THE DEVELOPMENT OF

LACTOCOCCUS LACTIS

AS AN ANTIMICROBIAL AGENT

Yu Pei Tan

Bachelor of Laws (Honours)

Bachelor of Applied Science (Biotechnology)

Bachelor of Applied Science (Honours)

Institute of Health and Biomedical Innovation

School of Life Sciences

Queensland University of Technology

Brisbane, Queensland, Australia

A thesis submitted for the degree of Master of Applied Science

(Research) at Queensland University of Technology

2010

ii

iii

ABSTRACT

Non-pathogenic lactic acid bacteria are economically important Gram-positive

bacteria used extensively in the food industry. Due to their “generally regarded

as safe” status, certain species from the genera Lactobacillus and Lactococcus

are also considered desirable as candidates for the production and secretion of

recombinant proteins, particular those with therapeutic applications.

The hypothesis examined by this thesis is that Lactococcus lactis can be

modified to be an effective antimicrobial agent. Therefore, the aims of this

thesis were to investigate the optimisation of the expression, secretion and/or

activities of potential heterologous antimicrobial proteins by the model lactic

acid bacterium, Lactococcus lactis subsp. cremoris MG1363.

L. lactis strains were engineered to express and secrete the recombinant CyuC

surface protein from Lactobacillus reuteri BR11, and a fusion protein consisting

of CyuC and lysostaphin using the Sep promoter and secretion signal. CyuC

has been characterised as a cystine-binding protein, but has also been

demonstrated to have fibronectin binding activity. Lysostaphin is a bacteriolytic

enzyme with specific activity against the Gram-positive pathogen,

Staphylococcus aureus. These modified L. lactis strains were then investigated

to see if they had the ability to inhibit the adhesion of S. aureus to host

extracellular matrix (ECM) proteins. It was observed that the cell extracts of the

L. lactis strain with the vector only (pGhost9:ISS1) was able to inhibit the

adhesion of S. aureus to fibronectin, whilst the cell extracts of the L. lactis strain

expressing lysostaphin was able to inhibit adhesion to keratin.

Finally, this thesis has identified specific lactococcal genes that affect the

secretion of lysostaphin through the use of random transposon mutagenesis.

Ten mutants with higher lysostaphin activity contained insertions in four

different genes encoding: (i) an uncharacterised putative transmembrane protein

(llmg_0609), (ii) an enzyme catalysing the first step in peptidoglycan

biosynthesis (murA2), (iii) a homolog of the oxidative defence regulator (trmA),

and (iv) an uncharacterised putative enzyme involved in ubiquinone

iv

biosynthesis (llmg_2148). The higher lysostaphin activity observed in these

mutants was found to be due to higher amounts of lysostaphin being secreted.

The findings of this thesis contribute to the development of this organism as an

antimicrobial agent and also to our understanding of L. lactis genetics.

Keywords: Lactococcus, recombinant protein secretion, lysostaphin, ECM

proteins

v

TABLE OF CONTENTS

ABSTRACT iii TABLE OF CONTENTS v LIST OF TABLES ix LIST OF FIGURES x LIST OF ABBREVIATIONS xii LIST OF MANUSCRIPTS xv STATEMENT OF ORIGINAL AUTHORSHIP xvi ACKNOWLEDGEMENTS xvii LITERATURE REVIEW 1 CHAPTER 1 - LITERATURE REVIEW 1.1 AN OVERVIEW OF LACTIC ACID BACTERIA 2

1.1.1 Genomics of lactic acid bacteria 5 1.1.2 Applications 6 1.1.3 Extracellular proteins of Gram-positive bacteria 9

1.1.3.1 Covalent attachment of surface proteins 14 1.1.3.2 Non-covalent attachment of surface proteins 14

1.1.3.2.1 LysM domains 14 1.1.3.2.2 YG repeats or choline-binding domains 15 1.1.3.2.3 GW modules 15 1.1.3.2.4 S-layer homology domains 16 1.1.3.2.5 Unique domain – Sep 16 1.1.3.2.6 Non-specific anchored proteins 17

1.1.4 Transposon mutagenesis – tool for genetic analyses 18 1.2 AN OVERVIEW OF ANTIMICROBIAL PROTEINS 20

1.2.1 Attachment blocking proteins 20 1.2.1.1 Anti-adhesin antibodies 20 1.2.1.2 Adhesin analogues 21 1.2.1.3 Host-receptor analogues 21

1.2.2 Bacteriophage endolysins 22 1.2.2.1 Structure of endolysins 24

1.2.3 Bacteriocins 25 1.2.3.1 Modified bacteriocins (class I) 28 1.2.3.2 Unmodified bacteriocins (class II) 29 1.2.3.3 Large heat-labile bacteriocins (class III) 29 1.2.3.4 Therapeutics and other applications of bacteriocins 34

1.3 AIMS OF THIS STUDY 35 CHAPTER 2 - GENERAL MATERIALS AND METHODS 37 2.1 GROWTH MEDIA 38

2.1.1 Agar plates 38 2.1.2 Antibiotics 38 2.1.3 Brain Heart Infusion (BHI) medium 39 2.1.4 GM17 medium 39 2.1.5 GM17+LmB agar plates 39 2.1.6 GM17+SaB agar plates 39 2.1.7 GM17+SaU agar plates 39 2.1.8 Isopropylthio--D-galactoside (IPTG) plates 39 2.1.9 Lysogeny Broth (LB) 40

vi

2.1.10 de Man, Rogosa and Sharpe (MRS) medium 40 2.1.11 Psi medium 40 2.1.12 SGM17MC medium 40 2.1.13 SOC medium 40 2.1.14 5-bromo-4-chloro-3-indolyl--D-galactoside (X-Gal) plates 41 2.1.15 Escherichia coli JM109 41 2.1.16 Lactic acid bacterial strains 41 2.1.17 Pathogenic strains 42

2.2 BACTERIAL CULTURE METHODOLOGIES 42 2.2.1 Chemically competent E. coli JM109 cell preparation 42 2.2.2 Electrocompetent L. lactis cell preparation 43 2.2.3 Isolation of chromosomal DNA from L. lactis 43 2.2.4 Purification of plasmids from E. coli 44 2.2.5 Transformation of chemically competent E. coli 45 2.2.6 Transformation of electrocompetent L. lactis 45

2.3 SOLUTIONS FOR DNA ANALYSES 46 2.3.1 Agarose gel loading buffer 46 2.3.2 Tris-borate EDTA (TBE) buffer 46

2.4 METHODS FOR DNA ANALYSES 46 2.4.1 Agarose gel electrophoresis 46 2.4.2 DNA precipitation 47 2.4.3 Gel purification of DNA 47 2.4.4 Ligation reactions 47 2.4.5 Polymerase chain reaction (PCR) 47 2.4.6 Purification of PCR products 48 2.4.7 Quantitation of DNA 48 2.4.8 Restriction enzymes 48 2.4.9 Sequencing 48

2.5 SOLUTIONS FOR PROTEIN ANALYSES 49 2.5.1 CAPS transfer buffer 49 2.5.2 Coomassie stain 49 2.5.3 Electrode buffer 49 2.5.4 Phosphate buffered saline (PBS) (pH 7.0) 49 2.5.5 2x SDS loading buffer (non-reducing) 49

2.6 METHODS FOR PROTEIN ANALYSES 50 2.6.1 SDS polyacrylamide gel electrophoresis (SDS-PAGE) 50 2.6.2 Trichloroacetic acid (TCA) precipitation of supernatant proteins 50 2.6.3 Western blots 51 2.6.4 L. lactis cell associated protein extraction 52

CHAPTER 3 - APPLICATION OF CYUC-LYSOSTAPHIN FUSION PROTEIN SECRETED BY LACTOCOCCUS LACTIS TO PREVENT STAPHYLOCOCCUS AUREUS ADHERENCE TO EXTRACELLULAR MATRIX PROTEINS IN VITRO 53 3.1 INTRODUCTION 54 3.2 MATERIALS AND METHODS 56

3.2.1 Construction of L. lactis strains that secreted CyuC or CyuC-lysostaphin fusion protein 56 3.2.2 Cell fractionation, protein extraction and western blot analysis 61 3.2.3 Prediction of protein molecular weight based on sequence 61 3.2.4 Stock solutions of fibronectin, collagen, and keratin 62

vii

3.2.5 L. lactis crude cell extracts for adherence assay 62 3.2.6 Preparation of S. aureus for adherence assay 62 3.2.7 Adherence of S. aureus to immobilised ECM proteins and L. lactis cell extracts 63 3.2.8 Statistical data analyses of significance using Student’s t-test 64

3.3 RESULTS 64 3.3.1 Expression of CyuC and CyuC-Lss confirmed by western blot analysis 64 3.3.2 Optimisation of ECM proteins used in the S. aureus adherence assay 66 3.3.3 L. lactis cell extracts containing recombinant proteins have no effect on the adherence of S. aureus to immobilised collagen 67 3.3.4 Adherence of S. aureus to fibronectin is inhibited by the cell extracts of all L. lactis strains, including the L. lactis pGhost9:ISS1 68 3.3.5 Adherence of S. aureus to keratin is inhibited by cell extracts from L. lactis pGhost9-CyuC-Lss and L. lactis pGhost9-his1-lss-his2 69

3.4 DISCUSSION 70 CHAPTER 4 - LACTOCOCCUS LACTIS FACTORS INVOLVED IN THE EXPRESSION AND SECRETION OF ANTIMICROBIAL CELL WALL LYTIC ENZYMES 73 4.1 INTRODUCTION 74 4.2 MATERIALS AND METHODS 74

4.2.1 Construction of a lysostaphin expressing L. lactis strain suitable for random insertional mutagenesis 74 4.2.2 Construction of a L. lactis transposon library by random insertional mutagenesis 76 4.2.3 Screening the transposon library for mutants with altered lysostaphin activity 82 4.2.4 Characterisation of the pGhost9:ISS1 insertion site and isolation of stable ISS1-generated mutants 82 4.2.5 Prediction of operon structures 85 4.2.6 Prediction of subcellular locations of proteins 86 4.2.7 Cell fractionation, protein extraction, SDS-PAGE, and western blot 86 Endolysin 87 4.2.8 Ply511 expression and secretion in [lss] mutant strains 87 4.2.9 Lysozyme resistance test 87 4.2.10 Transmission electron microscopy (TEM) 88 4.2.11 Statistical data analysis of significance using Student’s t-test 88 4.2.12 Alignment and phylogenetic analysis 88

4.3 RESULTS 88 4.3.1 Isolation and identification of mutants with altered lysostaphin activity 88 4.3.2 Characterisation of the genes which affected lysostaphin secretion 90

4.3.2.1 The gene llmg_0609 is incorrectly annotated and is renamed lom 90 4.3.2.2 The murA2 gene encodes for the primary MurA in L. lactis 94 4.3.2.3 More lysostaphin is secreted by the trmA[lss] mutant strain under high temperature stress 96

viii

4.3.2.4 Basis for lysostaphin secretion in llmg_2148[lss] mutant is unclear 96

4.3.3 The lom, murA2, and trmA mutant strains secrete higher levels of the cell wall hydrolytic enzyme, Ply511, compared to wild-type 97 4.3.4 The murA2 and trmA mutants were more resistant to lysozyme hydrolysis 99

4.4 DISCUSSION 99 CHAPTER 5 - GENERAL DISCUSSION 105 CHAPTER 6 - REFERENCES 111

ix

LIST OF TABLES

Table 1.1 Non-exhaustive list of heterologous proteins produced in LAB.

10

Table 1.2 Studies that used pGhost9:ISS1 to identify gene functions in

LAB 19

Table 1.3 Non-exhaustive list of functional bacteriophage endolysins. 26

Table 1.4 Non-exhaustive list of Gram-positive bacterial bacteriocins. 31

Table 3.1 Strains, plasmids, and oligonucleotides used in this study. 60

Table 4.1 Strains, plasmids, and oligonucleotides used in this study. 80

Table 4.2 Characteristics of mutants with lysostaphin activity greater than

that of the wild-type. 90

x

LIST OF FIGURES

Figure 1.1 Phylogenetic tree of Gram-positive bacteria. 4

Figure 1.2 Phylogenetic tree of LAB and related bacteria. 4

Figure 1.3 Schematic representation of the B. subtilis protein translocation

pathway. 13

Figure 1.4 Modular structure of Sep. 17

Figure 1.5 Schematic representation of the structural motifs of the

lysostaphin protein. 34

Figure 3.1 Schematic representation of the PCR overlap strategy employed

to clone the CyuC (A), and CyuC-Lss (B) fusion protein to the

Sep promoter and secretion signal at the 5’ end, and the cyuC

operon transcription terminator at the 3’ end. 58

Figure 3.2 Expression of recombinant CyuC from L. lactis pGhost-CyuC,

CyuC-Lss from L. lactis pGhost-CyuC-Lss and Lss from L. lactis

pGhost-his1-lss-his2. 65

Figure 3.3 Adherence of S. aureus to wells coated with four different

concentrations of collagen, keratin, and fibronectin. 66

Figure 3.4 Adherence of S. aureus to wells coated with collagen and

exposed to cell extracts from, L. lactis pGhost9-CyuC (CyuC), L.

lactis pGhost9-CyuC-Lss (CLss), and L. lactis pGhost9-his1-lss-

his2 (Lss). 67

Figure 3.5 Adherence of S. aureus to wells coated with fibronectin and

exposed to cell extracts from, L. lactis pGhost9-CyuC (CyuC), L.

lactis pGhost9-CyuC-Lss (CLss) or L. lactis pGhost9-his1-lss-

his2 (Lss). 68

Figure 3.6 Adherence of S. aureus cells to wells coated with keratin and

exposed to cell extracts from L. lactis pGhost9-CyuC (CyuC), L.

lactis pGhost9-CyuC-Lss (CLss) or L. lactis pGhost9-his1-lss-

his2 (Lss). 69

Figure 4.1 The regions of the his operon cloned from the chromosome (A)

and the structure of pGhost-his1-lss-his2 (B). 77

Figure 4.2 Stable integration of the lss expression cassette into the L. lactis

chromosome. 78

xi

Figure 4.3 Representation of the pGhost9-transposed mutant between

duplicated ISS1 elements (A). 83

Figure 4.4 Schematic representation of the creation of a mutant by random

transposon mutagenesis using pGhost9:ISS1 and the excision of

the plasmid from the chromosome. 84

Figure 4.5 Example of a western blot used in semi-quantification. 86

Figure 4.6 Identification of the insertion sites for the nine over-secreting

mutants. 91

Figure 4.7 Phylogenetic tree showing L. lactis MurA2 is more closely

related to the primary MurA in other species. 93

Figure 4.8 Transmission electron micrographs of the control strain,

MG1363[lss] (A, B) and the murA2[lss] mutant (C, D). 94

Figure 4.9 Coomassie-stained SDS-PAGE of proteins from the supernatant

fractions. 95

Figure 4.10 Western blot detection of L. lactis strains secreting lysostaphin

and Ply511 in the cell associated and supernatant fractions. 97

Figure 4.11 Dilutions of cultures incubated for 18 h spotted onto GM17 agar

with various concentrations of lysozyme. 99

xii

LIST OF ABBREVIATIONS

2D 2 dimensional

6-histidine hexa-histidine

aa amino acids

ABC ATP-binding cassette

APF aggregating promoting factor

ATCC American Tissue Culture Collection

ATP adenosine triphosphate

BCV bovine corona virus

BHI brain heart infusion

BLAST basic local alignment search tool

bp (bps) base pair(s)

BSA bovine serum albumin

CAPS 3-cyclohexylamino-1-propanesulfonic acid

CFTR cystic fibrosis transmembrane conductase regulator

cfu colony forming units

ClfB clumping factor B

d day

DMSO dimethyl sulfoxide

DNA deoxyribonucleic acid

dNTP deoxynucleotide triphosphate

ECM extracellular matrix

ECMBPs extracellular matrix binding proteins

EDTA ethylenediaminetetraacetate

Em erythromycin

FnBPA fibronectin binding protein A

FnBPB fibronectin binding protein B

g gravitational force

GAS group A streptococci

G+C guanine and cytosine

GRAS generally regarded as safe

HIV human immunodeficiency virus

IMAC immobilised metal affinity chromatography

kb kilo bases

xiii

kDa kiloDaltons

LAB lactic acid bacteria

LB Lysogeny Broth

LysM lysin motif

MAb monoclonal antibody

Mbps mega base pairs

mol% percentage molarity

MRS de Man, Rogosa and Sharpe

MRSA methicillin-resistant Staphylococcus aureus

MSSA methicillin-susceptible Staphylococcus aureus

MSCRAMMs microbial surface components recognising adhesive

matrix molecules

NICE nisin-controlled gene expression system

NSP4 bovine non-structural protein 4

NucT staphylococcal nuclease

OD optical density

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PCR polymerase chain reaction

pI isoelectric point

PSep Sep promoter

QUT Queensland University of Technology

RE restriction enzyme

RNA ribonucleic acid

rRNA ribosomal RNA

scFv single-chain fragment variable

SD standard deviations

SDS sodium dodecyl-sulfate

SLH S-layer homology

SNPs single nucleotide polymorphisms

ssSep Sep secretion signal

subsp. subspecies

TBE Tris-borate EDTA

TBS Tris-buffered saline

xiv

TBS-T Tris-buffered saline with Tween

TCA trichloroacetic acid

TE Tris-EDTA buffer

TEM transmission electron microscopy

TEMED N,N,N’,N’-tetramethylethylenediamine

UV ultraviolet

X-Gal 5-bromo-4-chloro-3-indolyl--D-galactosidase

xv

LIST OF MANUSCRIPTS

Contents related to thesis:

Random mutagenesis identified novel host factors involved in the secretion

of antimicrobial cell wall lytic enzymes by Lactococcus lactis.

Yu Pei Tan, Philip M. Giffard, Daniel G. Barry, Wilhelmina M. Huston and

Mark S. Turner

Applied and Environmental Microbiology (October, 2008), Vol 74, pp. 7490-

7496

Other work:

Inactivation of an iron transporter in Lactococcus lactis results in

resistance to tellurite and oxidative stress.

Mark S. Turner, Yu Pei Tan and Philip M. Giffard

Applied and Environmental Microbiology (October, 2007); Vol 73, pp. 6144-

6149

xvi

STATEMENT OF ORIGINAL AUTHORSHIP

The work contained in this thesis has not been previously submitted for a degree

or diploma at this or any other higher education institution. To the best of my

knowledge and belief, the thesis contains no material previously published or

written by any other person except where due references is made.

Signed:_______________________________________

Yu Pei Tan

LLB BAppSc(Hons)

Date:____________________

xvii

ACKNOWLEDGEMENTS

Firstly, I would like to express my appreciation to my supervisory team, Dr

Mark S. Turner, Dr Wilhelmina M. Huston, and Associate Professor Philip M.

Giffard, for their support and encouragement. I would like to thank Mark for

his time, effort, and patience as a remarkable teacher, and his continued efforts

even after he has moved on from QUT. I have learnt a lot from Mark in these

past few years, from molecular microbiology and Gram-positive bacteria to golf

and beer drinking. I also wish to thank Willa for joining my supervisory team

half way through my research studies. Willa has been a wonderful and

enthusiastic mentor, always positive, and always believed in me. Finally, thank

you to Phil for challenging me to be a better scientist and for your support and

guidance even from as far away as Darwin.

I would also like to acknowledge the staff and students from the School of Life

Sciences and the Institute of Health and Biomedical Innovation, in particular

members of the Chlamydia and Reproductive Health research groups. I would

like to thank the following people for your invaluable friendship: Steven Bell,

Alison Carey, Shea Carter, Kelly Cunningham, Peter Cunningham, Tegan

Harris, Raquel Lo, Shreema Merchant, Candice Mitchell, and Alex Stephens. I

would also like to acknowledge Shea Carter and Callum Eastwood (University

of Melbourne) for mutual support during the thesis writing phase.

Next, I would like to thank my non-science friends: Malcolm and Janet Choi,

Melissa Gazsik, Angela Harris, Phil Kay, Eddie Leong, Eleanor Leung, and

Matthew Yates. These are people who have endured my eccentricities, and who

supported me, even though they had no idea what I was doing.

Finally, I would like to thank my parents for their constant support throughout

the decade of my QUT studies. I would not have been able to achieve all that I

have without their moral and financial support. I would like to dedicate this

thesis to my late mother: Thank you for everything, Mama.

xviii

1

CHAPTER 1

LITERATURE REVIEW

2

1.1 AN OVERVIEW OF LACTIC ACID BACTERIA

Lactic acid bacteria (LAB) are comprised of a diverse group of Gram-positive

bacteria. They are all catalase negative and they can range from being

aerophilic, aerotolerant to strict anaerobes. They occur as rods or cocci, and are

generally non-motile and non-spore-forming (with the exception of the genus

Sporolactobacillus) (Salk, 1973; Wood, 1992). Most importantly, all LAB

produce lactic acid as the sole or major product from fermentation of sugars,

therefore based upon this, they fall into two large groups: homofermentators and

heterofermentators. Homofermentors metabolise sugar via glycolysis (Embden-

Meyerhof-Parnas pathway). This results almost exclusively in lactic acid as the

end product under standard conditions, and the metabolism is referred to as

homolactic fermentation. Heterofermentors metabolise sugar via the 6-

phosphogluconate/phosphoketolase pathway, resulting in significant amounts of

other end products such as ethanol, acetic acid and carbon dioxide in addition to

lactic acid, and the metabolism is referred to as heterolactic fermentation

(Madigan et al., 2000; Salminen et al., 2004).

The classification of LAB into different genera is traditionally based on

morphology, mode of glucose fermentation, growth at different temperatures,

pH requirement, configuration of the lactic acid produced, ability to grow at

high salt concentrations, and acid or alkaline tolerance. Chemotaxonomic

markers, such as fatty acid composition and constituents of the cell wall are also

used in classification. With the advent of nucleotide sequencing, classification

based upon the sequence data of 16S and 23S ribosomal RNA (rRNA) and the

G+C content (i.e. the percentage moles of guanine plus cytosine content in the

genomic DNA) is the currently the most suitable approach.

Based on 16S and 23S rRNA sequence data, the Gram-positive bacteria form

two lines of descent (Figure 1.1). One phylum consists of Gram-positive

bacteria with a DNA base composition of less than 50 mol% G+C (the

Clostridium branch), whereas the other branch (Actinomyces) comprises

organisms with a G+C content that is higher than 50 mol%. The typical LAB

are of the genera Carnobacterium, Enterococcus, Lactobacillus, Lactococcus,

Leuconostoc, Pediococcus, and Streptococcus (Figures 1.1 and 1.2). However,

3

organisms such as those belonging to the genera Listeria and Staphylococcus,

ferment sugars with the production of lactic acid and are closely related to LAB

by 16S rRNA sequences, except they are catalase positive. Originally, the

genus Bifodobacterium was considered to be a member of the LAB, but based

on the high DNA G+C content and from 16S rRNA data it is now quite clear

that bifidobacteria belong to the actinomyces branch.

Lactobacillus, Leuconostoc and Pediococcus are traditionally treated separately

because of their different morphology and/or fermentation patterns. However,

phylogenetically they are intermixed (Figure 1.1). Based on 16S rRNA studies,

the genus Lactobacillus and other related genera were subdivided into three

groups: Leuconostoc, Lactobacillus delbrueckii and Lactobacillus casei-

Pediococcus (Collins et al., 1991). The Leuconostoc group is composed of all

members of the genus Leuconostoc and obligately heterofermentative

lactobacilli. The L. delbrueckii group comprises mostly of obligately

homofermentative lactobacilli. The L. casei-Pediococcus group is the largest of

the three subgroups and most of the members are facultatively

heterofermentative.

Lactococcus has its own phylogenetic cluster within the Clostridium branch

(Figure 1.1; Stackebrandt and Teuber, 1988). It was originally included in the

Streptococcus genus, but genetic evidence based on DNA-DNA and DNA-RNA

relatedness, clearly indicated that the lactic acid streptococci are a separate

species (Jarvis and Jarvis, 1981; Kilpper-Balz et al., 1982). Lactococcus was

conferred genus status and now accommodates non-motile, mesophilic

streptococci carrying a group N antigen (Schleifer and Kilpper-Balz, 1987).

4

ClostridiumActinomyces ClostridiumActinomyces

Figure 1.1. Phylogenetic tree of Gram-positive bacteria.

The bar indicates 100% expected sequence divergence (Schleifer and Ludwig,

1995).

Figure 1.2. Phylogenetic tree of LAB and related bacteria.

The bar indicates 100% expected sequence divergence (Schleifer and Ludwig,

1995).

5

1.1.1 Genomics of lactic acid bacteria

The first lactic acid bacterium genome to be completely sequenced was

Lactococcus lactis subsp. lactis IL1403, a laboratory strain (Bolotin et al.,

2001). Since then, the complete genome sequences of several LAB species

have been published: Lactobacillus plantarum (Kleerebezem et al., 2003),

Lactobacillus johnsonii (Pridmore et al., 2004), Lactobacillus acidophilus

(Altermann et al., 2005), Lactobacillus sakei (Chaillou et al., 2005),

Lactobacillus bulgaricus (van de Guchte et al., 2006), Lactobacillus salivarius

(Claesson et al., 2006), Streptococcus thermophilus (Bolotin et al., 2004),

Lactobacillus gasseri, Lactobacillus brevis, L. casei, L. delbrueckii subsp.

bulgaricus, Leuconostoc mesenteroides, Oenococcus oenii, Pediococcus

pentosaceus (Makarova et al., 2006). In addition, the genome of two L. lactis

subsp. cremoris strains have also been published: L. lactis subsp. cremoris

MG1363, the model lactic acid bacterium (Wegmann et al., 2007), and L. lactis

subsp. cremoris SK11, the phage-resistant strain used commercially in cheese

fermentation (Makarova et al., 2006). In general, LAB genomes are small (1.8

to 3.3-Mbps), compared to Escherichia coli (approximately 5.5-Mbps; Hayashi

et al., 2001) and Bacillus subtilis (4.2-Mbps; Kunst et al., 1997).

Analysis of the genome sequences of all LAB revealed a central trend of loss of

ancestral genes and metabolic simplification (Makarova et al., 2006; Wegmann

et al., 2007). The number of predicted protein-coding genes range between

approximately 1,700 (O. oenii) to over 2,700 (L. casei), and all LAB genomes

include pseudogenes, and varying in numbers from 17 (L. mesenteroides) to

over 200 pseudogenes (S. thermophilus) (Makarova et al., 2006). Differences

can be found even within the same LAB species, as observed by comparison of

the three L. lactis strains. The genome of L. lactis subsp. cremoris MG1363 is

160-kbps and 90-kbps larger than L. lactis subsp. lactis IL1403 and L. lactis

subsp. cremoris SK11, respectively (Wegmann et al., 2007). The larger genome

means L. lactis subsp. cremoris MG1363 has 465 and 346 genes that are not

present in L. lactis subsp. lactis IL1403 and L. lactis subsp. cremoris SK11,

respectively (Wegmann et al., 2007). Forty-seven of these genes present in L.

lactis subsp. cremoris MG1363 and not in L. lactis subsp. lactis IL1403 were

characterised as involved in carbohydrate metabolism and transport. This is

6

reflected in the greater ability of L. lactis subsp. cremoris MG1363 to

metabolise plant-derived sugars (Wegmann et al., 2007)

1.1.2 Applications

LAB are generally used in food production. Food-grade LAB are mostly from

the genera Lactobacillus and Lactococcus and are considered non-pathogenic.

They are often used as starter cultures in the fermentation of food, such as

cheese and yoghurt production, fermented meat products, fermented vegetables

(such as kimchi and sauerkraut), the Japanese rice wine sake, and sourdough.

Some strains of LAB may be selected for use in food preservation due to

naturally producing bacteriocins and other antimicrobial properties. LAB

produce organic acid (lactic, acetic and propionic acid) that causes significant

changes in the pH of the growth environment (sufficient to antagonise many

microorganisms), hydrogen peroxide and fatty acids (Earnshaw, 1992). These

metabolites are used to extend the shelf-life of food and to suppress spoilage

and food-borne pathogens in dairy products (Vandenbergh, 1993; Elmer et al.,

1996; Naidu et al., 1999).

LAB are also used as ‘probiotics.’ The definition of ‘probiotic’ is a “mono- or

mixed culture of live microorganisms which, applied to animal or [hu]man,

affect beneficially the host by improving the properties of the indigenous

microflora” (Havenaar and Huis In’t Veld, 1992). Probiotic LAB predominantly

belong to the genus Lactobacillus. The main mechanisms whereby probiotics

exert protective or therapeutic effects are believed to be caused by bacterial

interference, in which the presence of a microorganism limits the pathogenic

potential of another (Mcfarlane and Cummings, 1999; Sanders, 1999). The

most frequently used bacteria with well documented clinical effects are

Lactobacillus rhamnosus GG (used exclusively in probiotic yoghurts

manufactured by Parmalat®), L. acidophilus, L. casei Shirota strain (used

exclusively in the fermented milk drink, Yakult®), Lactobacillus reuteri

(Biogaia®) and L. johnsonii (used in probiotic yoghurts manufactured by

Nestlé®) (Alvarez-Olmos and Oberhelman, 2001). Lactobacillus-based

probiotics have long been used for antibiotic-associated diarrhoea. L. rhamnosus

GG is by far the most extensively studied probiotic organism in adults and

7

children. It has been reported to delay the first onset of pouchitis (complication

from proctocolectomy surgery) (Gosselink et al., 2004), alleviate the length and

intensity of antibiotic-associated diarrhoea in adults (Siitonen et al., 1999) and

children (Arvola et al., 1999; Vanderhoof et al., 1999), promote recovery from

rotaviral diarrhoea in children (Majamaa et al., 1995), and has the potential to

treat Clostridium difficile-associated diarrhoea (Gorbach et al., 1978; Biller et

al., 1995).

