Aw

AMa

b

c

a

ARRAA

KGKGPP

1

gfg

0

Animal Reproduction Science 151 (2014) 71–77

Contents lists available at ScienceDirect

Animal Reproduction Science

jou rn al hom epage : w ww.elsev ier .com/ locate /an i r eprosc i

ssociation analysis of polymorphisms in caprine KiSS1 geneith reproductive traits

. Maitraa, Rekha Sharmaa,∗, Sonika Ahlawata, M.S. Tantiaa,anoranjan Royb, Ved Prakashc

National Bureau of Animal Genetic Resources, Karnal, IndiaWest Bengal University of Animal and Fishery Sciences, Kolkata, IndiaCentral Sheep and Wool Research Institute, Avikanagar, India

r t i c l e i n f o

rticle history:eceived 1 May 2014eceived in revised form 1 September 2014ccepted 16 September 2014vailable online 28 September 2014

eywords:oatsiSS1PR54recocityrolificacy

a b s t r a c t

KiSS1 is considered to be a key mediator of molecular mechanism of reproduction (pubertyand prolificacy) in mammals. Kisspeptins are a family of structurally related peptides,encoded by KiSS1 gene, with ability to regulate gonadotropin-releasing hormone and hencehypothalamic–pituitary–gonadal axis. The present study investigated the polymorphismof caprine KiSS1 gene in 9 Indian goat breeds differing in sexual precocity and prolificacy.Comparison of KiSS1 amplified sequences of indigenous goats resulted in identificationof nine SNPs (intron (1) G296C, T455G, T505A, T693C, T950C and intron (2) T1125C,A2510G, C2540T, A2803G) of which four are novel. These loci were not segregating together(r2 < 0.33). Mutations existed in both, sexually precocious and late-maturing goat breeds aswell as low and high prolificacy goat breeds. Three loci reported to be associated with goatlitter size (G296C, G2510A and C2540T) were identified in Indian goats as well. Associa-tion between loci of KiSS1 gene and age of puberty as well as litter size was explored inBlack Bengal (N = 158), a sexually precocious and prolific goat breed of India by designingPCR–RFLP. None of the mutations were found to be associated with reproductive traits how-ever, difference in litter size as well age of sexual maturity for different genotypes indicatesthat the study on additional data based on more number of breeds and animals would

be interesting to perform. Considering the importance of the reproductive trait in smallruminants, the results extend the limited information on genetic variation of the caprineKiSS1, which might contribute toward molecular breeding to enhance productivity ofgoat.

© 2014 Elsevier B.V. All rights reserved.

. Introduction

The Kisspeptin/GPR54 pathway is considered as a key

atekeeper of pubertal development and reproductiveunction. So far, there have been some studies of KiSS1ene as a candidate gene for reproductive traits in animals,

∗ Corresponding author. Tel.: +91 9255482422; fax: +91 184 2267654.E-mail address: rekvik@gmail.com (R. Sharma).

http://dx.doi.org/10.1016/j.anireprosci.2014.09.013378-4320/© 2014 Elsevier B.V. All rights reserved.

which revealed that this gene plays an important rolein animal reproduction (Ardlie et al., 2002; Huijbregtset al., 2012; Tomikawa et al., 2010). Kisspeptins are thepeptide products of KiSS1 gene, which operate via theircognate receptors, G-protein-coupled receptor (GPR54).These neuropeptides have emerged as essential upstream

regulators of neurons that reside in the basal forebrainand produce Gonadotropin Releasing Hormone (GnRH)(Popa et al., 2005; Knoll et al., 2013). Human KiSS1 genemaps to chromosome 1q32 and consists of three exons

roduction Science 151 (2014) 71–77

72 A. Maitra et al. / Animal Rep

(West et al., 1998; Luan et al., 2007). The latter two exonsof KiSS1 gene are finally translated into a 145 amino acidprotein along with a putative signal sequence, from whichdifferent forms of kisspeptin consisting 54, 14, 13 and 10amino acid are derived (Luan et al., 2007). KiSS1 neurons inthe hypothalamus participate in crucial features of repro-ductive maturation and function, such as brain-level sexdifferentiation, puberty onset and neuroendocrine regula-tion of gonadotropin secretion and ovulation (Caraty et al.,2010).

Mutations of GPR54 (KiSS1R) are associated with hypog-onadotrophic hypogonadism in humans (de Roux et al.,2003; Seminara et al., 2003), a phenotype which is alsoobserved in mice carrying inactivating mutations of KiSS1gene (Tena-Sempere, 2010). Activated mutations of KiSS1gene (Ko et al., 2010; Luan et al., 2007) have been shownto cause central precocious puberty (CPP) in humans withmaturation of the hypothalamic–pituitary–gonadal (ovar-ian) axis (HPGA) by a gonadotropin dependent manner.

