Attenuated Human Parainfluenza Virus Type 1 (HPIV1) Expressingthe Fusion Glycoprotein of Human Respiratory Syncytial Virus (RSV)as a Bivalent HPIV1/RSV Vaccine

Natalie Mackow, Emérito Amaro-Carambot, Bo Liang, Sonja Surman, Matthias Lingemann, Lijuan Yang, Peter L. Collins, Shirin Munir*

RNA Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA

ABSTRACT

Live attenuated recombinant human parainfluenza virus type 1 (rHPIV1) was investigated as a vector to express the respiratorysyncytial virus (RSV) fusion (F) glycoprotein, to provide a bivalent vaccine against RSV and HPIV1. The RSV F gene was engi-neered to include HPIV1 transcription signals and inserted individually into three gene locations in each of the two attenuatedrHPIV1 backbones. Each backbone contained a single previously described attenuating mutation that was stabilized against de-attenuation, specifically, a non-temperature-sensitive deletion mutation involving 6 nucleotides in the overlapping P/C openreading frames (ORFs) (C�170) or a temperature-sensitive missense mutation in the L ORF (LY942A). The insertion sites in thegenome were pre-N (F1), N-P (F2), or P-M (F3) and were identical for both backbones. In vitro, the presence of the F insert re-duced the rate of virus replication, but the final titers were the same as the final titer of wild-type (wt) HPIV1. High levels of RSVF expression in cultured cells were observed with rHPIV1-C�170-F1, -F2, and -F3 and rHPIV1-LY942A-F1. In hamsters, therHPIV1-C�170-F1, -F2, and -F3 vectors were moderately restricted in the nasal turbinates, highly restricted in lungs, and geneti-cally stable in vivo. Among the C�170 vectors, the F1 virus was the most immunogenic and protective against wt RSV challenge.The rHPIV1-LY942A vectors were highly restricted in vivo and were not detectably immunogenic or protective, indicative of over-attenuation. The C�170-F1 construct appears to be suitably attenuated and immunogenic for further development as a bivalentintranasal pediatric vaccine.

IMPORTANCE

There are no vaccines for the pediatric respiratory pathogens RSV and HPIV. We are developing live attenuated RSV and HPIVvaccines for use in virus-naive infants. Live attenuated RSV strains in particular are difficult to develop due to their poor growthand physical instability, but these obstacles could be avoided by the use of a vaccine vector. We describe the development andpreclinical evaluation of live attenuated rHPIV1 vectors expressing the RSV F protein. Two different attenuated rHPIV1 back-bones were each engineered to express RSV F from three different gene positions. The rHPIV1-C�170-F1 vector, bearing an atten-uating deletion mutation (C�170) in the P/C gene and expressing RSV F from the pre-N position, was attenuated, stable, and im-munogenic against the RSV F protein and HPIV1 in the hamster model and provided substantial protection against RSVchallenge. This study provides a candidate rHPIV1-RSV-F vaccine virus suitable for continued development as a bivalent vaccineagainst two major childhood pathogens.

Human respiratory syncytial virus (RSV) is the leading viralcause of severe acute respiratory infection (ARI) in infants

and young children worldwide. RSV is an enveloped, nonseg-mented, negative-strand RNA virus of the family Paramyxoviri-dae. RSV infects early in life and is responsible globally for anestimated 34 million annual pediatric cases of acute bronchiolitisand pneumonia, 4 million hospitalizations, and up to 199,000pediatric deaths, 99% of which occur in the developing world (1).The human parainfluenza viruses (HPIVs) are also envelopednonsegmented negative-strand RNA viruses of the familyParamyxoviridae. HPIV serotype 1 (HPIV1), HPIV2, and HPIV3in particular are important agents of pediatric ARI and in aggre-gate are second in importance only to RSV (2). No vaccines arecurrently available for RSV or any of the HPIVs. Here we describethe development and evaluation of attenuated strains of HPIV1 asvectors to express the fusion (F) protein of RSV as a bivalentHPIV1/RSV vaccine.

A formalin-inactivated RSV vaccine evaluated in infants andchildren in the 1960s was poorly protective and, paradoxically,primed for greatly enhanced RSV disease (3, 4). Markers for RSV

disease enhancement have also been observed with purified RSVsubunit vaccines in experimental animals (5, 6). Therefore, inac-tivated and subunit vaccines are considered contraindicated inyoung RSV-naive recipients. In contrast, live attenuated RSV andlive vectored RSV vaccines have been shown to be free of theeffects of enhancing disease in experimental animals and in infants

Received 28 May 2015 Accepted 27 July 2015

Accepted manuscript posted online 29 July 2015

Citation Mackow N, Amaro-Carambot E, Liang B, Surman S, Lingemann M, Yang L,Collins PL, Munir S. 2015. Attenuated human parainfluenza virus type 1 (HPIV1)expressing the fusion glycoprotein of human respiratory syncytial virus (RSV) as abivalent HPIV1/RSV vaccine. J Virol 89:10319 –10332. doi:10.1128/JVI.01380-15.

Editor: T. S. Dermody

Address correspondence to Shirin Munir, munirs@niaid.nih.gov.

* Present address: Shirin Munir, National Institute of Allergy and InfectiousDiseases, National Institutes of Health, Bethesda, Maryland, USA.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.01380-15

October 2015 Volume 89 Number 20 jvi.asm.org 10319Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

and children (7, 8). Similar to RSV, inactivated HPIV3 has alsobeen reported to prime for enhanced HPIV3 disease in experi-mental animals following HPIV3 challenge (9). These observa-tions indicate that live attenuated RSV and HPIV vaccines arepreferred for infants and young children. These vaccines would begiven intranasally (i.n.), which stimulates innate, cellular, and hu-moral immunity both systemically and in the respiratory tract.This immunization route in infants also decreases the virus-neu-tralizing and immunosuppressive effects of maternally derived se-rum antibodies (10). Local respiratory tract immunity is particu-larly effective in restricting the replication and transmission ofthese respiratory pathogens.

Our laboratory has been developing live attenuated RSV andHPIV vaccine strains by introducing a series of attenuating muta-tions into the respective viruses using reverse genetics (11, 12).Evaluation of these strains in clinical studies is ongoing. However,we are also pursuing the alternative approach described here ofusing attenuated HPIV strains to express RSV antigens becausethis strategy has a number of potential advantages. As notedabove, this strategy provides a bivalent vaccine against RSV andthe HPIV vector. In addition, the HPIVs replicate in cell culture totiters that are 10- to 100-fold greater than those of RSV, facilitatingmanufacture. RSV is also notorious for being susceptible to a lossof infectivity during handling, which complicates vaccine devel-opment, manufacture, and delivery. The HPIVs are substantiallymore stable, which may be critical for extending RSV vaccines todeveloping countries, where their need is the greatest. RSV grownin vitro typically forms long filaments that complicate manufac-ture, whereas the HPIVs form smaller spherical particles. RSVmay also be inherently more pathogenic and possibly more im-munosuppressive than the HPIVs, which would be another ad-vantage of an HPIV-vectored RSV vaccine. We have also found inrodents that use of an HPIV-vectored vaccine as a boost subse-quent to administration of a live attenuated RSV strain is moreimmunogenic than a second dose of the same attenuated RSVstrain (unpublished data). This is likely because the RSV-specificimmunity resulting from the primary immunization restricts asecond dose of an attenuated RSV strain more efficiently than itdoes an HPIV-vectored virus.

The HPIV1 genome consists of 6 genes encoding the nucleo-protein (N), phosphoprotein (P/C), internal matrix protein (M),fusion glycoprotein (F), hemagglutinin-neuraminidase glycopro-tein (HN), and large polymerase protein subunit (L) (2). Eachgene encodes a major viral protein: N, P, M, F, HN, and L. The Pgene carries an additional overlapping open reading frame (ORF)expressing a set of carboxy coterminal C accessory proteins thatinhibit host interferon and apoptosis responses (13). Like othernonsegmented negative-strand RNA viruses, HPIV1 transcrip-tion initiates at the 3= end of the genome and proceeds in a sequen-tial start-stop process regulated by short gene start (GS), gene end(GE), and intergenic (IG) signals that flank each gene to generatea series of monocistronic mRNAs. There is a 3=-to-5= gradient ofdecreasing transcription, with the promoter-proximal genes be-ing expressed at higher levels (2, 14). Like other paramyxoviruses,complete infectious, replication-competent recombinant HPIV1(rHPIV1) can be recovered in cell culture from transfected cDNAsby reverse genetics. HPIVs can accommodate and express severaladded foreign genes (15). However, we usually insert only a singleforeign gene, because multiple genes can be overly attenuating andcan accumulate point mutations. There are two RSV neutraliza-

tion antigens that are also the major protective antigens: the Fglycoprotein and the heavily glycosylated glycoprotein (G). The Fprotein is the RSV antigen of choice to be expressed from a vectorbecause it is a more effective neutralization and protective antigenthan G (16) and is also one of the most highly conserved proteinsamong RSV strains, whereas G is highly divergent.

Previous studies have described the development of an atten-uated chimera of recombinant bovine and human parainfluenzavirus type 3 (PIV3), namely, rB/HPIV3, expressing the RSV Fprotein as an experimental bivalent vaccine for RSV and HPIV3(17–19). Clinical evaluation of an rB/HPIV3-RSV-F construct inseronegative children showed that it was infectious, well tolerated,and attenuated but was less immunogenic against RSV F thanhoped (7). This appeared to be due at least in part to geneticinstability that silenced expression of the RSV F insert in a sub-stantial proportion of vector particles (20). However, furtherstudies are under way to stabilize the RSV F insert and enhanceimmunogenicity (21). HPIV1 is another attractive vector for ex-pressing RSV F protein. In particular, HPIV1 infects somewhatlater in childhood (22, 23) than RSV or HPIV3 (23), and so anrHPIV1-vectored RSV vaccine might be used subsequent to a liveattenuated RSV or rB/HPIV3-vectored vaccine to boost immuneresponses to RSV.

In the present study, we investigated the development of anrHPIV1-vectored vaccine expressing the RSV F protein from acodon-optimized ORF (Fig. 1; Table 1). We constructed two at-tenuated rHPIV1 backbones that each contained a different, pre-viously described attenuating mutation (namely, C�170 andLY942A; the viruses are designated rHPIV1-C�170 and rHPIV1-LY942A, respectively) that had been designed for stability againstdeattenuation (Table 1) (24–26). The C�170 mutation consists of a6-nucleotide deletion in the overlapping P and C ORFs (Table 1).In the C ORF, this results in the deletion of 2 amino acids and thesubstitution of a third amino acid (specifically, the triplet 168-RDF-170 was changed to the single amino acid S), whereas in theoverlapping P ORF, it results in the deletion of 2 amino acids(172-GF-173). The C�170 mutation is non-temperature sensitive.It reduces the ability of C proteins to inhibit the host type I inter-feron response and apoptosis (13, 24, 26), resulting in viral atten-uation. The other mutation is a missense mutation (942-Y to A,called LY942A) in the L ORF that was designed to involve 3 nucle-otide substitutions so that it is highly resistant to deattenuation(Table 1), as has been confirmed previously (27). The LY942A mu-tation is temperature sensitive. Each of these mutations has beenshown to be moderately attenuating in vivo (24–26). We com-pared the effects of inserting the RSV F gene at the first, second,or third gene position of the rHPIV1-C�170 and rHPIV1-LY942A

backbones. These six viruses were constructed and recovered byreverse genetics. They were analyzed, along with their respectiveattenuated parent and wild-type (wt) HPIV1, for replication, pro-tein expression, and stability in vitro. The hamster model was usedto assess in vivo replication (upper and lower respiratory tract),vaccine virus stability, immunogenicity, and protection against wtRSV challenge. The results identified an optimal construct suit-able for further development.