Some LAB species can be isolated from the mucosal surfaces of humans, such

as the oral cavity, gastrointestinal and urogenital tracts, as part of the natural

microflora. Lactobacilli are generally commensal and largely found in the

gastrointestinal and urogenital tracts, though in small numbers in the oral cavity

due to its poor ability to adhere to oral tissues (de Vrese and Schrezenmeir,

2008). L. casei and L. acidophilus are the most common lactobacilli isolated

from the gastrointestinal and urogenital tracts, and Lactobacillus fermentum is

most commonly found in the mouth and faeces. Lactococcus are non-

colonising, whilst Streptococcus colonises the mucous membranes of the mouth,

throat and respiratory and urogenital tracts, and to a lesser extent the

gastrointestinal tract. The genus Streptococcus also includes several species

that are important pathogens in humans. In addition to the highly virulent

species, such as Streptococcus pyogenes, Streptococcus pneumoniae and

Streptococcus agalactiae, many of the oral streptococci are capable of acting as

opportunistic pathogens under appropriate conditions (Hardie and Whiley,

1995). Streptococcus mutans is one of the most frequently isolated oral

streptococci and historically occupies a central position in the pathogenesis of

dental caries (Clarke, 1924; Loesche, 1986). Streptococcus milleri is a

commensal of the mouth, the gastrointestinal tract and the vagina (Bannantyne

and Randal, 1977), but has been associated with flexor sheath infection of the

hand (Lunn et al., 2001) and abscesses of the liver, brain and joints (Gossling,

1988; Rouff, 1988).

Due to their generally regarded as safe (GRAS) status, certain LAB are

considered ideal candidates either to be utilised as heterologous protein factories

(Nouaille et al., 2003), as potential live recombinant mucosal vaccines, delivery

8

vehicle for vaccines (Wells and Mercenier, 2008), and co-cultivation in food

products to suppress/prevent growth of food-borne pathogens (Cavadini et al.,

1998; Turner et al., 2007ba). As such, there have been a number of studies

conducted on protein expression and secretion systems in LAB, particularly in

lactobacilli and lactococci. Table 1.1 represents a non-exhaustive list of

heterologous proteins produced in LAB. Some of the heterologous proteins are

vaccine candidates, such as bovine corona virus epitope and the human

immunodefiency virus (HIV) envelope protein, whilst others are bacteriocins,

anti-bacterial peptides or proteins which inhibit the growth of or kill different

bacteria (more details provided in section 1.2.3).

Of the numerous LAB species with GRAS status, L. lactis has emerged as the

model bacterium for use in the production and secretion of therapeutic or

vaccine proteins (Le Loir et al., 2005). For this reason, L. lactis has been

extensively studied for the past two decades: its metabolism is relatively simple

and the genome of the international prototype for LAB genetics, L. lactis subsp.

cremoris MG1363, has been sequenced (Wegmann et al., 2007). L. lactis

provides several advantages in protein production and secretion. It only secretes

one major protein, Usp45, thus simplifying downstream purification processes

(van Asseldonk et al., 1993). The fermentation process of L. lactis can be easily

scaled up without the use of sophisticated equipment (Mierau et al., 2005a;

Mierau et al., 2005b). Numerous tools have also been developed for the

expression and secretion of heterologous proteins in the L. lactis MG1363

strain, such as inducible promoters, modified secretion signal sequences (Dieye

et al., 2001; Ravn et al., 2003), inactivation of proteases or the supplementation

with heterologous secretion machinery (Nouaille et al., 2006). Many of the

heterologous proteins produced in LAB listed in Table 1.1 were produced in L.

lactis or using tools originally developed in L. lactis. A few of these tools are

briefly described here.

The most extensively studied inducible expression system for LAB is the nisin-

controlled expression system (NICE; de Ruyter et al., 1996), where the nisA

promoter is induced by the antibacterial peptide nisin in a L. lactis host strain

that has been modified to abolish nisin production. A more recently described

9

inducible expression system utilised the pstF promoter of L. lactis subsp.

cremoris MG1363 to produce heterologous proteins comparable to the NICE

system (Siren et al., 2008). The cells are cultivated until they have consumed

phosphate in the growth medium to a concentration that induces the pstF

promoter. This new inducible promoter has the advantage that no inducing

agents need to be added and is functional without the need for modification of

the host strain. Another of these tools involves the inactivation of proteases. A

L. lactis strain was constructed deficient in the intracellular ClpP and

extracellular HtrA proteases, thus allowing heterologous proteins to be secreted

without degradation by host proteases (Cortes-Perez et al., 2006). In addition to

increase protein secretion level and stability, the L. lactis clpP-htrA mutant

strain also showed greater tolerance to high temperature stress and ethanol

resistance, and higher viability. The final tool described here involves the

supplementation of the L. lactis secretion machinery with components from

other bacteria. Supplementation of L. lactis with B. subtilis SecDF, a

component of the B. subtilis secretion machinery required for high-capacity

protein secretion, showed an increase in the levels of recombinant proteins

secreted (Nouaille et al., 2006).

1.1.3 Extracellular proteins of Gram-positive bacteria

Proteins that are expressed by LAB may be targeted to three different

subcellular locations including the cytoplasm, the extracellular environment or

the cell surface. As such, identification of signals which target secreted proteins

to the extracellular environment and signals which anchor proteins to cell

surface have been utilised to target heterologous proteins in LAB. To produce a

protein of interest, secretion is generally preferred to cytoplasmic production

because it allows continuous culture and simplifies purification. To use

lactobacilli or lactococci as a protein delivery vehicle, e.g. in the digestive tract

of humans or animals, secretion is also preferable because it facilitates

interaction between the protein and its environment, and does not rely on cell

lysis for the interaction. The following is a review on the mechanisms that

Gram-positive bacteria use to secrete and anchor proteins to the cell surfaces.

10

Table 1.1. Non-exhaustive list of heterologous proteins produced in LAB.

Proteins Expressing bacteria Reference Antigens Bovine corona virus (BCV) epitope L. lactis Langella and Le Loir, 1999 Bovine non-structural protein 4 (NSP4) L. lactis Enouf et al., 2001 Brucella abortus antigen L7/L12 L. lactis Ribeiro et al., 2002 Chlamydial antigen OmpA L. reuteri Turner and Giffard, 1998 HIV Env protein L. reuteri Turner and Giffard, 1998 Human cystic fibrosis transmembrane conductance regulator (CFTR) protein

L. reuteri Turner et al., 2003

Human E-cadherin L. lactis, L. reuteri, L. rhamnosus Turner et al., 2004a Human papillomavirus E7 L. lactis Bermudez-Humaran et al., 2002 Porcine parvovirus VP2 L. casei Xu and Li, 2008 scFv (against Human IgE) L. johnsonii Scheppler et al., 2005 TTFC L. lactis Wells et al., 1993 Bacteriocins Acidocin A L. casei Kanatani et al., 1995

Acidocin B L. plantarum Van der Vossen et al., 1994

Carnobacteriocin B2 L. sakei Axelsson et al., 1998

Colicin V L. lactis Divergicin A Leuconostoc gelidum

Van Belkum et al., 1997

Van Belkum et al., 1997

Enterocin A Enterococcus faecalis O’Keeffe et al., 1999

Helveticin J L. johnsonii Fremaux and Klaenhammer, 1994

Hiracin JM79 L. lactis, L. sakei, E. faecalis, Enterococcus faecium

Sanchez et al., 2008

Lactacin 3147 E. faecalis Ryan et al., 1999 Lactacin F L. gelidum Allison et al., 1995

Lactococcin A L. gelidum Leucocin A L. lactis

van Belkum and Stiles, 1995

11

Lysostaphin L. lactis, L. reuteri, L. rhamnosus, L. plantarum Turner et al., 2007b L. johnsonii Fremaux and Klaenhammer, 1993 Mesentericin Y105 Lactococcus cremoris Biet et al., 1998

L. lactis Chikindas et al., 1995

L. sakei Axelsson et al., 1998 Pediocin PA-1

E. faecalis, S. thermophilus Coderre and Somkuti, 1999

Listeria monocytogenes bacteriophage endolysin, Ply511

L. lactis, L. reuteri, L. rhamnosus, L. plantarum Turner et al., 2007b

Cell wall anchor S. aureus Protein A L. lactis Steidler et al., 1998a Enzymes L. delbrueckii cell surface proteinase PrtB L. lactis Germond et al., 2003

Staphylococcal nuclease (NucT) L. lactis, Streptococcus salivarus Le Loir et al., 1994 Immune modifiers/adjuvant Cholera toxin B subunit Lactobacillus paracasei, L. plantarum Slos et al., 1998 Human Interferon-beta 1b L. lactis Zhuang et al., 2008 Murine IL-2 L. lactis Murine IL-6 L. lactis

Steidler et al., 1998b Steidler et al., 1998b

Murine IL-10 L. lactis Schotte et al., 2000 Murine IL-12 L. lactis Bermudez-Humaran et al., 2003 Miscellaneous protein Brazzein (sweet-tasting) L. lactis Berlec et al., 2008

12

In LAB, like in other bacteria, proteins destined for translocation across the

cytoplasmic membrane contain a signal peptide (Blobel, 1980) that is generally

composed of a core of 15 to 20 hydrophobic residues flanked at the N-terminal

end by positively charged residues (Emr et al., 1980; Silhavy et al., 1983). For

secreted proteins, signal peptides are proteolytically removed by signal

peptidases upon translocation across the cytoplasmic membrane (Dev and Ray,

1990; Dalbey et al., 1997). Sometimes secreted proteins require subsequent

folding and maturation steps to acquire their active conformation (Pugsley and

Possot, 1993).

Signal peptides are necessary and sufficient for protein translocation across

membranes if the fused polypeptide substrate can be maintained in an export

competent state, a function that can be achieved in one of two separate pathways

(de Gier et al., 1997, Valent et al., 1998). In one pathway, a signal peptide

recognition protein can bind to the signal peptides of nascent chains and

temporally arrest their ribosomal translation (Walter and Blobel, 1980; Walter

and Blobel, 1981; Walter et al., 1981). Alternatively, signal peptide-bearing

precursors may be translocated after their synthesis has been completed, i.e. by

a post-translational translocation process.

Translocation of proteins involves different transport systems such as the

general secretory (Sec) pathway or the ATP-binding cassette (ABC) transporters

(Tjalsma et al., 2000). The highly conserved Sec pathway, which represents the

main pathway for protein transport in Gram-positive bacteria, has been studied

extensively in B. subtilis (Figure 1.3). This pathway mediates the translocation

of secretory and membrane proteins through a channel formed by the

membrane-embedded Sec-YEG protein complex, and driven by SecA, a

peripherally bound ATPase, which interacts with its substrate proteins and has

an affinity for Sec-YEG (Campo et al., 2004).

13

Signal peptide

Signal peptidecleavage site

Signal peptidase

Cell membrane Cell wall

Signal peptide

Signal peptidecleavage site

Signal peptidase

Cell membrane Cell wall Figure 1.3. Schematic representation of the B. subtilis protein translocation

pathway.

This pathway mediates the secretion of proteins across the cytoplasmic

membrane. To release the secreted proteins, the signal peptide is cleaved by

signal peptidases, and the mature protein is correctly folded by PrsA. Figure

has been adapted from Yamane et al., 2004.

The majority of extracellular proteins in Gram-positive bacteria are at some

stage anchored to the cell wall either via covalent or non-covalent cell wall

binding domains. Covalent attachment to the cell wall or cytoplasmic

membrane occurs via the carboxy-terminal LPXTG-type or amino-terminal

LXXC sorting signals, respectively (Navarre and Schneewind, 1999). Non-

covalent attachment to the cell wall or cell wall components occurs either via

specific repetitive LysM, choline-binding, or S-layer homology (SLH) domains

(Giffard and Jacques, 1994; Navarre and Schneewind, 1999; Buist et al., 2008)

or via non-specific cationic domains (Turner et al., 1997; Antikainen et al.,

2002). Varying amounts of both covalent and non-covalent surface anchored

proteins may be released into the environment due to cell wall turnover, cell

lysis, or proteolytic events (Buist et al., 1995; Piard et al., 1997; Rojas et al.,

2002; Roos and Jonsson, 2002).

14

1.1.3.1 Covalent attachment of surface proteins

Covalent attachment to the cell wall occurs via the C-terminal LPXTG sequence

motif, where X is any amino acid, followed by a C-terminal hydrophobic

domain and a tail of mostly positively charged residues (Fischetti et al., 1990).

The LPXTG motif is highly conserved within the sorting signals of all known

wall-anchored surface proteins of Gram-positive bacteria. LPXTG-carrying

proteins bind to the peptidoglycan peptide cross-bridge of the Gram-positive

bacteria cell wall. Cleavage has been demonstrated to occur between the

threonine and glycine residues at the LPXTG motif by a sortase (Navarre and

Schneewind, 1994). Examples of surface proteins with LPXTG include PrtP

(casein serine protease) from L. lactis (Vos et al., 1989), PrtP from L. paracasei

(Holck and Naes, 1992), M6 from S. pyogenes (Hollingshead et al., 1986), M

protein from streptococci (Talay et al., 1996), and Protein A (IgG binding

protein) from S. aureus (Uhlen et al., 1984; Shuttleworth et al., 1987).

Covalent attachment of proteins to the cytoplasmic membrane occurs via an N-

terminal LXXC secretion signal, where X is normally a small uncharged amino

acid. Following cleavage of this signal peptide by signal peptidase II, the

cysteine is then attached to a lipid (Hayanashi and Wu, 1990). Examples of

proteins with LXXC signal peptide include ScaA (manganese ion, Mn2+,

transporter) from Streptococcus gordonii PK488 (Kolenbrander et al., 1994;

Kolenbrander et al., 1998), PrtM (membrane-associated lipoprotein) from L.

lactis (Haandrikman et al., 1991) and OppA (oligopeptide transport protein)

from L. lactis (Tynkkynen et al., 1993).

1.1.3.2 Non-covalent attachment of surface proteins

1.1.3.2.1 LysM domains

The LysM domain is the most prominent way for proteins to attach to the cell

wall peptidoglycan in a non-covalent manner (Buist et al., 2008). This binding

has been recently demonstrated to be non-species-specific and the domain may

bind to many Gram-positive bacteria with different peptidoglycan structures

(Steen et al., 2003). The LysM domain occurs most often in cell wall degrading

enzymes where it anchors the catalytic domains to their peptidoglycan

substrates as repetitive sequences. LysM domains are typically found repeated a

15

number of times in the C-termini of non-covalently anchored surface proteins

such as in AcmA from L. lactis (contains three LysM domains) (Buist et al.,

1995), p60 and MurA from Listeria monocytogenes (contains two and four

LysM domains, respectively) (Goebel et al., 1991; Carroll et al., 2003).

1.1.3.2.2 YG repeats or choline-binding domains

Another non-covalent attachment mechanism to the cell wall is via choline-

binding domains, also known as YG repeats (Giffard and Jacques, 1994). The

most studied proteins which contain a choline-binding domain are that of

pneumococcal lytic enzymes (Lopez and Garcia, 2004). Pneumococcal

lipoteichoic or teichoic acids contain choline in their structure, an aminoalcohol

that plays a fundamental biological role in the physiology of pneumococcus

converting choline onto the cell surface of S. pneumoniae (Fischetti et al.,

2000). Pneumococcal bacteriophage endolysins, such as CPL-1 and -9 (Garcia

et al., 1990), and pneumococcal autolysins LytA, B and C, bind to choline

residues of the cell wall. This interaction is strictly required for activity. These

YG repeats are also found in several extracellular proteins of Gram-positive

bacteria such as glucan binding glucansucrases (Shah et al., 2004b) and

glucosyltransferases of oral streptococci (Wren, 1991; Von Eichel-Streiber et

al., 1992; Giffard and Jacques, 1994).

1.1.3.2.3 GW modules

Homologous domains of around 80-90 amino acids (aa) in length which are

present in a number of cell wall associated polypeptides from Gram-positive

bacteria have been shown to mediate cell wall anchoring of lysostaphin from

Staphylococcus simulans (Baba and Schneewind, 1996), autolysin of S. aureus

(Baba and Schneewind, 1998), Ami (amidase) and internalin B (invasion

protein) from L. monocytogenes (Braun et al., 1997) and SpaA (antigen) from

Erysipelothrix rhusiopathiae (Makino et al., 1998). These domains were

termed as GW modules due to the presence of GW dipeptide (Braun et al.,

1997). The cell wall components recognised by the GW modules are not

known, although it has been hypothesised that they may bind to a cell wall

component common to many Gram-positive bacteria, such as teichoic acid

moieties (Braun et al., 1997).

16

1.1.3.2.4 S-layer homology domains

Bacterial surface layers (S-layers) are two-dimensional crystalline arrays

covering the entire cell surface and are one of the most commonly observed

bacterial cell surface structures (Sleytr and Messner, 1988). The cell wall-

targeting mechanism of some S-layer proteins were found to be mediated by 10-

15 conserved amino acids, referred to as the S-layer homology (SLH) domain

(Fujino et al., 1993, Lupas et al., 1994). It has been found that S-layer proteins

lacking the SLH domain did not bind to cell walls in vitro (Olabarria et al.,

1996; Ries et al., 1997). The mechanism for SLH-mediated targeting of surface

proteins was not understood until recently, with the characterisation of the

csaAB operon of Bacillus anthracis (Mesnage et al., 2000). This conserved

operon encodes for the function of cell wall polysaccharide pyruvylation, a

modification that was necessary for the binding of the SLH domain to the cell

wall.

1.1.3.2.5 Unique domain – Sep

L. reuteri BR11 (formally classified as L. fermentum BR11) was isolated by

researchers at the Queensland University of Technology (QUT) from the female

guinea pig urogenital tract (Rush et al., 1994). Examination of supernatant

fractions from broth cultures revealed the presence of a 27 kDa small exported

protein (Sep; Figure 1.4). Sep is a 205 aa protein and contains a 30 aa secretion

signal and has overall homology (between 39 and 92%) with similar sized

proteins of Enterococcus faecium, S. pneumoniae, S. agalactiae and L.

plantarum. The C-terminal 81 aa of Sep showed strong homology to the

aggregating-promoting factor (APF) surface proteins of L. gasseri and L.

johnsonii (Turner et al., 2004a), which have been shown to determine cell shape

(Ventura et al., 2002). Sequence analysis of Sep for cell surface anchoring

domains revealed that it does not contain any typical covalent anchoring signals

such as cell wall-anchoring LXPTG or lipoprotein LXXC signal, but the N-

terminus of the mature protein unusually contain a single LysM domain, thus

making it distinct from APF proteins (Turner et al., 2004a). Within the C-

terminal domain, the presence of a YG motif was identified that was not related

to the LysM domain. LysM and YG domains are both functionally similar in

that they both recognise carbohydrates as ligands (Giffard and Jacques, 1994;

17

Bateman et al., 2000; Buist et al., 2008). Its biological function is unknown and

it is weakly anchored to the cell surface. Sep has also been shown to be useful

as a heterologous peptide fusion partner in L. reuteri BR11, L. rhamnosus GG

and L. lactis MG1363 (Turner et al., 2004a), and has the potential for

heterologous protein expression and export in LAB.

86% homology to C-terminal of APF1 from Lactobacillus johnsonii

Region rich in glutamine amino

acid

Lys M domain

Secretionsignal

YGQ-richLysMSS30 80 124 205

86% homology to C-terminal of APF1 from Lactobacillus johnsonii

Region rich in glutamine amino

acid

Lys M domain

Secretionsignal

YGQ-richLysMSS30 80 124 205

Figure 1.4. Modular structure of Sep.

Numbers above represents the number of amino acids. The YG motif is located

at amino acid position 150 (Y) and 155 (G) in the C-terminal region.

1.1.3.2.6 Non-specific anchored proteins

It is hypothesised that certain positively charged proteins may be anchored by

electrostatic interaction with acidic groups on the bacterial cell surface. One

such protein is the Lactobacillus S-layer protein. Unlike the S-layer proteins

described in section 1.1.3.2.4, S-layer proteins found in Lactobacillus lack the

SLH domain homologues, and the anchoring mechanism to the cell wall

remains uncharacterised (Engelhardt and Peters, 1998; Brechtel and Bahl,

1999). Based upon their genetic sequences, it was predicted that Lactobacillus

S-layer proteins range in size between 43 and 46 kiloDaltons (kDa) with basic

isoelectric points (pI > 9), and sequence variation in the N-terminal region

(Vidgren et al., 1992; Boot et al., 1993; Boot et al., 1995; Callegari et al., 1998;

Sillanpaa et al., 2000). The two well-characterised lactobacilli S-layer proteins

are CbsA of Lactobacillus crispatus (Sillanpaa et al., 2000), and SlpA of L.

brevis (Hynonen et al., 2002). Both these proteins exhibit binding activities to

extracellular matrix (ECM) proteins, with CbsA binding to collagen and SlpA

having affinity for epithelial cells and fibronectin. Furthermore, it was

demonstrated that the lysine-rich, C-terminal region of CbsA was responsible

18

for anchoring the S-layer protein to the cell wall peptidoglycan and this was

hypothesised to be based on electrostatic interactions involving the lysine

residues (Antikainen et al., 2002).

Another surface-located protein is CyuC (previously known as BspA), of L.

reuteri BR11 (Hung et al., 2005; Turner et al., 1997). CyuC is a high-affinity

L-cystine-binding protein, part of an ATP-binding cassette uptake transporter

system encoded by the cyuABC gene cluster (cyu for cystine uptake). CyuC was

found not to contain any lipoprotein cleavage and attachment motif (LXXC),

despite its origin in a Gram-positive bacterium. As the predicted isoelectric

point is 10.59, it was hypothesised that CyuC was anchored by electrostatic

interaction with the cell surface. This hypothesis was supported when CyuC

could be selectively removed from the surface by extraction with an acid buffer

(Turner et al., 1997).

1.1.4 Transposon mutagenesis – tool for genetic analyses

Much of the genetic potential of completely sequenced genomes is poorly

described or undefined. For example, 22% and 36% of the sequenced L. lactis

subsp. lactis IL1403 are of unknown function and poorly characterised,

respectively (Bolotin et al., 2001). The recently sequenced LAB prototype L.

lactis subsp. cremoris MG1363 is significantly larger (additional 160-kb) and is

predicted to encode 530 unique proteins (Wegmann et al., 2007). Therefore, to

take full advantage of functional genomics, it is essential to have efficient

genetic tools for mutagenesis.

In many bacteria, transposition has been a valuable genetic tool to study

chromosomal genes, their functions and regulators. Transposition is the random

non-sequence-specific insertion of a segment of DNA to a new position either

into the chromosome or plasmid. In L. lactis, transposition of the conjugative

elements Tn916 (Romero and Klaenhammer, 1990) and Tn919 (Hill et al.,

1987) have been reported. However, their use is limited by a requirement for

high-efficiency conjugal transfer and site-specific transposition in certain

strains. Maguin et al. (1996) developed an efficient insertional mutagenesis

method by associating the insertion sequence ISS1 (transposable bacterial

19

sequences) with the thermosensitive replicon pGhost. This mutagenic tool,

named pGhost9:ISS1, can be used even in poorly transformable strains, and has

been reported to be transformed in a number of species of on enterococci,

lactobacilli, lactococci, and streptococci (Table 1.2). High frequency

transposition using pGhost9:ISS1 allows efficient gene inactivation and direct

cloning of DNA surrounding the insertion. Efficient excision of the plasmid

replicon by a temperature shift gives rise to a stable food-grade mutant strain,

which doesn’t contain any antibiotic resistant markers. This is achieved when

pGhost9:ISS1 is first transformed in the LAB strain at a permissive temperature,

and transposition is selected for at a higher non-permissive temperature. This

temperature increase selects out plasmid replicating LAB. Replicative

transposition of the ISS1 sequences into the chromosome of LAB leads to the

integration of the plasmid vector. Transposition is thus revealed by selection for

antibiotic-resistant clones able to grow at a temperature restrictive for plasmid

replication.

Table 1.2. Examples of studies that used pGhost9:ISS1 to identify gene functions in LAB. Host species Function studied References

UV resistance Duwat et al., 1997 Secretion of NucT enzyme Nouaille et al., 2004 Biosynthesis of cell wall polysaccharides for bacteriophage adsorption

Dupont et al., 2004

L. lactis

Tellurite and oxidative stress resistance

Turner et al., 2007a

Branched-chain amino acid biosynthesis pathway for growth in milk

Garault et al., 2000

Phage resistance Lucchini et al., 2000

S. thermophilus

Defence against superoxide stress

Thibessard et al., 2004

S. agalactiae Signal transduction system regulating fibrinogen binding activity

Spellerberg et al., 2002

L. plantarum Regulation of phenolic acid metabolism

Gury et al., 2004

Streptoccus suis serotype 2 Exonuclease with cell-wall anchoring motif

Fontaine et al., 2004

20

1.2 AN OVERVIEW OF ANTIMICROBIAL PROTEINS

Antibiotic-resistant pathogens pose an enormous threat to the effective

treatment of a wide range of serious infections. Currently, some of greatest

causes for concern are infections by strains of S. aureus, enterococci and

pneumococci, displaying acquired resistance to six or more antibiotics. The

problem of antibiotic resistance has been compounded by the development of

many broad-spectrum antibiotics, whereas the patient population might be

served better by more selective medicines with activity restricted against small

groups of pathogens.

One option to combat infections caused by antibiotic-resistant bacteria is

vaccination. However, vaccines usually only elicit a systemic immune response

that may not, for example, efficiently reduce the mucosal carriage of the

pathogen (Mbelle et al., 1999; Veehoven et al., 2004). Other infectious disease

control methods for which resistance is rare and which are able to block the

initial entry into the host via mucosal sites are currently being investigated. One

such method is the use of antimicrobial proteins, such as attachment blocking

proteins, bacteriophage endolysins and bacteriocins.

1.2.1 Attachment blocking proteins

The identification of pathogen adhesins and host receptors has led to the

development of a new type of antimicrobial agent which blocks the initial stage

of infection, host attachment. Anti-adhesive strategies aimed at blocking this

interaction offer a means of preventing infection at an early stage. Three classes

of adhesion-blocking agent have been investigated: anti-adhesin antibodies,

adhesin analogues or receptor analogues (Kelly and Younson, 2000; Kelly et al.,

2001).

1.2.1.1 Anti-adhesin antibodies

This form of treatment involves passive immunisation of mucosal surfaces with

an anti-adhesin antibody. The uses of monoclonal antibodies (MAb) that

specifically target microbial adhesins are a means of enhancing the effectiveness

of this form of treatment. MAb were established to Helicobacter pylori and

inhibited adhesion to human cancer cell-line MKN45 (Osaki et al., 1998).

21

Adhesion-blocking MAb was also shown to be effective in protecting against

the re-colonisation of Porphyromonas gingivalis (possible cause of

periodontitis) in human trials (Booth et al., 1996).

However, the half-life of these molecules demands continuous administration

and raises the problems of bioavailability, safety and cost. This may be

overcome with the in situ delivery of passive immunity by non-pathogenic

bacteria producing anti-adhesin antibodies. This was demonstrated when a

single-chain fragment variable (scFv) antibody expressed by Lactobacillus zeae,

which was specific for the S. mutans surface antigen I/II, was able to reduce the

colonisation of the oral cavity by S. mutans and the development of dental caries

in rat models (Kruger et al., 2002). More recently, a L. casei strain was used to

secrete a scFv antibody specific for intercellular adhesion molecule 1, which

was able to block cell-associated HIV-1 transmission across an in vitro culture

model of the cervical epithelium (Chancey et al., 2006)

1.2.1.2 Adhesin analogues

Soluble forms of a microbial adhesin (or a fragment of it) may be used as

competitive inhibitors to block adhesion. A synthetic peptide corresponding to

residues 1025-1044 of SA I/II, which inhibited adhesion in vitro of S. mutans to

a salivary receptor (Kelly et al., 1995), was also shown to prevent infection in a

human clinical trial using a re-colonisation model (Kelly et al., 1999).

Other adhesin analogues may be found from another source, such as LAB.

Many commensal LAB have surface proteins that enable adhesion to host ECM

proteins just like their pathogenic relatives. It has been demonstrated that the

surface proteins of L. reuteri RC-14 was able to competitively inhibit adhesion

of E. faecalis to the surface of plastic (Heinemann et al., 2000) and of S. aureus

to surgical implants in mice (Gan et al., 2002).

1.2.1.3 Host-receptor analogues

Treatments using host-receptor analogues involve the use of analogues which

bind to microbial adhesins, thereby reducing the amount of microbial adhesins

available to bind to the real host-receptors. Many studies have investigated

22

soluble carbohydrate receptor analogues reflecting the frequency with which

these structures are recognised by microbial adhesins. Adhesion of S.

pneumoniae to human cell lines and to primary epithelial cells in vitro was

inhibited by sialylated oligosaccharides (Barthelson et al., 1998).

1.2.2 Bacteriophage endolysins

Near the end of the bacteriophage lytic cycle, the virus needs to coordinate

bacterial host lysis with the completion of viral assembly. For double-stranded

DNA bacteriophages, this is done by the production of a protein lytic system

consisting of a holin and lysin. The holin forms a pore in the bacterial

cytoplasmic membrane allowing the endolysin or lysin to gain access to the cell

wall. Degradation of the cell wall causes bacterial lysis by osmotic pressure and

therefore the release of progeny phage. Endolysins have particularly narrow

substrate specificities with generally only either intra-species or –genus

bacteriolytic activity. Table 1.3 lists examples of functional Gram-positive

bacteriophage endolysins with their specificity and the optimal pH for activity.

Endolysins from phages of Gram-positive hosts are able to quickly cause cell

lysis of the target bacteria when added exogenously (Loessner et al., 1995b).