Up to now, the literature concerning KiSS1 and goatreproduction is limited. Due to the importance of KiSS1as a regulator of puberty onset, it is probable that thepolymorphisms in this gene have some relationship withreproductive traits such as high prolificacy, sexual pre-cocity and year-round estrus phenotypes of goats. Indiangoat breeds differ pertaining to these reproductive traits.Goat genetic resource comprises of 23 recognized breedsin India (Sharma et al., 2013) which is valuable gene poolfor adaptive and economic traits, providing diversifiedgenetic material that can help to meet future challenges.Black Bengal goat is unique among all Indian goat breedsas these show significant characteristics of sexual pre-cocity and high prolificacy. The objectives of the presentstudy were firstly, to sequence characterize Indian goatKiSS1 gene through polymerase chain reaction (PCR) andsequence assembly; secondly, to identify single nucleotidepolymorphisms (SNPs) in the gene by sequence align-ment between goat breeds (Black-Bengal, Malabari, Beetal,Barbari, Osmanabadi, Sangamneri, Jakhrana, Ganjam andSirohi) differing in fecundity and age at puberty and finally,to study the relationship of the identified mutations withage at sexual maturity as well as litter size within BlackBengal goat.

2. Materials and methods

2.1. Animal selection, sample collection and DNAisolation

Nine well-recognized breeds of Indian goats from differ-ent geographic and agro-climatic parts across India (Fig. 1)were selected which differ in prolificacy (number of kidsper kidding) and age of sexual maturity (Table 1). Eachbreed was represented by five animals for polymorphismscanning. Unrelated animals were selected at random fromtheir breeding tracts by picking up only two samples perherd and only two herds per village. One hundred and fifty

eight Black Bengal goats were utilized (Kotulpur goat cumfodder form, West Bengal, India) for association betweenidentified genotypes in KiSS1 gene with reproductive traits(age of puberty and litter size at first, second, third and

Fig. 1. Geographical distribution of selected goat breeds.

fourth parity). Five milliliter blood per goat was collectedaseptically from the jugular vein in a vacutainer tube (B.D.Bioscience, Germany) containing EDTA as anticoagulant.All samples were delivered back to the laboratory in anice box. Genomic DNA was extracted from white bloodcells using standard phenol-chloroform extraction protocol(Sambrook et al., 1989).

2.2. Primers and PCR amplification

Three pairs of primers were utilized for amplification of5′UTR (includes exon 1 and intron 1), exon 2 and intron 2of KiSS1 gene (Table 2). Two pair of primers was designedaccording to the genomic DNA sequence of goat KiSS1gene (GU142847) and a primer pair was taken from lit-erature. The primers were synthesized by IDT (IntegratedDNA Technologies, Inc.). Polymerase chain reaction wascarried out in 25 �L reaction volumes with about 50–100 nggenomic DNA using i-cycler (BioRAD, USA). The reactionmixture consisted of 200 �M each of dATP, dCTP, dGTP,dTTP, 1.5 mM MgCl2, 50 pmol primer, 0.5 U Taq polymerase(Sigma–Aldrich®) and corresponding Taq buffer. Amplifi-cation conditions were as follows: initial denaturation for1 min at 94 ◦C; followed by 30 cycles of denaturation at94 ◦C for 1 min, annealing at precise temperature (Table 2)for 1 min, extension at 72 ◦C for 1 min; and finally extensionat 72 ◦C for 5 min. The PCR products were separated by elec-trophoresis on 1.8% agarose gels in parallel with a 100 bp

DNA ladder, enzymatically purified and sequenced fromboth directions using ABI-3100 Automated DNA Sequencer(Applied Biosystem, USA).

A. Maitra et al. / Animal Reproduction Science 151 (2014) 71–77 73

Table 1Geographical distribution and characteristics of selected Indian goat breeds.

Breed Geographical distribution Prolificacy Twinning percentage (%) Sexual maturity (age at puberty)

Beetal Punjab High >50 Medium (10–12months)Barbari Uttar Pradesh High >50 Medium (10–12months)Black-Bengal West Bengal, Bihar, Jharkhand High >50 Early (6–10 months)Malabari Kerala High >50 Early (6–10 months)Osmanabadi Maharashtra Medium 25–50 Medium (10–12months)Sangamneri Maharashtra Medium 25–50 Medium (10–12months)