MATERIALS AND METHODSCells and viruses. LLC-MK2 (ATCC CCL-7) rhesus monkey kidney andVero (ATCC CCL-81) African green monkey kidney cell lines were main-tained in Opti-MEM I medium with GlutaMAX (Life Technologies,

Mackow et al.

10320 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Grand Island, NY) supplemented with 5% fetal bovine serum (FBS; Hy-Clone/Logan, UT) and 1 mM L-glutamine (Life Technologies). BHK BSRT7/5 cells are baby hamster kidney 21 (BHK-21) cells that constitutivelyexpress T7 RNA polymerase (28). These cells were maintained in Glasgowminimal essential medium (GMEM; Life Technologies) supplementedwith 10% FBS, 2 mM L-glutamine, and 2% minimal essential mediumamino acids (Life Technologies).

The strains used in this work both for viruses and for all cDNAs wereHPIV1/Washington/20993/1964 (GenBank accession number AF457102)and RSV A2 (GenBank accession number M74568). HPIV1 and deriva-tives were propagated in LLC-MK2 cells in serum-free Opti-MEM I me-dium containing 1.2% trypsin (TrypLE Select; Life Technologies), 100

U/ml penicillin, 100 �g/ml streptomycin (Life Technologies), and 1mM L-glutamine. HPIV1 titers were determined by 10-fold serial di-lution in 96-well plates of LLC-MK2 cells in the same medium andincubation at 32°C for 7 days. Infected cells were detected by an he-madsorption (HAD) assay using guinea pig erythrocytes, and titerswere calculated as the log10 50% tissue culture infective doses(TCID50) per milliliter (24). The temperature-sensitive (ts) phenotypeof each virus was studied by evaluating the efficiency of replication at32, 35, 36, 37, 38, 39, and 40°C; this was done by serial dilution ofviruses in 96-well replicate plates of LLC-MK2 cells incubated in sealedcontainers in temperature-controlled water baths at various tempera-tures for 7 days, followed by the HAD assay (29).

FIG 1 Construction of HPIV1 antigenomic cDNAs containing the RSV F gene inserted at the first (F1), second (F2), or third (F3) gene position. The rHPIV1backbones contained either of two attenuating mutations: namely, the C�170 or the LY942A mutation in the P/C or L ORF, respectively (indicated by * and �,respectively). For the rHPIV1-F1 constructs, the RSV F gene was inserted at the MluI site located in the upstream nontranslated region of the N gene. ForrHPIV1-F2, the RSV F gene was inserted between the rHPIV1 N and P genes at the AscI site located in the upstream nontranslated region of the P gene. ForrHPIV1-F3, the RSV F gene was inserted between the rHPIV1 P and M genes at the NotI site situated in the downstream nontranslated region of the P gene. For allconstructs, the RSV F ORF was codon optimized for human expression and contained the two HEK amino acid assignments (see the text). Each RSV F insertcontained the N gene end (GE), intergenic (IG), and P gene start (GS) sequences, as shown, so that the sequence coding for RSV F would be expressed as anindependent mRNA.

TABLE 1 Attenuating mutations introduced in the HPIV1 backbone in the P/C or L ORF

Gene(s) Mutation ORF Nucleotide changea ¡ mutationType ofmutation Codon position

Amino acidchange

No. (type) of nucleotide changesneeded for reversion to wt

P/C �170 C AGG GAT TTC ¡ AGC Deletion 168–170 RDF ¡ S 6 (insertions)P/C �170 P AG GGA TTT C ¡ AGC Deletion 172–173 GF deletion 6 (insertions)L Y942A L TAT ¡ GCG Substitution 942 Y ¡ A 3 (substitutions)a Nucleotide changes (deletion or substitution) in the wt sequence are underlined in boldface.

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10321Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Design of rHPIV1-C�170 and rHPIV1-LY942A expressing the RSV Fprotein. The rHPIV1s were constructed using a previously described re-verse genetics system for wt HPIV1 (30). The recombinant full-lengthantigenomic cDNA of HPIV1 was modified by site-directed mutagenesisto introduce 3 additional unique restriction sites: MluI (ACGCGT, pre-Nposition, nucleotide numbers 113 to 118), AscI (GGCGCGCC, N-P posi-tion, nucleotide numbers 1776 to 1783), and NotI (GCGGCCGC, P-Mposition, nucleotide numbers 3609 to 3616) (Fig. 1). Two attenuatedbackbones were generated by introducing either the C�170 (25) or theLY942A (25, 27) mutation into the P/C or L ORF (Table 1), respectively,using a QuikChange Lightning mutagenesis kit (Agilent, Santa Clara,CA). For the rHPIV1 C�170 mutation, the forward mutagenic primer wasAAGAAGACCAAGTTGAGXCCAGAAGAGGTACGAAG and the re-verse primer was CTTCGTACCTCTTCTGGXCTCAACTTGGTCTTCTT. These primers introduced a 6-nucleotide deletion (GGATTT), rep-resented by the letter X in boldface, in the P/C ORF (Table 1), in keepingwith the rule of six (31, 32). For the LY942A mutation, the forward primerwas CCAGCTAACATAGGAGGGTTCAACGCGATGTCTACAGCTAGATGTTTTGTC and the reverse primer was GACAAAACATCTAGCTGTAGACATCGCGTTGAACCCTCCTATGTTAGCTGG; the site of theTAT (Y)-to-GCG (A) mutation at amino acid 942 in the L ORF is under-lined. Clones with the desired mutation were identified and sequenced intheir entirety by automated sequencing.

The RSV F ORF with HEK amino acid assignments Glu-66 and Pro-101 (33), which make its sequence identical at the amino acid level to thatof an early passage of strain A2, was codon optimized for human expres-sion as previously described (34) (GeneArt, Life Technologies, Grand Is-land, NY). The RSV F-gene insert was designed (Fig. 1) to include a set ofHPIV1 transcription signals (GE-IG-GS) so that in the final construct theRSV F gene would be expressed as a separate mRNA. RSV F-gene insertswere generated by PCR with a flanking MluI, AscI, or NotI restriction sitefor insertion in the first pre-N (F1), second N-P (F2), or third P-M (F3)position, respectively (Fig. 1). The F1, F2, and F3 inserts were designed toadopt the hexamer spacing of the N, P, and P genes, respectively (32). Thefollowing PCR primers were used to generate the RSV F inserts. For the F1gene position (MluI site), the forward primer was ACGCGTCCCGGGAACAATGGAACTGCTGATCCTGAAGGCCAACGCC and the reverseprimer was ACGCGTCGTACGCATTCACCCTAAGTTTTTCTTACTTTCTATCAGTTGGAGAAGGCGATATTGTTGATGCCGG; for the F2gene position (AscI site), the forward primer was GGCGCGC-C C C C G G G A A C A A T G G A A C T G C T G A T C C T G A A G G C C AACGCC and the reverse primer was GGCGCGCCCGTACGCCATTCACCCTAAGTTTTTCTTACTTGATTCTATCAGTTGGAGAAGGCGATATTGTTGATGCCGG; and for the F3 gene position (NotI site), the for-ward primer was GCGGCCGCCCGGGAAGTAAGAAAAACTTAGGGTGAATGAACAATGGAACTGCTGATCCTGAAGGCCAACGCC and thereverse primer was GCGGCCGCCGTACGCTATCAGTTGGAGAAGGCGATATTGTTGATGCCGG. The restriction sites used for cloning are un-derlined, the GE-IG-GS signals are in boldface, and the translational startsite (forward primer) and two stop codons (reverse primer) are italicized.PCR products were generated using an Advantage HF 2 PCR kit (Clon-tech, Mountain View, CA) and cloned into a TOPO TA cloning vector(Life Technologies), and the sequences were confirmed by automatedsequencing. The RSV F MluI, AscI, and NotI fragments were cloned intothe corresponding sites of the rHPIV1-C�170 or rHPIV1-LY942A back-bone. All viruses were designed to have the genome nucleotide lengthconform to the rule of six (32).

Recovery of rHPIV1-C�170 and rHPIV1-LY942A expressing the RSVF protein. The viruses were recovered in BHK BSR T7/5 cells as previouslydescribed (30, 35). Transfected cells were incubated overnight at 37°C andwashed twice with Opti-MEM I medium (Life Technologies), and freshOpti-MEM I medium containing 1 mM L-glutamine and 1.2% trypsin wasadded to the cells, followed by incubation at 32°C. At 48 h posttransfec-tion, the cells were harvested by scraping them into the medium, and thecell suspension was added to 50% confluent monolayers of MK2 cells in

Opti-MEM I medium containing 1 mM L-glutamine and 1.2% trypsinand incubated at 32°C. Virus was harvested after 7 days and was furtheramplified by one (rHPIV1-C�170) or two (rHPIV1-LY942A) passages inLLC-MK2 cells at 32°C. All recombinant viruses were completely se-quenced to confirm the lack of adventitious mutations except in the 82and 164 nucleotides at the 3= and 5= terminal ends, respectively. For this,viral RNA was extracted (QIAamp viral RNA minikit; Qiagen, Valencia,CA) from virus stocks and treated with RNase-free DNase I (Qiagen) toremove the plasmid DNA used for virus rescue. RNA was reverse tran-scribed (SuperScript first-strand synthesis system for reverse transcrip-tion-PCR [RT-PCR]; Life Technologies), and overlapping genome re-gions were amplified by PCR (Advantage-HF 2 PCR kit). RT-PCRcontrols lacking reverse transcriptase were included for all viruses. Thesecontrols showed that the amplified products were derived from viral RNAand not from the antigenome cDNA used for virus recovery. The genomesequence of each virus construct was determined by automated sequenc-ing of the uncloned overlapping amplified RT-PCR products and assem-bled using the Sequencher program, version 5.1 (Gene Codes Corpora-tion, Ann Arbor, MI).