This “lysis from without activity” is limited to Gram-positive bacteria, since

Gram-negative bacteria have an outer membrane. Although this activity has

been known for some time since the 1970’s (generally used to recover DNA,

RNA and proteins from cells) (Loessner et al., 1995b), it is surprising that

endolysins had not been investigated as bacterial control agents until the 21st

century. In the first study conducted this century, it was shown that 10ng of

purified endolysin from the streptococcal bacteriophage C1 was able to rapidly

kill 106 S. pyogenes in seconds (Nelson et al., 2001). The same killing effect

could also be observed in vivo with one oral endolysin treatment being sufficient

to eliminate S. pyogenes from mice with a heavily colonised oral pharynx. It

was also shown that the endolysin was only lethal to Group A, C and E

streptococci with no effects on other streptococci or other bacteria. This line of

research was extended to the treatment of S. pneumoniae infections using the

pneumococcal Dp-1 bacteriophage endolysin Pa1 (Loeffler et al., 2001). The

lethality of this enzyme was demonstrated on a range of pneumococci including

highly penicillin-resistant strains but was shown to be ineffective in killing oral

23

streptococcal strains, including S. mutans. Mice colonised intranasally with S.

pneumoniae revealed undetectable pneumococcal colony forming units five

hours after a single Pal treatment. Most recently the PlyG endolysin from the γ

bacteriophage from B. anthracis was shown to be specific in the killing of

members of the B. anthracis cluster of bacilli (Schuch et al., 2002). The PlyG

endolysin was able to rescue 77% of mice from what would be a lethal dose of

the test Bacillus cereus strain injected intraperitoneally.

As yet, no resistance has been observed for S. pyogenes, pneumococci or B.

cereus treated with varying amounts of endolysin. Even when B. cereus was

subjected to mutagenesis with methane sulphonic acid ethyl ester, which

increased the number of spontaneous antibiotic-resistant mutants, no endolysin-

resistant mutants were observed (Schuch et al., 2002). Spontaneous B. cereus

mutants resistant to γ bacteriophage are still sensitive to PlyG endolysin.

During the S. pyogenes and pneumococcal studies there was a rebound in

positive cultures for a few animals 1-2 days following endolysin treatment,

however none of these isolates were endolysin resistant. This suggests that

repeated administration of the endolysin treatment or a method whereby the

persistence of the endolysin at the mucosal surface can be increased may be

required for optimal effectiveness.

Endolysins may also have a potential as novel agents for the control of

foodborne pathogens such as L. monocytogenes (Loessner et al., 1995a) and

Clostridium perfringens (Zimmer et al., 2002) in human and animal foodstuffs.

The highly specific action of the endolysin, Ply3626, on C. perfringens forms

the basis for the potential applications of this enzyme, particularly as an

antimicrobial additive in poultry intestines and a biopreservative in raw chicken

or turkey (Zimmer et al., 2002). The use of lytic bacteriophages to reduce L.

monocytogenes on fruits has already been demonstrated (Leverentz et al., 2003).

In addition, the ability of the L. monocytogenes bacteriophage endolysin Ply511

to be cloned, expressed and secreted in L. lactis and other LAB (Gaeng et al.,

2000; Turner et al., 2007b) suggests the potential for this endolysin to be

utilised in fermented food products, such as dairy, meat and vegetables, the

24

contamination of which has been linked with human listeriosis (Farber and

Peterkin, 1991; Ryser and Marth, 1999).

1.2.2.1 Structure of endolysins

Most endolysins lack a secretory signal sequence and thus the holin, which

permeabilises the membrane, is required for the endolysin to gain access to the

peptidoglycan (Young et al., 2000). Depending on the peptidoglycan bond

which they hydrolyse, endolysins can be further grouped into N-

acetylmuramidases (lysozymes) which act on the carbohydrate components, N-

acetylmuramyl-L-alamidases which cleave the bond between the carbohydrate

and peptide components, endopeptidases which cleave the peptide interbridge,

or transglycosylases which cleave the glycosidic bond in a glycan strand of

bacterial cell wall (Young, 1992).

Little information has been published about the molecular structure and

mechanisms of functional endolysins. The focus has largely been on the holin

component of the bacteriophage lytic cassette as it controls the timing of cellular

lysis (Wang et al., 2000). It has been proposed that endolysins are modular

enzymes consisting of a catalytically active domain and a cell wall binding

domain. However, this hypothesis is mostly based upon sequence homologies,

and only recently experimental data has demonstrated which parts of the

endolysin contain the enzymatic activity and the cell wall binding capacity. In

most cases, the catalytic domains are located at the N-terminus and the cell-wall

binding domain is located at the C-terminus of endolysins.

Endolysins are typically between 30 and 60-kDa in size and sometimes function

as dimers (Grundling et al., 2000). The pH optimal for endolysin activity is

normally acidic (see Table 1.3), except for Listeria endolysins (pH 8.0-9.0)

(Loessner et al., 2002). Although most endolysins don’t contain secretion

signals, some like the L. plantarum phage g1e endolysin Lysg1e does. The N-

terminal region of Lysg1e, which is thought to be the catalytic domain of

endolysins in general, consists of a signal-peptide-like domain and a domain the

putative active sites of endolysin (Kakikawa et al., 2002).

25

1.2.3 Bacteriocins

Bacteriocins are anti-bacterial peptides or proteins ribosomally synthesised by

bacteria which either inhibit the growth or kill different bacteria. These toxins

have been found in all major lineages of bacteria, and it has been suggested that

99% of all bacteria may make at least one bacteriocin (Klaenhammer, 1988).

Bacteriocins can range from 19 to greater than 270 amino acids and vary in

action from forming holes in the cytoplasmic membrane to enzymatically

degrading the cell wall peptidoglycan.

Bacteriocins of Gram-positive bacteria differ from Gram-negative bacteria in

two fundamental ways: (i) bacteriocin production is not necessarily the lethal

event it is for Gram-negative bacteria; and (ii) Gram-positive bacteria have

evolved bacteriocin-specific regulation, whereas bacteriocins of Gram-negative

bacteria rely solely on host regulatory networks. The non-lethality of

bacteriocin production in Gram-positive bacteria is due to the transport

mechanisms Gram-positive bacteria encode to release the bacteriocin. Some

have evolved a bacteriocin-specific transport system, while others employ the

sec-dependent export pathway. From this point, only Gram-positive

bacteriocins will be discussed. Table 1.4 lists examples of Gram-positive

bacteriocins according to their class type.

26

Table 1.3. Non-exhaustive list of functional bacteriophage endolysins.

Lysin name Phage strain Host bacteria Optimum pH Specificity References C2(W) L. lactis 6.5-6.9 Group N and D lactic

streptococci Mullan and Crawford, 1985

Cp1-1 Cp-1 ND Garcia et al., 1987 Pa1 Dp-1

S. pneumoniae 8.0

Pneumococcal strains Sheehan et al., 1997

LysA L. reuteri ND L. fermentum, L. rhamnosus, L. casei, L. plantarum, Lactobacillus jensenii, L. delbrueckii subsp. lactis, L. lactis subsp. cremoris, S. pyogenes, S. agalactiae, S. aureus

Turner et al., 2004b

Lysg1e g1e L. plantarum L. gasseri, L. plantarum LysgaY gaY L. gasseri

ND B. subtilis, E.nterococcus hirae, L. casei, L. gasseri, L. plantarum, Lactococcus diacetylactis, L. lactis, L. mesenteroides, Micrococcus luteus, P. pentosaceus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hycus, S. simulans, Staphylococcus warneri, Staphylococcus xylosus

Yokoi et al., 2004

LytA US3 L. lactis ND 30 different lactococcal strains Platteeuw and de Vos, 1992

Mur LL-H L. delbrueckii 5.0 L. acidophilus, L. delbrueckii, Lactobacillus. helveticus, Pediococcus damnosus

Vasala et al., 1995

27

Mur-LH 0303 L. helveticus ND Thermophilic lactobacilli, lactococci, pediococci, B. subtilis, Brevibacterium linens, E. faecium

Deutsch et al., 2004

Ply118 A118 L. monocytogenes 8-9 Listeria species Loessner et al., 1995a Ply12 12826 B. cereus ND Bacillus species Loessner et al., 1997 Ply187 S. aureus phage

187 M. luteus ND Staphylococcus species Ashehov and Jevons, 1963

Ply21 TP21 B. cereus ND Bacillus species Loessner et al., 1997 Ply3626 3626 C. perfringens ND C. perfringens Zimmer et al., 2002 Ply500 A500 Ply511 A511

L. Monocytogenes 8-9 Listeria species Loessner et al., 1995a

PlyBa Bastille B. cereus ND Bacillus species Loessner et al., 1997 PlyGBS B30 S. agalactiae 5.5=6.0 Groups A, C, E and G

streptococci Pritchard et al., 2004

PlyV12 1 E. faecalis 6.0 E. faecalis, E. faecium Yoong et al., 2004 ND: Not determined

28

It is generally found that the killing range of bacteriocins is restricted to other

Gram-positive bacteria. The range of killing can vary significantly; from

relatively narrow (e.g. lactococcins A, B and M only kill Lactococcus) (Ross et

al., 1999) to extraordinary broad (e.g. nisin A have been shown to kill a wide

range of organisms including at least thirteen different genera) (Mota-Meira et

al., 2000). As an exception to the general rule, nisin A is also active against a

number of medically important Gram-negative bacteria, including

Campylobacter, Haemophilus, Helicobacter and Neisseria (Mota-Meira et al.,

2000). Bacteriocin genes are usually associated with a gene encoding the

‘immunity’ protein. This immunity protein protects bacteria from their own

bacteriocins, however the mechanism by which it does this remains unclear

(Hechard and Sahl, 2002).

Bacteriocins classification has been proposed on the basis of the primary

structures of bacteriocins produced by LAB (Klaenhammer, 1993; Nes et al.,

1996) (Table 1.4). Class I is composed of modified peptides, named

lantibiotics. Class II comprise of heat stable unmodified peptides. Class III

consists of larger heat labile proteins. Class I and II bacteriocins are the most

abundant and thoroughly studied. However, the state of bacteriocin

classification requires constant review as the knowledge concerning various

aspects of bacteriocin research rapidly accumulates and it appears that the term

bacteriocin has been used to cover a wide range of chemically diverse

substances which do not necessarily have much in common (Ennahar et al.,

2000).

1.2.3.1 Modified bacteriocins (class I)

A substantial proportion of the peptide bacteriocins of Gram-positive bacteria

undergo extensive post-translational modification before they are exported from

the cell (class I bacteriocins). These modified bacteriocins that contain non-

standard amino acids (e.g. hydroxyproline and selenomethionine), and are

therefore, given the designation ‘lantibiotics’ as an abbreviation for lanthionine-

containing peptide antibiotics.

29

Peptides classed as lantibiotics have a minimum of 19 and maximum of 38

amino acids. Lantibiotics are then further categorised into type-A and type-B

peptides (Jung, 1991). These classifications are based on structural and

functional aspects and take into account the fact that some lantibiotics are

elongated, flexible amphiphiles that form pores in bacterial membranes (i.e.

type-A), while others are globular, conformationally defined peptides that

inhibit enzyme functions (i.e. type-B).

1.2.3.2 Unmodified bacteriocins (class II)

Class II bacteriocins are unmodified, cationic and hydrophobic peptides of 20-

60 amino acids in length (Nes and Holo, 2000). They are divided into three

subclasses, IIa, IIb and IIc, on the basis of their primary structure. Their activity

mainly induces membrane permeabilisation and leakage of molecules from

sensitive bacteria. The inhibition spectrum is rather narrow, limited to species

or strains related to the producers. Accordingly, class II bacteriocins are mainly

active against low G+C gram-positive bacteria, such as lactic acid bacteria,

Listeria, Enterococcus and Clostridium.

The subclass IIa bacteriocins are those which share high similarities in their

primary structure as well as anti-listerial activity (Ennahar et al., 2000).

Subclass IIb includes bacteriocins whose activity depends on the

complementary action of two distinct peptides; therefore individual peptides

hardly display any activity. It is proposed that subclass IIc bacteriocins should

include miscellanous peptides with no structural similarity to subclass IIa or IIb

(Hechard and Sahl, 2002).

1.2.3.3 Large heat-labile bacteriocins (class III)

Large bacteriocins which cannot be identified as either class I or II are grouped

into this third class, including bacteriocins which function as cell wall degrading

enzymes.

The bacteriolytic activity and molecular structure of lysostaphin has been

thoroughly studied. Lysostaphin is an extracellular bacteriolytic enzyme

produced by a singly known staphylococcal strain, formerly designated as

30

Staphylococcus staphylolyticus (Schindler and Schuhardt, 1964) and now

designated as Staphylococcus simulans biovar staphylolyticus ATCC1362

(Sloan et al., 1982). The cell wall-degrading activity of lysostaphin is due to a

glycylglycine endopeptidase activity, which lyses practically all known

staphylococcal strains (Schindler and Schuhardt, 1964). The target of

lysostaphin is the interpeptide bridge of the peptidoglycan, which in S. aureus,

S. simulans, S. carnosus, and other staphylococcal strains is composed of five

glycine residues (Schleifer and Fischer, 1982). If one or more glycine residues

of the interpeptide bridge are replaced by serine residues, as in S. epidermidis

and S. simulans bv. staphylolyticus, the cell wall is less susceptible to

lysostaphin (Kloos and Schleifer, 1975; Robinson et al., 1979). Lysostaphin is

unable to hydrolyse glycylserine and serylglycine peptide bonds (Robinson et

al., 1979; de Hart et al., 1995). Lysostaphin seems to cleave specifically

between the third and fourth glycine residue of the pentaglycine cross-bridge, as

indicated by the release of LPXTG-containg staphylococcal cell wall bound

surface proteins following lysostaphin treatment. These proteins are covalently

anchored by their C-terminus to the pentaglycine cross-bridge of the

peptidoglycan (Schneewind et al., 1995; see 1.1.3.1).

Analysis of the lysostaphin gene (lss) sequence and the sequencing of the

amino-terminus of purified pro-lysostaphin and of mature lysostaphin revealed

that lysostaphin is organised as a preproprotein of 493 aa, with a signal peptide

of 36 aa, a propeptide of 211 aa from which 195 aa are organised in 15 tandem

repeats of 13 aa length, a mature protein of 246 aa (Thumm and Gotz, 1997;

Figure 1.5). Pro-lysostaphin is processed in the supernatant of S. simulans bv.

staphylolyticus by an extracellular cysteine protease. The mature lysostaphin

has 4.5-fold more activity than its preprotein. Therefore, it is hypothesised that

the tandem repeats of the propeptide are not necessary for protein export or

activation of lysostaphin, but rather keep the enzyme in a less active state

(Thumm and Gotz, 1997). Lysostaphin has optimal activity at pH 7.5 to 8.0

under low ionic conditions.

31

Table 1.4. Non-exhaustive list of Gram-positive bacterial bacteriocins. Class Bacteriocin Producing bacteria Sensitive bacteria References

Epidicin 280 S. epidermidis M. luteus, S. simulans, Staphylococcus carnosus Heidrich et al., 1998 Gallidermin Staphylococcus gallinarum Propionibacterium acne Kellner et al., 1988 Lacticin 481 L. lactis Clostridium tyrobutyricum Piard et al.,1993; Sahl and

Bierbaum, 1998 Lactocin S L. sakei Pediococcus acidilactici Mortvedt et al., 1991 Mutacin B-Ny266 S. mutans Actinomyces sp., Bacillus sp., Clostridium sp.,

Corynebacterium sp., Enterococcus sp., Gardnerella sp., Lactococcus sp., Listeria sp., Micrococcus sp., Mycobacterium sp., Propionibacterium sp., Streptococcus sp., Staphylococcus sp.

Mota-Meira et al., 2000

Nisin A Nisin Z

L. lactis B. cereus, C.. tyrobutyricum, L. lactis subsp. cermoris, L. monocytogenes, Micrococcus flavus, Sp. thermophilus

de Vos et al., 1993; Sahl and Bierbaum, 1998

Pep5 S. epidermidis S. carnosus, S. epidermidis, S. simulans Bierbaum et al., 1994 Salivaricin A Streptococcus salivarius M. luteus Ross et al., 1993 Subtilin B. subtilis Bacillus sp. Michener, 1953; Campbell and

Sniff, 1959

Class I Type-A lantibiotics

Variacin Micrococcus variants B. subtilis, B. cereus, Bacillus pumilis, Clostridium sp., E. faecalis, E. faecium, L. acidophilus, L. bulgaricus, Lactobacillus curvatus, L. delbrueckii, L. helveticus, L. plantarum, L. sakei, L. lactis, L. mesenteroides, Listeria innocua, L. monocytogenes, Listeria welhia, Staphylococcus sp., S. thermophilus

Pridmore et al., 1996

Type-B lantibiotics

Mersacidin Bacillus sp. C. difficile, Clostridium novyi, C. perfringens, Clostridium ramnosum, Clostridium septicum, Corynebacterium jeikeium, peptostreptococci, P. acnes, methicillin-susceptible (MS-) & methicillin-resistant (MR-) S. aureus, MS- & MR-S. epidermidis, S. pyogenes, S. agalactiae, Streptococcus bovis, S. pneumoniae

Niu and Neu, 1991

32

Bavaricin A Lactobacillus bavaricus L. monocytogenes Larsen et al., 1993 Carnobacteriocin B2 Carnobacterium piscicola Carnobacterium divergens, C. piscicola Quadri et al., 1995 Divergicin M35 C. divergens Carnobacteria sp., L. monocytogenes Tahiri et al., 2004 Enterocin A En. faecalis, L. plantarum, L. sakei, L. innocua, L.

monocytogenes, P. acidilactici, P. pentosaceus Aymerich et al., 1996

Enterocin P

E. faecium

S. aureus, L. monocytogenes, Clostridium botulinum, C. perfringens

Cintas et al., 1997

Leucocin A L. gelidium Hastings et al., 1991; Stiles, 1994

Mesentericin Y105 L. mesenteroides

Listeria sp.

Hechard et al., 1992 Mundticin Enterococcus mundtii C. botulinum, L. monocytogenes Bennick et al., 1998 Pediocin AcH C. perfringens, L. monocytogenes, S. aureus Bhunia et al., 1988 Pediocin PA-1

P. acidilactici L. monocytogenes Rodriguez et al., 2002

Piscicocin V1b C. piscicola C. divergens, E. faecalis, L. curvatus, L. plantarum, L. sakei, L. mesenteroides, L. innocua, L. monocytogenes, P. acidilactici

Bhugaloo-Vial et al., 1996

Class II Subclass IIa

Sakacin A Sakacin P

L. sakei C. piscicola, E. faecalis, E. faecium, Lactobacillus alimentarius, L. curvatus, L. sakei, Leuconostoc paramesenteroides, L. monocytogenes

Schillinger and Lucke, 1989; Tichaczek et al.,1994

Acidocin J1132 L. acidophilus L. acidophilus, L. brevis, L. casei, L. fermentum, L. plantarum Tahara et al., 1996 Enterocin 1071 E. faecalis C. tyrobutyricum, Enterococcus durans, E. faecalis, E.

faecalis subsp. liquifaciens, E. faecium, L. salivarius subsp. salivarius, L. innocua, Micrococcus sp., Peptostreptococcus aerogenes, Propionibacterium freudenreichii subsp. shermanii, S. agalactiae

Balla et al., 2000

Lactacin F L. acidophilis E. faecalis, L. delbrueckii subsp. bulgaricus and subsp. lactis, L. fermentum, L. helveticus

Muriana and Klaenhammer, 1991

Plantaricin EF L. casei, L. casei subsp. casei, L. plantarum, L. sakei, Lactobacillus viridescens, P. acidilactici, P. pentosaceus

Subclass IIb

Plantaricin JK

L. plantarum

L. plantarum, L. sakei, L. viridescens, P. Pentosaceus

Anderssen et al., 1998

33

Thermophilin 13 S. thermophilus B. cereus, Bifidobacterium bifidum, C. botulinum, E. faecium, L. acidophilus, L. helveticus, L. fermentum, L. cremoris, L. cremoris, L. mesenteroides, L. monocytogenes, S. thermophilus

Marciset et al., 1997

Lactococcin A L. lactis subsp. cremoris and subsp. lactis biovar diacetylactis

L. lactis subsp. cremoris, L. lactis subsp. lactis (bv. diacetylactis), Lactococcus raffinolactis, Lactococcus garvieae

Holo et al., 1991 Subclass IIc

Plantaricin A L. plantarum L. casei subsp. casei, L. plantarum, L. sakei, L. viridescens, P. pentosaceus

Anderssen et al., 1998

Helveticin J L. helveticus L. bulgaricus Joerger and Klaenhammer, 1986 Enterolysin A E. faecalis E. faecium, L. brevis, L. curvatus, L. sakei, L. cremoris, L.

lactis, P. acidilactici, P. pentosaceus Nilsen et al., 2003

Class III

Lysostaphin S. simulans bv. staphylolyticus

S. aureus, S. carnosus, Schindler and Schuhardt, 1964; Zygmunt and Tavormina, 1972; Schleifer and Fischer, 1982

34

The information for target cell specificity of lysostaphin is encoded in its 92aa

C-terminus (Baba and Schneewind, 1996). Experiments, whereby deletions of

the targeting signal did not interfere with endopeptidase activity but abolished

the bacteriolytic killing of S. aureus cells, indicated that this domain functions

to address specifically the bacteriocin molecule to its target cells (Baba and

Schneewind, 1996).

36 247 401 493

Cell walltargeting

15 tandem repeatsSignalpeptide

Propeptide Mature lysostaphin

36 247 401 493

Cell walltargeting

15 tandem repeatsSignalpeptide

Propeptide Mature lysostaphin

Figure 1.5. Schematic representation of the structural motifs of the lysostaphin

protein.

Numbers above represents the number of amino acids

1.2.3.4 Therapeutics and other applications of bacteriocins

The best characterised Gram-positive bacteriocins are from lactic acid bacteria.

Many of these LAB are food grade organisms that are already widely used in

the food industry in the production of fermented food, but now offer the further

prospect of application to improve food preservation. As LAB have been used

for centuries to ferment foods, they enjoy GRAS status worldwide. This

permits their use in fermented food with relatively little regulatory approval.

The best example of a commercially successful naturally produced inhibitory

agent is nisin. Known since 1928 to be produced by some L. lactis isolates

(Rogers, 1928) and structurally characterised in 1971 as a lanthionine-

containing peptide (Gross and Morell, 1971), nisin and nisin-producing strains

have had a long history of application in food preservation, especially in dairy

products.

A more recent example where bacteriocin is used as a therapeutic is the use of S.

salivarius K12 as an oral probiotic to treat halitosis and maintain throat health

35

(Blis K12 Throat Guard ®). S. salivarius K12 produces two unique types of

lantibiotics, salivaricin A2 and salivaricin B, which exhibit strong inhibitory

activity against S. pyogenes (Ross et al., 1993; Wescombe et al., 2006; Hyink et

al., 2007). S. salivarius is a primary coloniser of oral mucosal surfaces in

healthy human and is not known to initiate infections (Burton et al., 2006), in

contrast to the pathogenic S. pyogenes which has also adapted to exist on human

oral mucosal surfaces. Therefore, S. salivarius K12 can be used

prophylactically to colonise oral mucosal surfaces to reduce the incidences of S.

pyogenes infections (Tagg and Dierksen, 2003).

Although bacteriocins have been used as a food preservative since the 1950s,

the recent increase and spread of multi-drug resistant bacterial pathogens has led

to renewed interest in bacteriocins as a potential alternative anti-microbial

treatment to conventional antibiotics. S. aureus infection remains one of the

most common nosocomial and community-acquired infections. With the

emergence of methicillin-resistant S. aureus (MRSA) (Hiramatsu et al., 2001),

strains of S. aureus intermediately resistant to glycopeptides (Smith et al., 1999)

and the isolation of the first clinical strain of S. aureus fully resistant to

vancomycin (CDC, 2002), research has focused on lysostaphin as a potential

therapeutic agent rather than a research tool for DNA isolation, formation of

protoplasts and differentiation of staphylococcal strains for staphylococcal

genetic studies (Polack et al., 1993; Climo et al., 1998; Patron et al., 1999;

Dajcs et al., 2000; Climo et al., 2001). Lysostaphin has been reportedly

successful in treating systemic S. aureus infection in a mouse model (Kokai-

Kun et al., 2007), and also rapidly clearing S. aureus nasal colonisation in the

cotton rat model using a cream application (Kokai-Kun et al., 2003).

1.3 AIMS OF THIS STUDY

L. lactis is a Gram-positive bacterium that is considered a desirable candidate to

be utilised as a heterologous protein factory, and as a recombinant protein

delivery vehicle. Several tools have been designed for the purpose of

expressing and secreting heterologous proteins efficiently in L. lactis. One such

tool developed by the LAB research group at QUT utilises the promoter and

36

secretion signal from the highly abundant, non-covalently bound surface protein

Sep (patent number: PCT/AU2004/001461). Despite its unknown function, the

Sep system has been successfully utilised as a fusion partner for the

heterologous expression and secretion of several different proteins in L. lactis

and other LAB (Liu et al., 2006; Turner et al., 2004a; Turner et al., 2007b).

It is the overall hypothesis of this thesis that L. lactis can be modified to be an

effective antimicrobial. To this end, the expression and optimisation of

heterologous antimicrobial proteins in L. lactis were investigated. The first part

of the investigation (Chapter 3) was to produce several novel proteins in L.

lactis, including a fusion protein consisting of CyuC and lysostaphin to test their

potential in reducing S. aureus attachment to ECM proteins, whilst the second

part of the investigation (Chapter 4) sought to identify L. lactis factors which

affected the secretion of lysostaphin, the chosen heterologous protein of interest.

37

CHAPTER 2

GENERAL MATERIALS AND METHODS

38

2.1 GROWTH MEDIA

The following solutions were resuspended in Milli-Q H2O (water that has been

purified and deionised until the electrical resistance of the water measured 18

m) and sterilised by autoclaving at 121C for 15 min or by filter sterilisation

using a 0.22µm filter (Millipore).

2.1.1 Agar plates

Bacteriological agar (Oxoid Australia) was added to liquid media to achieve a

concentration of 1.4% w/v and the suspension autoclaved. This was distributed

in 15mL lots into 150mm petri dishes (Crown Scientific). For the addition of

supplements (e.g. antibiotics, lysozyme, autoclaved bacterial cells), the

sterilised solution was placed in a 50C water bath immediately following

autoclaving. Supplements were added to the desired concentration once the

solution has reached 50C.

2.1.2 Antibiotics

The addition of antibiotics to growth media was done following sterilisation.

The media were allowed to cool to approximately 50C before antibiotics were

added to the desired concentration.

Ampicillin

A stock solution of 100mg ampicillin mL-1 (Sigma Aldrich) was made up by

dissolving 100mg of ampicillin in 1mL of Milli-Q H2O. This solution was

filter-sterilised and stored at -20°C.

Erythromycin

A stock solution of 10mg erythromycin mL-1 (Sigma Aldrich) was made by

dissolving 10mg of erythromycin in 1mL of 70% v/v ethanol and stored at -

20C. This solution did not require filter sterilisation. This solution was only

used where a concentration of 2 to 5g erythromycin mL-1 was required. Where

a higher concentration was needed, the required amount of erythromycin was

dissolved in 70% v/v ethanol at a much higher concentration. This was

prepared fresh when required.

39

2.1.3 Brain Heart Infusion (BHI) medium

Brain Heart Infusion (BHI) medium was prepared by dissolving 3.7g of BHI

broth (Oxoid Australia) in 100mL of Milli-Q H2O and sterilised by autoclaving.

2.1.4 GM17 medium

GM17 medium was prepared by dissolving 3.72g of M17 broth (Oxoid

Australia) in 100mL of Milli-Q H2O and sterilised by autoclave. Once the

solution was cooled to room temperature (24C), 2.5mL of 20% w/v glucose

solution (filter-sterilised) was added.

2.1.5 GM17+LmB agar plates

These are GM17 agar plates that contain 300mL of autoclaved 100X

concentrate of stationary phase L. monocytogenes cells, and buffered with

potassium phosphate pH 7.0 to a final concentration of 200mM.

2.1.6 GM17+SaB agar plates

These are GM17 agar plates that contain 100mL of autoclaved 100X

concentrate of stationary phase S. aureus cells, buffered with potassium

phosphate buffer pH 7.0 to a final concentration of 200mM.

2.1.7 GM17+SaU agar plates

These are the similar to the GM17+SaB agar plates except without potassium

phosphate buffer.

2.1.8 Isopropylthio--D-galactoside (IPTG) plates

A stock solution was made by dissolving 2g of IPTG (Sigma Aldrich) in 2mL

Milli-Q H2O. The solution was filter-sterilised and stored at -20°C. IPTG (7L

of stock solution per agar plate) was added on the surface of pre-poured LB agar

plates containing 100g ampicillin mL-1. This solution was spread across the

surface of the agar with a sterile glass spreader until all the IPTG has been

absorbed by the agar plate.

40

2.1.9 Lysogeny Broth (LB)

Lysogeny Broth (LB) was prepared by dissolving 10g of tryptone (Oxoid

Australia), 5g of yeast extract (Oxoid Australia) and 10g of NaCl (Sigma

Aldrich) in 1L of Milli-Q H2O and sterilised by autoclaving.

2.1.10 de Man, Rogosa and Sharpe (MRS) medium

de Man, Rogosa and Sharpe (MRS) medium was prepared by dissolving 5.2g of

MRS broth (Oxoid Australia) in 100mL of Milli-Q H2O and sterilised by

autoclaving.

2.1.11 Psi medium

Psi medium was prepared by dissolving 20g of tryptone, 5g of yeast extract and

5g of MgSO4 (Sigma Aldrich) in 1L of Milli-Q H2O. The pH of the solution

was adjusted to 7.6 using 1M KOH (Sigma Aldrich) and sterilised by

autoclaving.

2.1.12 SGM17MC medium

SGM17MC medium was prepared by dissolving 7.45g M17 broth in 92mL

Milli-Q H2O and sterilised by autoclaving. Once this has cooled to room

temperature (24C), 5mL of sterile 20% w/v glucose solution, 1.6mL of sterile

2.5M MgCl2, 2mL of sterile 0.2M CaCl2 and 100mL of sterile 1M sucrose were

added. This medium was stored at 4°C.