2

VhwibTwuNsawut(mcc1Wp2

2

aprdepIe

TP

G

Jakhrana Rajasthan MediumGanjam Orissa Low

Sirohi Rajasthan Low

.3. Polymorphism screening

Sequence data were edited manually using Chromaser.2.33, (http//www.technelysium.com.au/chromas.tml). Multiple sequence alignments were performedith MegAlign program of LASERGENE software to

dentify SNPs. The sequence analysis was carried outy various modules of DNASTAR Version 4.0, Inc., USA.he coding DNA sequences of different exonic regionsere conceptually translated to amino acid sequencessing EDITSEQ software. Nucleotide BLAST program atCBI (http://www.ncbi.nlm.nih.gov/BLAST/) was used for

equence homology searches in public databases. Clusternalysis of Indian goat sequence with that of other speciesas performed following neighbor-joining proceduresing CLC Free Workbench software. The transcrip-ional factor binding sites were identified using MATCHhttp://www.cbil.upenn.edu/cgi-bin/pub/programs/

atch/bin/match.cgi) (Kel et al., 2003). The allelic frequen-ies, heterozygosity (He) and polymorphism informationontent (PIC) were calculated using Popgene (version.31). Phylogenetic analysis was performed with CLC Mainorkbench version 5.0.2. The linkage equilibrium was

erformed by Arlequin ver 3.5.1.3 (Excoffier and Lischer,010).

.4. SNP genotyping

Once polymorphisms of KiSS1 gene were identifiedfter sequence alignment between forty five sam-les of nine goat breeds, PCR–RFLP (polymerase chaineaction–restriction fragment length polymorphism) wasesigned to genotype five SNPs in one hundred and fifty

ight animals of Black Bengal goat breed. PCR–RFLP waserformed as per manufacturer’s instructions (Fermentas

nternational, Inc.) by mixing 5 �L of the PCR product withnzyme buffer and specific units of respective enzyme

able 2rimer sequences for KiSS1 gene for screening polymorphisms in Indian goats.

Primer name and Gene region Primer sequence (5′ to 3′) Amplireferen

K1 (5′UTR to exon 2) F:CTTGTGTTTGCTGGACAGTCTR: TGCTCCCTCCCAACCTTCTT

1101 b

K2 (partial intron1, exon2 andpartial intron 2)

F: AAGGGCAGGGTTGTCTCCR:TCTCTTGCTTGCAGGTTAGTGG

429 bp

K3 (Partial intron 2) F: CACTTGCTGGGATGATGGR:GGATAGAGCTTGGAAATAACC

726 bp

ene region and amplicon position refers to the sequence of goat KiSS1 gene (Gen

25–50 Medium (10–12months)<25 Late (13–18 months)<25 Late (13–18 months)

in a final volume of 15 �L. Digested fragments wereseparated by electrophoresis on 3% agarose gel stainedwith Ethidium bromide (2 �L/100 mL). The fragments werephotographed under gel documentation unit and theirsizes were estimated using a 100-bp DNA ladder (Fer-mentas International, Inc.) and then the genotypes wererecorded.

2.5. Association analysis

A linear mixed model was used to analyze the dataon litter size and linear fixed model was used for age atsexual maturity using SPSS 15 statistical software. Linearmixed model for litter size included fixed effects of geno-types, parity (1, 2, 3 and 4), year of kidding (2009–2013)and season of kidding (Winter—November to February,Summer—March to June and Monsoon—July to October).Data of litter size from consecutive parities of the sameindividual were considered as repeated measures. Cor-relations between litter size taken on the same animalin different parities were modeled using a first orderautoregressive covariance structure that assumes equalvariances and correlations that decline exponentially withan increase in parity. The covariance structure was selectedon the basis of the Bayesian information criteria (BIC) val-ues.

Yijklm = � + si + kj + gk + pl + (pg)kl + dlm + eijklm

where Yijklm is individual observation, � is overall popula-tion mean, si is effect of season of kidding, kj is the effect ofyear of kidding, gk is the effect of genotype, pl is the effectof parity, (pg)kl is the interaction effect of genotype and

parity, dlm is a normally distributed random variable withmean zero and variance �2

dcorresponding to doe m in par-

ity l and eijklm is a normally distributed random variablewith mean zero and variance �2

e independent of dlm.

con (position ince sequence)

Annealing temperature (◦C) Reference

p (1–1101) 64 Cao et al. (2010)

(812–1241) 61.8 Self designed

(2275–3001) 55.6 Self designed

Bank accession no. GU142847.1).

roduction Science 151 (2014) 71–77

74 A. Maitra et al. / Animal Rep

Linear fixed model for age at sexual maturity includedfixed factors; genotype, year of birth (2008–2012)and season of birth (Winter—November to February,Summer—March to June and Monsoon—July to October).

Yijkl = � + si + kj + gk + eijkl

where Yijkl is individual observation, � is overall populationmean, si is fixed effect of season of kidding, kj is the fixedeffect of year of birth, gk is the fix effect of genotype andeijkl is a normally distributed random variable with meanzero and variance �2

e .