Analysis of RSV F and HPIV1 vector protein expression by Westernblotting. Vero cells (1 � 106) were infected with the viruses at a multi-plicity of infection (MOI) of 5 TCID50 per cell, incubated at 32°C, andharvested at 48 h postinfection (p.i.) by lysis with 400 �l of 1� LDSsample buffer (Life Technologies). The lysates were reduced and dena-tured at 37°C for 30 min and subjected to electrophoresis on 4 to 12%bis-Tris NuPAGE gels (Novex-Life Technologies), and the separated pro-teins were transferred onto polyvinylidene difluoride (PVDF) membranesusing an iBlot protein transfer system (Life Technologies). Membraneswere blocked for 1 h in LI-COR blocking buffer (LI-COR Inc., Lincoln,NE) and probed with a murine monoclonal RSV F-specific antibody (cat-alog number ab43812; Abcam, Cambridge, MA) and the previously de-scribed (36) rabbit polyclonal antipeptide HPIV1 N-specific antiserumHPIV1-N-485, each of which was used at a 1:1,000 dilution in blockingbuffer. Replicate blots performed with the same set of lysates were probedwith rabbit polyclonal antipeptide antisera for HPIV1 P (SKIA-1), F(SKIA-15), or HN (SKIA-13) (produced by Mario Skiadopoulos), whichwere raised by immunization of rabbits with a keyhole limpet hemocya-nin-conjugated peptide derived from each protein sequence (RDPEAEGEAPRKQESC, CYTLESRMRNPYMGNNSN, and KTNSSYWSTTRNDNSTVC, respectively) and which were used at a 1:200 dilution. A replicateblot probed with anti-GAPDH (anti-glyceraldehyde-3-phosphate dehy-drogenase) antibody (catalog number ab9484; Abcam) was used as a load-ing control. After overnight incubation with the antibodies describedabove, the membranes were washed 4 times for 5 min each, followed byincubation for 1 h with infrared dye-labeled secondary antibodies dilutedin the LI-COR blocking buffer: specifically, goat anti-mouse immuno-globulin IRDye 680LT, goat anti-rabbit immunoglobulin IRDye 800CW,and goat anti-mouse immunoglobulin IRDye 800CW (LI-COR). Themembranes were scanned, and the blot images were acquired using anOdyssey infrared imaging system (LI-COR). The fluorescence intensitiesof the protein bands, derived from three independent experiments, werequantified by using the LI-COR image analysis suite (Image Studio) andare reported as the level of expression of RSV F or rHPIV1 vector proteins(N, P, F, and HN) relative to that of the respective F3 virus.

Double-staining fluorescence plaque assay to quantify viruses coex-pressing HPIV1 and RSV antigens. A double-staining fluorescenceplaque assay was performed as previously described (34) with few modi-fications. Briefly, infected Vero cell monolayers were incubated for 6 daysat 32°C under a 0.8% methylcellulose overlay containing 2 mM L-glu-tamine and 4% trypsin. For animal tissue-derived virus samples, ticarcil-lin-clavulanate (Timentin; 200 mg/ml), ampicillin (100 mg/ml), clinda-mycin (Cleocin; 150 mg/ml), and amphotericin B (250 �g/ml) wereincluded in the overlay. Immunostaining was performed with a mixtureof three RSV F-specific monoclonal antibodies (6) each at a 1:2,000 dilu-tion plus an HPIV1-specific goat polyclonal antibody (Abcam) at a

Mackow et al.

10322 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

1:1,600 dilution. The secondary antibodies were infrared dye-conjugatedgoat anti-mouse immunoglobulin 680LT and donkey anti-goat immuno-globulin 800CW (LI-COR), each of which was used at a 1:800 dilution.Images were acquired using an Odyssey infrared imaging system. Thesecondary antibody signals were pseudocolored to appear red and greenfor the detection of RSV F and HPIV1 antigens, respectively. The percent-age of rHPIV1 plaques expressing RSV F protein was determined by merg-ing the colors: plaques that appear yellow upon merging express bothHPIV1 antigens and the RSV F protein, and those that appear green ex-press HPIV1 antigens but not the RSV F protein.

Hamster studies. All animal studies were approved by the NationalInstitutes of Health (NIH) Institutional Animal Care and Use Committee(IACUC). Six-week-old golden Syrian hamsters were confirmed to beseronegative for HPIV1 and RSV by hemagglutination inhibition (HAI)assay and a plaque reduction assay (see below), respectively (37–39). Toassess vector replication in vivo, hamsters in groups of 12 per virus wereanesthetized, and each animal was inoculated i.n. with 0.1 ml of L15 me-dium (Life Technologies) containing 105 TCID50 of virus. Six hamstersper virus were euthanized per day on days 3 and 5 p.i., and nasal turbinatesand lungs were collected and tissue homogenates were prepared in L15medium containing ticarcillin-clavulanate (200 mg/ml), ampicillin (100mg/ml), clindamycin (150 mg/ml), and amphotericin B (250 �g/ml),clarified, and titrated by serial dilution on LLC-MK2 cells by HAD assay.Virus titers are reported as TCID50 per gram of hamster tissue.

To assess vector immunogenicity, each animal in groups of six ham-sters per virus was inoculated i.n. with 105 TCID50 of the six rHPIV1-RSV-F vectors, and wt RSV, rHPIV1-C�170, rHPIV1-LY942A, and rB/HPIV3-F2 were included as controls. Sera were collected at day 28 afterimmunization. The titers of RSV-specific neutralizing antibodies (NAbs)were determined by 60% plaque reduction neutralization tests (PRNT60)on Vero cells in the presence of guinea pig complement (37) using en-hanced green fluorescent protein (eGFP)-expressing RSV (40). The titersof HPIV1-specific NAbs on Vero cells were determined by a PRNT60 usinggreen fluorescent protein (GFP)-expressing rHPIV1 (rHPIV1-GFP), es-sentially as described above for RSV, with three modifications: (i) guineapig complement was not used, as it was found to neutralize HPIV1; (ii) theinoculated Vero cells were washed twice with 1� phosphate-bufferedsaline after virus adsorption to remove serum; and (iii) the methylcellu-lose overlay lacked FBS and contained 4% trypsin.

Protection against RSV infection was tested by challenge infection ofhamsters from the immunogenicity study described above at 30 days p.i.by i.n. inoculation with 0.1 ml L15 medium containing 106 PFU of wt RSVstrain A2. Hamsters were euthanized, and nasal turbinates and lungs werecollected at 3 days postchallenge. The viral loads of the challenge RSV inthese tissues were determined by plaque assay on Vero cells (41, 42).

RESULTSCreation of two attenuated HPIV1 backbones (rHPIV1-C�170

and rHPIV1-LY942A) expressing the RSV F protein from threedifferent genome locations. The C�170 and LY942A mutations wereindividually introduced into rHPIV1 to create two attenuated ver-sions of HPIV1, rHPIV1-C�170 and rHPIV1-LY942A (Table 1). TheRSV F ORF of strain A2 was optimized for human codon usageand engineered to be under the control of a set of HPIV1 tran-scription signals. Each was inserted into the rHPIV1-C�170 andrHPIV1-LY942A backbones at three different genome locations,namely, at the first gene position (pre-N, yielding rHPIV1-C�170-F1 and rHPIV1-LY942A-F1), at the second gene position(N-P, yielding rHPIV1-C�170-F2 and rHPIV1-LY942A-F2), and atthe third gene position (P-M, yielding rHPIV1-C�170-F3 andrHPIV1-LY942A-F3) (Fig. 1). Each vector gene maintained its orig-inal hexamer phasing, while the F1, F2, and F3 inserts had thehexamer phasing of the N, P, and P genes, respectively. The RSV Fprotein also carried the HEK amino acid assignments Glu and Pro

at residues 66 and 101, respectively (33), and therefore, its se-quence is identical at the amino acid level to the sequence of RSVF from an early passage of strain A2 (see Discussion).

The rHPIV1-RSV-F viruses were recovered by reverse genetics.All viruses were readily rescued, except for the rHPIV1-LY942A-F2construct, which required multiple passages to make a workingpool. Complete genome sequencing showed that all of the rH-PIV1-RSV-F working pools except for rHPIV1-LY942A-F2 werefree of adventitious mutations. For rHPIV1-LY942A-F2, we had toprepare nine independently rescued clones in order to find onethat lacked adventitious mutations. The other eight clones of thisvirus contained various adventitious mutations (four of these ge-nomes were sequenced fully; the other four were sequenced for theRSV F insert and flanking gene regions). In five of these viruses,there were various mutations in the GE, IG, and GS transcrip-tional signals of the gene junction immediately upstream of theRSV F ORF and sometimes in the RSV F-gene sequence (notshown). These likely reduced or ablated the expression of RSV F,although that was not examined. The other three clones had oneor two missense mutations in the N and/or L gene (not shown)that were not further investigated.

Replication of the rHPIV1-RSV-F vectors in Vero and LLC-MK2 cells. Replication of the rHPIV1-RSV-F vectors in vitro wasevaluated by determining their multistep growth kinetics in Vero(Fig. 2A and C) and LLC-MK2 (Fig. 2B and D) cells. On day 7, thefinal titers of all of the viruses in both cell lines were greater than7.2 log10 TCID50/ml in Vero cells and 7.4 log10 TCID50/ml in LLC-MK2 cells, with slight differences among the viruses that werestatistically insignificant (Fig. 2). These titers were also statisticallyindistinguishable from those of wt HPIV1.

However, some differences were observed during the period ofexponential replication, e.g., at day 2 p.i. In the case of therHPIV1-C�170 vectors (Fig. 2A and B), the rHPIV1-C�170 emptyvector and rHPIV1-C�170-F3 construct replicated similarly to wtHPIV1 in both cell lines on day 2 p.i. However, the replication ofrHPIV1-C�170-F1 was significantly reduced in Vero (P � 0.001)and LLC-MK2 (P � 0.05) cells compared to that of wt HPIV1, andthe replication of rHPIV1-C�170-F2 in Vero cells was significantlyreduced (P � 0.01) compared to that of wt HPIV1. For rHPIV1-LY942A (Fig. 2C and D), replication of the rHPIV1-LY942A emptyvector was significantly lower than that of wt HPIV1 in Vero cellson day 2 p.i., but both grew to similar titers in LLC-MK2 cells.Highly significant reductions (P � 0.0001) in replication com-pared to that of wt HPIV1 were observed for rHPIV1-LY942A-F1,-F2, and -F3 in Vero cells on day 2 p.i. Compared to the growth ofthe rHPIV1-LY942A empty vector, rHPIV1-LY942A-F1 grew at thesame rate in Vero cells, while the growth of rHPIV1-LY942A-F2 and-F3 (Fig. 2C) was reduced, but the differences were statisticallyinsignificant. In LLC-MK2 cells, rHPIV1-LY942A-F1, -F2, and -F3showed significantly reduced (P � 0.01, P � 0.0001, and P � 0.01,respectively) replication compared to that of wt HPIV1; only thereplication of rHPIV1-LY942A-F2 was significantly reduced (P �0.01) relative to that of the empty vector on day 2 p.i.