2.1.13 SOC medium

SOC media was prepared by dissolving 20g of tryptone, 5g of yeast extract and

0.5g of NaCl in 1L of Milli-QH2O. In addition, 3.73mL of 20% w/v KCl

(Sigma Aldrich) were added to the media and sterilised by autoclaving. Once

the solution has cooled to room temperature (24C), 10mL of sterile 2M MgCl2

(Sigma Aldrich) and 18mL of sterile 20% w/v glucose solution was added to the

media.

41

2.1.14 5-bromo-4-chloro-3-indolyl--D-galactoside (X-Gal) plates

A stock solution was made consisting of 20mg of X-Gal (Sigma Aldrich)

dissolved in 2mL of N,N’-dimethyl-formamide. This was stored at -20°C in a

bottle wrapped in aluminium foil. X-Gal (40µL of the stock solution per agar

plate) was spread onto the pre-poured LB agar plates containing 100µg

ampicillin mL-1. This solution was spread across the surface of the agar with a

sterile glass spreader until all the X-Gal has been absorbed by the agar plate.

BACTERIAL STRAINS

2.1.15 Escherichia coli JM109

This strain was originall purchased from Promega Australia for routine cloning.

It was cultured in LB (with aeration), on LB agar plates or on BHI agar plates,

supplemented with antibiotics as required. They were incubated at 30C or

37C.

2.1.16 Lactic acid bacterial strains

Lactococcus lactis subsp. cremoris MG1363

This is a well recognised model strain used extensively in the research of the

genetics and molecular biology of lactic acid bacteria, and was originally

donated by Scott Chandry, CSIRO, Werribee, Victoria, Australia. It was

cultured in GM17 medium or on GM17 agar plates, supplemented with

antibiotics as required, and incubated at 30C.

Lactobacillus plantarum ATCC 14917

This strain was first isolated from pickled cabbages and was purchased from the

American Tissue Culture Collection (ATCC). It was cultured in MRS medium,

or on MRS agar plates (in anaerobic jars with gas generating sachets from

Oxoid Australia), at 37C.

Lactobacillus rhamnosus GG

This strain is a commercial probiotic strain. It was purchased from the ATCC

(ATCC 53103) and was first isolated from human faeces. It was routinely

42

cultured in either MRS medium, or on MRS agar plates (in anaerobic jars with

gas generating sachets), at 37C.

Lactobacillus reuteri BR11

This strain was previously isolated from a guinea pig vaginal tract by

researchers at the Queensland University of Technology (Rush et al., 1994). It

was cultured in either MRS medium, or on MRS agar plates (in anaerobic jars

with gas generating sachets), at 37C.

2.1.17 Pathogenic strains

Listeria monocytogenes ATCC 19112

This strain was purchased from the ATCC and was first isolated from the spinal

fluid of a patient in Scotland, UK. It was cultured in either BHI medium or on

BHI agar plates at 37C.

Staphylococcus aureus ATCC 49476

This strain was generously donated by Dr Graeme Nimmo (Queensland Health)

and was characterised to be a MRSA strain. It was cultured in either BHI

medium or on BHI agar plates at 37C.

2.2 BACTERIAL CULTURE METHODOLOGIES

2.2.1 Chemically competent E. coli JM109 cell preparation

JM109 cells were plated out onto LB agar plates and incubated at 37°C for 18 h.

The following day, a colony was picked and inoculated into 3mL of LB, and

incubated at 37°C for 18 h. The stationary phase culture was then diluted 1 in

100 into 100mL of Psi medium, and was incubated at 37°C till the OD550nm

reached 0.4-0.6. The Cells were then incubated on ice for 15 min and then

pelleted by centrifugation at 3-5000 x g for 5 min at 4°C. The supernatant was

discarded and 0.4 volume (i.e. of starting volume) of TbfI buffer (30mM

potassium acetate, 100mM RbCl, 10mM CaCl2, 50mM MgCl2, 15% v/v

glycerol, filter-sterilised; Sigma Aldrich) at a pH of 5.8 (pH was adjusted with

100mM acetic acid) was used to resuspend cells. Cells were then incubated on

43

ice for 15 min, and pelleted as described previously. The supernatant was

discarded and cells were resuspended in 0.04 volume (i.e. of starting volume) of

TbfII buffer (10mM MOPS, 75mM CaCl2, 10mM RbCl, 15% v/v glycerol,

filter-sterilised; Sigma Aldrich) at pH 6.5 (pH was adjusted with 100mM

NaOH). Cells were used fresh for transformation or frozen for later use. When

freezing, cells were distributed into 200L aliquots and snap frozen in liquid

nitrogen before storing at -80°C. Cells were thawed on ice prior to use in

subsequent transformation reactions.

2.2.2 Electrocompetent L. lactis cell preparation

MG1363 cells were plated out on GM17 agar plates and incubated at 30°C for

18 h. The following day, a colony was picked and inoculated into 10mL of

GM17 medium and incubated at 30°C for 18 h. The stationary phase culture

was then diluted 1 in 100, 1 in 50 or 1 in 20 into 10mL of GM17 medium and

incubated at 30°C. After 3 hours, the OD600nm of whichever dilution reached 0.5

was used to dilute 1 in 100 into GM17 supplemented with glycine (final

concentration 2.5% w/v). Cells were then incubated at 30°C until they reached

an OD600nm of 0.45-0.55. The cells were pelleted by centrifugation at 3000 x g

for 15 min at 4°C. The supernatant was discarded and the cells were

resuspended in 12.5mL ice-cold (-20°C) poration-storage buffer (0.5M sucrose,

10% v/v glycerol, filter-sterilised through Millipore 0.22m filter), and the cells

pelleted as previously described. This was done twice. After the final wash, the

cells were resuspended in 1mL poration-storage buffer and used fresh for

transformation or frozen for later use. Cells were distributed into 200L

aliquots and snap frozen in liquid nitrogen before storing at -80°C. Cells were

thawed on ice prior to use in subsequent transformation reactions.

2.2.3 Isolation of chromosomal DNA from L. lactis

L. lactis was grown for a minimum of 18 h in 2mL of media and was

centrifuged at maximum speed (18,000 x g) in a bench top centrifuge for 10

min. After discarding the supernatant, the cells were resuspended in 850L of

TEN buffer (10mM Tris at pH 8.0, 1mM EDTA, 0.1M NaCl) and 150L of

lysozyme (100mg lysozyme dissolved in 1.5mL Milli-Q H2O) was added. This

44

mixture was incubated at 37°C in a water bath for 30 min, after which 115L of

10% w/v sodium dodecyl sulphate (SDS) and 1L Proteinase K (100mg

Proteinase K mL-1; Roche Applied Science) was added. The mixture was

incubated at 37°C in a water bath for 60 min. Then, 130L of 5M NaCl and

750L of chloroform-isoamyl alcohol mix (24:1 choloroform:isoamyl alcohol;

Sigma Aldrich) were added and the mixture was shaken vigorously. The

mixture was centrifuged at maximum speed (18,000 x g) in a bench top

centrifuge for 5 min. The top layer was removed and transferred into a 2mL

microfuge tube. Aftewards, 700L propan-2-ol was added to the top layer and

shaken vigorously. The mixture was centrifuged at maximum speed (18,000 x

g) in a bench top centrifuge for 5 min. The supernatant was discarded and the

resultant pellet of genomic DNA was washed with 1mL 70% v/v ethanol, and

centrifuged at maximum speed on a bench top centrifuge for 5 min. The

supernatant was discarded and the pellet was air dried or vacuum desiccated

before being dissolved in 150L TE buffer (10mM Tris at pH 8.0, 1mM EDTA)

and 1L Rnase A (10mg RnaseA mL-1; Roche Applied Science).

2.2.4 Purification of plasmids from E. coli

LB (3-5mL; supplemented with antibiotics) was inoculated with a colony from

an agar plate or from glycerol stocks and incubated at either 30°C or 37°C for a

minimum of 18 h. The stationary phase culture was centrifuged at maximum

speed (18,000 x g) in a bench top centrifuge for 5 min to pellet cells and the

supernatants discarded into disinfectant. Plasmids were either purified from the

cells using the QIAprep Spin Miniprep kit (Qiagen) following the

manufacturer’s instructions or by the following method. The pellet was

resuspended in 100L of solution I (25mM Tris-Cl at pH 8.0, 10mM EDTA,

filter-sterilised, stored at 4°C). Then, 200L of solution II (0.2M NaOH, 1%

w/v SDS, made fresh before use) was then added and mix by inversion 5 times.

Finally, 150L of solution III (3M potassium acetate adjusted to pH 5.4 with

5M acetic acid, stored at 4°C) was added and mixed by inversion 5 times. This

mixture was then centrifuged at maximum speed (18,000 x g) in a bench top

centrifuge for 5 min to pellet the cell debris, and the supernatant decanted into a

new microfuge tube. An optional step is the addition of 150L of chloroform-

45

isoamyl alcohol (24:1 choloroform:isoamyl alcohol; Sigma Aldrich) to the

tubes, then mixed by inversion 5 times and centrifuged at maximum speed

(18,000 x g) in a bench top centrifuge for 5 min. The top layer was removed

into a new 1.5mL microfuge tube and 1mL of 100% v/v ethanol was added.

The tube was mixed by inversion 10 times and centrifuged as previously

described for 5 min. The supernatant was discarded and the pellet was washed

with 100L of 70% v/v ethanol and centrifuged as previously described for 10

s. The supernatant was discarded and the pellet air dried or vacuum desiccated.

The pellet was resuspended in 30L of Milli-Q H2O with RnaseA (350g Rnase

A mL-1) and stored at 4°C.

2.2.5 Transformation of chemically competent E. coli

Cells were thawed on ice and then dispensed into 50L aliquots in 1.5mL

microfuge tubes. The ligation reaction (5µL) or the plasmid (2µL) was added to

the E. coli competent cells. (Specific details of the ligation reaction or plasmid

can be found in the material and methods section of chapters 3 and 4.)

Competent cells were gently mixed with the plasmids by flicking the tube.

Cells and plasmids were left on ice for 30 min. Cells were then heat shocked at

42°C in a water bath for 50 s, and then quickly returned to ice for 2 min. Cold

(4°C) SOC medium (900µL) was added to each tube. All tubes were then

incubated at either 30°C or 37°C (depending on the plasmid) in a shaker for 1 h.

Cells were then plated out onto selective agar plates. Inoculated agar plates

were incubated at 30°C (for 2 to 4 days) or 37°C (for 18 h). The plasmid,

pUC19 (Promega), was used as a transformation control was used to ensure

competent cells were able to be transformed.

2.2.6 Transformation of electrocompetent L. lactis

Cells were thawed on ice and then dispensed into 50L aliquots in ice-cold

electroporation cuvettes (Bio-Rad Laboratories). The ligation reaction (2µL) or

the plasmid of interest (2µl) was added to the L. lactis competent cells.

Competent cells were gently mixed by flicking the cuvettes. The cells were

pulsed (200, 2.5kv, 25F charge duration 4.8 msec, 2mm electrode gap) and

immediately transferred into 1.5mL microfuge tubes with 960L of ice-cold

46

SGM17MC medium and placed on ice for 10 min. Cells were then incubated at

30°C for 2 h. Cells were plated out onto selective agar plates, and incubated at

30°C for 18 h. The plasmid, pGhost9:ISS1, was used as a transformation

control in order to ensure competent cells were able to be transformed.

2.3 SOLUTIONS FOR DNA ANALYSES

2.3.1 Agarose gel loading buffer

Gel loading buffer for visualisation of DNA on agarose gel was made with

0.25% w/v bromophenol blue, 30% v/v glycerol and in a solution of 100mM

Tris (pH 8.0). Gel loading buffer was diluted 6-fold into DNA solutions before

being loaded onto the agarose gels.

2.3.2 Tris-borate EDTA (TBE) buffer

Tris-borate EDTA (TBE) buffer was prepared by combining 10.8g of Tris-base,

5.5g of boric acid and 0.93g of Na4EDTA in 1L of Milli-Q H2O. The pH was

adjusted to 8.3.

2.4 METHODS FOR DNA ANALYSES

2.4.1 Agarose gel electrophoresis

Agarose gels (0.7-2% w/v) were prepared by combining low electroendosmosis

agarose (Roche Applied Science) in TBE buffer to the desired percentage

depending on the anticipated product size. Agarose was dissolved in the TBE

buffer by microwaving the mixture in 30 s bursts until completely dissolved.

The agarose was allowed to cool to 50°C, then ethidium bromide (Bio-Rad

Laboratories) was added to achieve a final concentration of 0.5µg ethidium

bromide mL-1, and the solution poured into 7cm x 10cm or 15cm x 10cm gel

moulds (Bio-Rad Laboratories) containing an agarose gel comb (Bio-Rad

Laboratories). DNA solution was combined with agarose gel loading buffer

prior to electrophoresis. Bands were visualised under ultra-violet light (UVP

Gel-documentation system, UVP Incorporated).

47

2.4.2 DNA precipitation

To precipitate DNA, 0.1 volume of 3M sodium acetate (pH 5.2) and 2.5 volume

of 100% v/v ethanol were added to samples and placed on ice for 30 min. The

samples were then centrifuged at maximum speed (18,000 x g) in a bench top

centrifuge at 4C for 20 min. The supernatant was discarded and the pellet was

washed with 70% v/v ethanol and then centrifuged as previously described at

room temperature (24C) for 5 min. The supernatant was discarded and the

pellets air dried or vacuum desiccated. The pellets could then be resuspended in

any desired solution.

2.4.3 Gel purification of DNA

Digested plasmid DNA was resolved on a 0.7% w/v TBE agarose gel at 100V

for 60 min, excised from the gel, and purified using QIAgen Gel Purification kit

(Qiagen) following the manufacturer’s instructions.

2.4.4 Ligation reactions

Ligation reactionss were performed using T4 DNA ligase (Roche Applied

Science). The reactions were set up as directed by the manufacturer. Briefly,

DNA from digested vectors was resuspended in 17µL of Milli-Q H2O and 2µl

of 10x Ligation Buffer (660mM Tris-HCl, 50mM MgCl2, 10mM

dithioerythritol, 10mM ATP; Roche Applied Science), and 1µl of T4 DNA

ligase was added. The reactions were incubated at 4°C for a minimum of 18 h.

2.4.5 Polymerase chain reaction (PCR)

A standard Polymerase chain reaction (PCR) amplification mix contained

2.75mM MgCl2, 3.75U Expand Long Template Enzyme mix (Roche Applied

Science) or Pfu DNA polymerase (Promega), 400µM of deoxynucleoside

triphosphates (dNTPs) (Roche Applied Science), 500nM of primers (Sigma

Proligo), 1l of DNA template and sterile Milli-Q H2O added to a total volume

of 50l. Thermal cycling was done on an MJ Research PTC-200 Thermal

Cycler (Geneworks). Cycle conditions for gene amplification was as follows:

Step 1: 94°C for 2 min, then 30 cycles of 93°C for 10 s,55°C for 30 s, and 68°C

for 1 min, followed by final extension step of 68°C for 7 min. The cycle

48

conditions were varied at times to optimise specific reactions. Full details are

provided in the “Materials and Methods” sections of the relevant chapters.

2.4.6 Purification of PCR products

PCR products were purified using the Hi-Pure PCR Purification kit (Roche

Applied Science) following the manufacturer’s instructions. An additional

centrifugation step was introduced whereby the final eluted product was

centrifuged at maximum speed (18,000 x g) in a bench top centrifuge for 1 min,

and the supernatant removed to a 1.5mL microfuge tube. This step was

introduced to remove any contaminating resin from the filter of the purification

column.

2.4.7 Quantitation of DNA

DNA concentrations were determined by measuring the A260nm and its quality

determined by measuring the ratios of A260nm and A280nm. For absorbance

readings, DNA solutions were diluted 50-fold and analysed using a DU800

UV/visible spectrophotometer (Beckman Coulter).

2.4.8 Restriction enzymes

All restriction enzymes used in this study were purchased from Roche Applied

Science and digest reactions were performed following the manufacturer’s

directions. The average digest reactions were set up so that 20L contained

4L of plasmid DNA, 2L of 10x Incubation Buffer (SuRE/Cut Buffer B or H

depending upon the restriction enzyme in use; Roche Applied Science), and 10

units of enzyme. The reactions volumes varied with the amount of plasmid

DNA or PCR product to be digested. All reactions were incubated at 37C for a

minimum of 2 h.

2.4.9 Sequencing

The DNA template (plasmid) and primer (Sigma Proligos) was provided to the

Australia Genome Research Facility (http://www.agrf.org.au) for sequencing.

49

2.5 SOLUTIONS FOR PROTEIN ANALYSES

2.5.1 CAPS transfer buffer

CAPS transfer buffer for protein transfer in western blots were prepared by

dissolving 2.21g of 3-cyclohexylamino-1-propanesulfonic acid (CAPS; Sigma

Aldrich) in 800mL Milli-Q H2O, and pH adjusted to 11.0 using NaOH. Then

100mL of methanol was added and the total volume was adjusted to 1L with

Milli-Q H2O. The buffer was prepared at least 1 h prior to use and kept at 4°C

with stirring.

2.5.2 Coomassie stain

Coomassie stain consisted of 0.25g of Comassie Brilliant Blue R250 (Sigma

Aldrich) dissolved in 125mL of methanol. Then 25mL of acetic acid and

100mL Milli-Q H2O were added.

2.5.3 Electrode buffer

Electrode buffer (10x) was prepared by dissolved 30.3g of Tris-base, 144.2g of

glycine in 950mL Milli-Q H2O, and then adding 50mL of 10% w/v SDS

solution. This solution was stored at 4°C. The electrode buffer was diluted 10-

fold in Milli-Q H2O prior to use.

2.5.4 Phosphate buffered saline (PBS) (pH 7.0)

Phosphage buffered saline (PBS) was prepared either by using PBS tables

(Oxoid Australia) following the manufacturer’s instructions or by dissolving 8g

of NaCl, 0.2g of KCl, 1.44g of Na2HPO4 and 0.24g of KH2PO4 in 1L of Milli-Q

H2O. The pH was adjusted to 7.0 using NaOH. The solution was sterilised by

autoclaving.

2.5.5 2x SDS loading buffer (non-reducing)

The 2x SDS sample loading buffer consisted of 100mM Tris (pH 6.8), 4% w/v

SDS, 0.2% w/v bromophenol blue and 20% v/v glycerol. Protein samples that

were to be separated via electrophoresis were mixed 1:1 v/v with the 2x SDS

loading buffer.

50

2.6 METHODS FOR PROTEIN ANALYSES

2.6.1 SDS polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-PAGE was carried out using the Bio-Rad Mini-PROTEAN 3 apparatus,

according to the manufacturer’s instructions. Briefly, a 12% v/v resolving gel

was prepared by combining 3mL of 30% w/v acrylamide, 4.35mL of Milli-Q

H2O, 2.5mL of resolving gel buffer (1.5M Tris, pH 8.8) and 0.1mL of 10% w/v

SDS. Finally, 5µL of N,N,N’,N’-tetramethylethylenediamine (TEMED) and

50µL of 30% w/v ammonium persulphate were added, and the solution was

carefully mixed and quickly poured into the glass plate cassette. Milli-Q H2O

(500µL) was layered over the top to prevent the gel from drying. The resolving

gel was left to polymerise for 20 min. Once the gel had set, the Milli-Q H2O

was carefully tipped off and a 4% v/v spacer gel solution was added to the top

of the resolving gel. A 4% v/v spacer gel was prepared by combining 1mL of

30% w/v acrylamide, 6.4mL of Milli-Q H2O, 2.5mL of spacer gel buffer (1M

Tris, pH 6.8) and 0.1mL 10% w/v SDS. Finally, 10µL of TEMED and 50µL of

30% w/v ammonium persulfate were added, and the solution was carefully

mixed and quickly poured on top of the resolving gel. A Teflon comb was

quickly inserted into the spacer gel solution and the gel allowed to polymerise

for 20 min. Following polymerisation, the Teflon comb was removed and the

gel cassette placed in an electrophoresis tank. The tank was filled with 1x

electrode buffer, and protein samples in non-reducing SDS loading buffer were

loaded into the wells using capillary pipette tips. The gel was run at 170V until

the dye front reached the bottom of the resolving gel. If the gel was for a

western blot, the gel was pre-treated with CAPS transfer buffer for a minimum

of 5 min at room temperature (24C). If the gel was for visualisation of protein

bands, it was place into Coomassie stain for a minimum of 2 h. Gels were de-

stained using multiple changes of de-stain solution (45% v/v methanol, 10% v/v

acetic acid).

2.6.2 Trichloroacetic acid (TCA) precipitation of supernatant proteins

Proteins in the culture supernatant were precipitated using the following

method. The cultures were centrifuged at 3000 to 5000 x g for 10 min at 4°C.

The supernatant was then filtered through 0.22m filter (Millipore). 1.8mL of

51

the filtered supernatant was transferred into a 2mL microfuge tube and chilled

on ice for a minimum of 5 min. Cold (4C) 80% w/v TCA (125µL) was added

and the solution mixed by inversion 10 times, and placed on ice for a minimum

of 30 min (average 60 min). The proteins were pelleted by centrifugation at

maximum speed (18,000 x g) in a bench top centrifuge for 5 min at 4°C. The

supernatant was discarded and the pellet was washed with 700L of cold (-

20°C) acetone and centrifuged as previously described. The supernatant was

discarded and the pellet air dried or vacuum desiccated. The pellet was

resuspended in equal volumes of NaOH (50mM) and 2x SDS loading buffer to

the desired volume.

2.6.3 Western blots

SDS-PAGE gels were carried out as described in section 2.6.1 and pre-treated

with CAPS transfer buffer. Protein was transferred from a SDS-PAGE gel to a

nitrocellulose membrane (GE Healthcare) using CAPS transfer buffer at 70V for

90 min on ice. Following transfer the nitrocellulose membrane was removed

from the tank and blocked in a solution of 1% w/v casein (Roche Applied

Science) in Tris-buffered saline (TBS; 50mM Tris, 150mM NaCl, pH 7.5) and

Tween-20 (TBS-T; TBS with 0.1% v/v Tween-20) for a minimum of 1 h. After

blocking, the membrane was washed with TBS for a minimum of 2 min, and

then incubated with the primary antibody for 1 h with gentle rocking. The

primary antibody used was a mouse anti-His6 monoclonal antibody (Sigma

Aldrich) diluted 3000-fold in a solution of 0.5% v/v casein in TBS. After

incubation, the membrane was washed twice with TBS-T for 10 min. Rabbit

anti-mouse-HRP-conjugate (Dako) was used as the secondary antibody, diluted

1000-fold in a solution of 0.5% v/v casein in TBS, and incubated for 1 h with

gentle rocking. The membrane was then washed three times with TBS-T for 5

min. The bound secondary antibodies were detected using the Lumi-Light

chemiluminescence kit (Roche Applied Science). The membrane was exposed

on Autorade X-ray films (AGFA), with exposures ranging from 10 s to 1 min

for films with strong signals, and from 10 min up to 18 h for weak signals.

52

2.6.4 L. lactis cell associated protein extraction

Two different cell associated protein extraction methods were used. This

involved either boiling the cells in 2x SDS loading buffer or homogenising the

cells using glass beads. For both methods, the L. lactis culture was centrifuged

at 3000-5000 x g for 10 min at 4°C, and the supernatant removed. For the

boiling method, the cells were resuspended in 50µL of 2x SDS loading buffer,

giving a total volume of approximately 200µL. The cells were incubated at

97°C for 5 min in a heating block prior to loading of SDS-PAGE. For the glass

bead method, the pelleted cells were washed in 3 to 5mL of PBS, and

centrifuged at 3000-5000 x g for 10 min at 4°C. The cells were resuspended to

10 or 100 times concentration in PBS and transferred to a 2mL cryovial with

0.75mL of 0.1mm diameter zirconia/silicone glass beads (Daintree Scientific).

The mixture was homogenised with a Mini-Beadbeater-8 cell disruptor

(Daintree Scientific) for 1 min, then placed on ice for 1 min. When thicker cell

suspensions were used, the homogenisation step was repeated. The

homogenised suspension was centrifuged at maximum speed (18,000 x g) in a

bench top centrifuge for 10 min at 4°C to remove the glass beads and cell

debris. The supernatant was transferred into a 1.5mL microfuge tube and mixed

with an equal volume of 2x SDS loading buffer. The samples were incubated at

97°C for 5 min in a heating block prior to loading of SDS-PAGE.

53

CHAPTER 3

APPLICATION OF CYUC-LYSOSTAPHIN FUSION

PROTEIN SECRETED BY LACTOCOCCUS LACTIS TO

PREVENT STAPHYLOCOCCUS AUREUS ADHERENCE TO

EXTRACELLULAR MATRIX PROTEINS IN VITRO

54

3.1 INTRODUCTION

L. lactis is a Gram-positive bacterium widely used in the dairy manufacturing

industry. Due to its GRAS status; it is often regarded as a promising host for

the production of recombinant proteins of therapeutic interest. One such protein

is lysostaphin, an endopeptidase that is naturally produced by S. simulans biovar

staphylolyticus ATCC1362 (Schindler and Schuhart, 1964). Lysostaphin

specifically cleaves the pentaglycine cross bridges of S. aureus peptidoglycan,

which results in cell wall weakening, and consequentially, cell death. Interest in

this antimicrobial enzyme has increased in recent years due to the worsening

problem of MRSA, and several studies have demonstrated its usefulness in the

treatment of infections (Patron et al., 1999; Dajcs et al., 2000; 2001; Kokai-Kun

et al., 2007; Oluola et al., 2007). Recombinant lysostaphin was first produced

in E. coli in 1987 (Recsei et al., 1987). More recently, it has been expressed as

an intracellular protein in L. lactis using the NICE system (Mierau et al., 2005a;

2005b). Recent work by Turner et al. (2007b) has demonstrated the expression

and secretion of active lysostaphin in several lactic acid bacteria, including L.

lactis.

S. aureus is an important human pathogen in nosocomial and community

acquired infections (Boucher and Corey, 2008; Chastre, 2008). It is the primary

causative agent of wound infections, bacteraemia, and sepsis, culminating in

high mortality rates. With the decrease in the efficacy of antibiotics to treat S.

aureus infections, this pathogen has become a considerable problem on a

worldwide basis. Of particular concern are MRSA, and strains with reduced or

complete resistance against vancomycin (Tenover et al., 1998; CDC, 2002) and

teicoplanin (Kaatz et al., 1990), antibiotics which are the last line of defence

against MRSA. Escalation in the spread of antibiotic-resistant S. aureus

(Grundman et al., 2006) highlights an urgent need for new measures to prevent

and treat S. aureus infections. An alternative to antibiotics which has attracted

significant interest in recent years is the antimicrobial protein, lysostaphin.

More importantly, lysostaphin can also kill antibiotic resistant strains such as

MRSA (Wu et al., 2003). S. aureus strains resistant to lysostaphin become

hypersusceptible to -lactam antibiotics, including methicillin (Stranden et al.,

55

1997; Climo et al., 2001). Therefore, a combination treatment of lysostaphin

and a -lactam antibiotic for MRSA would not lead to any lysostaphin resistant

survivors (Clino et al., 2001).

S. aureus is also present as a commensal organism in humans and colonises

multiple sites, such as the nasal passage, which is the most frequent site of

carriage (Fierobe et al., 1999; Kluytmans et al., 1997; Lee et al., 1999; White

and Smith, 1963). S. aureus adhere to host ECM proteins, such as fibronectin,

collagen, and keratin, via surface proteins called microbial surface components

recognising adhesive matrix molecules (MSCRAMMs), and these interactions

are important for initiating infection. Clumping factor B (ClfB), and fibronectin

binding proteins A and B (FnBPA and FnBPB), have been identified as S.

aureus MSCRAMMs which bind to keratin and fibronectin, respectively

(Peacock et al., 1999; O’Brien et al., 2002). Specifically, ClfB has been shown

to bind to the keratin of human nasal epithelial cells, and that mutants lacking

ClfB adhered poorly to keratin and showed overall reduction in adherence to

human nasal epithelial cells (O’Brien et al., 2002). In addition, intranasal

immunisation of mice with ClfB was able to reduce S. aureus nasal colonisation

(Schaffer et al., 2006).

Previous research has demonstrated that the CyuC protein (Turner et al., 1999),

found in abundance on the cell wall of L. reuteri BR11, can bind to fibronectin

in ligand blots (M. S. Turner, personal communication). It has also been

reported that the use of whole cells or cell surface extracts (which contain

CyuC) of the related strain L. reuteri RC-14 (Reid et al., 1992) were able to

significantly inhibit the adherence of S. aureus to silicone implants, and thus

reduced S. aureus surgical implant infections (Gan et al., 2002). The

hypothesised mechanism for this was that the biosurfactant of L. reuteri RC-14

contained cell surface extracellular matrix binding proteins (ECMBPs) which

may effectively compete with S. aureus’ own MSCRAMMs for binding to host

sites. This suggests that native proteins from L. reuteri, including CyuC, may

be able to reduce S. aureus colonisation and infection by competitive inhibition

of binding to ECM proteins.

56

Therefore, the aim of this study was to investigate the potential of lysostaphin

and CyuC when expressed by L. lactis singularly or as a fusion protein to act as

S. aureus inhibitory agents. This involved determining if: (i) L. lactis can be

used to express CyuC and a CyuC-lysostaphin fusion protein, and (ii) the CyuC-

lysostaphin fusion protein will have superior anti-staphylococcal activity by

being able to inhibit S. aureus adherence to immobilised ECM proteins.