3. Results and discussion

3.1. PCR amplification of Indian goat KiSS1 gene

Genomic DNA of nine indigenous goat breeds wassuccessfully amplified using three pairs of primers forKiSS1 gene. The results showed that amplification frag-ment sizes were consistent with the target ones andhad good specificity, which could be directly analyzedby sequencing. Three fragments of 1101, 429 and 726 bpDNA were sequenced, assembled and accessions werereceived (JX643984, KC989927 and KJ425411) from Gen-Bank. The amplified region of KiSS1 gene (1.970 kb) covered5′UTR region (that includes exon 1 and intron 1) andexon 2 along with downstream intronic region. Nine hun-dred base pair of intron 2 was investigated in Indiangoats which included 185 bp amplified with primer K2and 726 bp with primer K3, corresponding to 1066–1250and 2371–2990 bp of goat KiSS1 gene (GU142847). Splic-ing of exons and introns was consistent with the GT-AGrule.

3.2. Goat KiSS1 sequence analysis

There were a total of 135 nucleotide changes in theamplified regions of caprine KiSS1 gene as compared toBos taurus (NW 003104427) out of which 60% were tran-sitions and 31.8% were transversions. InDels were alsorecorded which included insertions at 5 positions (Sup-plementary Table S1) of which two locations involvedinsertion of 11 (between 3764 and 3770) and 4 bases(between 4065 and 4066) in caprine sequence as com-pared to cattle. Deletions were recorded at six positionsthat included continuous deletions of 26 (1417–1442) and47 bp (1806–1852) upstream and 7 bp (3764–3770) down-stream of exon 2. Four variations were recorded in exon 2region among goat and cattle of which one (C996T) resultsin change of amino acid in corresponding conceptualizedprotein. However this amino acid change is not expectedto affect the overall conformation of peptide as leucine at12th position of 34 amino acid long peptide chain, will bereplaced by another non-polar amino acid phenylalanineof the same group. No variation was observed between

Indian and Jining Grey goat (GU142847) with respect toamplified KiSS1 gene sequence. Accordingly, correspond-ing coding DNA sequence (CDS) of KiSS1 gene revealedhomology of 100% with Capra hircus and 91% with B. taurus.

Fig. 2. Phylogenetic analysis of KiSS1 coding DNA sequence of differentspecies following UPGMA algorithm (branch number represent bootstrapvalue in 1000 replicates).

Phylogenetic analysis of KiSS1 gene following UPGMA algo-rithm (Fig. 2) revealed that domestic animals and murines(NC 000067) form distinct clusters and small ruminants(goat) were closer to large ruminants (cattle) as com-pared to pig (NC 010451), horse (NC 009148) and human(NC 00001).

3.3. SNP identification and genotyping

Comparison of 45 amplified sequences of indigenousgoats resulted in identification of nine SNPs in KiSS1 gene;four in the region amplified with primer pair K1 (positions296, 455, 505 and 693 of 5′UTR region); two in the regionamplified with primer pair K2 (positions 950 of 5′UTR and1125 of intron 2) and three (G2510A, C2540T and A2803G)in the intron 2 region amplified by primer K3 (Table 3).None of the above SNPs were located in exonic regions.However, intronic SNPs in KiSS1 gene might influence thestability of mRNA, can affect the mechanism of deadeny-lation and degradation and consequently, the amount ofproteins produced. Thus, these intronic mutations shouldbe considered for association with the functional traits.Similarly, the SNPs observed in 5′UTR can result in gainor loss of transcription factor binding sites. Since tran-scription factors are essential for the regulation of geneexpression, the information can be useful to elucidate theregulatory mechanisms, which affects precocious behavioror fecundity in Indian goat populations. However, the resultof MATCH revealed that mutations were not affecting anyof transcription factor binding sites.

Allele and genotype frequencies of KiSS1 gene in dif-ferent Indian goats are presented in Table 3. Majority ofthe SNPs (6) in KiSS1 gene expressed all the three possiblegenotypes (Supplementary Fig. 1). The genotype distribu-tion of the nine mutations did not show obvious differencebetween sexual precocious breeds and the sexual late-maturing goat breeds and no consistency with the high orlow prolificacy goat breeds. Polymorphisms of KiSS1 genehave been explored in humans and other mammals. SNPsof KiSS1 gene were firstly identified in humans by Luan et al.(2007). Mutations (C374T, G645CA) associated with theprecocious puberty phenotype in humans have also beenreported (Silveira et al., 2010; Huijbregts et al., 2012). Sofar there have been few reports KiSS1 gene polymorphismsin goats. Cao et al. (2010) detected six mutations in KiSS1gene of five goat breeds with different prolificacy. Recently,

eleven novel SNPs were identified in a study on three goatbreeds (An et al., 2013). Various studies (Cao et al., 2010;Feng et al., 2001) including the present one did not findmutation in exon 2, which may reflect the fact that exon 2

A. Maitra et al. / Animal Reproduction Science 151 (2014) 71–77 75

Table 3Polymorphisms identified in KiSS1 gene in nine Indian goat breeds.