Expression of RSV F and HPIV1 proteins by the rHPIV1-RSV-F vectors. Expression of the RSV F protein and the HPIV1vector N, P, F and HN proteins was evaluated by Western blottinganalyses. Representative blots from one of three independent ex-periments for the rHPIV1-C�170 and rHPIV1-LY942A constructsare shown in Fig. 3A, and results from all three experiments arequantified in Fig. 3B and C for the rHPIV1-C�170 and rHPIV1-

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10323Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

LY942A constructs, respectively, with the values normalized relativeto those of the F3 construct in each series as 1.0.

The RSV F protein is synthesized as a precursor (F0) that iscleaved twice by a cellular protease into disulfide-linked F1 and F2

subunits and a short peptide, p27. Immunostaining with an F-spe-cific monoclonal antibody detected the F0 (70-kDa) and F1 (48-kDa) forms. The rHPIV1 C�170-F1, -F2, and -F3 constructs ex-pressed substantial amounts of RSV F (Fig. 3A and B) that wereonly slightly higher for F1 and F2 than F3 (Fig. 3B), with thedifferences being statistically insignificant. Thus, contrary to ex-pectations, a 3=-5= polar gradient of expression of the RSV F pro-tein from F1 to F2 was not observed for this vector backbone, andthere was only a modest reduction from F2 to F3. In contrast,however, a strong polar gradient of RSV F expression was ob-

served in the case of the rHPIV1-LY942A constructs, with the ex-pression of RSV F by the F1 virus being significantly higher thanthat by the F2 (P � 0.05) and F3 (P � 0.05) viruses (Fig. 3A and C).

Evaluation of the vector N, P, F, and HN protein expressionshowed that it was generally not greatly affected by the C�170 mu-tation: specifically, the rHPIV1-C�170 empty vector had a vectorprotein expression profile similar to that of wt HPIV1 (Fig. 3B).For the three versions of the rHPIV1-C�170 vector expressing RSVF, the F3 virus expressed N, P, F, and HN at levels similar to thosefor the empty rHPIV1-C�170 vector. The F2 virus expressed Nprotein similarly to the empty rHPIV1-C�170 vector but showedreduced expression of P, F, and HN proteins, of which only theHN reduction was statistically significant compared to the emptyvector. The F1 virus demonstrated a significant reduction in the

FIG 2 Multistep virus replication in Vero (A and C) and LLC-MK2 (B and D) cells. Triplicate wells of cell monolayers in 6-well plates were infected at an MOIof 0.01 TCID50 with rHPIV1-C�170 or -LY942A expressing the RSV F gene (F1, F2, or F3), with the rHPIV1-LY942A or rHPIV1-C�170 empty vector, or with wtHPIV1. Cultures were incubated at 32°C. Aliquots of cell culture medium were collected at 24-h intervals, and virus titers (log10 TCID50 per milliliter) weredetermined by serial dilution on LLC-MK2 cells and HAD assay. Mean titers with SEMs are shown. One-way analysis of variance with Tukey’s multiple-comparison posttest was used to determine the statistical significance of the difference between the titer of each virus and that of wt HPIV1 at day 2 p.i. (a timeof exponential replication) and at day 7 p.i. (when the final titer had been reached), which is indicated by asterisks, as follows: *, P � 0.05; **, P � 0.01; ***, P �0.001; ****, P � 0.0001.

Mackow et al.

10324 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

expression of all vector proteins, including N (P � 0.05), P (P �0.01), F (P � 0.05), and HN (P � 0.05), compared to that of theempty vector. Thus, insertion of the RSV F gene into the rHPIV1-C�170 vector reduced the expression of downstream vector genesin all constructs except F3.

The LY942A mutation had a greater effect on the expression of

vector proteins: specifically, compared with the levels of proteinexpression by wt HPIV1, the rHPIV1-LY942A empty vector hadsignificantly reduced levels of expression of the P (P � 0.05), F(P � 0.05), and HN (P � 0.01) proteins, with no significant dif-ference being found for the N protein (Fig. 3A and C). In the caseof the three versions of rHPIV1-LY942A expressing RSV F, the

FIG 3 Western blot analysis of the in vitro expression of RSV F and HPIV1 proteins by the rHPIV1-RSV-F vectors. (A) Vero cells were infected with the indicatedviruses at an MOI of 5 TCID50. At 48 h p.i., cells were lysed with SDS sample buffer. All samples were denatured, reduced, and subjected to SDS-PAGE. Proteinswere transferred onto PVDF membranes and probed with either an RSV F-specific mouse monoclonal antibody or rabbit polyclonal antipeptide antibodiesmonospecific to the HPIV1 N, P, HN, or F protein. GAPDH was used as a loading control. Corresponding infrared dye-conjugated anti-mouse and anti-rabbitantibodies were used as secondary antibodies. Images were acquired using an Odyssey infrared imaging system. The RSV F and the rHPIV1 vector proteins appearred and green, respectively. The images shown are representative of three independent experiments. (B and C) The intensities of protein bands from the threeindependent Western blot experiments, one of which is shown in panel A, were quantified, and the expression is shown relative to that of the corresponding F3virus, which was given a value of 1.0. Plots show the data as means � SEMs. The statistical significance of the difference in expression of the indicated HPIV1proteins between the indicated viruses was analyzed by one-way analysis of variance with Dunnett’s multiple-comparison test using the 95% confidence intervaland is indicated as follows: *, P � 0.05; **, P � 0.01; ****, P � 0.0001.

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10325Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

expression of the N, P, F, and HN proteins by the F1 virus wasvery similar to that by the rHPIV1-LY942A empty vector,whereas the expression by the F3 virus was somewhat lowerthan that by the empty vector, but not significantly so. In con-trast, the F2 virus exhibited a highly pronounced and signifi-cant reduction in the expression of the N, P, F, and HN proteinscompared to the expression by the rHPIV1-LY942A empty vec-tor, although the reduction in the expression of N was less thanthat for the other proteins.

Temperature sensitivity of the rHPIV1-RSV-F vectors. Asnoted above, the C�170 mutation did not confer the temperature-sensitive (ts) phenotype in previous studies, whereas the LY942A

mutation did (26, 27). Insertion of RSV F into an HPIV vector hasalso been shown to confer the ts phenotype (21). We thereforeevaluated the ability of the rHPIV1-RSV-F constructs to grow inLLC-MK2 cells at 32, 35, 36, 37, 38, 39, and 40°C (Table 2). Whilethe C�170 mutation did not confer the ts phenotype in previousstudies, in the present study the rHPIV1-C�170 empty vector had ashutoff temperature of 40°C (Table 2) and was thus ts, whereas wtHPIV1 was not, but the effect was small. The rHPIV1-C�170-F2and -F3 constructs also had shutoff temperatures of 40°C and thusdid not differ significantly from the empty vector. However, rH-PIV1-C�170-F1 had a lower shutoff temperature of 39°C (Table 2).In the present study, the rHPIV1-LY942A empty vector had a shut-off temperature of 36°C, similar to the values of 35 to 37°C asso-ciated with this mutation in previous studies (25, 27). The rH-PIV1-LY942A-F1 and -F2 constructs were more ts than the emptyvector, having shutoff temperatures of 35°C, while the rHPIV1-LY942A-F3 vector had the same 36°C shutoff temperature as theempty vector (Table 2). Thus, insertion of the RSV F gene into theF1 position of either attenuated backbone increased the ts pheno-type, insertion into the F3 position of either backbone did notincrease the ts phenotype, and insertion into the F2 position in-creased the ts phenotype only for the LY942A backbone.

Stability of RSV F-protein expression by the rHPIV1-RSV-Fvectors after in vitro replication. The working pools of therHPIV1-RSV-F constructs were evaluated for the frequency ofRSV F expression in individual viral plaques using a double-staining fluorescence plaque assay with antibodies specific toRSV F and the HPIV1 antigens. A total number of 140, 77, and59 plaques were counted for rHPIV1-C�170-F1, -F2, and -F3,respectively, and 100% of the rHPIV1 plaques expressed the

RSV F protein. F1 made smaller plaques than F2 and F3, whilethe sizes of the F2 and F3 plaques were similar to each other(data not shown). A total of 214, 70, and 192 plaques werecounted for rHPIV1-LY942A-F1, -F2, and -F3, respectively, and100%, 100%, and 97% of these rHPIV1 plaques expressed theRSV F antigen, respectively. Overall, rHPIV1-LY942A formedplaques that were much smaller than those formed by the rH-PIV1-C�170 constructs. Since the assay was performed at the per-missive temperature of 32°C, the reductions in plaque size, whichsuggest a relatively more attenuated phenotype and slower spread,may not be a ts effect. The reduced plaque size was consistent withtheir relatively slower replication profiles (Fig. 2).

Replication of the rHPIV1-RSV-F vectors in the respiratorytract of hamsters. Viruses were evaluated for their ability to rep-licate in the upper respiratory tract (URT) and lower respiratorytract (LRT) of hamsters. The virus titers in the nasal turbinates(Fig. 4A) and lungs (Fig. 4B) on days 3 and 5 are shown. TherHPIV1-C�170 empty vector was significantly more attenuatedthan wt HPIV1 in the nasal turbinates on day 5 and in the lungs onboth days, with no virus being detected in the lungs of 5/6 animalson day 5. The addition of the RSV F insert provided further atten-uation to the rHPIV1-C�170 vector: for the F1 derivative, this dif-ference in attenuation from that of the empty vector was signifi-cant only on day 3 in the lungs, for the F2 derivative this wassignificant on both days in the nasal turbinates and on day 3 in thelungs, and for the F3 derivative this was significant on day 5 in thenasal turbinates and day 3 in the lungs.

The rHPIV1-LY942A empty vector was significantly more atten-uated than wt HPIV1 on both days in both the nasal turbinatesand lungs, with no virus being detected in the nasal turbinates onday 5 or in the lungs on either day. Thus, this mutation was indeedstrongly attenuating in vivo. Because the empty vector was sostrongly attenuated (i.e., virus was detected only in the nasal tur-binates and only on 1 day), the effect of further addition of theRSV F insert was difficult to determine. For the RSV F derivatives,no virus was detected on either day in the lungs (except for a singleanimal in the F3 group) and nasal turbinates (except for the F2group on day 3). Thus, a general lack of detectable virus replica-tion in the nasal turbinates and lungs precluded comparison of theconstructs in these anatomical compartments.