3.2 MATERIALS AND METHODS

3.2.1 Construction of L. lactis strains that secreted CyuC or CyuC-

lysostaphin fusion protein

L. lactis strains were constructed which expressed and secreted CyuC or CyuC

fused to lysostaphin (CyuC-Lss) using the Sep promoter (PSep) and the Sep

secretion signal (ssSep) The strategy was to use overlap extension PCR to create

long DNA fragments from smaller fragments (Higuchi et al., 1988).

Oligonucleotides (Figure 3.1, Table 3.1) were designed to amplify the following

region of genes as discrete fragments with 20-bp complementary overlaps, as

described below:

- PSep, ssSep, and 6xhis,

- the mature CyuC peptide (corresponding to amino acids 26 to 264),

- the stem-loop transcription terminator that followed the CyuC sequence

(Turner et al., 1999), and

- the mature lysostaphin peptide.

The CyuC expression cassette was assembled from two DNA fragments. The

first fragment was the PSep-ssSep-6xhis fragment, which was amplified from

pGhost9-his1-lss-his2 (Table 3.1, Figure 4.1B) using the primers SepUSEco-5F

and 6HSepUS-3R (Figure 3.1A, Table 3.1). The second fragment encoded the

mature CyuC protein and contains the cyuC operon transcription terminator

(6xhis-CyuC-term), which was amplified from chromosomal DNA extracts of L.

reuteri BR11 (prepared by R. Galea) using the primers 6HCyuC-5F and

CyuCTermHind-3R (Table 3.1). DNA encoding 6xhis was also inserted at the

57

N-terminus of the CyuC encoding fragment (Figure 3.1A). The PCR products

of PSep-ssSep-6xhis and 6xhis-CyuC-term were purified as described in section

2.4.6, and dilutions of the purified products were combined and used as

templates for the amplification of PSep-ssSep-6xhis-CyuC-term using the primers

SepUSEco-5F and CyuCTermHind-3R (Figure 3.1A). The resulting 1.6-kb

PCR product was ligated into pGEM-3Zf to form pGEM3-CyuC following

digestion with EcoRI and HindIII. This cloned expression cassette was

sequenced and verified to contain the predicted DNA sequence.

In a similar fashion, the CyuC-Lss expression cassette was amplified from three

fragments. The first fragment was PSep-ssSep-CyuC, which encoded the Sep

promoter and Sep secretion signal with a 20-bp region complementary to the

cyuC sequence at the 3’ end. This was amplified from pGhost9-his1-lss-his2

(Table 3.1) using the primers SepUSEco-5F and SepUS-3R (Figure 3.1B; Table

3.1). The second fragment was ssSep-CyuC-Lpx, which encoded the sequence

for the mature CyuC protein with a 20-bp complementary region to the Sep

secretion signal at the 5’ end and to the LPXTG linker at the 3’ end. This

fragment was amplified from L. reuteri chromosomal DNA extracts using the

primers SepCyuClss-5F and LpxCyuC-3R (Figure 3.1B; Table 3.1). The third

fragment, Lpx-6xhis-Lss-term, was amplified from pGEM3-CyuC-Lss-term

using the primers Lpx6HLss-5F and CyuCTermHind-3R (Figure 3.1B; Table

3.1). This fragment encoded the mature lysostaphin protein and the cyuC

operon transcription terminator, with a 20-bp complementary region to the

LPXTG linker at the 5’ end. Amplification was undertaken in a two-step

process. Firstly, ssSep-CyuC-Lpx and Lpx-6xhis-Lss-term were gel purified (as

described in section 2.4.3), and used as templates and amplified using the

primers SepCyuClss-5F and CyuCTermHind-3R (Figure 3.1B). Then, the ssSep-

CyuC-Lpx-6xhis-Lss-term PCR product was gel purified, and used as template

along with the PSep-ssSep-CyuC fragment and amplified using SepUSEco-5F and

CyuCTermHind-3R (Figure 3.1B). The resultant PCR product was cloned into

pGEM-3Zf to generate pGEM3-CyuC-Lss. This cloned expression cassette was

sequenced and verified to contain the predicted DNA sequence.

58

PSepssSep

CyuC

PSepssSep

CyuC

Lss

SepUSEco-5F SepUSEco-5F

6HSepUS-3F

6HCyuC-5FCyuCTermHind-3R

CyuCTermHind-3R

SepUS-3F

LpxCyuC-3RSepCyuClss-5F

Lpx6HLss-5F

PSepssSep

CyuC

PSepssSep

CyuC Lss

PSepssSep

CyuC Lss

A BPSepssSep

CyuC

PSepssSep

CyuC

Lss

SepUSEco-5F SepUSEco-5F

6HSepUS-3F

6HCyuC-5FCyuCTermHind-3R

CyuCTermHind-3R

SepUS-3F

LpxCyuC-3RSepCyuClss-5F

Lpx6HLss-5F

PSepssSep

CyuC

PSepssSep

CyuC Lss

PSepssSep

CyuC Lss

A B

59

Figure 3.1. Schematic representation of the PCR overlap strategy employed to clone the CyuC (A), and CyuC-Lss (B) fusion protein to the Sep

promoter and secretion signal at the 5’ end, and the cyuC operon transcription terminator at the 3’ end.

Symbols: Sep promoter, PSep; Sep secretion signal, diagonal lines and ssSep; 6xhis, black box; LPXTG linker, horizontal lined box; CyuC, dotted

box; lysostaphin (Lss), grey box; lollipop symbol, cyuC operon transcription terminator; primers, broken arrows.

60

Table 3.1. Strains, plasmids, and oligonucleotides used in this chapter. Details Source Strains E. coli JM109 Cloning host Promega L. lactis MG1363 Plasmid free L. lactis subsp. cremoris Gasson, 1983 S. aureus ATCC 49476 Plasmids pGEM-3Zf Ampr ; 3.2-kb pGhost9:ISS1 Emr ori (Ts); 4.6-kb ; non-replicative in L. lactis at 37°C pGEM3-CyuC-Lss-term Ampr ; 5.5-kb ; pGEM-3Zf containing CyuC, LPXTG linker, 6xhis, lysostaphin, and CyuC transcription terminator M.S. Turner. pGEM3-CyuC Ampr ; 4.8-kb ; pGEM-3Zf containing PSep-ssSep-6xhis-CyuC-term This study pGEM3-CyuC-Lss Ampr ; 5.6-kb ; pGEM-3Zf containing PSep-ssSep-CyuC-LPXTG-6xhis-Lss-term This study pGhost9-CyuC Emr ; 5.3-kb ; pGhost9 containing PSep-ssSep-6xhis-CyuC-term This study pGhost9-CyuC-Lss Emr ; 6.1-kb ; pGhost9 containing PSep-ssSep-CyuC-LPXTG-6xhis-Lss-term This study pGhost9-his1-lss-his2 Emr ; pGhost9:ISS1 containing the lss cassette within the his operon (7.6-kb) Chapter 4 Oligonucleotides SepUSEco-5F ATAGAATTCAACCTTCCTGCTGACCT This study SepUS-3R ATCGGTGTAGATAGTGTCAGCAT This study 6HSepUS-3R GTGATGATGGTGATGATGATCGGTGTA This study 6HCyuC-5F CATCATCACCATCATCACGCATCTTCGGCAGTAAATTC This study SepCyuClss-5F CTGACACTATCTACACCGATGCATCTTCGGCAGTAAATTC This study LpxCyuC-3R TTCTCCTGTTGATGGTAATCCTCCTTCTGTAATATCCGCACCAA This study Lpx6HLss-5F GGAGGATTACCATCAACAGGAGAACATCATCACCATCATCAC This study CyuCTermHind-3R TAGCAAGCTTTCACCCACTCATTCGTCAGGC This study Restriction enzyme sites are underlined.

61

The inserts from both pGEM3-CyuC and pGEM3-CyuC-Lss were digested

using EcoRI and HindIII, and cloned into pGhost9:ISS1, replacing the ISS1

element. The resulting plasmids, pGhost9-CyuC and pGhost9-CyuC-Lss, were

transformed first into E. coli, and then into L. lactis. L. lactis pGhost9-CyuC-

Lss was grown on GM17+SaB agar plates (see section 2.1.6) containing 5µg

erythromycin mL-1 (GM17+SaB+5Em). These agar plates containing

autoclaved whole S. aureus cells are opaque. Colonies that produced active

lysostaphin, which lyses the S. aureus cells, will exhibit a visible zone of

clearing (or halo) around the colonies itself. This zone of clearing indicates that

the lysostaphin expressed was active. As a control, L. lactis pGhost9-CyuC did

not generate any zones of clearing on GM17+SaB+5Em, thus indicating that the

halos were specific to the production of lysostaphin.

3.2.2 Cell fractionation, protein extraction and western blot analysis

Cell associated and supernatant proteins were prepared from cultures from three

different incubation times: late-log phase of growth (cultures grown for 18 h

diluted 50-fold into fresh media and incubated until the OD600nm reached 1.0),

minimum 18 h incubation, and two days incubation. Proteins in the supernatant

were precipitated using TCA as described in section 2.6.2. For the cell

associated proteins, 10mL of cultures were centrifuged at 3000 to 5000 x g for

10 min. The cell pellet was then resuspended in 50µL of 2x SDS-PAGE

loading buffer giving a total volume of 200µL per 10mL of cells.

The protein samples were incubated at 97°C for 5 min, and 20µL were

separated by SDS-PAGE as described in section 2.6.1, and then transferred to

nitrocellulose membrane and the proteins were detected as described in section

2.6.3.

3.2.3 Prediction of protein molecular weight based on sequence

The predicted molecular weights of recombinant CyuC and CyuC-Lss were

calculated by the Protein Molecular Weight Calculator

(http://www.bioinformatics.org/sms/prot_mw.html).

62

3.2.4 Stock solutions of fibronectin, collagen, and keratin

In this study, fibronectin, collagen, and keratin are collectively referred to as

ECM proteins. Human fibronectin (BD Biosciences) was resuspended in sterile

Milli-Q H2O to obtain a stock concentration of 1mg fibronectin mL-1. Collagen

type I from calf skin (Sigma Aldrich) was resuspended in Milli-Q H2O to obtain

a stock concentration of 1.67mg collagen mL-1. Type I keratin from human

epidermis (Sigma Aldrich) was purchased in solution, and the concentration

varied depending on the batch purchased. Stocks of fibronectin and collagen

were stored at -20°C. Once thawed, they were stored at 4°C and used within 2

weeks. Keratin was stored at 4°C.

3.2.5 L. lactis crude cell extracts for adherence assay

L. lactis pGhost9:ISS1, L. lactis pGhost9-CyuC, L. lactis pGhost9-CyuC-Lss,

and L. lactis pGhost9-his1-lss-his2 (Table 3.1) were inoculated into 400mL of

GM17 medium containing 5µg erythromycin mL-1 (GM17+5Em), and

incubated at 30°C for two days. The cells were centrifuged at 5000 x g for 15

min. The cells were washed with 5mL of PBS, centrifuged at the same speed,

and the supernatant discarded. The cells were then resuspended in PBS to

achieve at 100 times concentration (i.e. 400mL of cell culture in 4mL of PBS),

and aliquots of 1.0mL were transferred into cryovials with approximately

0.75mL of 0.1mm zirconia/silicone beads (Daintree Scientific). The cells were

homogenised with a Mini-Beadbeater-8 cell disruptor (Biospec) for 1 min,

placed on ice for 1 min and homogenised again. Cell debris and beads were

removed by centrifugation in a benchtop centrifuge at maximum speed (18,000

x g) for 10 min at 4°C. Approximately 700µL of the supernatant was removed

from each aliquot and pooled.

3.2.6 Preparation of S. aureus for adherence assay

S. aureus was inoculated into 10mL of BHI media and incubated at 37°C for a

minimum of 18 h. The overnight incubated cultures were diluted 50-fold into

50mL of BHI and incubated at 37°C until the OD600nm reached 0.8. The cells

were centrifuged at 5000 x g for 10 min. The cells were washed once in 5mL of

PBS, centrifuged at the same speed, and the supernatant discarded. The cells

were then resuspended in PBS to obtain an OD600nm of 4.0.

63

3.2.7 Adherence of S. aureus to immobilised ECM proteins and L. lactis

cell extracts

Adherence experiments were performed in 96-well flat-bottomed polystyrene

tissue culture plates (Nunc) coated with ECM proteins and protein extracts from

L. lactis pGhost9:ISS1, L. lactis pGhost9-CyuC, L. lactis pGhost9-CyuC-Lss or

L. lactis pGhost9-his1-lss-his2 (Table 3.1). The protocol followed was that

published by Walsh et al. (2004) with some modifications. Each well was

coated first with 100µL of ECM proteins (at a concentration of 20µg ECM

protein mL-1) in coating buffer (20mM sodium carbonate buffer, pH 9.6).

Coating buffer without ECM proteins was used as a blank control. The plate

was sealed with parafilm, covered in foil, and incubated at 4°C for a minimum

of 18 h. Any unbound ECM proteins were discarded and the wells were

washed three times with 100µL PBS. The wells were then blocked with 100µL

of 5mg bovine serum albumin mL-1 (BSA) in PBS at 37°C for 2 h. The BSA

solution was discarded and the wells were washed three times with 100µL PBS.

Crude cell extracts from L. lactis pGhost9:ISS1, L. lactis pGhost9-CyuC, L.

lactis pGhost9-CyuC-Lss or L. lactis pGhost9-his1-lss-his2 (prepared according

to section 4.2.5) were dispensed into each well (100µL/well) and incubated at

4°C for a minimum of 18 h. Wells containing PBS only was used as a positive

control for S. aureus adherence to the ECM proteins. The crude extracts (or

PBS) were discarded and the wells were washed three times with 100µL PBS.

S. aureus cells (prepared according to section 4.2.6) were added to each well

(100µL/well) and then incubated at 37°C for 2 h. Unattached S. aureus were

discarded and the wells were washed three times with 100µL PBS. Cells that

remained attached were fixed with 100µL of 25% v/v formaldehyde (Sigma

Aldrich) for 30 min at room temperate (24C), after which the wells were

washed three times with 100µL PBS. The fixed cells were stained with 100µL

of 0.5% w/v crystal violet solution (Sigma Aldrich) for 1 min and discarded.

The wells were washed twice with 100µL PBS and once with 200µL PBS. The

stain was solubilised with 100µL of 5% v/v acetic acid for 10 min at room

temperature (24C). The A570nm was measured in a microplate

spectrophotometer (Benchmark Plus Microplate Spectrophotometer, Bio-Rad).

64

3.2.8 Statistical data analyses of significance using Student’s t-test

All data from the S. aureus adherence assays represent the mean SD of at least

two different experiments performed in triplicate for each condition tested. An

exception was made for the collagen adherence assays and in the fibronectin

adherence assays (as indicated) where the data represent the mean SD of a

single experiment performed in triplicate for each condition tested. The

determination of statistical significance, as indicated by a two-tailed p value,

was performed using unpaired Student’s t-test as calculated by the software

GraphPad QuickCalcs (http://www.graphpad.com/quickcalcs/ttest1.cfm).

3.3 RESULTS

3.3.1 Expression of CyuC and CyuC-Lss confirmed by western blot

analysis

The expression of the recombinant CyuC and CyuC-Lss proteins from L. lactis

was confirmed by western blot analysis. Cell associated and supernatant

proteins from three different incubation times were analysed by western blotting

using mouse anti-His6 monoclonal antibodies (Figure 3.2). Previously, it has

been demonstrated that wild-type L. lactis do not contain any anti-His6 cross-

reactive proteins from the cell associated or supernatant fractions (Turner et al.,

2007b). Wild-type CyuC from L. reuteri BR11 resolves on SDS-PAGE as a 32-

kDa protein (Turner et al., 1997), whilst the recombinant CyuC resolved at

approximately 36-kDa (Figure 3.2). The recombinant CyuC is larger due to the

addition of the 6xhis tag and 5 amino acids from the mature Sep protein that

remained after the secretion signal has been processed. The lysostaphin protein

is predicted to be 29-kDa (Turner et al., 2007b) and resolved at approximately

36-kDa (Figure 3.2). The CyuC-Lss fusion protein is predicted to have a

combined size of 61-kDa and resolved at approximately 66-kDa (Figure 3.2).

The most recombinant CyuC and CyuC-Lss proteins were found in the cell

associated fractions of cultures after two days of incubation (Figure 3.2),

whereas equal amounts of lysostaphin were found in the cell associated and

65

supernatant fractions of late-log phase cultures. Therefore, to maximise the

amount of extractable recombinant CyuC and CyuC-Lss, the cultures were

incubated for two days, and the cells were lysed by homogenisation with 0.1mm

zirconia/silicone beads (section 3.2.5).

37

29

50

97104

3729

C S C S C S2 days O/N late-log

CyuC

CyuC-Lss

Lss

37

29

50

97104

3729

C S C S C S2 days O/N late-log

CyuC

CyuC-Lss

Lss

Figure 3.2. Expression of recombinant CyuC from L. lactis pGhost-CyuC,

CyuC-Lss from L. lactis pGhost-CyuC-Lss and Lss from L. lactis pGhost-his1-

lss-his2.

Cell associated (C) and supernatant (S) fractions were taken from cultures

incubated for two days, minimum 18 h (O/N), and until it reached late-log

phase. The amount of protein loaded was equivalent to 1mL of culture for cell

associated, and 900µL for supernatant fractions. Molecular mass standards are

indicated in kDa. Proteins were detected with mouse anti-His6 monoclonal

antibody.

66

3.3.2 Optimisation of ECM proteins used in the S. aureus adherence assay

The wells of a 96-wells flat-bottomed tissue culture plate were coated with

100µL of ECM proteins at the following concentrations: 1µg, 5µg, 10µg, and

20µg per mL. S. aureus cells were prepared as described in section 3.2.6 and

the adherence was measured as described in section 3.2.7. The results indicate

that at the concentration of 20µg ECM protein mL-1 the wells have almost

reached saturation point, as indicated by the maximal adhesion of S. aureus

observed (Figure 3.3). Therefore, 20µg ECM protein mL-1 was determined to

be the optimal concentration to be used in the S. aureus adherence assays.

0.000

0.200

0.400

0.600

0.800

1.000

1.200

1.400

1.600

1 5 10 20

ECM proteins (µg/mL)

A57

0nm

Collagen Keratin Fibronectin

0.000

0.200

0.400

0.600

0.800

1.000

1.200

1.400

1.600

1 5 10 20

ECM proteins (µg/mL)

A57

0nm

Collagen Keratin Fibronectin

Figure 3.3. Adherence of S. aureus to wells coated with four different

concentrations of collagen, keratin, and fibronectin.

Each data point represents the mean of replicate wells (n = 3). Error bars are

represented by ± SD.

67

3.3.3 L. lactis cell extracts containing recombinant proteins have no effect

on the adherence of S. aureus to immobilised collagen

Cell extracts from L. lactis pGhost9:ISS1, L. lactis pGhost-CyuC, L. lactis

pGhost-CyuC-Lss, and L. lactis pGhost9-his1-lss-his2 were added to wells pre-

coated with collagen, and the adherence of S. aureus was measured as described

in section 3.2.7. The results indicate that S. aureus adhered to wells coated with

collagen only (Figure 3.4, column PBS), and that cell extracts from L. lactis

pGhost9:ISS1, L. lactis pGhost-CyuC, L. lactis pGhost-CyuC-Lss, and L. lactis

pGhost9-his1-lss-his2 had no effect on the adherence of S. aureus (Figure 3.4).

0.0

0.5

1.0

1.5

2.0

2.5

PBS pG9 CyuC CLss Lss Blank

A57

0nm

0.0

0.5

1.0

1.5

2.0

2.5

PBS pG9 CyuC CLss Lss Blank

A57

0nm

0.0

0.5

1.0

1.5

2.0

2.5

PBS pG9 CyuC CLss Lss Blank

A57

0nm

Figure 3.4. Adherence of S. aureus to wells coated with collagen and exposed

to cell extracts from, L. lactis pGhost9-CyuC (CyuC), L. lactis pGhost9-CyuC-

Lss (CLss), and L. lactis pGhost9-his1-lss-his2 (Lss).

Wells containing collagen only (PBS) were used as a positive control for S.

aureus adherence, whilst wells treated with cell extracts from L. lactis

pGhost9:ISS1 (pG9) were used as a negative control for the L. lactis strains

expressing recombinant proteins. Blank refers to where S. aureus cells were

added to wells blocked with BSA only. The columns represent the mean of

replicate wells (n = 3). Error bars represent ± SD.

68

3.3.4 Adherence of S. aureus to fibronectin is inhibited by the cell extracts

of all L. lactis strains, including the L. lactis pGhost9:ISS1

Cell extracts from L. lactis pGhost9:ISS1, L. lactis pGhost-CyuC, L. lactis

pGhost-CyuC-Lss, and L. lactis pGhost9-his1-lss-his2 were added to wells pre-

coated with fibronectin, and the adherence of S. aureus were measured as

described in section 3.2.7. The results demonstrate that extracts from all the L.

lactis strains, including the strain containing the vector only (pGhost9:ISS1),

significantly inhibited the adherence of S. aureus to fibronectin (Figure 3.5).

0.00.20.40.60.81.01.2

PBS pG9 CyuC CLss Lss Blank

A 570

nm

0.00.20.40.60.81.01.2

PBS pG9 CyuC CLss Lss Blank

A 570

nm

Figure 3.5. Adherence of S. aureus to wells coated with fibronectin and

exposed to cell extracts from, L. lactis pGhost9-CyuC (CyuC), L. lactis

pGhost9-CyuC-Lss (CLss) or L. lactis pGhost9-his1-lss-his2 (Lss).

Wells containing fibronectin only (PBS) were used as a positive control for S.

aureus adherence, whilst wells treated with cell extracts from L. lactis

pGhost9:ISS1 (pG9) were used as a negative control for the L. lactis strains

expressing recombinant proteins. Blank refers to where S. aureus cells were

added to wells blocked with BSA only. All the columns represent the mean of

replicate wells (n = 9, except CLss and Lss, where n = 3). Error bars represent

± SD.

69

3.3.5 Adherence of S. aureus to keratin is inhibited by cell extracts from

L. lactis pGhost9-CyuC-Lss and L. lactis pGhost9-his1-lss-his2

Cell extracts from L. lactis pGhost9:ISS1, L. lactis pGhost9-CyuC, L. lactis

pGhost9-CyuC-Lss, and L. lactis pGhost9-his1-lss-his2 were added to wells pre-

coated with keratin, and the adherence of S. aureus were measured as described

in section 3.2.7. The results indicate that keratin coated wells treated with cell

extracts from L. lactis pGhost9-CyuC-Lss had significantly less adherent S.

aureus cells as compared to keratin coated wells treated with cell extracts from

L. lactis pGhost9:ISS1 (Figure 3.6). Cell extracts from L. lactis pGhost9-his1-

lss-his2 were able to completely inhibit the adherence of S. aureus to keratin

(Figure 3.6).

0.00.20.40.60.81.01.2

PBS pG9 CyuC CLss Lss Blank

A57

0nm

*

**

0.00.20.40.60.81.01.2

PBS pG9 CyuC CLss Lss Blank

A57

0nm

0.00.20.40.60.81.01.2

PBS pG9 CyuC CLss Lss Blank

A57

0nm

*

**

Figure 3.6. Adherence of S. aureus cells to wells coated with keratin and

exposed to cell extracts from L. lactis pGhost9-CyuC (CyuC), L. lactis pGhost9-

CyuC-Lss (CLss) or L. lactis pGhost9-his1-lss-his2 (Lss).

Wells containing keratin only (PBS) were used as a positive control for S.

aureus adherence, whilst wells treated with cell extracts from L. lactis

pGhost9:ISS1 (pG9) were used as a negative control for the L. lactis strains

expressing recombinant proteins. Blank refers to where S. aureus cells were

added to wells blocked with BSA only. All the columns represent the mean of

replicate wells (n = 12, except CLss and Lss, where n = 6). Error bars represent

± SD. * indicates p < 0.02 between CLss and pG9. ** indicates p < 0.0001

between Lss and pG9.

70

3.4 DISCUSSION

The aim of this study was to investigate the potential of lysostaphin and CyuC

when expressed by L. lactis, singularly or as a fusion protein, to act as S. aureus

antimicrobial agents. The two proteins (CyuC and CyuC-Lss) were expressed

in L. lactis using the Sep promoter and the Sep secretion signal, and were then

tested for their abilities to reduce S. aureus adhesion to the extracellular matrix

proteins fibronectin, collagen, and keratin.

Recombinant L. lactis strains were successfully generated which expressed and

secreted recombinant CyuC and CyuC-Lss using the Sep promoter and secretion

signal. Examination of the expression and secretion of recombinant CyuC and

CyuC-Lss by L. lactis by western blot analysis showed that substantial

quantities of CyuC and CyuC-Lss were present in the cell associated fractions

after two days of growth, whereas recombinant lysostaphin was present in

abundance at late-log phase (Figure 3.2). This expression and secretion profile

may be attributed to the nature of CyuC. CyuC is a positively charged protein

(pI of 10.6) which is anchored to the negatively charged cell wall by

electrostatic interactions (Turner et al., 1997). The absence of CyuC and CyuC-

Lss in the supernatant fractions from late-log phase and overnight cultures is

supported by previous studies where the yield of CyuC from log phase cultures

of L. reuteri BR11 was significantly lower than at stationary phase (i.e.

incubated for a minimum of 18 h) (M.S. Turner, personal communication). The

absence of CyuC and CyuC-Lss in the supernatant fraction of overnight culture

(i.e. incubated for a minimum of 18 h) is supported by the fact that the native

CyuC is not a secreted protein, i.e. not detected in the supernatant of stationary

phase cultures of L. reuteri BR11 (Turner et al., 1997). The Sep secretion

signal exports the recombinant CyuC and CyuC-Lss, but the positive charge of

CyuC likely anchors it to the negatively charged lactococcal cell surface. The

presence of CyuC and CyuC-Lss in the supernatant fraction after two days of

incubation is most likely due to cell lysis. Therefore, crude extracts of CyuC

and CyuC-Lss were made from harvesting whole cells incubated for two days

and lysed by homogenisation.

71

Recombinant CyuC, CyuC-Lss, and lysostaphin were investigated for their

ability to affect the adhesion of S. aureus to immobilised ECM proteins. Three

ECM proteins, type I collagen from calf skin, fibronectin purified from human

plasma and keratin type I from human epidermis, were selected for testing on

the basis of their importance in the pathogenesis of S. aureus. S. aureus

colonises the host by adhesion to components of the host ECM proteins

mediated by bacterial cell wall associated proteins called MSCRAMMs (Patti

and Hook, 1994; Foster and Hook, 1998). S. aureus can express up to 20

different potential MSCRAMMs that are covalently anchored to the cell wall

peptidoglycan through the action of sortase (Navarre and Schneewind, 1994;

Mazmanian et al., 1999). Specific MSCRAMMs have been identified that bind

to fibronectin (Signas et al., 1989; Jonsson et al., 1991), collagen (Switalski et

al., 1989), and keratin (O’Brien et al., 2002).

Crude cell extracts prepared from lactococcal cultures incubated for two days

were added into wells pre-coated with ECM proteins and then discarded before

S. aureus cells were added. By doing so, it was hypothesised that only CyuC or

CyuC-Lss would bind to the ECM proteins, thereby blocking the adhesion of S.

aureus. The results from the adhesion assays were different for each of the

three ECM proteins.

Cell extracts from all the lactococcal strains tested did not have any effect on the

adhesion of S. aureus to collagen (Figure 3.4). This may be due to the fact that

recombinant CyuC or CyuC-Lss did not strongly bind with the immobilised

collagen, and thus unable to affect S. aureus adhesion.

The S. aureus adhesion assay on immobilised fibronectin showed that the cell

extracts of all the recombinant lactococcal strains tested were able to completely

inhibit adhesion (Figure 3.5). In particular, it was observed that the negative

control strain, L. lactis pGhost9:ISS1, was also able to inhibit adhesion (Figure

3.5, column pG9). This observation was confirmed by repeated

experimentation. As such, it was concluded that any possible role that the

recombinant CyuC, CyuC-Lss and lysostaphin may play would be masked by

native lactococcal proteins. The mechanism by which L. lactis pGhost9:ISS1

72

was able to block S. aureus adhesion to fibronectin is unclear. L. lactis itself

does not express any surface proteins that adhere to fibronectin, and it is this

trait that lends itself to studies involving the recombinant expression of

fibronectin binding proteins from other bacteria, such as L. brevis S-layer

protein (Avall-Jaaskelainen et al., 2003), S. pyogenes M1 protein (Cue et al.,

2001), and S. aureus fibronectin binding proteins (Sinha et al, 2000; Que et al.,

2001). While L. lactis may not have any fibronectin adherence properties on the

cell surface, the cell extracts used in the adhesion assays also contain

intracellular proteins which may play a role. However, there has been no

previous study reporting the ECM protein adhesion properties of intracellular

proteins.

Unexpectedly, the cell extract from L. lactis pGhost9-his1-lss-his2 was able to

significantly inhibit the adherence of S. aureus to keratin (Figure 3.6). There

has been no previous study reporting the ability of lysostaphin to bind to keratin,

although it has been shown to bind to plastic and still maintained its lytic

activity against S. aureus (Shah et al., 2004a). A possible explanation of the

adherence assay results may be that lysostaphin was able to bind to the plastic

surface of the wells. However, this is unlikely to be the case as the wells were

blocked with BSA to ensure that proteins in the L. lactis cell extracts only came

in contact with the ECM proteins. It is also unlikely that lysostaphin bound to

BSA itself as 20µg keratin mL-1 resulted in saturation of the wells (as

interpreted by the maximal adhesion of S. aureus observed in Figure 3.3), thus

not leaving much surface area for BSA to block. Therefore, the results suggest

that lysostaphin has either bound to keratin and thus prevent S. aureus

adherence or has enzymatically degraded bound S. aureus cells, and that the

CyuC portion of the CyuC-Lss fusion protein reduced the ability of lysostaphin

to bind to keratin or reduced the enzymatic activity of lysostaphin. Irrespective

of either of these hypotheses, it is clear that lysostaphin has significant potential

in the prevention of S. aureus interaction on keratin rich surfaces. Therefore, to

enhance the production of lysostaphin by L. lactis, the aim of the next chapter

was to identify and characterise L. lactis mutants which are altered in their

lysostaphin producing abilities.