SNP Position inreference sequence

Primer Region Genotypefrequency

Allelefrequency

Reported association(reference)

G296C 296 K1 5′UTR GG = 0.675GC = 0.275CC = 0.005

G = 0.81C = 0.19

Associated (Cao et al.,2010)

T455G 455 K1 5′UTR TT = 0.325TG = 0.550GG = 0.125

T = 0.6G = 0.4

Reported—not associated(Cao et al., 2010)

T505A 505 K1 5′UTR TT = 0.425TA = 0.575

T = 0.71A = 0.29

Reported—not associated(Cao et al., 2010)

T693C 693 K1 5′UTR TT = 0.75TC = 0.20CC = 0.05

T = 0.85C = 0.15

Novel

T950C 950 K2 5′UTR TT = 0.854TC = 0.125CC = 0.02

T = 0.92C = 0.08

Novel

T1125C 1125 K2 Intron 2 TT = 0.917CC = 0.083

T = 0.96C = 0.04

Novel

A2510G 2510 K3 Intron 2 AA = 0.032AG = 0.129GG = 0.839

A = 0.1G = 0.9

Associated (An et al., 2013)

C2540T 2540 K3 Intron 2 CC = 0.226CT = 0.194TT = 0.580

C = 0.32T = 0.68

Associated (An et al., 2013)

AA =AG =

T cession

iaGti

Ked(opGTtaWwsts

TCK

A2803G 2803 K3 Intron 2

he number corresponds to the sequence of goat KiSS1 gene (GenBank ac

s important for the function of KiSS1 gene and is evolution-rily conserved. It’s worth mentioning that three (G296C,455T and T505A) out of the nine mutations identified in

he present study correspond to the mutations reported inntron 1 by Cao et al. (2010).

Restriction enzyme sites which recognize the SNPs iniSS1 have been identified using NEB cutter V2.0 (Vinczet al., 2003). Six polymorphic sites of KiSS1 gene can beetected by restriction fragment length polymorphismRFLP) as nucleotide variation changes the recognition sitef a restriction endonuclease (Table 4). The amplificationroduct of primer K1 can be used to detect polymorphism296C, T455G, T505A, T693C and of K2 for T950C and1125C mutation. Following this approach, allele and geno-ype frequencies of KiSS1 mutations were recorded in 158nimals of Black Bengal goat breed and are listed in Table 5.ild allele was dominant at all the loci and three genotypes

ere observed at all loci except T1125C. Polymorphism

canning with forty-five animals yielded only two geno-ypes (TT and TA) at T505A locus whereas, on increasing theample size (158) even minor allele (AA) could be detected

able 4hange in recognition site of restriction endonucleases due to SNPs iniSS1 gene.

SNPs Restrictionenzyme

Digestion site Digestiontemp. (◦C)

C296G AcII 5′ .AACGTT.3′ 37 ◦CT455G SacII 5′ .CCGCGG.3′

T505A DraIII 5′ .CACNNNGTG.3′

T693C MspI 5′ .CCGG.3′

T950C SfaNI 5′ .GCATC(N)5NNNN.3′

T1125C HinfI 5′ .GANTC.3′

A2510G PvuII 5′ .CAGCTG.3′

C2540T SacI 5′ .GAGCTC.3′

0.643 0.357

A = 0.82G = 0.18

Novel

no. GU142847).

(Table 5). One of the important observations is the pres-ence of favorable alleles (C allele at 296, A allele at 2510and T allele at 2540 loci) in Black Bengal goat which havebeen reported to be associated with greater litter size indifferent goat breeds (An et al., 2013; Cao et al., 2010).Our results indicate that Black Bengal goat was in a stateof Hardy–Weinberg equilibrium (P < 0.01) for all the lociexcept T505A with moderate genetic diversity at T455Gand T505A and close to moderate diversity at G296C loci,according to the classification of PIC (low polymorphismif PIC value <0.25, moderate polymorphism if 0.25 < PICvalue < 0.50, and high polymorphism if PIC > 0.50).