We also included for comparison the rHPIV1-CR84G/�170

HN553ALY942A virus (designated the rHPIV1 vaccine candidate in

TABLE 2 Temperature sensitivity of recombinant viruses on LLC-MK2 cell monolayersa

Virus

Virus titer (log10 TCID50/ml) at:

32°C 35°C 36°C 37°C 38°C 39°C 40°C

wt HPIV1 7.7 8.5 7.5 7.5 8.0 7.2 6.2rHPIV1-C�170 7.0 7.0 6.5 6.2 6.7 6.5 3.2rHPIV1-LY942A 8.0 7.2 5.2 4.5 2.2 �1.2 �1.2rHPIV1-C�170-F1 7.0 6.7 7.0 6.2 6.2 3.2 1.5rHPIV1-C�170-F2 8.2 6.5 7.7 7.0 7.7 6.5 2.2rHPIV1-C�170-F3 8.0 8.0 7.5 8.0 7.7 6.7 2.0rHPIV1-LY942A-F1 7.0 4.7 4.7 1.5 1.5 �1.2 �1.2rHPIV1-LY942A-F2 5.5 3.2 �1.2 �1.2 �1.2 �1.2 �1.2rHPIV1-LY942A-F3 8.2 7.2 5.5 4.2 �1.2 �1.2 �1.2a Serial dilutions of each of the indicated viruses were inoculated on LLC-MK2 cells and incubated at the indicated temperature for 7 days. Virus was detected by HAD assay. Thedetection limit was 1.2 TCID50/ml. Underlined values in boldface indicate the virus shutoff temperature, defined as the lowest restrictive temperature at which the mean log10

reduction in virus titer at a given temperature versus that at 32°C was 2.0 log10 TCID50/ml or greater than that of wt HPIV1 at the same two temperatures. The shutoff temperatureof wt HPIV1 is �40°C (not shown); viruses with shutoff temperatures of �40°C are considered temperature sensitive.

Mackow et al.

10326 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Fig. 4), which was previously demonstrated to be strongly at-tenuated in African green monkeys (25) and was recently foundto be overattenuated in seronegative children (43). In the pres-ent study, this virus did not replicate detectably in either thenasal turbinates or the lungs of the hamsters. As another con-trol, we also included the chimeric bovine/human PIV3 ex-pressing RSV F from the second gene position (rB/HPIV3-F2).In a previous clinical study by others (7), a similar version of rB/HPIV3-F2 replicated to a moderate titer in 6- to 24-month-old chil-dren seronegative for RSV and HPIV3 and was well tolerated, sug-gesting that it has an appropriate level of attenuation (7). In thepresent study, this control replicated somewhat more efficiently thanthe rHPIV1-C�170-based vectors in the nasal turbinates and repli-cated to low titers in the lungs, where the rHPIV1-RSV-F viruses werealmost completely restricted.

Stability of RSV F-protein expression by the rHPIV1-RSV-Fvectors after in vivo replication. To evaluate the rHPIV1 vectorsfor in vivo stability, Vero cells were infected with serially dilutedhomogenates of the nasal turbinates and lungs of the infectedhamsters. The double-staining immunofluorescence plaque assaywas performed to determine the percentage of viral plaques ex-pressing RSV F. Consistent with the general lack of replication in

the lungs (Fig. 4B), no plaques could be detected in the lung ho-mogenates for any vector. Similarly, no plaques were detectablefor the rHPIV1-LY942A-RSV-F vectors in the nasal turbinates. Sta-bility could be assessed for the rHPIV1-C�170-RSV-F viruses innasal turbinate specimens, as shown in Table 3. Of the 30 samplesanalyzed on days 3 and 5, 29 had 100% of plaques expressing RSVF and 1 had 98% of plaques expressing RSV F. These data suggestthat the rHPIV1-C�170 vectors expressing RSV F are relatively sta-ble in the hamster model, with little evidence of the emergence ofvariants with silenced RSV F expression after in vivo replicationfor 3 to 5 days being present.

Induction of serum NAbs against RSV and HPIV1. Sera fromimmunized hamsters were collected at 28 days p.i., and the neutral-izing antibody (NAb) titers against RSV and HPIV1 were determinedby PRNT60 (Table 4). The rHPIV1-C�170-F1, -F2, and -F3 constructsinduced substantial titers of RSV-specific NAbs that were not statis-tically different from each other, although the titer of the F1 constructwas the highest. However, these were significantly lower than that ofrB/HPIV3-F2, a difference that likely stems from the significantlyreduced in vivo replication of these viruses compared to that of rB/HPIV3-F2 (Fig. 4A and B; see Discussion). The rHPIV1-LY942A-F1,-F2, and -F3 viruses failed to induce a detectable NAb response to

FIG 4 Replication of the rHPIV1-RSV-F vectors in the nasal turbinates (A) and lungs (B) of hamsters. Hamsters were inoculated i.n. with 105 TCID50 of therHPIV1-C�170 or -LY942A vectors expressing the RSV F gene (F1, F2, or F3), the rHPIV1-LY942A or rHPIV1-C�170 empty vector, wt HPIV1, rHPIV1-CR84GC�170HN553ALY942A (HPIV1 vaccine candidate), or rB/HPIV3-F2 (a chimeric bovine/human PIV3 expressing RSV F from the 2nd position). Animals weresacrificed on days 3 and 5 p.i. (6 animals per virus per day), and the nasal turbinates and lungs were collected and prepared as tissue homogenates. Virus titers(log10 TCID50 per gram of tissue) were determined by serial dilution on LLC-MK2 cells and HAD assay. Titers for individual animals are shown for day 3 (�) and day5 (�). The mean for each group is shown by horizontal dashed and solid lines for days 3 and 5, respectively, and the values obtained on days 3 and 5 are shown in boldfaceand italics, respectively. The limit of detection (LOD) was 1.5 log10 TCID50/ml and is indicated with a dotted line. The statistical significance of the difference between eachvirus and wt HPIV1 or the respective empty vector was determined by one-way analysis of variance with Tukey’s multiple-comparison posttest using the 95% confidenceinterval and is indicated at the lower and upper bars, respectively, as follows: *, P � 0.05; ***, P � 0.001; ****, P � 0.0001; ns, not significant (P � 0.05).

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10327Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

RSV (Table 4). This is consistent with their high degree of restrictionin the hamster (Fig. 4).

The HPIV1-specific serum NAb responses in hamsters werealso evaluated (Table 4). Overall, the HPIV1 NAb titers were lowerthan the RSV NAb titers. As indicated in Materials and Methods,guinea pig complement was included for RSV but was excludedfrom the HPIV1 neutralization assay, as it directly neutralizedHPIV1. The lack of complement likely accounts for the generallylower titers of HPIV1-specific NAbs. For example, the rHPIV1-C�170-F2 and -F3 viruses did not induce detectable levels ofHPIV1 NAbs, even though they induced significant titers of RSV-specific NAbs, as noted above. Only the rHPIV1-C�170 emptyvector and the rHPIV1-C�170-F1 construct induced detectableHPIV1-specific NAb titers, which were not statistically different

from each other. None of the rHPIV1-LY942A viruses, includingthe empty vector, induced detectable levels of HPIV1-specificNAbs, consistent with their highly restricted replication in ham-sters.

Protection against wt RSV challenge. The hamsters that wereimmunized as described above (Table 4) were challenged i.n. onday 30 postimmunization with 106 PFU of wt RSV (strain A2).Hamsters were euthanized on day 3 postchallenge, and the RSVtiters in the nasal turbinates and lungs were determined by plaqueassay on Vero cells to assess protection against RSV replication(Fig. 5A and B). The protection provided by vaccine candidatesgenerally correlated with their ability to induce RSV-specific se-rum NAbs. In the nasal turbinates, the rHPIV1-C�170-F1 and -F3viruses provided a significantly greater restriction of RSV replica-tion (P � 0.0001 and P � 0.05, respectively) compared to thatprovided by the empty vector. In contrast, the F2 virus did notinduce significant protection in the nasal turbinates. In the lungs,the rHPIV1-C�170-F1, -F2, and -F3 viruses each reduced the meanRSV titers compared to that with the empty vector, but only thereduction by the F1 virus was statistically significant (P � 0.05).The rB/HPIV3-F2 control provided significant protection againstRSV challenge in the nasal turbinates (P � 0.0001) and lungs (P �0.05), consistent with our previous report (21). The levels of pro-tection afforded by rHPIV1-C�170-F1 and rB/HPIV3-F2 were verysimilar. The rHPIV1-LY942A-F1, -F2, and -F3 viruses did not pro-vide protection against RSV challenge, with the titers of the chal-lenge RSV loads being very similar to that of the rHPIV1-LY942A

empty vector. This was consistent with their lack of in vivo repli-cation and immunogenicity against RSV.

DISCUSSION

The goal of this study was to develop rHPIV1 as a vector express-ing the RSV F protein to provide a live attenuated bivalent vaccineagainst RSV and HPIV1. This would enable simultaneous immu-nization against two important pediatric viruses with a single bi-valent vaccine. Each of these pathogens lacks an approved vaccine,and the characteristics of epidemiology and the disease of RSV andHPIV1 overlap. Thus, an HPIV/RSV vaccine is a logical combina-

TABLE 3 Percentage of virus population expressing RSV F after in vivoreplicationa

Virus

Day 3 Day 5

% PFUexpressingRSV F

Total no.of plaques

% PFUexpressingRSV F

Total no.of plaques

rHPIV1-C�170-F1 100 (6/6)b 283 100 (5/6) 13298 (1/6) 51

rHPIV1-C�170-F2 100 (6/6) 87 NDc NDrHPIV1-C�170-F3 100 (6/6) 503 100 (6/6) 131a The percentage of the virus population expressing RSV F after in vivo replication wasdetermined by a double-staining immunofluorescence plaque assay. Vero cells wereinfected with serially diluted tissue homogenates of the nasal turbinates collected ondays 3 and 5 p.i. from hamsters infected with rHPIV1-C�170-F1, -F2, and -F3 (n � 6animals per virus per day; the results of the experiment are shown in Fig. 4) andincubated for 6 days under a methylcellulose overlay. Viral plaques were stained withmouse monoclonal anti-RSV F and goat polyclonal anti-HPIV1 antibodies, followed bydetection with corresponding infrared dye-conjugated secondary antibodies. Thepercentages of plaques expressing both RSV F and HPIV1 antigens are shown. rHPIV1-C�170-F1, -F2, and -F3 in lung tissue samples and rHPIV1-LY942A-F1, -F2, and -F3 innasal turbinate and lung tissue samples could not be tested due to their lack ofreplication in these tissues (Fig. 4).b Data in parentheses represent the number of hamsters in that group of 6 for which theindicated percentage applies.c ND, no plaques were detected.

