoOF region of the Bacillus subtilis chromosome. J. Bac-teriol. 170:4194-4208.

57. Ueshima, R., N. Fujita, and A. Ishihama. 1989. DNA supercoil-ing and temperature shift affect the promoter activity of theEscherichia coli rpoH gene encoding the heat-shock sigmasubunit of RNA polymerase. Mol. Gen. Genet. 215:185-189.

58. Weir, J., M. Predich, E. Dubnau, G. Nair, and I. Smith. 1991.Regulation of spoOH, a gene coding for the Bacillus subtilis OrHfactor. J. Bacteriol. 173:521-529.

59. Wu, J.-J., M. G. Howard, and P. J. Piggot. 1989. Regulation oftranscription of the BaciUus subtilis spoILA locus. J. Bacteriol.171:692-698.

60. Wu, J.-J., P. J. Piggot, K. M. Tatti, and C. P. Moran, Jr. 1991.Transcription of the Bacillus subtilis spoILA locus. Gene 101:113-115.

61. Yamashita, S., H. Yoshikawa, F. Kawamura, H. Takahashi, T.Yamamoto, Y. Kobayashi, and H. Saito. 1986. The effect ofspoOmutations on the expression of spoOA- and spoOF-lacZ fusion.Mol. Gen. Genet. 205:28-33.

62. York, K., T. J. Kenney, S. Satola, C. P. Moran, Jr., H. Poth, andP. Youngman. 1992. SpoOA controls the a-"-dependent activa-tion of Bacillus subtilis sporulation-specific transcription unitspollE. J. Bacteriol. 174:2648-2658.

63. Yoshikawa, H., J. Kazami, S. Yamashita, T. Chibazakura, H.Sone, F. Kawamura, M. Oda, M. Isaka, Y. Kobayashi, and H.Saito. 1986. Revised assignment for the Bacillus subtilis spoOFgene and its homology with spoOA and with two Escherichia coligenes. Nucleic Acids Res. 14:1063-1072.

64. Zuber, P., J. Healy, H. L. Carter III, S. Cutting, C. P. Moran,Jr., and R. Losick 1989. Mutation changing the specificity of anRNA polymerase sigma factor. J. Mol. Biol. 206:605-614.

65. Zuber, P., and R. Losick. 1983. Use of a lacZ fusion to study therole of spoO genes of Bacillus subtilis in developmental regula-tion. Cell 35:275-283.

66. Zuber, P., M. Marahiel, and J. Robertson. 1988. Influence ofabrB on the transcription of the sporulation-associated genesspoVG and spoOH in Bacillus subtilis, p. 123-127. In A. T.Ganesan and J. A. Hoch (ed.), Genetics and biotechnology ofbacilli, vol. 2. Academic Press, Inc., New York.

J. BACTERIOL.

on March 6, 2021 by guest

http://jb.asm.org/

Dow

nloaded from