3.4. Association analysis of SNPs with litter size and ageat sexual maturity

All the loci were retained for association analysis(additional file 2: Table S2) as linkage disequilibrium is con-sidered to be strong only if r2 > 0.33 (Ardlie et al., 2002). Thepuberty age and litter size are governed by many factors viz.genetic, environmental and nutritional. Hence, the effectof season, year of kidding/birth and parity was consideredalong with genotype in the model. The effect of season wassignificant on litter size whereas parity and year of kiddingalso significantly affected litter size but effect varied withchange in locus combination in the model. The effect ofyear of birth and season of birth was non-significant on ageat sexual maturity. The interaction effect of genotype andparity was non-significant on litter size. The least squaremeans along with standard error for age at puberty as well

as litter size for different KiSS1 genotypes in Black Bengalgoat are presented in Table 6. None of the mutations werefound to be associated with age of sexual maturity and littersize in Black Bengal goats. However there was difference

76 A. Maitra et al. / Animal Reproduction Science 151 (2014) 71–77

Table 5Genotypic distribution and allelic frequencies of five SNP loci in KiSS1 gene in Black Bengal goats (N = 158).

Mutation Genotypes Genotype frequency Allele frequency H–W test (�2) He PIC

C296G CC (3) CC-0.01 C-0.18 X2 = 1.15 0.2952 0.2516CG (50) CG-0.32 G-0.82GG (105) GG-0.66

T455G TT (61) TT-0.39 T-0.64 X2 = 1.01 0.4608 0.3546TG (79) TG-0.5 G-0.36GG (18) GG-0.11

T505A TT (65) TT-0.41 T-0.67 X2 = 3.81 0.4422 0.3444TA (81) TA-0.51 A-0.33AA (12) AA-0.08

T950C TT (127) TT-0.80 T-0.9 X2 = 0.29 0.18 0.1638TC (30) TC-0.19 C-0.1CC (1) CC-0.01

T1125C TT (139) TT-0.88 T-0.94 X2 = 0.65 0.1128 0.1064TC (19) TC-0.12 C-0.06CC (0) CC-0

The numbers in the brackets are the genotyped individuals.

Table 6Least square means and standard errors for the litter size and age at puberty (days) of the different genotypes.

Locus Genotype Age at puberty First paritylitter size

Second paritylitter size

Third paritylitter size

Fourth paritylitter size

N Mean ± SE N Mean ± SE N Mean ± SE N Mean ± SE N Mean ± SE

C296G CC 0 – 3 1.55 ± 0.32 3 1.57 ± 0.32 2 1.10 ± 0.39 2 1.54 ± 0.40CG 24 260.12 ± 13.11 50 1.20 ± 0.09 38 1.45 ± 0.10 34 1.53 ± 0.10 20 1.69 ± 0.13GG 38 254.96 ± 11.35 105 1.31 ± 0.07 84 1.40 ± 0.07 74 1.57 ± 0.07 50 1.57 ± 0.09

T455G GG 10 259.26 ± 15.69 18 1.16 ± 0.14 14 1.41 ± 0.16 12 1.44 ± 0.17 4 1.79 ± 0.28TG 36 257.46 ± 11.56 78 1.26 ± 0.07 65 1.39 ± 0.08 55 1.55 ± 0.08 33 1.56 ± 0.11TT 16 249.28 ± 14.37 61 1.35 ± 0.08 45 1.45 ± 0.09 42 1.55 ± 0.10 34 1.64 ± 0.11

T505A AA 3 254.57 ± 23.46 12 1.41 ± 0.17 11 1.51 ± 0.17 10 1.50 ± 0.18 8 1.53 ± 0.20TA 28 247.99 ± 13.12 80 1.29 ± 0.07 68 1.46 ± 0.08 63 1.59 ± 0.08 43 1.66 ± 0.09TT 31 260.45 ± 11.66 64 1.24 ± 0.08 44 1.37 ± 0.09 35 1.48 ± 0.10 19 1.57 ± 0.13

T950C TC 15 253.64 ± 13.78 30 1.30 ± 0.11 26 1.50 ± 0.12 24 1.69 ± 0.12 12 1.59 ± 0.16.06

.13

.06

TT 44 255.17 ± 11.43 127 1.26 ± 0T1125C TC 6 258.33 ± 19.52 19 1.10 ± 0

TT 55 256.31 ± 11.23 139 1.30 ± 0

in litter size as well age of sexual maturity for differentgenotypes at all the locus under study.