73

CHAPTER 4

LACTOCOCCUS LACTIS FACTORS INVOLVED IN THE

EXPRESSION AND SECRETION OF ANTIMICROBIAL

CELL WALL LYTIC ENZYMES

74

4.1 INTRODUCTION

The levels of heterologous proteins secreted by L. lactis and other lactic acid

bacteria are generally low, and efforts have been made to improve the secretion

efficiency by modifying secretion signal sequences (Dieye et al., 2001; Ravn et

al., 2003) inactivating proteases (Poquet et al., 2000; Miyoshi et al., 2002;

Cortes-Perez et al., 2006) or supplying heterologous protein secretion

machinery (Nouaille et al., 2006). Some insight into the heterologous protein

secretion mechanism of L. lactis was gained when Nouaille et al. (2004)

identified thirteen genes which affected the secretion efficiency of the

staphylococcal nuclease reporter enzyme (NucT) using random mutagenesis.

The inactivation of these genes resulted in either increased or decreased NucT

secretion efficiency. One gene of particular interest was dltA, which encoded a

protein that catalyses the incorporation of D-alanine residues into lipoteichoic

acids (LTA) which results in a greater net positive charge on the cell surface. It

was hypothesised that the inactivation of dltA modified the cell wall to become

negatively charged, thereby reducing the secretion efficiency of the positively

charged NucT by electrostatic interactions.

In this study, random transposon mutagenesis was used to identify genes which

affect the expression and/or the secretion of lysostaphin by L. lactis.

Interestingly, none of the genes identified in the Nouaille et al. (2004) study

were identified. Instead, four genes were identified which, when inactivated,

resulted in an increase in the amount of lysostaphin secreted by L. lactis. These

genes have not been previously characterised as associated with protein

secretion, and they are likely to be involve in the modification of the cell

envelope of L. lactis, much like dltA.

4.2 MATERIALS AND METHODS

4.2.1 Construction of a lysostaphin expressing L. lactis strain suitable for

random insertional mutagenesis

Previously, the pGhost9:ISS1 plasmid carrying a lysostaphin expression cassette

(lss) was used to express and secrete lysostaphin in L. lactis (Turner et al.,

2007b). In this cassette, the DNA sequence encoding the Sep promoter and the

75

Sep secretion signal was fused to the beginning of the gene encoding the mature

lysostaphin protein (Figure 4.1B). A 6xhis encoding DNA region was also

inserted into the expression cassette to allow the detection of the recombinant

protein. In order to stabilise the lysostaphin expression cassette and remove the

pGhost9 plasmid DNA from the cell, it was necessary to integrate it into the

chromosome (Figure 4.2C). The strategy to obtain the chromosomally modified

lysostaphin expressing L. lactis strain (MG1363[lss]) was as follows. The lss

expression cassette was ligated to two fragments of the inactive histidine

biosynthesis (his) operon (Delorme et al., 1993) with lss and his in the same

orientation (Figure 4.1B). Firstly, the upstream fragment (his1; 1-2-kb) was

amplified from chromosomal DNA extracts of wild-type L. lactis using the

primers His1Sal5 and His1Xba3 (Figure 4.1A, Table 4.1) and corresponds to

647-bp from the start of hisC to 816-bp from the start of hisZ. The downstream

fragment (his2; 1.2-kb) was amplified using His2Xho5 and His2Eco3 (Figure

4.1A, Table 4.1) and corresponds to 834-bp from the start of hisZ to 222-bp

from the start of hisD. Both his fragments were first cloned into plasmids (his1

into pBluescript II KS+, and his2 into pGEM-T Easy), and then transformed

into E. coli JM109 for routine cloning and sequencing. Once the his1 and his2

sequences were verified to contain the correct sequence, his1 was digested from

pBS-his1 using SalI and XbaI, and his2 from pGEMT-his2 using XhoI and

EcoRI. These fragments were then ligated to the lss expression cassette which

was isolated as a XbaI and XhoI digested fragment from pSep-6 x His-Lss

(Turner et al., 2007b). The ligation reaction was used as a template for

amplification by PCR using the primers His1Sal5 and His2Eco3. The resulting

3.9-kb PCR fragment was digested with SalI and EcoRI, and cloned into

pGEM-T Easy (pGEMT-his1-lss-his2). Once the whole fragment was verified

to contain the correct sequence, it was cloned into pGhost9:ISS1 (pGhost9-his1-

lss-his2), transformed into wild-type L. lactis and stable integration of lss into

the chromosome was performed in two steps. Firstly, L. lactis pGhost9-his1-

lss-his2 was incubated at 37°C for 18 h, and integrants were selected on a

GM17 agar plate containing 2µg erythromycin mL-1 (GM17+2Em). A colony

was isolated, and was confirmed as containing an integrated copy of pGhost9-

his1-lss-his in the his operon by PCR using the chromosomal DNA as template

and the primers lss-Pst and His2-DS (Figure 4.2B, Table 4.1). In addition, the

76

integrant was confirmed to have lysostaphin activity on GM17+SaB agar plates

containing 2g erythromycin mL-1 (GM17+SaB+2Em). Clones that express

and secrete lysostaphin will produce clearing zones (or halos) around the

colonies (Turner et al., 2007b). Next, to remove the pGhost9 plasmid from the

chromosome, the lysostaphin expressing strain was incubated at 30C in the

absence of erythromycin to stimulate recombination by allowing the plasmid to

replicate, and then incubated at 37°C to allow the loss of the excised plasmid

(Biswas et al., 1993). This recombination event can occur in two ways. The

first results in the recombination of the plasmid with the lss expression cassette

remaining in the chromosome (Figure 4.2C), whilst the second results in the

complete lost of the construct (Figure 4.2D). The resulting stable integrant,

MG1363[lss] (Figure 4.2C), was selected for its lysostaphin activity and

erythromycin sensitivity phenotype.

4.2.2 Construction of a L. lactis transposon library by random insertional

mutagenesis

The MG1363[lss] strain was transformed with pGhost9:ISS1 according to the

methods described in sections 2.2.2 and 2.2.6. A random transposon library was

prepared essentially as described by Maguin et al. (1996). Briefly, the

MG1363[lss] strain containing pGhost9:ISS1 was incubated for 18 h in

GM17+5Em medium. The saturated culture was diluted 100-fold in GM17

medium (without erythromycin), and incubated for 3 h at 30C, and then for 3 h

at 37C. The culture was then diluted so that approximately 50 colony forming

units (cfu) were plated on each GM17+SaB+2Em or GM17+SaU agar plates

containing 2µg erythromycin mL-1 (GM17+SaU+2Em), and incubated at 37C

for two days to select for pGhost9-transposed mutants (Figure 4.4B).

77

his1 (1.2-kb) his2 (1.2-kb)PSep

ssSep lss

6xhis

*B

hisC hisZ hisG hisD

His1Sal5 His1Xba3 His2Xho5 His2Eco3

A

pGhost9hisC hisZ hisZ hisG hisD

his1 (1.2-kb) his2 (1.2-kb)PSep

ssSep lss

6xhis

*B

hisC hisZ hisG hisD

His1Sal5 His1Xba3 His2Xho5 His2Eco3

A

pGhost9hisC hisZ hisZ hisG hisD

Figure 4.1. The regions of the his operon cloned from the chromosome (A) and the structure of pGhost-his1-lss-his2 (B).

The two his fragments were PCR amplified using the primers sets His1Sal5 and His1Xba3 (his1; white block arrows) and His2Xho5 and

His2Eco3 (his2; white block arrows). The lss expression cassette consists of the Sep promoter (PSep) and secretion signal (ssSep; hash box) with a

6xhis coding sequence (black box) fused to the 5’ of the lysostaphin gene (lss; dotted box). An asterisk indicates a stop codon at the end of the

lysostaphin gene.

78

hisC hisZ hisG hisD

hisD

A

B

C

pGhost9-his1-lss-his2

Ts repA

hisChisZ

lss

hisZhisG hisD

EmR

PSep

hisC hisZ hisZ

hisG

hisD

hisC hisZ hisG

hisC hisZ hisG hisD hisC hisZ hisG hisD

lss-Pst His2-DS

37°C

30°C

his1 his2

D

hisC hisZ hisG hisD

hisD

A

B

C

pGhost9-his1-lss-his2

Ts repA

hisChisZ

lss

hisZhisG hisD

EmR

PSep

hisC hisZ hisZ

hisG

hisD

hisC hisZ hisG

hisC hisZ hisG hisD hisC hisZ hisG hisD

lss-Pst His2-DS

37°C

30°C

his1 his2

D

79

Figure 4.2. Stable integration of the lss expression cassette into the L. lactis chromosome.

The construct pGhost9-his1-lss-his2 was integrated into the his operon (large block arrows) by single crossover homologous recombination

through the his2 region (A). The site of homologous recombination is marked with a cross. The integrant (B) was confirmed by amplification

by PCR using the primers lss-Pst and His2-DS (broken arrows). A shift of the integrant to 30°C stimulates recombination between the

duplicated his genes by allowing the plasmid to replicate, thus leading to plasmid excision. Excision through his1 gives rise to a stable

integration of the lss expression cassette (C), whereas excision through his2 restores the original chromosomal structure (D).

80

Table 4.1. Strains, plasmids, and oligonucleotides used in this chapter.

Details Source/Reference Strains E. coli JM109 L. lactis MG1363 L. lactis MG1363[lss] L. monocytogenes ATCC 19112 S. aureus ATCC 49476 Plasmids pBluescript II KS+ pGEM-3Zf pGEM-T Easy pGhost9:ISS1 pSep-6 x His-Lss pBS-his1 pGEMT-his2 pGEMT-his1-lss-his2 pGhost9-his1-lss-his2 pSep511sec Oligonucleotides His1Sal5 His1Xba3 His2Xho5 His2Eco3 lss-Pst His2-DS ISS1-seq1 ISS1-seq2

Cloning host Plasmid free L. lactis subsp. cremoris L. lactis carrying the lss cassette on the chromosome Ampr ; 3.0-kb Ampr ; 3.2-kb Ampr ; 3.0-kb Emr ori (Ts); 4.6-kb ; non-replicative in L. lactis at 37°C Ampr; pGEM-3Zf containing the PSep-ssSep-6xhis-lss expression construct (5.3-kb) Ampr ; pBS containing fragment of MG1363 his operon on the 5’ end of the lss cassette (4.2-kb) Ampr ; pGEM-T Easy containing fragment of MG1363 his operon on the 3’ end of the lss cassette (4.2-kb) Ampr ; pGEM-T Easy vector containing the lss cassette within the his operon (6.9-kb) Emr ; pGhost9:ISS1 containing the lss cassette within the his operon (7.6-kb) Emr ; pGhost:ISS1 containing the PSep-ssSep-6xhis-Ply511 expression construct (5.5-kb) 5’-CAGGTCGACCTTTGGGAGTCGCCTTTGGCT 5’-TACTCTAGACTGAAACATCAGCCCAGTATA 5’-AGACTCGAGGGCGCAAGCGACTATATCCGG 5’-TTCGAATTCTTCTTCGCGCTCCTTGCGGTG 5’-AACAGCTGCAGGAGCTGCAACACATGAACATTC 5’-TGTGATTTGGTACGACGCAGAATTCTAAAGT 5’-CACGATAGCTTAGATTGTAACG 5’-GAACCGAAGAAATGGAACGCTC

Promega

Gasson, 1983 This study

Promega Promega Promega

Maguin et al., 1996 Turner et al., 2007b

This study This study

This study This study

Turner et al., 2007b

This study This study This study This study

Turner et al., 2007b This study

Maguin et al., 1996 Maguin et al., 1996

81

Restriction enzyme recognition sites introduced by primers are underlined.

82

4.2.3 Screening the transposon library for mutants with altered

lysostaphin activity

The mutants were screened for the absence of halos or halos larger than that

produced by the other colonies on the agar plate, which would be indicative of

lower or higher lysostaphin activity, respectively. Any mutants which initially

appeared to be of interest were isolated and inoculated in GM17+2Em medium,

and then incubated at 37C. After 18 h of incubation, the mutants were plated

by 16-streak technique onto one side of a GM17+SaB+2Em agar plate and a

GM17+SaU+2Em agar plate, whilst the other side was similarly inoculated with

the control strain, MG1363[pGhost9-his1-lss-his2]. These plates were

incubated at 37C for two days after which the size of the halos produced by the

colonies of the mutant were then directly compared with the halos produced by

the colonies of the control strain. Mutants with different sized halos compared

with the control strain were retained for further investigation. The average

diameter of the halo of the control strain was 3.4 mm. Larger halos from the

selected mutants had diameters 0.8 mm to 2.8 mm greater than that produced by

the control strain.

4.2.4 Characterisation of the pGhost9:ISS1 insertion site and isolation of

stable ISS1-generated mutants

The plasmid pGhost9:ISS1 contains unique restriction enzyme recognition sites

adjacent to the ISS1 element (Figure 4.4A). These were used after transposition

to clone chromosomal DNA flanking the pGhost9:ISS1 insertion site as

previously described (Maguin et al., 1996). Briefly, chromosomal DNA was

isolated and subjected to either EcoRI or HindIII digestion. Following this, the

digested DNA was placed in a ligation reaction which allowed recircularisation

of the fragments, including the pGhost9:ISS1 plasmid containing chromosomal

DNA (Figures 5.3B and C). The ligated products were transformed into E. coli

JM109, and incubated at 30C for two days. The plasmids were purified and

submitted for sequencing using the primer ISS1-seq1 for the EcoRI

chromosomal junction or ISS1-seq2 for the HindIII junction (Figures 4.3B and

C; Table 4.1). The genes flanking the inserted transposon structure were

83

identified by sequence comparison with the sequenced genome of L. lactis

subsp. cremoris MG1363 strain (Wegmann et al., 2007).

For further analyses, mutants which contained only the ISS1 element on its

chromosome (herein referred to as ISS1-generated mutants; Figure 4.4C) were

generated from pGhost-transposed mutants by excising pGhost9:ISS1 from the

chromosome. This was to eliminate the erythromycin resistance marker and to

allow stability of the integrated ISS1-generated mutants element to grow at

30C, the optimal temperature for L. lactis. This was accomplished as described

by Maguin et al. (1996). Briefly, the pGhost9-transposed mutants were

incubated in GM17 medium at 37C for 18 h. The culture was diluted 106-fold

into GM17 medium and incubated at 30C for 18 h. This step stimulates

recombination between the duplicated ISS1 elements (Figure 4.4B) as this is the

permissive temperature for pGhost9:ISS1 plasmid replication. This gave rise to

a chromosomal structure whereby a single ISS1 element remained, thus

disrupting the gene (Figure 4.4C). Cultures were then diluted and plated onto

GM17 agar plates at 37C to prevent plasmid replication. Colonies were replica

plated onto GM17 agar plates with and without 5µg erythromycin mL-1.

Colonies in which excision had occurred and the plasmid was lost were

phenotypically sensitive to erythromycin. Where more than one mutant was

identified with insertion in the same gene, only one was selected to create a

temperature-stable mutant and used as a representative for further analyses.

These mutants were then retested for their lysostaphin activities by streaking a

loopful of overnight cultures onto one side of a GM17+SaB and GM17+SaU

agar plate, whilst the other side was similarly inoculated with the control strain,

MG1363[lss]. These plates were incubated at 30C for two days, after which

the size of the halos of the mutant colonies were then directly compared with the

control strain.

84

EcoRI HindIII

ISS1 ISS1pGhost9

EcoRIHindIII

ISS1-seq1 ISS1-seq2

ISS1

fragment ofchromosome

EcoRI

EcoRI

ISS1-seq1ISS1

fragment of chromosome

HindIII

HindIII

ISS1-seq2

A

B C

EcoRI HindIII

ISS1 ISS1pGhost9

EcoRIHindIII

ISS1-seq1 ISS1-seq2

ISS1

fragment ofchromosome

EcoRI

EcoRI

ISS1-seq1ISS1

fragment of chromosome

HindIII

HindIII

ISS1-seq2

A

B C

Figure 4.3. Representation of the pGhost9-transposed mutant between

duplicated ISS1 elements (A).

The primer used to sequence the chromosomal DNA included in pGhost9:ISS1

digested from EcoRI (B), or HindIII (C) is as indicated (broken arrow).

Symbols: white box and white block arrows, chromosomal DNA; green block

arrows, ISS1 transposon element; solid lines, pGhost9 plasmid; dotted arrows,

primer. EcoRI and HindIII sites are indicated.

85

ISS1

EcoRI

HindIII

pGhost9:ISS1

MG1363[lss] pGhost9:ISS1at 30°C

Shift temperature to 37°C and select for transposants

pGhost9-transposed mutant

ISS1 ISS1pGhost9:ISS1

A

B

Shift temperature to 30°C to stimulate plasmid replication and recombination between duplicated ISS1 elements

ISS1ISS1-generated mutant

C

ISS1

EcoRI

HindIII

pGhost9:ISS1

MG1363[lss] pGhost9:ISS1at 30°C

Shift temperature to 37°C and select for transposants

pGhost9-transposed mutant

ISS1 ISS1pGhost9:ISS1

A

B

Shift temperature to 30°C to stimulate plasmid replication and recombination between duplicated ISS1 elements

ISS1ISS1-generated mutant

C

Figure 4.4. Schematic representation of the creation of a mutant by random

transposon mutagenesis using pGhost9:ISS1 and the excision of the plasmid

from the chromosome.

L. lactis with pGhost9:ISS1 was cultured at 30°C (A). A shift in temperature to

37°C selected for pGhost9-transposed mutants (B). This structure must be

maintained at 37°C. Changing the temperature back to 30°C stimulated a

recombination event between the duplicated ISS1 elements by allowing the

plasmid to replicate. The result is a temperature stable ISS1-generated mutant

whereby a single ISS1 element remained in the chromosome thus disrupting the

gene (C). Symbols: white block arrows, chromosomal DNA; green block

arrows, ISS1 transposon element; solid lines, pGhost9 plasmid.

4.2.5 Prediction of operon structures

To determine if the genes containing ISS1 insertions were cotranscribed with

downstream genes, two operon prediction methods were used which are

available at http://www.microbesonline.org/operons (Price et al., 2005) and

http://operondb.cbcb.umd.edu/cgi-bin/operondb/operons.cgi (Ermolaeva et al.,

2001). The accuracy of the Price et al. (2005) method, which has been

estimated based on the prediction of experimentally proven operons and from

86

microarray expression data, is 82% for most genomes. The identification of

likely co-transcribed genes was predicted by at least one of these two methods.

4.2.6 Prediction of subcellular locations of proteins

Protein sequences were analysed using three freely available online programs:

SOSUI, a predictor of transmembrane regions (http://bp.nuap.nagoya-

u.ac.jp/sosui/) (Hirokawa et al., 1998); PHD transmembrane helix predictor

(http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_phd.html)

(Rost et al., 1995); and TMpred, a predictor of transmembrane regions and

protein orientation (http://www.ch.embnet.org/software/TMPRED_form.html)

(Hofmann and Stoffel, 1993). .

4.2.7 Cell fractionation, protein extraction, SDS-PAGE, and western blot

L. lactis strains of interest were incubated for 18 h, diluted 50-fold into 10mL of

fresh medium, and incubated at 30°C (or at 37°C as indicated) until the OD600nm

reached 1.0. The cells were pelleted by centrifugation at 3000 – 5000 x g for 10

min at 4°C. Proteins in the supernatant were precipitated using TCA as

described in section 2.6.2. The protein pellet was resuspended in either 20L or

100L of 50mM NaOH and equal volumes of 2x SDS loading buffer. The cell

pellet was resuspended in 50L of 2x SDS loading buffer giving a total volume

of 200L per 10mL of culture.

The protein samples were heated at 97C for 5 min and separated by SDS-

PAGE as described in section 2.6.1. The gel was then either stained with

Coomassie for the visualisation of protein bands or transferred to nitrocellulose

membrane and the proteins were detected as described in section 2.6.3.

To semi-quantify the amount of proteins, films which have not been over

exposed were scanned (CanoScan800F, Canon), and the total amount of his-

labelled proteins from the supernatant and cell associated fractions were

estimated with the GeneTools software (Syngene). An example is shown in

Figure 4.5 where a band from MG1363[lss] and the murA2[lss] mutant were

compared using the GeneTools software.

87

MG[seplss] 31397 (murA2)

37

29

kDa 900 450 90 45 900 450 200

MG[seplss] 31397 (murA2)

37

29

kDa37

29

kDa 900 450 90 45 900 450 200

Figure 4.5. Example of a western blot used in semi-quantification.

MG1363[lss] and the L. lactis mutant strain 31397 were grown at 37C. The

numbers above the western blot protein bands represent the amount of culture

supernatant loaded in each lane in µL. Bands which did not suffer from over

exposure from MG1363[lss] (lane 450) and murA2[lss] mutant (lane 45) were

then compared using the GeneTools software. Molecular mass standards are

expressed in kilodaltons (kDa). Previous work has shown that supernatant and

cell associated extracts of wild-type L. lactis do not contain any proteins which

react with anti-His6 antibodies (Turner et al., 2007b).

4.2.8 Endolysin Ply511 expression and secretion in [lss] mutant strains

The L. monocytogenes bacteriophage endolysin Ply511 was transformed into

wild-type L. lactis, the control strain (MG1363[lss]), the lom[lss], murA2[lss],

and trmA[lss] mutant strains. The Ply511 gene was introduced into these strains

using the pGhost9:ISS1 plasmid under the control of the Sep expression system

(pSep511sec; Table 4.1) (Turner et al., 2007b). The transformed strains were

tested for Ply511 activity against L. monocytogenes cells on GM17+LmB agar

plates containing 5µg erythromycin mL-1 (GM17+LmB+5Em) (Turner et al.,

2007b). Ply511 was also detected on western blots using anti-His6 monoclonal

antibody as described in section 4.2.7.

4.2.9 Lysozyme resistance test

The lysozyme resistance test was performed as described by Veiga et al. (2007).

Briefly, solutions of chicken egg white lysozyme (Sigma Aldrich) in GM17

were freshly prepared and diluted 10-fold into molten GM17 agar at 45°C.

88

Then, 5µL of cultures incubated for 18 h were diluted 10-fold and then spotted

onto the GM17 agar containing different concentrations of lysozyme. The

plates were then incubated at 30°C or 37°C as indicated.

4.2.10 Transmission electron microscopy (TEM)

Cultures incubated for 18 h were diluted 100-fold and incubated at either 30ºC

or 37ºC. After 3, 6, and 20 h of incubation, 100µL of culture was fixed in 0.4%

v/v glutaraldehyde (ProSciTech), 100mM cacodylate buffer (pH 7.3). After 18

h of fixative, the cells were washed in 100mM cacodylate buffer. Cells were

postfixed in 1% w/v osmium tetroxide and embedded in Spurr expoxy resin.

Ultrathin sections (50 – 100 nm) were cut and stained with 2% w/v uranyl

acetate and 0.1% w/v lead citrate prior to examination and photography using

the JOEL 1200 EX transmission electron microscope. Ultrathin sectioning and

TEM photography were conducted by Dr Christina Theodoropoulos (Analytical

Electron Microscopy Facility, QUT).

4.2.11 Statistical data analysis of significance using Student’s t-test

Statistical data analysis was performed using unpaired Student’s t-test as

calculated by the software GraphPad QuickCalcs

(http://www.graphpad.com/quickcalcs/index.cfm).

4.2.12 Alignment and phylogenetic analysis

The protein sequences were aligned using the program CLUSTALX as

implemented by the MEGA4 software (Tamura et al., 2007) with the gap

opening and extension penalties of 10.0 and 0.2, respectively. Phylogenetic tree

was constructed by neighbour-joining method using MEGA4 based on pairwise

distances between amino acid sequences (Saitou and Nei, 1987).

4.3 RESULTS

4.3.1 Isolation and identification of mutants with altered lysostaphin

activity

In total, 35,881 MG1363[lss] mutant clones were screened for increase in or the

absence of lysostaphin activity on GM17+SaB+2Em and GM17+SaU+2Em

89

agar plates. On that basis, 124 mutants were initially selected and their

lysostaphin activity was directly compared to the appropriate control strain,

MG1363[pGh-his1-lss-his2], by growing both on the same agar plate. Ten of

the 124 initial mutants were confirmed to have a halo size greater than that of

MG1363[pGh-his1-lss-his2], whilst one mutant was confirmed as having no

halo. The locations of the transposed pGhost9:ISS1 were identified by

comparison of the flanking sequences with the L. lactis MG1363 genome

sequence (Wegmann et al., 2007) (Table 4.2). The mutant with no lysostaphin

activity resulted from the transposition of pGhost9:ISS1 into the lss expression

cassette. The other mutants were located in four separate genes: llmg_0609

(three mutants), murA2 (five mutants), trmA (one mutant), and llmg_2148 (one

mutant).

The plasmid pGhost9:ISS1 was excised from all mutants to create ISS1-

generated mutants (Figure 4.4C). These ISS1-generated mutants were streaked

onto GM17+SaB (without erythromycin) to reconfirm the lysostaphin activity

phenotype and also to compare against the control strain, MG1363[lss]. The

llmg_0609 and llmg_2148 mutants retained their increased lysostaphin activity

at 30°C, whilst the large zones of activity were only observed at 37°C in the

murA2 and trmA mutants. The amount of lysostaphin secreted, generation time

and stationary culture pH were measured for all mutants (Table 4.2). The

increase in lysostaphin activity of the ten mutants was determined by western

blot analysis to be due to an increase in the amount of lysostaphin as compared

with the control strain, MG1363[lss] (Figure 4.6, Table 4.2 shaded column). The

levels were determined by direct comparison to the amount secreted by

MG1363[lss] which was assigned a value of 1.0 (Table 4.2). The average

increases (± standard deviation) in the lysostaphin levels in the cell extracts and

supernatants of the three llmg_0609 mutants were 3.0-fold (±0.2-fold), and

12.0-fold (±3.6-fold), respectively; both levels were significantly higher than

those of the control strain (p < 0.01). The average increase (± standard

deviation) in the lysostaphin level in the supernatants of the five murA2 mutants

grown at 37C was 6.2-fold (±0.7-fold), and the level was significantly higher

than that of the control strain (p < 0.01).

90

4.3.2 Characterisation of the genes which affected lysostaphin secretion

4.3.2.1 The gene llmg_0609 is incorrectly annotated and is renamed lom

Three independent ISS1 insertions were found in the gene llmg_0609 (Figure

4.6A, Table 4.2) which is annotated in the L. lactis MG1363 genome to

putatively encode for an enzyme (PabC) which functions as a 4-amino-4-

deoxychorismate lyase (ADC lyase). It is unlikely that llmg_0609 is the pabC

gene as it has recently been proposed that the open-reading frame of the true

pabC gene in L. lactis MG1363 is contained within the llmg_1154 open-reading

frame as a fusion to pabB (Wegkemp et al., 2007). Furthermore, a comparative

alignment of llmg_0609 to the pabC gene sequences from E. coli (Green et al.,

1992) and B. subtilis (Slock et al., 1990) did not reveal any similarities.

Therefore, it is proposed that llmg_0609 be renamed as lom (lysostaphin

oversecreting mutant) to avoid confusion.

An in silico approach was taken in an attempt to gain an insight into what may

be the true function of lom. Searches through the Genbank database using the

blastp and tblastx algorithms (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi)

revealed significant protein sequence homologies to putative ADC lyase from

Streptococcus species as well as to streptococcal proteins with predicted solute-

binding functions. However, none of these homologous proteins have been

subjected to functional analyses. Protein sequence analysis of Lom revealed a

single transmembrane helix predicted to lie in the central region (amino acids

177 to 195; IITVIVVLLILVVGGTGWY) (Figure 4.6A) with the C-terminal

region of the protein extending outside of the membrane.

91

Table 4.2. Characteristics of mutants with lysostaphin activity greater than that of the wild-type.

Levels of Lysostaphin

Mutant Genea

Homologous

proteins Predicted functionb

Downstream gene possibly affected by ISS1 insertion

(predicted function)c Cell

associatedd Supernatantd Generation

time (mins)e pHf MG1363[lss] 1.0 (1.0) 1.0 (1.0) 67 (91)g 4.3 2190 llmg_0609 Unknown (membrane location

predicted) greA (transcription elongation factor)

3.1 9.8 59 4.3

11135 “ “ 3.1 10.1 61 4.5 24185 “ “ 2.8 16.1 56 4.4 18662 llmg_0517 MurA2 Uridine diphosphate (UDP)-

N-acetylglucosamine enolpyruvyl transferase

llmg_0518 (unknown function) 3.0 (0.8) 3.4 (6.2)g 63 (75)g 4.3

24189 “ “ “ 0.7 (2.0)g 1.3 (5.4)g 62 (76)g 4.3 28801 “ “ “ 1.3 (nd)g 1.3 (7.2)g 59 (79)g 4.3 31394 “ “ “ nd (nd)g 2.4 (6.0)g 57 (63)g 4.3 31397 “ “ “ nd (nd)g 2.8 (6.4)g 64 (72)g 4.3 16270 llmg_0640 TrmA (Spx) Temperature resistance;

transcription regulation None 1.9 (1.2)g 4.3 (7.2)g 77 (55)g 4.3

2194 llmg_2148 UbiG 3-demethylubiquinone-9 3-methyltransferase

fmt (methionyl-tRNA fomyltransferase)

3.3 6.6 56 4.4

a Gene in which pGhost9:ISS1 integration occurred. b Predicted function as determined by annotation from MG1363 genome available on Genbank. c Downstream genes that are likely located in an operon with the gene containing the ISS1 element were predicted by computational methods (section 5.2.5). d The amount of lysostaphin secreted was determined by western blot analysis of the total amount of lysostaphin in the cell associated or supernatant fractions in comparison to MG1363[lss], which is assigned the index 1.0. e Generation time was calculated based on the exponential growth phase (Madigan et al., 2001). f pH was measured from overnight cultures grown in GM17 medium supplemented with a final concentration of 1% w/v glucose at 30°C. g Figures in parentheses are measurements taken from cultures grown at 37°C. h nd indicates that lysostaphin was not detected in the cell associated fraction by western blot analysis.