TABLE 4 RSV- and HPIV1-neutralizing serum antibody responses to the rHPIV1-RSV-F vectorsa

Immunizing virus

Neutralizing serum antibody responseb (mean reciprocal log2 PRNT60 � SE) to:

RSV HPIV1

Preimmunization Day 28 Preimmunization Day 28

rHPIV1-C�170 �3.3 �3.3 (A) �1 3.9 � 0.3 (A)rHPIV1-LY942A �3.3 �3.3 (A) �1 �1 (B)rHPIV1-C�170-F1 �3.3 7.3 � 0.3 (B, C) �1 2.8 � 0.5 (A)rHPIV1-C�170-F2 �3.3 4.7 � 0.7 (C) �1 �1 (B)rHPIV1-C�170-F3 �3.3 6.7 � 0.8 (C, B) �1 �1 (B)rHPIV1-LY942A-F1 �3.3 �3.3 (A) �1 �1 (B)rHPIV1-LY942A-F2 �3.3 �3.3 (A) �1 �1 (B)rHPIV1-LY942A-F3 �3.3 �3.3 (A) �1 �1 (B)rB/HPIV3-F2 �3.3 9.7 � 0.4 (D) �1 �1 (B)wt RSV �3.3 11.3 � 0.4 (D) �1 �1 (B)a Groups of 6-week-old hamsters (n � 6) were immunized i.n. with 105 TCID50 of each indicated virus in a 0.1-ml inoculum.b Serum samples were collected on day 0 prior to immunization and at day 28 p.i. Antibody titers against RSV and HPIV1 were determined by using 60% plaque reductionneutralization tests (PRNT60) and GFP-expressing viruses. The limits of detection were 3.3 and 1.0 reciprocal log2 PRNT60 for RSV and HPIV1, respectively. The statisticalsignificance of the differences among the groups for RSV antibody titers was determined by one-way analysis of variance with Tukey’s multiple-comparison posttest (P � 0.05), andthat for HPIV1 antibody titers was determined by an unpaired t test. Mean neutralizing antibody titers were categorized into groups A, B, C, and D, indicated in parentheses. Titerswith different letters are statistically different from each other; titers with two letters are not statistically different from those with either letter.

Mackow et al.

10328 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

tion that would broaden the coverage against pediatric respiratorytract disease. Attenuation for RSV and the HPIVs must be donecarefully to avoid overattenuation and loss of immunogenicity.Therefore, we evaluated several variables in an effort to identifysuitable rHPIV1-RSV-F constructs.

First, we evaluated two rHPIV1 backbones that each containeda different HPIV1-attenuating mutation developed in previousstudies (24–26, 35), namely, the C�170 and the LY942A mutations.Each of these was designed for stability against deattenuation, andboth are present (together with additional mutations) in the vac-cine candidate rHPIV1-CR84G/�170HN553ALY942A that was recentlyfound to be overattenuated in HPIV1-seronegative infants andchildren (43). Since the insertion of an added heterologous genetypically confers attenuation, in the present study we includedonly a single mutation, C�170 or LY942A, into each backbone, inaddition to the RSV F insert, in order to avoid overattenuation.

A second variable was that the C�170 and LY942A mutations havedifferent mechanisms of attenuation. Specifically, the C�170 mu-tation reduces viral inhibition of host interferon and apoptosisresponses and thus has the potential for increased immunogenic-ity, since these responses can have adjuvant effects (44). In addi-tion, the C�170 mutation does not confer temperature sensitivityand may thus allow some replication in the lungs that might in-crease immunogenicity. In contrast, the LY942A mutation is astrong temperature sensitivity-conferring mutation, which isthought to disproportionately restrict replication in the lower(warmer) respiratory tract and may thus reduce the possibility oflower respiratory tract reactogenicity.

As a third variable, we evaluated three different insertion sites,

namely, the first, second, and third gene positions (F1, F2, and F3,respectively). Placement of a gene closer to the promoter in anonsegmented negative-strand RNA virus typically increases itsrate of transcription, and this can further influence attenuation inat least two ways: (i) increased expression of the RSV F proteincould interfere with vector replication due to syncytium forma-tion and other effects, and (ii) the presence of an added gene canreduce the transcription of downstream vector genes, with pro-moter-proximal inserts affecting a greater number of vector genes.In addition, we have found that, for reasons that are not clear orpredictable, a particular construct can occasionally have an unex-pectedly high degree of attenuation, as was observed with the rB/HPIV3-F3 construct in a previous study (21) and the rHPIV1-LY942A-F2 construct in the present study.

The vectors were constructed using an F ORF sequence thathad previously been codon optimized for expression in humancells (34). The sequence of the expressed F protein was also de-signed previously (34) to be identical at the amino acid level to thesequence of the earliest available passage of strain A2, calledHEK-7, because of the human embryonic kidney cell line used atthat time. As previously discussed (34), the encoded HEK F pro-tein has a hypofusogenic phenotype that may represent the fusionphenotype of the native A2 clinical isolate (34).

All six rHPIV1-RSV-F constructs with the exception ofrHPIV1-LY942A-F2 were readily recovered. Nine independenttransfections were required to recover a clone of the rHPIV1-LY942A-F2 construct that was free of adventitious mutations. Infive of the eight mutated clones, the adventitious mutations wereones that likely reduce or ablate expression of the RSV F insert and

FIG 5 Protection against challenge wt RSV replication in the nasal turbinates (A) and lungs (B) of hamsters previously immunized with the rHPIV1-RSV-F vectors.Hamsters (n � 6 per group) were inoculated i.n. with the viruses indicated along the x axis (the same animals were used to evaluate immunogenicity; Table 4), and at 30days p.i., each animal was challenged i.n. with 106 PFU of wt RSV A2. Three days later, the animals were sacrificed, the nasal turbinates and lungs were collected andprepared as tissue homogenates, and the titer of challenge RSV (log10 PFU per gram of tissue) was determined by plaque assay on Vero cells. The mean value for eachgroup is shown as a boldface number and by a horizontal bar. The statistical significance of the differences between viruses was determined by one-way analysis ofvariance with Tukey’s multiple-comparison posttest using the 95% confidence interval and is indicated as follows: *, P � 0.05; **, P � 0.01; ****, P � 0.0001; ns, notsignificant (P � 0.05).

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10329Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

were reminiscent of ones described previously in the rB/HPIV3-F2 virus from the nasal washes of vaccinated children (20).The other three mutant clones had mutations in the N and/or Lprotein whose effects are unknown. Since the RSV F-gene insertand the insertion site of the rHPIV1-LY942A-F2 virus were identicalto those of the rHPIV1-C�170-F2 virus this suggests that insertioninto the second position was not sufficient alone to achieve theseeffects of inefficient recovery and the frequent occurrence of adven-titious mutations. In addition, the observation that these effects wereobserved with the rHPIV1-LY942A-F2 virus but not the F1 and F3derivatives suggests that the LY942A mutation alone was also not suf-ficient to achieve these effects; thus, they appeared to be due to thecombination of the F2 gene position and the LY942A mutation.

All of the rHPIV1-RSV-F vectors, including rHPIV1-LY942A-F2, replicated in Vero and LLC-MK2 cells to final titers that werestatistically indistinguishable from those of wt HPIV1 (Fig. 2).Some reductions in replication kinetics were observed during ex-ponential-phase replication (e.g., day 2). For example, the LY942A

mutation generally reduced the growth rate more than the C�170

mutation, especially in Vero cells. Also, the attenuating effect ofthe RSV F insert was generally greater in the LY942A backbone,suggesting that the RSV F insert has a greater effect on a moreattenuated backbone. There was some evidence of a greater reduc-tion in the growth rate in association with promoter-proximalinserts: for example, among the rHPIV1-C�170-RSV-F viruses, agreater reduction was observed for the F1 and F2 viruses in Verocells and for the F1 virus in LLC-MK2 cells, whereas the growthrate of the F3 virus was similar to that of the empty vector and wtHPIV1. However, since these various differences were not re-flected in the final titers, all of these constructs would be amenableto vaccine manufacture.

Analysis of intracellular protein expression in Vero cells usingWestern blotting showed that the rHPIV1-C�170-F1, -F2, and -F3constructs expressed high levels of RSV F protein with little evi-dence of a polar gradient. With the rHPIV1-LY942A vectors ex-pressing RSV F, the expression of the RSV F protein by the F1construct was high and comparable to that by the rHPIV1-C�170-RSV-F constructs, whereas the expression by the F2 and F3 con-structs was greatly reduced. With regard to the effect of the RSV Finsert on the expression of vector proteins in the rHPIV1-C�170

and rHPIV1-LY942A backbones, the results were variable. In twocases (the rHPIV1-C�170-F1 and -F2 viruses), the expression ofthose genes that were downstream of the RSV F insert were re-duced compared to those in the empty vector, consistent with theexpected effect on the transcriptional gradient. In one case (therHPIV1-LY942A-F2 virus), the expression of both upstream anddownstream genes were reduced, an effect that might be related tothe debilitated nature of this construct exemplified by the reducedefficiency of recovery and the frequent occurrence of adventitiousmutations. In the other three cases (the rHPIV1-C�170-F3 andrHPIV1-LY942A-F1 and -F3 viruses), there was no significant re-duction in the expression of the vector genes compared to that inthe respective empty vectors.

The insertion of RSV F into either vector backbone increasedthe level of temperature sensitivity in a number of cases. Viruswith the C�170 backbone was marginally temperature sensitive,and this was increased for the F1 derivative but not for F2 or F3.The LY942A construct was substantially more temperature sensi-tive, and this was further increased for the F1 and F2 derivativesbut not for F3. The basis for the increases in temperature sensitiv-

ity is unclear: it may be related to reductions in vector proteinsynthesis. As noted above, the temperature sensitivity of a vaccinevirus would be expected to reduce reactogenicity in the lower re-spiratory tract.

The rHPIV1 constructs were evaluated for replication and im-munogenicity in hamsters. The rHPIV1-C�170 empty vector wasmore attenuated than wt HPIV1 in the nasal turbinates and, to agreater degree, in the lungs. Compared to the rHPIV1-C�170

empty vector, the F2 derivative was more attenuated in the nasalturbinates, and all three derivatives (F1, F2, and F3) were moreattenuated in the lungs, with no replication being detectable in thelungs of most of the animals. The rHPIV1-LY942A empty vectorwas much more attenuated than wt HPIV1 in both the nasal tur-binates and lungs on day 3, with no virus being detectable in thenasal turbinates of 3/6 of the animals or in the lungs of any of theanimals; no replication in either compartment was detected onday 5. The rHPIV1-LY942A-F1 and -F3 derivatives were furtherattenuated in the nasal turbinates, whereas the general lack ofreplication in the lungs made it impossible to assess further atten-uation in that compartment. Curiously, the F2 derivative repli-cated in the nasal turbinates somewhat more efficiently than theempty vector, which was surprising, given the somewhat debili-tated nature of this virus in other assays. The rHPIV1-CR84G/�170-HN553ALY942A vaccine candidate, which was included as a control,did not replicate detectably in the nasal turbinates or lungs of anyanimal. Since this virus is overattenuated in seronegative infantsand children (43), an appropriate rHPIV1-RSV-F candidate shouldbe less attenuated, which was the case with the rHPIV1-C�170-F1,-F2, and -F3 constructs.