It has been suggested that kisspeptins play an essen-tial role in governing reproductive functions in differentspecies (Gottsch et al., 2004; Navarro et al., 2005; Shahabet al., 2005). Hence KiSS1 gene has been explored ascandidate gene for reproductive traits in goats by fewresearchers. Cao et al. (2010) indicated an associationbetween allele C of the 296 locus and allele deletion ofthe 1960–1977 locus in KiSS1 gene and high litter sizein Jining Grey goats. For the 296 locus, the Jining Greygoat does with genotype CC had 0.80 (P < 0.01) or 0.77(P < 0.01) kids more than those with genotype GG or GC,respectively. However no significant association could beestablished between other polymorphisms and sexual pre-cocity. Similar to the findings of Cao et al. (2010), presentinvestigation on Indian goats also did not find associa-tion between age at puberty and polymorphisms in KiSS1gene. Another mutation, T2643C in the intron 2 of goatKiSS1 has been reported (Hou et al., 2011) to have signifi-cant effect on litter size (P < 0.05). Recently, association of

G384A, T2489C, G2510A and C2540T SNPs with litter size(P < 0.05) has been described (An et al., 2013). It is of furtherinterest that three of the associated SNPs (G296C, G2510Aand C2540T) are also reported in the present investigation

98 1.39 ± 0.07 85 1.51 ± 0.07 59 1.61 ± 0.0915 1.28 ± 0.15 13 1.73 ± 0.16 8 1.67 ± 0.20

110 1.44 ± 0.07 97 1.53 ± 0.07 64 1.59 ± 0.08

on Indian goats. Because different genotypes exhibited dif-ference in litter size as well age of sexual maturity, thereis a need for further studies with more number of breedsand animals to confirm the association of SNPs with repro-ductive trait. Our results in goats add up to the existingknowledge and extend the spectrum of genetic variationof caprine KiSS1 gene, which might contribute to improve-ment of goat genetic resources and breeding.

4. Conclusions

In conclusion, this study explored the genetic polymor-phisms of KiSS1 gene and identified nine SNPs, of whichfour are novel. Three of the identified loci have alreadybeen associated with increased litter size in Chinese goats.Thus these polymorphisms may play an important role inreproductive functions including age of sexual maturityand litter size. Association between mutations of KiSS1 geneand sexual precocity and litter size was analyzed. Differ-ence in litter size as well age of sexual maturity for differentgenotypes necessitates the need of additional data based

on more number of breeds and animals to confirm the sig-nificant effect. These SNPs should be useful for researcherswilling to work with genetic markers in goats, genotypingin case-control association or population genetic studies.

roductio

C

e

A

cAbmd

A

fj

R

A

A

C

C

d

E

F

G

H

Vincze, T., Posfai, J., Roberts, R.J., 2003. NEBcutter, a program to cleave DNA

A. Maitra et al. / Animal Rep

onflict of interest statement

The authors declare that they have no competing inter-sts.

cknowledgements

This study was supported by the Indian Council of Agri-ultural Research, New Delhi under Network Project onnimal Genetic Resources of India. Co-operation renderedy Department of Animal Resources Development, Govern-ent of West Bengal in Black Bengal sample collection is

ully acknowledged.

ppendix A. Supplementary data

Supplementary data associated with this article can beound, in the online version, at http://dx.doi.org/10.1016/.anireprosci.2014.09.013.

eferences

n, X., Ma, T., Hou, J., Fang, F., Han, P., Yan, Y., Zhao, H., Song, Y., Wang, J.,Cao, B., 2013. Association analysis between variants in KiSS1 gene andlitter size in goats. BMC Genet. 14, 63–68.

rdlie, K.G., Kruglyak, L., Seielstad, M., 2002. Patterns of linkage disequi-librium in the human genome. Nat. Rev. Genet. 3, 299–309.

ao, G.L., Chu, M.X., Fang, L., Di, R., Feng, T., Li, N., 2010. Analysis on DNAsequence of KiSS1 gene and its association with litter size in goats.Mol. Biol. Rep. 37, 3921–3929.

araty, A., Franceschini, I., Hoffman, G.E., 2010. Kisspeptin and the preovu-latory gonadotrophin-releasing hormone/luteinising hormone surgein the ewe, basic aspects and potential applications in the control ofovulation. J. Neuroendocrinol. 22, 710–715.

e Roux, N., Genin, E., Carel, J.C., Matsuda, F., Chaussain, J.L., Milgrom, E.,2003. Hypogonadotropic hypogonadism due to loss of function of theKiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100(9), 10972–10976.

xcoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: a new series ofprograms to perform population genetics analyses under Linux andWindows. Mol. Ecol. Resour. 10, 564–567.

eng, T., Zhao, Y.Z., Chu, M.X., Zhang, Y.J., Fang, L., Di, R., Cao, G.L., Li, N.,2001. Association between sexual precocity and alleles of KISS1 andGPR54 genes in goats. Anim. Biotechnol. 20, 172–176.

ottsch, M.L., Cunningha, M.J., Smith, J.T., Popa, S.M., Acohido, B.V., Crow-ley, W.F., Seminara, S., Clifton, D.K., Steiner, R.A., 2004. A role for

kisspeptins in the regulation of gonadotropin secretion in the mouse.Endocrinology 145, 4073–4077.