92

rpoE llmg_0609 greA

transmembrane helix

2418

5

1113

521

90

hyp protapt

hyp prot

suhB murA2 hyp prot tig

1866

224

189

2880

131

394

3139

7

clpP hyp prot trmA hyp protput prot

1627

0

A

C

E

2937

11135MG1363

20L200L

[lss][lss]

30°C30°C

2937

28801MG1363

90L450L

[lss][lss]

37°C37°C

16270MG1363

45L200L

[lss][lss]

37°C37°C

2937

B

D

F

rpoE llmg_0609 greA

transmembrane helix

2418

5

1113

521

90

hyp protapt

hyp prot

suhB murA2 hyp prot tig

1866

224

189

2880

131

394

3139

7

clpP hyp prot trmA hyp protput prot

1627

0

A

C

E

29372937

11135MG1363

20L200L

[lss][lss]

30°C30°C

2937

28801MG1363

90L450L

[lss][lss]

37°C37°C

16270MG1363

45L200L

[lss][lss]

37°C37°C

29372937

B

D

F

93

Figure 4.6. Identification of the insertion sites for the nine over-secreting mutants.

(A) Locations of the three mutants in the llmg_0609 gene at nucleotide positions 818 (mutant 24185), 1354 (mutant 11135), and 1408 (mutant

2190) from the start of the gene. The predicted single transmembrane helix is located from amino aids 177 to 195 (dotted box). (B) A

representative western blot of lysostaphin in the supernatant fractions from MG1363[lss] and mutant 1135[lss] grown at 30ºC. (C) The five

independent insertions in the murA2 gene are located at nucleotide positions 116 (mutant 28801), 753 (mutant 24189), 766 (mutant 31397), 1050

(mutant 31394), and 1220 (mutant 18662). (D) A representative western blot of lysostaphin in the supernatant fractions from MG1363[lss] and

mutant 28801[lss] grown at 37ºC. (E) The single mutation of the trmA gene (mutant 16270) is located 34-bp upstream of the start of the gene.

(F) A representative western blot of lysostaphin in the supernatant fractions from MG1363[lss] and mutant 16270[lss] grown at 37ºC. The

variable supernatant quantities loaded in all the western blots are indicated in the tables directly above the blots.

94

4.3.2.2 The murA2 gene encodes for the primary MurA in L. lactis

Five mutations were identified in the murA2 gene (Figure 4.6C, Table 4.2).

This gene putatively encodes UDP-N-acetylglucosamine enopyruvyl transferase

(MurA), which catalyses the first step in the biosynthesis of peptidoglycan

(Marquardt et al., 1992). As with other low-G+C Gram-positive bacteria (Du et

al., 2000), L. lactis has two genetic copies of the MurA enzymes (MurA1 and

MurA2) (Wegmann et al., 2007). MurA2 in L. lactis is more closely related to

enzymes in related species that are annotated as the primary MurA enzyme. L.

lactis MurA2 is 61% and 40% identical to the B. subtilis MurAA and MurAB

proteins, respectively (Figure 4.7).

L. lactis MurA2

S. pneumoniae MurA1

B. subtilis MurAA

E. coli MurA

B. subtilis MurAB

L. lactis MurA1

S. pneumoniae MurA2100100

10099

0.05

Primary MurA enzyme

L. lactis MurA2

S. pneumoniae MurA1

B. subtilis MurAA

E. coli MurA

B. subtilis MurAB

L. lactis MurA1

S. pneumoniae MurA2100100

10099

0.05

L. lactis MurA2

S. pneumoniae MurA1

B. subtilis MurAA

E. coli MurA

B. subtilis MurAB

L. lactis MurA1

S. pneumoniae MurA2100100

10099

0.05

Primary MurA enzyme

Figure 4.7. Phylogenetic tree showing L. lactis MurA2 is more closely related

to the primary MurA in other species.

The tree was constructed by the neighbour-joining method. The scale bar

represents 0.05 expected amino acid replacements per site. The percentage of

replicate trees in which the associated taxa clustered together in the bootstrap

test (1000 replicates) are shown next to the branches.

The lysostaphin over-secretion phenotype of the murA2 mutants was observed

under heat stress at 37C (Table 4.2). As the function of MurA is in

peptidoglycan biosynthesis, the thickness of the cell walls of the murA2 mutants

was examined under TEM. Examinations of the thickness of the cell walls

(Figure 4.8) did not reveal any gross changes between the murA2 mutants and

the MG1363[lss] strain at both 30°C and 37°C. Similarly, Coomassie-stained

SDS-PAGE analysis of proteins from supernatant fractions showed that the

murA2 mutants (and other mutants) did not release greater amounts of

intracellular proteins than the control strain (MG1363[lss]) (Figure 4.9).

95

100nm

A B

C D

100nm

100nm 100nm

Cell membrane

Outer edge of cell wall

100nm100nm

A B

C D

100nm100nm

100nm100nm 100nm100nm

Cell membrane

Outer edge of cell wall

Figure 4.8. Transmission electron micrographs of the control strain,

MG1363[lss] (A, B) and the murA2[lss] mutant (C, D).

Overnight cultures of both strains were diluted 100-fold and cultured at 30C

(A, C) and 37C (B, D) for 6 h. The thickness of the cell wall was determined

by measuring the distance between the cell membrane and the outer edge of the

cell wall on the TEM micrographs.

96

M 1 2 3 4 5 6 7 8 9

20

2935

4890

128

30C 37C

Usp45

Figure 4.9. Coomassie-stained SDS-PAGE of proteins from the supernatant

fractions.

The lanes on the SDS-PAGE are as follows: pre-stained SDS-PAGE standards

indicated in kDa (lane M); the control strain, MG1363[lss] (lanes 1 and 5),

trmA[lss] mutant (lanes 2 and 6), lom[lss] mutant (lane 3), and murA2[lss]

mutant (lanes 4 and 7). The level of Usp45, an abundantly secreted

extracellular protein of unknown function (Van Asseldonk et al., 1990), was

used as an approximate indicator of the total amount of proteins loaded onto the

gel. The control and mutant strains were incubated at either 30C or 37C for 18

h and the supernatant fraction was processed according to section 4.2.7.

4.3.2.3 More lysostaphin is secreted by the trmA[lss] mutant strain under

high temperature stress

A single insertion was identified 34-bp upstream of the trmA gene (Figure 4.6E,

Table 4.2). TrmA has homology to Spx, an oxidative stress regulator in B.

subtilis (Nakano et al., 2003), and there are seven genes in the trmA family

encoded by the MG1363 genome (Wegmann et al., 2007). It is interesting to

note that the trmA mutant in this study secreted more lysostaphin under heat-

stress conditions at 37C (Table 4.2), despite a previous report that the absence

of TrmA stimulated an increase in the proteolytic activity of the intracellular

protease, ClpP (Frees et al., 2001)

4.3.2.4 Basis for lysostaphin secretion in llmg_2148[lss] mutant is unclear

Finally, one of the mutants selected from the screening had an inactivation in

the gene annotated as llmg_2148 (Table 4.2). The basis for the increased

97

lysostaphin secretion remains unclear. This gene is annotated as a putative

enzyme, 3-demethylubiquinone-9 3-methyltransferase (UbiG; Wegmann et al.,

2007), which in E. coli is involved in ubiquinone biosynthesis (Stroobant et al.,

1972). However, this annotation may be inaccurate as llmg_2148 has no

similarity to functionally characterised UbiG enzymes in the databases.

4.3.3 The lom, murA2, and trmA mutant strains secrete higher levels of

the cell wall hydrolytic enzyme, Ply511, compared to wild-type

To examine whether the increase in lysostaphin secretion is specific to

lysostaphin, the ability of the wild-type L. lactis, the control strain

(MG1363[lss]), and the lysostaphin secreting mutant strains (lom[lss],

murA2[lss], and trmA[lss]) to express another heterologous protein, Ply511, was

compared. Ply511 is a peptidoglycan hydrolytic endolysin (N-acetylmuramoyl-

L-alanine amidase) from L. monocytogenes bacteriophage (Loessner et al.,

1995a). All strains transformed with the Ply511 expression cassette

(pSep511sec; Table 4.1) demonstrated activity against both L. monocytogenes

and S. aureus, as evidenced by zones of clearing on agar plates containing

autoclaved cells. The zones of activity of Ply511 on GM17+LmB+5Em agar

plates were compared, and the diameters of the activity zones between the

control and the mutant strains were found to be the same. Zones of clearing of

the mutant and the control strains on agar plates could not be adequately

captured to an adequate resolution using a digital camera or laboratory gel

documentation system and therefore data could not be shown. The amount of

Ply511 secreted into the supernatant was examined using western blot analysis.

The amounts of recombinant Ply511 found on the cell associated fraction and

secreted into supernatant by the mutant strains, lom[lss][511], murA2[lss][511],

and trmA[lss][511] were greater than the control strain, MG1363[lss][511]

(Figure 4.10).

98

293750

293750

lysostaphin293750

293750

293750

293750

Cell associated Supernatant

Ply511

[511][511][511][511]

1ml1ml1ml1ml

[lss][lss][lss][lss]

trmAmurA2lomMG1363

450µl450µl450µl900µl

[lss][lss][lss][lss]

[511][511][511][511]

trmAmurA2lomMG1363

293750

293750

lysostaphin293750

293750

293750

293750

Cell associated Supernatant

Ply511

[511][511][511][511]

1ml1ml1ml1ml

[lss][lss][lss][lss]

trmAmurA2lomMG1363

450µl450µl450µl900µl

[lss][lss][lss][lss]

[511][511][511][511]

trmAmurA2lomMG1363

Fgure 4.10. Western blot detection of L. lactis strains secreting lysostaphin and Ply511 in the cell associated and supernatant fractions.

The different strains and the quantities loaded on the western blot are indicated in the table. Molecular mass standards are expressed in kDa.

The amount of cell associated protein is equivalent to 1mL of late-exponential phase culture. The amount of supernatant protein loaded in each

lane is equivalent of 900L of late-exponential phase culture for the control strain (MG1363[lss][511]) and 450L for mutant strains. The

Ply511 protein resolved at approximately 40kDa. The lysostaphin protein resolved at approximately 31kDa.

99

4.3.4 The murA2 and trmA mutants were more resistant to lysozyme

hydrolysis

A recent study has shown that a mutation in trmA results in lysozyme resistance

in MG1363 (Veiga et al., 2007). In this study, the trmA mutant which expresses

lysostaphin (trmA[lss]) was also more resistant to lysozyme than the wild-type

expressing lysostaphin (MG1363[lss]) (Figure 4.11). Interestingly, the control

strain, MG1363[lss], was observed to be much more sensitive to lysozyme

hydrolysis compared with the non-lysostaphin expressing wild-type strain,

MG1363 (Figure 4.11B). It was also observed that the murA2[lss] mutant strain

was moderately more resistant to lysozyme than the control strain

(MG1363[lss]) (Figure 4.11B).

4.4 DISCUSSION

The aim of this study was to identify L. lactis factors which affect the secretion

efficiency of the peptidoglycan hydrolase lysostaphin, and mutants which

overproduce this important antimicrobial enzyme. A previously described

method was adapted in this study whereby random mutagenesis (using the ISS1

transposon in the plasmid pGhost9:ISS1) was used to identify factors which

affected the secretion of the staphylococcal nuclease reporter (NucT) in L. lactis

(Nouaille et al., 2004). In this study, a L. lactis strain was constructed in which

the lysostaphin gene was integrated into the chromosome under the control of

the Sep promoter and secretion signal. Transposon mutagenesis was then

performed on this strain to generate mutants which produced higher or lower

lysostaphin activities.

In total, 35,881 MG1363[lss] transposon mutants were screened and eleven

clones were identified which had altered lysostaphin activity. As ISS1 insertion

is reportedly random (Maguin et al., 1996), the number of mutants screened

theoretically corresponds to approximately 14-fold coverage of the L. lactis

MG1363 genome, approximately 2.53-Mbp (Wegmann et al., 2007). Nouaille

et al. (2004) expressed reservations that pGhost9:ISS1 insertional transposition

was totally random as they had screened over 35,000 mutants, and yet did not

obtain any mutants with an insertion in the nucT expression cassette thus

causing the abolition of NucT expression. In contrast, this study identified a

100

A0 10-1 10-2 10-3 10-4

B

MG1363

MG1363[lss]

lom[lss]

murA2[lss]

trmA[lss]

MG1363[lss]

murA2[lss]

trmA[lss]

C

dilutions of cultures

MG1363

MG1363

0.25mg lysozyme mL-1

at 30C

0.25mg lysozyme mL-1

at 37C

A0 10-1 10-2 10-3 10-4

B

MG1363

MG1363[lss]

lom[lss]

murA2[lss]

trmA[lss]

MG1363[lss]

murA2[lss]

trmA[lss]

C

dilutions of cultures

MG1363

MG1363

A0 10-1 10-2 10-3 10-4

B

MG1363

MG1363[lss]

lom[lss]

murA2[lss]

trmA[lss]

MG1363[lss]

murA2[lss]

trmA[lss]

C

dilutions of cultures

MG1363

MG1363

0.25mg lysozyme mL-1

at 30C

0.25mg lysozyme mL-1

at 37C

Figure 4.11. Dilutions of cultures incubated for 18 h spotted onto GM17 agar

with various concentrations of lysozyme.

All strains showed identical growth on GM17 agar plates without lysozyme at

30°C and 37°C. Therefore, only the growth of MG1363 is shown. (A) 0mg

lysozyme mL-1 at 30°C, (B) 0.25mg lysozyme mL-1 at 30°C, (C) 0.25mg

lysozyme mL-1 at 37°C. The trmA[lss] mutant strain is more resistant to

lysozyme hydrolysis than the control strain, MG1363[lss].

single mutant in which the transposon had inserted into the lysostaphin

expression cassette. The other ten mutants were all confirmed to secrete higher

level of lysostaphin than the control, MG1363[lss] (Table 4.2). Examination of

the L. lactis MG1363 genome showed that it is possible that the llmg_0609,

murA2, and llmg_2148 gene could be part of different operons. Downstream

genes predicted to be located in these operons by at least one of two

computational prediction programs (section 4.2.5) are described in Table 4.2.

Transcript analysis by Dupont et al. (2004) has shown that, due to the presence

of a promoter in the ISS1 element, ISS1 (and pGhost9:ISS1) insertion does not

lead to polar effects on downstream genes. Such effects are observed, however,

101

when the ISS1 sequence, which encodes a putative transposase, is orientated in

the same direction as the interrupted genes. In this study, the ISS1 elements

were orientated in the same direction as the interrupted genes in two llmg_0609

mutants (2190 and 24185) and two murA2 mutants (18662 and 31397). In these

mutants, it would be expected that the genes downstream would be transcribed

and that the phenotypes observed would not be due to polar effects. In the

llmg_2148 mutant, the ISS1 element is in the opposite orientation to the

interrupted gene and therefore may affect the transcription of the downstream

fmt gene (Table 4.2). It should also be noted that the ISS1 element in mutant

16270 has inserted 34bp upstream of the trmA gene and in the opposite direction

and is therefore expected to prevent its transcription.

This study then focused on the further characterisation of the lom, murA2, and

trmA mutants, as lom and murA2 had several independent insertional mutants

and the inactivation of trmA had been identified in other random mutagenesis

studies (Duwat et al., 1999; Frees et al., 2001; Turner et al., 2007a).

Three mutants had independent insertions in a gene encoding an uncharacterized

putative transmembrane protein (llmg_0609). This gene is annotated in

Genbank as pabC, and putatively encodes for an enzyme which functions as an

ADC lyase. In other bacterial systems, ADC lyase catalyses the third step in the

biosynthesis of para-aminobenzoate acid (pABA) and exists as part of an operon

with pabA and pabB. A recent study has proposed that the true L. lactis pabC is

fused to pabB (Wegkemp et al., 2007). Therefore, to avoid confusion,

llmg_0609 is herein referred to as lom, a gene of unknown function. Analyses

of the Lom protein sequence by three independent computer programs predicted

a single transmembrane helix spanning amino acids 177 to 195 which is located

in the central region of the protein (Figure 4.6A). This is further evidence that

lom has no similarities to the cytosolic PabC, and that its role in lysostaphin

secretion may be as a transmembrane protein. Therefore, the protein Lom is

likely to be localised in the membrane.

Five mutants had independent insertions in the murA2 gene, which encodes for

a putative UDP-N-acetylglucosamine enopyruvyl transferase (MurA). This

102

enzyme catalyses the first step in the peptidoglycan biosynthesis pathway

(Marquardt et al., 1992). As with other low-G+C Gram-positive bacteria (Du et

al., 2000), L. lactis has two MurA enzymes (MurA1 and MurA2) (Wegmann et

al., 2007). Despite the designation, MurA2 showed greater homologies to B.

subtilis MurAA (61%) and S. pneumoniae MurA1 (70%). Additionally, all

three are more similar to the MurA in E. coli and other bacteria with just one

MurA enzyme, than are the other MurA paralogues in the Gram-positive species

(Figure 4.7). The simplest explanation for this is that the L. lactis MurA2, B.

subtilis MurAA, and S. pneumoniae MurA1 are orthologues of E. coli MurA

and may represent the primary MurA. Previous studies have identified MurA2

proteins in the cytoplasm of wild-type L. lactis subsp. lactis IL1403 (Guillot et

al., 2003), and in particular, up-regulated in response to acid stress in two L.

lactis MG1363 mutants (Budin-Verneuil et al., 2007). Lysostaphin over-

production at high temperature in the murA2 mutants is most likely due to cell

wall modifications. Du et al. (2000) demonstrated that MurA1 and MurA2 were

both enzymatically functional and could substitute for each other in S.

pneumoniae. In contrast, MurAB could not substitute for MurAA in B. subtilis

(Kock et al., 2004). As the lysostaphin-secreting mutants did not have any

growth defects, it is likely that the murA1 paralogue is able to substitute

functionally at 30C, but not completely at 37C. Mutations in murA2 did not

have any obvious affect on the morphology or the thickness of the cell walls

(Figures 4.8 and 4.9).

One mutant contained an insertion upstream of the trmA gene. It is interesting

to note that two previous studies using pGhost9:ISS1 random mutagenesis in L.

lactis also identified insertional mutants upstream of trmA, strongly indicating

that this gene may not contain any ISS1-specific recognition sites (Duwat et al.,

1999; Frees et al., 2001; Turner et al., 2007a). The inactivation of this gene has

been reported to confer various stress-resistant phenotypes. Various random

mutagenesis studies identified trmA mutants as able to relieve temperature

sensitivity in recA (Duwat et al., 1999) and clpP (Frees et al., 2001) mutant

strains, and conferred resistance to tellurite and oxidative stress in the wild-type

strain (Turner et al., 2007a). In addition, a trmA mutant has increased resistance

103

against the hydrolytic activity of lysozyme in the wild-type strain, due to

regulation of genes involved in the modification of cell wall acetylation (Veiga

et al., 2007). Veiga et al. (2007) hypothesised that TrmA competes with SpxB,

one of its paralogues, for the binding of RpoA, the α-subunit of RNA

polymerase. The inactivation of trmA may allow SpxB to access RpoA, and this

interaction activates the expression of oatA, encoding the lactococcal

peptidoglycan O-acetylase, thus modifying the cell wall to become lysozyme

resistant (Veiga et al., 2007). In this study, it was observed that the wild-type

strain expressing lysostaphin (MG1363[lss]) was more sensitive to lysozyme

compared with the non-lysostaphin secreting wild-type, MG1363 (Figure

4.12B). This result suggests that lysostaphin may be attacking lactococcal

peptidoglycan during its passage through the cell wall, thereby making it weaker

and more susceptible to lysozyme. According to Veiga et al., (2007) the

resultant interactions within a trmA mutant give rise to changes in acetylation

and thickness of peptidoglycan, thereby making it more resistant to lysozyme

hydrolysis. As such, the trmA mutant may also be more resistant to the non-

specific degradation caused during the secretion of lysostaphin and as a result

may be able to tolerate higher levels of secretion of the damaging lysostaphin.

Four genes capable of affecting the secretion of lysostaphin in L. lactis were

identified. These genes are different from those previously identified in the

NucT study (Nouaille et al., 2004), suggesting that lactococcal host factors that

affect the secretion of heterologous proteins differ depending on the protein of

interest. Whilst the mechanisms remain speculative, the inactivation of these

four genes led to increased amounts of lysostaphin secreted without any obvious

detrimental effects to the host cell morphology and growth rate. This study also

described the construction of novel L. lactis strains that are able to secrete two

kinds of peptidoglycan hydrolases, lysostaphin and Ply511. The identification

of these L. lactis strains with the capacity to over-secrete two heterologous

proteins of therapeutic interest enhances the consideration of L. lactis as an

antimicrobial agent. The results of this study also provide new insights into

lactococcal factors which are important for the secretion efficiency of

heterologous proteins, which may have applications in the food and

pharmaceutical industries.

104

105

CHAPTER 5

GENERAL DISCUSSION

106

LAB are a group of Gram-positive, non-sporulating bacteria that include the

genera Lactobacillus, Leuconostoc, Pediococcus, Streptococcus, and

Lactococcus. For thousands of years, certain LAB have been used in food- and

feed-fermentation processes, and they are also important members of the human

endogenous microflora that are associated with different mucosal surfaces of the

body. Therefore, LAB have had a long and safe association with humans and

their food. In the past 20 years, there has been increasing interest in the use of

LAB as protein delivery vehicles and for the production of heterologous

proteins of therapeutic interest. Of specific interest to this project is L. lactis, a

widely used bacterium in the food industry. The strain used in this study, the

plasmid-free L. lactis subsp. cremoris MG1363, is extensively used as a model

strain in LAB genetics and molecular biology research, and the knowledge

gained from fundamental research on this strain has been exploited for a wide

variety of biotechnological applications. The importance of developments for

biotechnology and microbiology research is enormous, as many molecular tools

initially developed for the model L. lactis, such as genetic manipulations and

heterologous protein expression, have also been shown to be useful in other

LAB (Maguin et al., 1996, Kleerebezem et al., 1997, Turner et al., 2004a).

The aim of this thesis was to develop L. lactis as an antimicrobial agent. To

achieve this purpose, two aims were developed: (i) the engineering of two

recombinant proteins as a fusion and the investigation of the ability of this

chimeric protein to inhibit the interaction of S. aureus with host ECM proteins,

(ii) and the identification of L. lactis factors which increased the secretion of

recombinant lysostaphin.

In the investigation of the first aim, L. lactis strains were constructed that

expressed and secreted two proteins of interest (CyuC and lysostaphin)

separately and as a single fusion protein using the Sep expression system. CyuC

was hypothesised to have binding activities to ECM proteins and thus might be

able to competitively inhibit the adherence of S. aureus to ECM proteins. It was

also hypothesised that the combination of CyuC and lysostaphin as a single

fusion protein (CyuC-Lss) would increase the inhibition effect due to its dual

functionality. This concept of fusion proteins is not unique. Previously,

107

lysostaphin has been fused to the S. agalactiae bacteriophage endolysin B30 and

expressed in E. coli (Donovan et al., 2006). The fusion protein was shown to

have S. aureus and Sp. agalactiae lytic activities, suggesting that lysostaphin

can tolerate the addition of extra protein sequences on the N-terminus. In this

study, it was found that the CyuC and lysostaphin were both active as part of a

fusion protein. Crude cell extracts of the L. lactis strain with the pGhost9:ISS1

vector only was able to significantly inhibit S. aureus adherence to fibronectin,

whilst the L. lactis strain secreting lysostaphin was able to inhibit adherence to

keratin. Future research may be able to identify lactococcal protein(s) with

fibronectin binding activities. This may be achieved by western ligand blotting

of proteins which have been separated by 2D SDS-PAGE, and to identify the

dominant proteins by N-terminal sequencing. Other avenues for future research

may be to further investigate the mechanism by which the L. lactis secreting

lysostaphin strain is able to inhibit S. aureus adhesion to keratin. A

lactococcal intermediary protein between lysostaphin and keratin may be

identified by use of, for example, Biacore’s Flexchip technology (Biacore Life

Sciences) to screen for lactococcal proteins which exhibit binding affinities to

both lysostaphin and keratin.

The results of the first aim demonstrated the utility of L. lactis to express and

secrete heterologous lysostaphin. However, the levels of recombinant proteins

produced by L. lactis and other LAB are generally low when compared with that

produced by E. coli (Jana and Deb, 2005) and B. subtilis expression hosts

(Schallmey et al., 2004). Levels are also very much dependent upon the

expression system used and the heterologous protein of interest. Heterologous

protein production in E. coli is often intracellular and involves expensive and

problematic downstream purification processes to remove endotoxin or

lipopolysaccharide. Although B. subtilis is endotoxin free, heterologous

proteins are degraded by its complex extracellular proteolytic system (Westers

et al., 2004). In comparison, L. lactis is considered a desirable alternative for

heterologous protein production, and as such, attention in recent times has been

turned toward the modification of L. lactis to improve the export of recombinant

proteins. Examples of this can be found in the inactivation of htrA and clpP to

improve the secretion of NucT (see section 1.1.2), and the Nouaille et al. (2004)

108

study, which identified thirteen lactococcal genes which either increased or

decreased NucT secretion when inactivated (see section 4.1). The study in

chapter 4 identified four genes (lom, murA2, trmA, and llmg_2148) that were

different from the Nouaille et al. (2004) study. When these genes were

inactivated, the resultant mutants produced increased amounts of lysostaphin

protein and the L. monocytogenes bacteriphage endolysin, Ply511. This

discovery clearly demonstrated that the factors involved in the secretion of

recombinant proteins in L. lactis is very much dependent on the recombinant

protein of interest and may also relate to the expression and/or secretion system

used. It may also raise doubts regarding previous studies which investigated the

optimisation of protein secretion using only a single reporter protein, such as

NucT (e.g. Dieye et al., 2001; Ravn et al., 2003), and did not verify the efficacy

of the secretion system with a different recombinant protein. Of the four genes

identified, perhaps the most interesting is lom, both from the genetic and

biotechnological points of view. Its inactivation resulted in the greatest increase

in the amount of lysostaphin secreted compared with the other mutants, yet its

function remains unknown. In silico analyses revealed that the Lom protein has

similarities to other uncharacterised proteins with predicted solute-binding

functions, and that it has a single transmembrane helix predicted to lie in the

central region. Based on these in silico analyses, it is hypothesised that Lom

may function as part of a multi-component pore-forming complex, and may

therefore directly affect the secretion of lysostaphin out of the cell. Another

hypothesis is that Lom may act as a signalling protein similar to anti-sigma

factors, which also have one transmembrane spanning domain, and which

respond to a signal and accordingly modify protein export patterns or

proteolysis (Yoshimura et al., 2004). Whilst these are purely speculative, to

functionally characterise Lom may prove more challenging. A starting point

may be to assess the downstream effect of a L. lactis lom mutation by analysing

gene expression levels by microarray or protein expression levels by 2D SDS-

PAGE. From the perspective of developing L. lactis as an antimicrobial agent,

the inactivation of lom has generated a L. lactis strain capable of increased

lysostaphin production without detriment to cellular growth. A previous study

was able to produce lysostaphin using the NICE system intracellularly in L.

lactis (Mierau et al., 2005a). The advantage conferred by the Sep expression

109

system is that the production of lysostaphin is constitutive, whereas in the NICE

system, the induction of lysostaphin production has to be made at the

appropriate growth phase, and the growth of the culture is limited upon

induction (Mierau et al., 2005a). Unlike, the NICE system, the Sep expression

system (which includes a secretion signal) allows for lysostaphin to be readily

exported into the supertatant. Although the amounts of recombinant proteins

produced is low, the Sep expression system has been a consistent performer in

expressing functional recombinant proteins in LAB (Turner et al., 2004a;

2007b; Liu et al., 2007).

This body of research has advanced the knowledge base of L. lactis genetics and

its biotechnological applications. Of particular significance are the observations

that wild-type L. lactis can inhibit S. aureus adhesion to fibronectin, and

similarly, that extracts from a lysostaphin-secreting strain can inhibit S. aureus

adhesion to keratin. In addition, novel L. lactis strains were identified which

have increased production of lysostaphin, and also able to secrete more of a

secondary cell wall lytic enzyme. These results may be applied to the further

development of L. lactis as an antimicrobial agent, and to the development of

heterologous protein production in lactic acid bacteria.

110

111

CHAPTER 6

REFERENCES

112

Allison, G.E., Ahn, C., Stiles, M. E., Klaenhammer, T. R. (1995) Utilisation of the leucocin A export system in Leuconostoc gelidum for production of a Lactobacillus bacteriocin. FEMS Microbiol. Lett. 131: 87-93.

Altermann, E., Russell, W. M., Azcarate-Peril, M. A., Barrangou, R., Buck, B. L., McAuliffe, O., Souther, N, Dobson, A., Duong, T., Callanan, M., Lick, S., Hamrick, A., Cano, R., Klaenhammer, T. R. (2005) Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus NCFM. Proc. Natl. Acad. Sc. U. S. A. 102: 3906-3912.

Alvarez-Olmos, M.I., Oberhelman, R. A. (2001) Probiotic agents and infectious diseases: A modern perspective on a traditional therapy. Clin. Infect. Dis. 32: 1567-1576.

Anderssen, E.L., Diep, D. B., Nes, I. F., Eijsink, V. G., Nissen-Meyer, J. (1998) Antagonistic activity of Lactobacillus plantarum C11: two new two-peptide bacteriocins, plantaricins EF and JK, and the induction factor plantaricin A. Appl. Environ. Microbiol. 64: 2269-2272.