In the immunized hamsters, RSV-specific serum NAb re-sponses were detected for the rHPIV1-C�170-F1, -F2, and -F3 con-structs but not for any of the rHPIV1-LY942A-based constructs.The titer of NAbs induced by the rHPIV1-C�170-F1 construct wasthe highest, followed in order by the F3 construct and the F2construct. The titers of NAbs correlated with the magnitude of invivo replication rather than the amount of intracellular synthesisof the RSV F protein measured in vitro. These titers were signifi-cantly lower than those induced by rB/HPIV3-F2 or wt RSV.However, these controls proved to not be ideal. In the case of therB/HPIV3-F2 control, this virus replicated much more efficientlyin the nasal turbinates and lungs than any of the rHPIV1-RSV-Fconstructs, and therefore, it is not surprising that it was substan-tially more immunogenic. However, since wt HPIV1 did not rep-licate much more efficiently than the rB/HPIV3-F2 construct,even though the latter is attenuated and the former is not, it ap-pears that hamsters are more permissive for the rB/HPIV3 back-bone than the HPIV1 backbone. This would not be the case inhumans, since the rB/HPIV3 backbone has been shown to be at-tenuated and well tolerated, whereas wt HPIV1 is not attenuated,and therefore, we anticipate that in humans the HPIV1-basedconstructs will have immunogenicity greater than that suggestedby the hamster model. wt RSV was also used as a control for im-munogenicity, but it was also not ideal because it replicates evenmore efficiently than rB/HPIV3-F2 (34) and expresses two RSVneutralization antigens, whereas only F is expressed by the HPIVvectors. Therefore, the immunogenicity of the rHPIV1-C�170-RSV-F constructs is probably more promising than might be sug-gested by the present comparison to rB/HPIV3-F2 and wt RSV.

Protective efficacy was evaluated by challenge with wt RSV. Pro-tection was statistically significant for rHPIV1-C�170-F1 in both the

Mackow et al.

10330 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

nasal turbinates and lungs and for rHPIV1-C�170-F3 in the nasal tur-binates only. Protection was not significant for the rHPIV1-C�170-F2construct, despite its ability to induce a moderate titer of RSV-neu-tralizing serum antibodies. Importantly, the protection conferred bythe rHPIV1-C�170-F1 construct was statistically indistinguishablefrom that of the rB/HPIV3-F2 control. This was somewhat unex-pected, because rHPIV1-C�170-F1 induced significantly lower RSVNAb titers than rB/HPIV3-F2. Consistent with their lack of immu-nogenicity, the rHPIV1-LY942A-F1, -F2, and -F3 constructs did notprovide detectable protection.

Previous clinical evaluation of the rB/HPIV3-F2 constructshowed that the stability of RSV F expression is an importantconsideration (20). In that study, 2.5% of the virus in the clinicaltrial material used for human administration did not express RSVF, and approximately half of the nasal wash specimens from vac-cine recipients contained virus with mutations expected to reduceor ablate expression of the RSV F insert (20). This suggests that invitro and in vivo there was selection of variants in which expressionof the RSV F insert had been silenced. In the present study, weevaluated the stability of RSV F expression by coimmunostainingfor RSV F and HPIV1 antigens in a double-staining immunoflu-orescence plaque assay. This was done for our virus stocks and alsofor virus recovered from tissue homogenates of infected hamsters.This showed that expression of the RSV F protein by the rHPIV1vectors was quite stable, with close to 100% of the plaques express-ing the RSV F antigen. This suggests that there was not a strongselective pressure in vitro or in vivo for variants in which expres-sion of the RSV F protein had been silenced. However, this willwarrant careful monitoring in future studies.

In summary, this study evaluated a number of variables andidentified the rHPIV1-C�170 backbone as a promising vector forexpressing the RSV F protein to develop an attenuated bivalentRSV/HPIV1 vaccine candidate. The F1, F2, and F3 sites appearedto be suitable in this backbone, with the F1 (pre-N) site appearingto be the most immunogenic and protective. This construct hasseveral desirable features: (i) the C�170 mutation has been stabi-lized against deattenuation; (ii) this mutation has been character-ized, has already been used in a candidate evaluated in humans,and has the potential to enhance immunogenicity; (iii) this can-didate replicated in Vero cells to final titers similar to that of wtHPIV1, an essential feature for vaccine manufacture; (iv) it wasmore attenuated than the rB/HPIV3-F2 construct, and its level ofprotective efficacy was statistically indistinguishable from that ofthe rB/HPIV3-F2 construct; (v) the construct was stable for RSVF-protein expression after in vitro and in vivo replication; and (vi)it was the most immunogenic vector inducing the highest titers ofRSV and HPIV1 NAbs and was also the most protective against awt RSV challenge. The rHPIV1-C�170-F1 candidate is suitable forfurther evaluation in nonhuman primates and could also be modifiedto express a stabilized prefusion form of the RSV F protein (45) thatmight induce an immune response with an increased quantity andquality of RSV NAbs. An rHPIV1-vectored pediatric RSV vaccinecould be used either as a primary RSV vaccine or to boost immunityinduced by a previous live attenuated RSV vaccine.

ACKNOWLEDGMENTS

We thank Mario Skiadopoulos for providing antipeptide antisera againstthe HPIV1 N, P, F, and HN proteins, Fatemeh Davoodi for technicalassistance, and staff from the Comparative Medicine Branch, NIAID,

NIH, for their technical help in the care and management of the animalsused in the experiments.

This study was supported by the Intramural Research Program ofNIAID, NIH.

REFERENCES1. Nair H, Nokes DJ, Gessner BD, Dherani M, Madhi SA, Singleton RJ,

O’Brien KL, Roca A, Wright PF, Bruce N, Chandran A, Theodoratou E,Sutanto A, Sedyaningsih ER, Ngama M, Munywoki PK, KartasasmitaC, Simoes EA, Rudan I, Weber MW, Campbell H. 2010. Global burdenof acute lower respiratory infections due to respiratory syncytial virus inyoung children: a systematic review and meta-analysis. Lancet 375:1545–1555. http://dx.doi.org/10.1016/S0140-6736(10)60206-1.

2. Karron RA, Collins PL. 2007. Parainfluenza viruses, p 1497–1520. InKnipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B,Straus SE (ed), Fields virology, 5th ed. Lippincott Williams & Wilkins,Philadelphia, PA.

3. Kapikian AZ, Mitchell RH, Chanock RM, Shvedoff RA, Stewart CE.1969. An epidemiologic study of altered clinical reactivity to respiratorysyncytial (RS) virus infection in children previously vaccinated with aninactivated RS virus vaccine. Am J Epidemiol 89:405– 421.

4. Kim HW, Canchola JG, Brandt CD, Pyles G, Chanock RM, Jensen K,Parrott RH. 1969. Respiratory syncytial virus disease in infants despiteprior administration of antigenic inactivated vaccine. Am J Epidemiol89:422– 434.

5. Connors M, Collins PL, Firestone CY, Sotnikov AV, Waitze A, DavisAR, Hung PP, Chanock RM, Murphy BR. 1992. Cotton rats previouslyimmunized with a chimeric RSV FG glycoprotein develop enhanced pul-monary pathology when infected with RSV, a phenomenon not encoun-tered following immunization with vaccinia-RSV recombinants or RSV.Vaccine 10:475– 484. http://dx.doi.org/10.1016/0264-410X(92)90397-3.

6. Murphy BR, Sotnikov AV, Lawrence LA, Banks SM, Prince GA.1990. Enhanced pulmonary histopathology is observed in cotton ratsimmunized with formalin-inactivated respiratory syncytial virus(RSV) or purified F glycoprotein and challenged with RSV 3– 6 monthsafter immunization. Vaccine 8:497–502. http://dx.doi.org/10.1016/0264-410X(90)90253-I.

7. Bernstein DI, Malkin E, Abughali N, Falloon J, Yi T, Dubovsky F,MI-CP149 Investigators. 2012. Phase 1 study of the safety and immuno-genicity of a live, attenuated respiratory syncytial virus and parainfluenzavirus type 3 vaccine in seronegative children. Pediatr Infect Dis J 31:109 –114. http://dx.doi.org/10.1097/INF.0b013e31823386f1.

8. Wright PF, Karron RA, Belshe RB, Shi JR, Randolph VB, Collins PL,O’Shea AF, Gruber WC, Murphy BR. 2007. The absence of enhanceddisease with wild type respiratory syncytial virus infection occurring afterreceipt of live, attenuated, respiratory syncytial virus vaccines. Vaccine25:7372–7378. http://dx.doi.org/10.1016/j.vaccine.2007.08.014.

9. Ottolini MG, Porter DD, Hemming VG, Prince GA. 2000. Enhancedpulmonary pathology in cotton rats upon challenge after immunizationwith inactivated parainfluenza virus 3 vaccines. Viral Immunol 13:231–236. http://dx.doi.org/10.1089/vim.2000.13.231.

10. Murphy BR, Alling DW, Snyder MH, Walsh EE, Prince GA, ChanockRM, Hemming VG, Rodriguez WJ, Kim HW, Graham BS, Wright PF.1986. Effect of age and preexisting antibody on serum antibody responseof infants and children to the F and G glycoproteins during respiratorysyncytial virus infection. J Clin Microbiol 24:894 – 898.

11. Karron RA, Buchholz UJ, Collins PL. 2013. Live-attenuated respiratorysyncytial virus vaccines. Curr Top Microbiol Immunol 372:259 –284. http://dx.doi.org/10.1007/978-3-642-38919-1_13.

12. Schmidt AC, Schaap-Nutt A, Bartlett EJ, Schomacker H, Boonyaratana-kornkit J, Karron RA, Collins PL. 2011. Progress in the development ofhuman parainfluenza virus vaccines. Expert Rev Respir Med 5:515–526.http://dx.doi.org/10.1586/ers.11.32.

13. Bartlett EJ, Cruz AM, Esker J, Castano A, Schomacker H, Surman SR,Hennessey M, Boonyaratanakornkit J, Pickles RJ, Collins PL, MurphyBR, Schmidt AC. 2008. Human parainfluenza virus type 1 C proteins arenonessential proteins that inhibit the host interferon and apoptotic re-sponses and are required for efficient replication in nonhuman primates.J Virol 82:8965– 8977. http://dx.doi.org/10.1128/JVI.00853-08.

14. Nagai Y. 1999. Paramyxovirus replication and pathogenesis. Reverse ge-netics transforms understanding. Rev Med Virol 9:83–99.

15. Skiadopoulos MH, Surman SR, Riggs JM, Orvell C, Collins PL, Murphy

Live Attenuated HPIV1-Vectored RSV Vaccines

October 2015 Volume 89 Number 20 jvi.asm.org 10331Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

BR. 2002. Evaluation of the replication and immunogenicity of recombi-nant human parainfluenza virus type 3 vectors expressing up to threeforeign glycoproteins. Virology 297:136 –152. http://dx.doi.org/10.1006/viro.2002.1415.

16. Karron RA, Collins PL. 2007. Respiratory syncytial virus and metapneu-movirus, p 1601–1636. In Knipe DM, Howley PM, Griffin DE, Lamb RA,Martin MA, Roizman B, Straus SE (ed), Fields virology, 5th ed. LippincottWilliams & Wilkins, Philadelphia, PA.