ou, J.X., An, X.P., Wang, J.G., Song, Y.X., Cui, Y.H., Wang, Y.F., Chen, Q.J.,Cao, B.Y., 2011. New genetic polymorphisms of KiSS1 gene and theirassociation with litter size in goats. Small Ruminant Res. 96, 106–110.

n Science 151 (2014) 71–77 77

Huijbregts, L., Roze, C., Bonafe, G., Houang, M., Le Bouc, Y., Carel, J.C., Leger,J., Alberti, P., de Roux, N., 2012. DNA polymorphisms of the KiSS1 3′

untranslated region interfere with the folding of a G-rich sequenceinto G-quadruplex. Mol. Cell Endocrinol. 351, 239–248.

Kel, A.E., Gobling, E., Reuter, I., Cheremushkin, E., Kel- Margoulis,O.V., Wingender, E., 2003. MATCH—a tool for searching transcrip-tion factor binding sites in DNA sequences. Nucleic Acids Res. 31,3576–3579.

Knoll, J.G., Clay, C.M., Bouma, G.J., Henion, T.R., Schwarting, G.A., Millar,R.P., Tobet, S.A., 2013. Developmental profile and sexually dimor-phic expression of KiSS1 and KiSS1R in the fetal mouse brain front.Endocrinology 4, 140.

Ko, J.M., Lee, H.S., Hwang, J.S., 2010. KiSS1 gene analysis in Korean girlswith central precocious puberty, a polymorphism, pP110T, suggestedto exert a protective effect. Endocrinology 57, 701–709.

Luan, X., Zhou, Y., Wang, W., Yu, H., Li, P., Gan, X., Wei, D., Xiao, J.,2007. Association study of the polymorphisms in the KiSS1 gene withcentral precocious puberty in Chinese girls. Eur. J. Endocrinol. 157,113–118.

Navarro, V.M., Castellano, J.M., Fernandez-Fernandez, R., Tovar, S., Roa,J., Mayen, A., Nogueiras, R., Vazquez, M.J., Barreiro, M.L., Magni, P.,2005. Characterization of the potent luteinizing hormone-releasingactivity of KiSS1 peptide, the natural ligand of GPR54. Endocrinology146, 156–163.

Popa, S.M., Clifton, D.K., Steiner, R.A., 2005. A KiSS to remember. TrendsEndocrinol. Metab. 16, 249–250.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning a Labo-ratory Manual. Cold Spring Harbour Lab Press, Cold Spring Harbour,NY.

Seminara, S.B., Messager, S., Chatzidaki, E.E., Thresher, R.R., Acierno, J.S.,Shagoury, J.K., Bo-Abbas, Y., Kuohung, W., Schwinof, K.M., Hendrick,A.G., 2003. The GPR54 gene as a regulator of puberty. N. Engl. J. Med.349 (17), 1614–1618.

Shahab, M., Mastronardi, C., Seminara, S.B., Crowley, W.F., Ojeda, S.R.,Plant, T.M., 2005. Increased hypothalamic GPR54 signaling, a poten-tial mechanism for initiation of puberty in primates. Proc. Natl. Acad.Sci. U.S.A. 102, 2129–2134.

Sharma, A., Dutt, G., Jayakumar, S., Saroha, V., Verma, N.K., 2013. Geneticstructuring of nine Indian domestic goat breeds based on SNPs iden-tified in IGF-1 gene. Anim. Biotechnol. 24, 148–157.

Silveira, L.G., Noel, S.D., Silveira-Neto, A.P., Abreu, A.P., Brito, V.N., Santos,M.G., Bianco, S.D.C., Kuohung, W., Xu, S., Gryngarten, M., 2010. Muta-tions of the KiSS1 gene in disorders of puberty. J. Clin. Endocrinol.Metab. 95, 2276–2280.

Tena-Sempere, M., 2010. Roles of kisspeptins in the control ofhypothalamic–gonadotropic function, focus on sexual differentiationand puberty onset. Endocrinol. Dev. 17, 52–62.

Tomikawa, J., Homma, T., Tajima, S., Shibata, T., Inamoto, Y., Takase, K.,Inoue, N., Ohkura, S., Uenoyama, Y., Maeda, K., 2010. Molecular char-acterization and estrogen regulation of hypothalamic KiSS1 gene inthe pig. Biol. Reprod. 82, 313–319.

with restriction enzymes. Nucleic Acids Res. 31, 3688–3691.West, A., Vojta, P.J., Welch, D.R., Weissman, B.E., 1998. Chromosome local-

ization and genomic structure of the KiSS1 metastasis suppressor gene(KiSS1). Genomics 54, 45–148.