17. Schmidt AC, McAuliffe JM, Murphy BR, Collins PL. 2001. Recombi-nant bovine/human parainfluenza virus type 3 (B/HPIV3) expressing therespiratory syncytial virus (RSV) G and F proteins can be used to achievesimultaneous mucosal immunization against RSV and HPIV3. J Virol75:4594 – 4603. http://dx.doi.org/10.1128/JVI.75.10.4594-4603.2001.

18. Schmidt AC, Wenzke DR, McAuliffe JM, St Claire M, Elkins WR,Murphy BR, Collins PL. 2002. Mucosal immunization of rhesus monkeysagainst respiratory syncytial virus subgroups A and B and human parain-fluenza virus type 3 by using a live cDNA-derived vaccine based on a hostrange-attenuated bovine parainfluenza virus type 3 vector backbone. JVirol 76:1089 –1099. http://dx.doi.org/10.1128/JVI.76.3.1089-1099.2002.

19. Tang RS, Schickli JH, MacPhail M, Fernandes F, Bicha L, Spaete J,Fouchier RA, Osterhaus AD, Spaete R, Haller AA. 2003. Effects ofhuman metapneumovirus and respiratory syncytial virus antigen inser-tion in two 3= proximal genome positions of bovine/human parainfluenzavirus type 3 on virus replication and immunogenicity. J Virol 77:10819 –10828. http://dx.doi.org/10.1128/JVI.77.20.10819-10828.2003.

20. Yang CF, Wang CK, Malkin E, Schickli JH, Shambaugh C, Zuo F,Galinski MS, Dubovsky F, Study Group, Tang RS. 2013. Implication ofrespiratory syncytial virus (RSV) F transgene sequence heterogeneity ob-served in phase 1 evaluation of MEDI-534, a live attenuated parainfluenzatype 3 vectored RSV vaccine. Vaccine 31:2822–2827. http://dx.doi.org/10.1016/j.vaccine.2013.04.006.

21. Liang B, Munir S, Amaro-Carambot E, Surman S, Mackow N, Yang L,Buchholz UJ, Collins PL, Schaap-Nutt A. 2014. Chimeric bovine/humanparainfluenza virus type 3 expressing respiratory syncytial virus (RSV) Fglycoprotein: effect of insert position on expression, replication, immu-nogenicity, stability, and protection against RSV infection. J Virol 88:4237– 4250. http://dx.doi.org/10.1128/JVI.03481-13.

22. Counihan ME, Shay DK, Holman RC, Lowther SA, Anderson LJ. 2001.Human parainfluenza virus-associated hospitalizations among childrenless than five years of age in the United States. Pediatr Infect Dis J 20:646 –653. http://dx.doi.org/10.1097/00006454-200107000-00003.

23. Reed G, Jewett PH, Thompson J, Tollefson S, Wright PF. 1997. Epide-miology and clinical impact of parainfluenza virus infections in otherwisehealthy infants and young children �5 years old. J Infect Dis 175:807– 813.http://dx.doi.org/10.1086/513975.

24. Bartlett EJ, Amaro-Carambot E, Surman SR, Collins PL, Murphy BR,Skiadopoulos MH. 2006. Introducing point and deletion mutations intothe P/C gene of human parainfluenza virus type 1 (HPIV1) by reversegenetics generates attenuated and efficacious vaccine candidates. Vaccine24:2674 –2684. http://dx.doi.org/10.1016/j.vaccine.2005.10.047.

25. Bartlett EJ, Castano A, Surman SR, Collins PL, Skiadopoulos MH,Murphy BR. 2007. Attenuation and efficacy of human parainfluenza virustype 1 (HPIV1) vaccine candidates containing stabilized mutations in theP/C and L genes. Virol J 4:67. http://dx.doi.org/10.1186/1743-422X-4-67.

26. Newman JT, Riggs JM, Surman SR, McAuliffe JM, Mulaikal TA, CollinsPL, Murphy BR, Skiadopoulos MH. 2004. Generation of recombinanthuman parainfluenza virus type 1 vaccine candidates by importation oftemperature-sensitive and attenuating mutations from heterologousparamyxoviruses. J Virol 78:2017–2028. http://dx.doi.org/10.1128/JVI.78.4.2017-2028.2004.

27. McAuliffe JM, Surman SR, Newman JT, Riggs JM, Collins PL, MurphyBR, Skiadopoulos MH. 2004. Codon substitution mutations at two po-sitions in the L polymerase protein of human parainfluenza virus type 1yield viruses with a spectrum of attenuation in vivo and increased pheno-typic stability in vitro. J Virol 78:2029 –2036. http://dx.doi.org/10.1128/JVI.78.4.2029-2036.2004.

28. Buchholz UJ, Finke S, Conzelmann KK. 1999. Generation of bovinerespiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essentialfor virus replication in tissue culture, and the human RSV leader regionacts as a functional BRSV genome promoter. J Virol 73:251–259.

29. Skiadopoulos MH, Tao T, Surman SR, Collins PL, Murphy BR. 1999.Generation of a parainfluenza virus type 1 vaccine candidate by replacingthe HN and F glycoproteins of the live-attenuated PIV3 cp45 vaccine virus

with their PIV1 counterparts. Vaccine 18:503–510. http://dx.doi.org/10.1016/S0264-410X(99)00227-3.

30. Newman JT, Surman SR, Riggs JM, Hansen CT, Collins PL, Murphy BR,Skiadopoulos MH. 2002. Sequence analysis of the Washington/1964 strain ofhuman parainfluenza virus type 1 (HPIV1) and recovery and characterizationof wild-type recombinant HPIV1 produced by reverse genetics. Virus Genes24:77–92. http://dx.doi.org/10.1023/A:1014042221888.

31. Calain P, Roux L. 1993. The rule of six, a basic feature for efficient replication ofSendai virus defective interfering RNA. J Virol 67:4822–4830.

32. Kolakofsky D, Pelet T, Garcin D, Hausmann S, Curran J, Roux L. 1998.Paramyxovirus RNA synthesis and the requirement for hexamer genomelength: the rule of six revisited. J Virol 72:891– 899.

33. Whitehead SS, Juhasz K, Firestone CY, Collins PL, Murphy BR.1998. Recombinant respiratory syncytial virus (RSV) bearing a set ofmutations from cold-passaged RSV is attenuated in chimpanzees. JVirol 72:4467– 4471.

34. Liang B, Surman S, Amaro-Carambot E, Kabatova B, Mackow N,Lingemann M, Yang L, McLellan JS, Graham BS, Kwong PD,Schaap-Nutt A, Collins PL, Munir S. 8 July 2015. Enhanced neutral-izing antibody response induced by respiratory syncytial virus pre-fusion F protein expressed by a vaccine candidate. J Virol. http://dx.doi.org/10.1128/JVI.01373-15.

35. Bartlett EJ, Amaro-Carambot E, Surman SR, Newman JT, Collins PL,Murphy BR, Skiadopoulos MH. 2005. Human parainfluenza virus type I(HPIV1) vaccine candidates designed by reverse genetics are attenuatedand efficacious in African green monkeys. Vaccine 23:4631– 4646. http://dx.doi.org/10.1016/j.vaccine.2005.04.035.

36. Bartlett EJ, Cruz AM, Boonyaratanakornkit J, Esker J, Castano A,Skiadopoulos MH, Collins PL, Murphy BR, Schmidt AC. 2010. A novelhuman parainfluenza virus type 1 (HPIV1) with separated P and C genesis useful for generating C gene mutants for evaluation as live-attenuatedvirus vaccine candidates. Vaccine 28:767–779. http://dx.doi.org/10.1016/j.vaccine.2009.10.069.

37. Coates HV, Alling DW, Chanock RM. 1966. An antigenic analysis ofrespiratory syncytial virus isolates by a plaque reduction neutralizationtest. Am J Epidemiol 83:299 –313.

38. Coates HV, Forsyth BR, Chanock RM. 1966. Biophysical studies ofrespiratory syncytial virus. I. Density of respiratory syncytial virus andassociated complement-fixing antigens in cesium chloride density gradi-ent. J Bacteriol 91:1263–1269.

39. van Wyke Coelingh KL, Winter CC, Tierney EL, London WT, MurphyBR. 1988. Attenuation of bovine parainfluenza virus type 3 in nonhumanprimates and its ability to confer immunity to human parainfluenza virustype 3 challenge. J Infect Dis 157:655– 662. http://dx.doi.org/10.1093/infdis/157.4.655.

40. Munir S, Le Nouen C, Luongo C, Buchholz UJ, Collins PL, Bukreyev A.2008. Nonstructural proteins 1 and 2 of respiratory syncytial virus sup-press maturation of human dendritic cells. J Virol 82:8780 – 8796. http://dx.doi.org/10.1128/JVI.00630-08.

41. Durbin AP, Karron RA. 2003. Progress in the development of respiratorysyncytial virus and parainfluenza virus vaccines. Clin Infect Dis 37:1668 –1677. http://dx.doi.org/10.1086/379775.

42. Luongo C, Winter CC, Collins PL, Buchholz UJ. 2013. Respiratory syncytialvirus modified by deletions of the NS2 gene and amino acid S1313 of the Lpolymerase protein is a temperature-sensitive, live-attenuated vaccine candi-date that is phenotypically stable at physiological temperature. J Virol 87:1985–1996. http://dx.doi.org/10.1128/JVI.02769-12.

43. Karron RA, Mateo JC, Thumar B, Schaap-Nutt A, Buchholz UJ,Schmidt AC, Bartlett EJ, Murphy BR, Collins PL. 12 November 2014.Evaluation of a live-attenuated human parainfluenza type 1 vaccine inadults and children. J Pediatr Infect Dis Soc. http://dx.doi.org/10.1093/jpids/piu104.

44. Leitner WW, Hwang LN, Bergmann-Leitner ES, Finkelstein SE, FrankS, Restifo NP. 2004. Apoptosis is essential for the increased efficacy ofalphaviral replicase-based DNA vaccines. Vaccine 22:1537–1544. http://dx.doi.org/10.1016/j.vaccine.2003.10.013.

45. McLellan JS, Chen M, Joyce MG, Sastry M, Stewart-Jones GB, Yang Y,Zhang B, Chen L, Srivatsan S, Zheng A, Zhou T, Graepel KW, KumarA, Moin S, Boyington JC, Chuang GY, Soto C, Baxa U, Bakker AQ,Spits H, Beaumont T, Zheng Z, Xia N, Ko SY, Todd JP, Rao S, GrahamBS, Kwong PD. 2013. Structure-based design of a fusion glycoproteinvaccine for respiratory syncytial virus. Science 342:592–598. http://dx.doi.org/10.1126/science.1243283.

Mackow et al.

10332 jvi.asm.org October 2015 Volume 89 Number 20Journal of Virology

on February 11, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from