Antikainen, J., Anton, L., Sillanpaa, J., Korhonen, T. K. (2002) Domains in the S-layer protein CbsA of Lactobacillus crispatus involved in adherence fo collagens, laminin and lipoteichoic acids and in self-assembly. Mol. Microbiol. 46: 381-394.

Arvola, T., Laiho, K., Torkkeli, S., Mykkanen, H., Salminen, S., Maunula, L., Isolauri, E., (1999) Prophylatic Lactobacillus GG reduces antibiotic-associated diarrhea in children with respiratory infections: a randomised study. Pediatrics. 104: http://www.pediatrics.org/cgi/content/full/104/105/e164.

Asheshov, E.A., Jevons, M. P. (1963) The effect of heat on the ability of a host strain to support the growth of a Staphylococcus phage. J. Gen. Microbiol. 31: 97-107.

Avall-Jaaskelainen, S., Lindholm, A., Palva, A (2003) Surface display of the receptor-binding region of the Lactobacillus brevis S-Layer protein in Lactococcus lactis provides nonadhesive lactococci with the ability to adhere to intestinal epithelial cells. Appl. Environ. Microbiol. 69: 2230-2236.

Axelsson, L., Katla, T., Bjornslett, M., Eijinsk, V. G. H., Holck, A. (1998) A system for heterologous expression of bacteriocins in Lactobacillus sake. FEMS Microbiol. Lett. 168: 137-143.

Aymerich, T., Holo, H., Havarstein, L. S., Hugas, M., Garriga, M., Nes, I. F. (1996) Biochemical and genetic characterisation of enterocin A from Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of bacteriocins. . Appl. Environ. Microbiol. 62: 1676-1682.

Baba, T., Schneewind, O. (1996) Target cell specificity of a bacteriocin molecule: a C-terminal signal directs lysostaphin to the cell wall of Staphylococcus aureus. EMBO J. 18: 4789-4797.

Baba, T., Schneewind, O. (1998) Targeting of muralytic enzymes to the cell division site of Gram-positive bacteria: repeat domains direct autolysin to the equatorial surface ring of Staphylococcus aureus. . EMBO J. 17: 4639-4646.

Balla, E., Dicks, L. M., Du Toit, M., Van Der Merwe, M. J., Holzapfel, W. H. (2000) Characterisation and cloning of the genes encoding enterocin 1071A and enterocin 1071B, two antimicrobial peptides produced by

113

Enterococcus faecalis BFE1071. . Appl. Environ. Microbiol. 66: 1298-1304.

Bannantyne, R.M., Randal, C. (1977) Ecology of 350 isolates of the group F streptococcus. Am. J. Clin. Pathol. 67: 184-186.

Barriere, C., Veiga-da-Cunha, M., Pons, N., Guedon, E., van Hijum, S. A. F. T., Kok, J., Kuipers, O. P., Ehrlich, D. S., Renault, P. (2005) Fructose utilisation in Lactococcus lactis as a model for low-GC Gram-positive bacteria: its regulator, signal and DNA-binding site. J. Bacteriol. 187: 3752-3761.

Barthelson, R., Mobasseri, A., Zopf, D., Simon, P. (1998) Adherence of Streptococcus pneumoniae to respiratory epithetial cells is inhibited by sialylated oligosaccharides. Infect. Immun. 66: 1439-1444.

Bateman, A., Bycroft, M. (2000) The structure of a LysM domain from Escherichia coli membrane-bound lytic murein transglycosylase D (MltD). J. Mol. Biol. 4: 1113-1119.

Bennick, M.H., Vanloo, B., Brasseur, R., Gorris, L. G., Smid, E. J. (1998) A novel bacteriocin with a YGNGV motif from vegetable-associated Enterococcus mundtii: full characterisation and interaction with target organisms. Biochim. Biophys. Acta. 1373: 47-58.

Berlec, A., Tompa, G., Slapar, N., Fonovic, U. P., Rogelj, I., Strukelj, B. (2008) Optimisation of fermentation conditions for the expression of sweet-tasting protein brazzein in Lactococcus lactis. Lett. Appl. Microbiol. 46: 227-231.

Bermudez-Humaran, L.G., Langella, P., Miyoshi, A., Gruss, A., Guerra, R. T., Montes de Oca-Luna, R., Le Loir, Y. (2002) Production of human papillomavirus type 16 E7 protein in Lactococcus lactis. Appl. Environ. Microbiol. 68: 917-922.

Bermudez-Humaran, L.G., Langella, P., Cortes-Perez, N., Gruss, A., Tamez-Guerra, R. S., Oliveira, S. C., Montes de Oca-Luna, R., Le Loir, Y. (2003) Intranasal administration of recombinant Lactococcus lactis secreting murine interleukin-12 enhances antigen-specific Th1 cytokine production. Infect. Immun. 71: 1887-1896.

Bhugaloo-Vial, P., Dousset, X., Metivier, ., Sorokine, O., Anglade, P., Boyaval, P., Marion, D. (1996) Purification and amino acid sequences of piscicocins V1a and V1b, two class IIa bacteriocins secreted by Carnobacterium piscicola V1 that display significantly different levels of specific inhibitory activity. Appl. Environ. Microbiol. 62: 4410-4416.

Bhunia, A.K., Johnson, M. C., Ray, B. (1988) Purification, characterisation and antimicrobial spectrum of a bacteriocin produced by Pediococcus acidilactici. J. Appl. Bacteriol. 65: 261-268.

Bierbaum, G., Reis, M., Szekat, C., Sahl, H. G. (1994) Construction of an expression system for mutagenesis of the lantibiotic Pep5. Appl. Environ. Microbiol. 60: 2876-2883.

Biet, F., Berjeaud, J. M., Worobo, R. W., Cenatempo, Y., Fremaux, C. (1998) Heterologous expression of the bacterium mesentericin Y105 using the dedicated transport system and the general secretion pathway. Micrbiology. 144: 2845-2854.

Biller, J.A., Katz, A. J., Flores, A. F., Buie, T. M., Gorbach, S. L. (1995) Treatment of recurrent Clostridium difficile colitis with Lactobacillus GG. J. Pediatr. Gastroenterol. Nutr. 21: 224-226.

114

Blobel, G. (1980) Intracellular protein topogenesis. Proc. Natl. Acad. Sc. U. S. A. 77: 1496-1500.

Boel, G., Jin, H., Pancholi, V. (2005) Inhibition of cell surface export of group A streptococci anchorless surface dehydrogenase affects bacterial adherence and antiphagocytic properties. Infect. Immun. 73: 6237-6248.

Bolotin, A., Wincker, P., Mauger, S., Jaillon, O., Malarme, K., Weissenbach, J., Ehrlich, S. D., Sorokin, A. (2001) The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 11: 731-753.

Bolotin, A., Quinquis, B., Renault, P., Sorokin, A., Ehrlich, S. D., Kulakauskas, S., Lapidus, A., Goltsman, E., Mazur, M., Pusch, G. D., Fonstein, M., Overbeek, R., Kyprides, N., Purnelle, B., Prozzi, D., Ngui, K., Masuy, D., Hancy, F., Burteau, S., Boutry, M., Delcour, J., Goffeau, A., Hols, P. (2004) Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus. Nat. Biotechnol. 22: 1523-1524.

Boot, H.J., Kolen, C. P., van Noort, J. M., Pouwels, P. H. (1993) S-layer protein of Lactobacillus acidophilus ATCC 4356: purification, expression in Escherichia coli, and nucleotide sequence of the corresponding gene. J. Bacteriol. 174: 6089-6096.

Boot, H.J., Kolen, C. P., Pouwels, P. H. (1995) Identification, cloning, and nucleotide sequence of a silent S-layer protein gene of Lactobacillus acidophilus ATCC 4356 which as extensive similarity with the S-layer protein gene of this species. J. Bacteriol. 177: 7222-7230.

Booth, V., Ashley, F. P., Lehner, T. (1996) Passive immunisation with monoclonal antibodies against Porphyromonas gingivalis in patients with periodontitis. Infect. Immun. 64: 422-427.

Boucher, H.W., Corey, G. R. (2008) Epidemiology of methicillin-resistant Staphylococcus aureus. Clin. Infect. Dis. 46: S344-349.

Braun, L., Dramsi, S., Dehoux, P., Bierne, H., Lindahl, G., Cossart, P. (1997) InIB: an invasion protein of Listeria monocytogenes with a novel type of surface association. Mol. Microbiol. 25: 285-294.

Brechtel, E., Bahl, H. (1999) Thermoanaerobacterium thermosulfurigenes EM1 S-layer homology domains do not attach to peptidoglycan. J. Bacteriol. 181: 5017-5023.

Brinster, S., Furlan, S., Serror, P. (2007) C-terminal WxL domain mediates cell wall binding in Enterococcus faecalis and other Gram-positive bacteria. J. Bacteriol. 189: 1244-1253.

Budin-Verneuil, A., Pichereau, V., Auffray, Y., Ehrlich, D., Maguin, E. (2007) Proteome phenotyping of acid stress-resistant mutants of Lactococcus lactis MG1363. Proteomics. 7: 2038-2046.

Buist, G., Kok, J., Leenhouts, K. J., Dabrowski, M., venema, G., Haandrikman, A. J. (1995) Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus latis, a muramidase needed for cell separation. J. Bacteriol. 177: 1554-1563.

Buist, G., Steen, A., Kok, J., Kuipers, O. (2008) LysM, a widely distributed protein motif for binding to (peptido)glycans. Mol. Microbiol. 68: 838-847.

115

Burton, J.P., Wescombe, P. A., Moore, C. J., Chilcott, C. N., Tagg, J. R. (2006) Safety assessment of the oral cavity probiotic Streptococcus salivarius K12. Appl. Environ. Microbiol. 72: 3050-3053.

C.D.C. (2002) Staphylococcus aureus resistant to vancomycin - United States, 2002. Morb. Mortal. Wkly. Rep. 51: 565-567.

Callegari, M.L., Riboli, B., Sanders, J. W., Cocconcelli, P. S., Kok, J., Venema, G., Morelli, L. (1998) The S-layer gene of Lactobacillus helveticus CNRZ 892: cloning, sequence and heterologous expression. Microbiology. 144: 719-726.

Campbell, L.L.J., Sniff, E. E. (1959) Effect of subtilin and nisin on the spores of Bacillus coagulans. J. Bacteriol. 77: 766-770.

Campo, N., Tjalsma, H., Buist, G., Stepniak, D., Meijer, M., Veenhuis, M., Westermann, M., Muller, J. P., Bron, S., Kok, J., Kuipers, O. P., Jongbloed, J. D. H. (2004) Subcellular sites for bacterial protein export. Mol. Microbiol. 53: 1583-1599.

Carroll, S.A., Hain, T., Technow, U., Darji, A., Pashalidis, P., Joseph, S. W., Chakraborty, T. (2003) Identification and characterisation of a peptidoglycan hydrolase MurA, of Listeria monocytogenes, a muramidase needed for cell separaction. J. Bacteriol. 185: 6801-6808.

Cavadini, C., Hertel, C., Hammes, W. P. (1998) Application of lysostaphin-producing lactobacilli to control staphylococcal food poisoning in meat products. J. Food. Prot. 61: 419-424.

Chaillou, S., Champomier-Vergès, M. C., Cornet, M., Crutz-Le Coq. A. M., Dudez, A. M., Martin, V., Beaufils, S., Darbon-Rongère, E., Bossy, R., Loux, V., Zagorec, M. (2005) The complete genome sequence of the meat-borne lactic acid bacterium Lactobacillus sakei 23K. Nat. Biotechnol. 23: 1494-1495.

Chancey, C.J., Khanna, K. V., Seegers, J. F., Zhang, G. W., Hildreth, J., Langan, A., Markham, R. B. (2006) Lactobacilli-expressed single-chain variable fragment (scFv) specific for intercellular adhesion molecule 1 (ICAM-1) blocks cell-associated HIV-1 transmission across a cervical epithelial monolayer. J. Immunol. 176: 5627-5636.

Chastre, J. (2008) Evolving problems with resistant pathogens. Clin. Microbiol. Infect. 14: S3-14.

Chikindas, M.L., Venema, K., Ledeboer, A. M., Venema, G., Kok, J. (1995) Expression of lactococcin A and pediocin PA-1 in heterologous hosts. Lett. Appl. Microbiol. 21: 183-189.

Cintas, L.M., Casaus, P., Havarstein, L. S., Hernandez, P. E., Nes, I. F. (1997) Biochemical and genetic characterisation of enterocin P, a novel sec-depending bacteriocin from Enterococcus faecium P13 with a broad antibacterial spectrum. Appl. Environ. Microbiol. 63: 4321-4330.

Claesson, M.J., Li, Y., Leahy, S., Canchaya, C., van Pijkeren, J. P., Cerdeño-Tárraga, A. M., Parkhill, J., Flynn, S., O'Sullivan, G. C., Collins, J. K., Higgins, D., Shanahan, F., Fitzgerald, G. F., van Sinderen, D., O'Toole, P. W. (2006) Multireplicon genome architecture of Lactobacillus salivarius. Proc. Natl. Acad. Sc. U. S. A. 103: 6718-6723.

Clarke, J.K. (1924) On the bacterial factor in the aetiology of dental caries. Brit. J. Exp. Pathol. 5: 141-147.

Climo, M.W., Patron, R. L., Goldstein, B. P., Archer, G. L. (1998) Lysostaphin treatment of experimental methicillin-resistant Staphylococcus aureus

116

aortic valve endocarditis. Antimicrob. Agents Chemother. 42: 1355-1360.

Climo, M.W., Ehlert, K., Archer, G. (2001) Mechanism and suppression of lysostaphin resistance in oxacillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45: 1431-1437.

Coderre, P.E., Somkuti, G. A. (1999) Cloning and expression of the pediocin operon in Streptococcus thermophilus and other lactic acid fermentation bacteria. Curr. Microbiol. 39: 295-301.

Collins, M.D., Rodrigues, U. M., Ash, C., Aguirre, M., Farrow, J. A. E., Martinez-Murica, A., Phillips Bam Williams, A. M., Walbanks, S. (1991) Phylogenetic analysis of the genes Lactobacillus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiol. Lett. 77: 5-12.

Cortes-Perez, N.G., Poquet, I., Oliveira, M., Gratadoux, J. J., Madsen, S. M., Miyoshi, A., Corthier, G., Azevedo, V., Langella, P., Bermudez-Humaran, L. G. (2006) Construction and characterisation of a Lactococcus lactis strain deficient in intracellular ClpP and extracellular HtrA proteases. Microbioloy. 152: 2611-2618.

Cue, D., Lam, H., Cleary, P. P. (2001) Genetic dissection of the Streptococcus pyogenes M1 protein: regions involved in fibronectin binding and intracellular invasion. Microb. Pathog. 31: 231-242.

Dajcs, J.J., Hume, E. B., Moreau, J. M., Caballero, A. R., Cannon, B. M., O'Callaghan, R. J. (2000) Lysostaphin treatment of methicillin-resistant Staphylococcus aureus keratitis in the rabbit. Invest. Ophthalmol. Vis. Sci. 41: 1432-1437.

Dajcs, J.J., Thibodeaux, B. A., Hume, E. B., Zheng, X., Sloop, G. D., O'Callaghan, R. J. (2001) Lysostaphin is effective in treating methicillin-resistant Staphylococcus aureus endophthalmitis in the rabbit. Curr. Eye. Res. 22: 451-457.

Dalbey, R.E., Lively, M. O., Bron, S., van Dijl, J. M. (1997) The chemistry and enzymology of the type I signal peptidases. Protein Sci. 6: 1129-1138.

de Gier, J.W., Valent, Q. A., Von Heijne, G., Luirink, J. (1997) The E. coli SRP: preferences of a targeting factor. FEBS Lett. 408: 1-4.

de Hart, H.P., Heath, H. E., Heath, L. S., LeBlanc, P., Sloan, G. L. (1995) The lysostaphin endopeptidase resistance gene (epr) specifies modification of peptidoglycan cross bridges in Staphylococcus simulans and Staphylococcus aureus. Appl. Environ. Microbiol. 61: 1475-1479.

de Rutyer, P.G., Kuipers, O. P., de Vos, W. M. (1996) Controlled gene expression systems for Lactococcus lactis with the food-grade inducter nisin. Appl. Environ. Microbiol. 62: 3662-3667.

de Vos, W.M., Mulders, J. W., Siezen, R. J., Hugenholtz, J., Kuipers, O. P. (1993) Properties of nisin Z and distribution of its gene, nisZ, in Lactococcus lactis. Appl. Environ. Microbiol. 59: 213-218.

de Vrese, M., Schrezenmeir, J. (2008) Probiotics, Prebiotics, and Synbiotics. Adv. Biochem. Eng. Biotechnol. 111: 1-66.

Deutsch, S.M., Guezenec, S., Poit, M., Foster, S., Lortal, S. (2004) Mur-LH, the broad-spectrum endolysin of Lactobacillus helveticus temperate bacteriophage phi-0303. Appl. Environ. Microbiol. 70: 96-103.

Dev, I.K., Ray, P. H. (1990) Signal peptidases and signal peptide hydrolases. J. Bioenerg. Biomembr. 22: 271-290.

117

Dieye, Y., Usai, S. Clier, F., Gruss, A., Piard, J. C. (2001) Design of a protein-targeting system for lactic acid bacteria. J. Bacteriol. 183: 4157-4166.

Donovan, D.M., Dong, S., Garrett, W., Rousseau, G. M., Moineau, S., Pritchard, D. G. (2006) Peptidoglycan hydrolase fusions maintain their parental specificities. Appl. Environ. Microbiol. 72: 2988-2996.

Du, W., Brown, J. R., Sylvester, D. R., Huang, J., Chalker, A., F., So, C. Y., Holmes, D. J., Payne, D. J., Wallis, N. G. (2000) Two active forms of UDP-N-acetylglucosamine enolpyruvul transferase in Gram-positive bacteria. J. Bacteriol. 182: 4146-4152.

Dupont, K., Janzen, T., Kvist Vogensen F., Josephsen, J., Stuer-Lauridsen, B. (2004) Identification of Lactococcus lactis genes required for bacteriophage adsorption. Appl. Environ. Microbiol. 70: 5825-5832.

Duwat, P., Cochu, A., Ehrlich, S. D., Gruss A. (1997) Characterisation of Lactococcus lactis UV-sensitive mutants obtained by ISS1 transposition. J. Bacteriol. 179: 4473-4479.

Earnshaw, R.G. (1992) Chapter 9: The Antimicrobial Action of Lactic Acid Bacteria: Natural Food Preservation Systems. In The Lactic Acid Bacteria, Volume 1: The Lactic Acid Bacteia in Health and Diseas. Wood, B.J.B. (ed). London, U. K.: Elsevier Applied Science.

Elmer, G.W., Surawiz, C. M., McFarland, L. V. (1996) Biotherapeutic agents: a neglected modality for the treatment of selected intestinal and vaginal infections. JAMA 275: 870-876.

Emr, S.D., Hedgpeth, J., Clement, J. M., Silhavy, T. J., Hognung, M. (1980) Sequence analysis of mutations that prevent export of lambda receptor, an Escherichia coli outer membrane protein. Nature. 285: 82-85.

Engelhardt, H., Peters, J. (1998) Structural research on surface layers: a focus on stability, surface layer homology domains, and surface layer–cell wall interactions. J. Struct. Biol. 124: 276-302.

Ennahar, S., Sashihara, T., Sonomoto, K., Ishizaki, A. (2000) Class IIa bacteriocins: biosynthesis, structure and activity. FEMS Microbiol. Rev. 24: 85-106.

Enouf, V., Langella, P., Commissaire, J., Cohen, J., Corthier, J. (2001) Bovine rotavirus non-structural protein 4 produced by Lactococcus lactis is antigenic and immunogenic. Appl. Environ. Microbiol. 67: 1423-1428.

Ermolaeva, M.D., White, O., Salzberg, S. L. (2001) Prediction of operons in microbial genomes. Nucleic Acids. Res. 29: 1216-1221.

Fallico, V., McAuliffe, O., Fitzgerald, G. F., Hill, C., Ross, R. P. (2009) The presence of pMRC01 promotes greater cell permeability and autolysis in lactococcal starter cultures. Int. J. Food Microbiol. 133: 217-224.

Farber, J.M., Peterkin, P. I. (1991) Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev. 55: 476-511.

Fierobe, L., Decre, D., Muller, C., Lucet, J.-C., Marmuse, J.-P., Mantz, J., Demonts, J.-M. (1999) Methicillin-resistant Staphylococcus aureus as a causative agent of postoperative intra-abdominal infection: relation to nasal colonization. Clin. Infect. Dis. 29: 1231-1238.

Fischetti, V.A., Pancholi, V., Schneewind, O. (1990) Conservation of a hexapeptide sequence in the anchor region of surface proteins from Gram-positive cocci. Mol. Microbiol. 4: 1603-1605.

Fischetti, V.A., Novick, R. P., Ferretti, J. J., Portnoy, D. A., Rood, J. J. (2000) Gram-positive pathogens. Washington, D. C., U. S. A.: ASM Press.

118

Fontaine, M.C., Perez-Casal, J., Wilson, P. J. (2004) Investigation of a novel DNase of Streptococcus suis serotype 2. Infect. Immun. 72: 774-781.

Foster, T.J., Hook, M. (1998) Surface protein adhesins of Staphylococcus aureus. Trends Microbiol. 6: 484-488.

Frees, D., Varmanen, P., Ingmer, H. (2001) Inactivation of a gene that is highly conserved in Gram-positive bacteria stimulates degradation of non-native proteins and concomitantly increases stress tolerance in Lactococcus lactis. Mol. Microbiol. 41: 93-103.

Fremaux, C., Klaehammer, T. R. (1993) Molecular analysis of the lactacin F operon. Appl. Environ. Microbiol. 59: 3906-3915.

Fremaux, C., Klaehammer, T. R. (1994) Helveticin J, a large heat-labile bacteriocin form Lactobacillus helveticus. In Bacteriocins of Lactic Acid Bacteria: Microbiology, Genetics and Applications. De Vuyst, L., Vandamme, E. J. (ed). London, U. K.: Elsevier.

Fujino, T., Beguin, P., Aubert, J. P. (1993) Organisation of a Clostridium thermocellum gene cluster encoding the cellulosomal scaffolding protein CipA and a protein possibly involved in attachment of the cellulosome to the cell surface. J. Bacteriol. 175: 1891-1899.

Gaeng, S., Scherer, S., Neve, H., Loessner, M. J. (2000) Gene cloning and expression and secretion of Listeria monocytogenes bacteriophage-lytic enzymes in Lactococcus lactis. Appl. Environ. Microbiol. 66: 2951-2958.

Gan, B.S., Kim, J., Reid, G., Cadieux, P., Howard, J. C. (2002) Lactobacillus fermentum RC-14 inhibits Staphylococcus aureus infection of surgical implants in rats. J. Infect. Dis. 185: 1369-1372.

Garault, P., Letort, C., Juillard, V., Monnet, V. (2000) Branched-chain amino acid biosynthesis is essential for optimal growth of Streptococcus thermophilus in milk. Appl. Environ. Microbiol. 66: 5128-5133.

Garcia, J.L., Garcia, E., Arraras, A., Garcia, P., Ronda, C., Lopez, R. (1987) Cloning, purification and biochemical characterisation of the pneumococcal bacteriophage Cp-1 lysin. J. Virol. 61: 2573-2580.

Garcia, P., Garcia, J. L., Garcia, E., Sanchez-Puelles, J. M., Lopez, R. (1990) Modular organisation of the lytic enzymes of Streptococcus pneumoniae and its bacteriophages. Gene. 86: 81-88.

Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154: 1-9.

Germond, J.E., Delley, M., Gilbert, C., Atlan, D. (2003) Determination of the domain of Lactobacillus delbrueckii subsp. Bulgaricus cell surface proteinase PrtB involved in attachment to the cell wall after heterologous expression of the prtB gene in Lactococcus lactis. Appl. Environ. Microbiol. 69: 337-3384.

Giffard, P.M., Jacques, N. A. (1994) Definition of a fundamental repeating unit in streptococcal glucosyltransferase glucan-binding regions and related sequences. J. Dent. Res. 73: 1133-1141.

Goebel, W., Chakraborty, T., Domann, E., Kohler, S., Kuhn, M., Leimeister-Wachter, M., Sokolovic, Z., Wuenscher, M. (1991) Studies on the pathogenicity of Listeria monocytogenes. Infection. 19: S195-197.

Gorbach, S.L., Chang, T., Goldin, B. (1978) Successful treatment of relapsing Clostridium difficile colitis with Lactobacillus GG. Lancet. 2: 1519.

119

Gosselink, M.P., Shouten, W. R., van Lieshout, L. M., Hop, W. C., Laman, J. D., Ruseler-van Embden, J. G. (2004) Delay the first onset of pouchitis by oral intake of the probiotic strain Lactobacillus rhamnosus GG. Dis. Colon Rectum 47: 876-884.

Gossling, J. (1988) Occurrence and pathogenicity of Streptococcus milleri group. Rev. Infect. Dis. 10: 257-285.

Green, J.M., Merkel, W. K., Nichols, B. P. (1992) Characterisation and sequence of Escherichia coli pabC, the gene encoding aminodeoxychorismate lyase, a pyridoxal phosphate-containing enzyme. J. Bacteriol. 174: 5317-5323.

Gross, E., Morell, J. L. (1971) The structure of nisin. J. Am. Chem. Soc. 93: 4634-4635.

Grundman, H., Aires-de-Sousa, M., Boyce, J., Tiemersma, E. (2006) Emergence and resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat. Lancet. 368: 874-885.

Guillot, A., Gitton, C., Anglade, P., Mistou, M. Y. (2003) Proteomic analysis of Lactococcus lactis, a lactic acid bacterium. Proteomics. 3: 337-354.

Gury, J., Barthelmebs, L., Cavin, J. F. (2004) Random transposon mutagenesis of Lactobacillus plantarum using the pGh9:ISS1 vector to clone genes involved in the regulation of phenolic acid metabolism. Arch. Microbiol. 182: 337-345.

Haandrikman, A.J., Kok, J., Venema, G. (1991) Lactococcal proteinase maturation protein PrtM is a lipoprotein. J. Bacteriol. 173: 4517-4525.

Hardie, J.M., Whiley, R. A. (1995) Chapter 4: The genus Streptococcus. In The Lactic Acid Bacteria, Volume 1: The Lactic Acid Bacteria in Health and Disease. Wood, B.J.B. (ed). London, U. K.: Elsevier Applied Science.

Hastings, J.W., Sailer, M., Johnson, K., Roy, K. L., Vederas, J. C., Stiles, M. E. (1991) Characterisation of leucocin A-UAL 187 and cloning of the bacteriocin gene from Leuconostoc gelidum. J. Bacteriol. 173: 7491-7500.

Havenaar, R., Huis In't Veld, J. H. J. (1992) Chapter 6: Probiotics: A General View. In The Lactic Acid Bacteria, Volume 1: The Lactic Acid Bacteria in Health and Disease. Wood, B.J.B. (ed). London, U. K.: Elsevier Applied Science.

Hayanashi, S., Wu, H. C. (1990) Lipoproteins in bacteria. J. Bioenerg. Biomembr. 22: 451-471.

Hayashi, T., Makino, K., Ohnishi, M., Kurokawa, K., Ishii, K., Yokoyama, K., Han, C. G., Ohtsubo, E., Nakayama, K., Murata, T., Tanaka, M., Tobe, T., Iida, T., Takami, H., Honda, T., Sasakawa, C., Ogasawara, N., Yasunaga, T., Kuhara, S., Shiba, T., Hattori, M., Shinagawa, H. (2001) Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8: 11-22.

Hechard, Y., Derijard, B., Letellier, F., Cenatiempo, Y. (1992) Characterisation and purification of mesentericin Y105, an anti-Listeria bacteriocin from Leuconostoc mesenteroides. J. Gen. Microbiol. 138: 2725-2731.

Hechard, Y., Sahl, H. G. (2002) Mode of action of modified and unmodified bacteriocins from Gram-positive bacteria. Biochimie. 84: 545-557.

Heidrich, C., Pag, U., Josten, M., Metzger, J., Jack, R. W., Bierbaum, G., Jung, G., Sahl, H. G. (1998) Isolation, characterisation, and heterologous

120

expression of the novel lantibiotic epicidin 280 and analysis of its biosynthetic gene cluster. Appl. Environ. Microbiol. 64: 3140-3146.

Heinemann, C., van Hylckama Vlieg, J. E., Janssen, D. B., Busscher, H. J., van der Mei, H. C., Reid, G. (2000) Purification and characterisation of a surface-binding protein from Lactobacillus fermentum RC-14 that inhibits adhesion of Enterococcus faecalis 1131. FEMS Microbiol. Lett. 190: 177-180.

Higuchi, R., Krummel, B., Saiki, R. (1988) A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids. Res. 16: 7351-7367.

Hill, C., Daly, C., Fitzgerald, G. F. (1987) Development of high-frequency delivery system for transposon Tn919 in lactic streptococci: random insertion in Streptococcus lactis subsp. diacetylactis 18-16. Appl. Environ. Microbiol. 53: 74-78.

Hiramatsu, K., Cui, L., Kuroda, M., Ito, T. (2001) The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol. 9: 486-493.

Hirokawa, T., Boon-Chieng, S., Mitaku, S. (1998) SOSUI: classification and secondary structure prediction system for membrane proteins. Bioinformatics 14: 378-379.

Hofmann, K., Stoffel, W. (1993) TMbase - a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler 374: 166.

Holck, A., Naes, H. (1992) Cloning, sequencing and expression of the gene encoding the cell-envelope-associated proteinase from Lactobacillus paracasei subsp. paracasei NCDO 151. J. Gen. Microbiol. 138: 1353-1364.

Hollingshead, S.K., Fischetti, V. A., Scott, J. R. (1986) Complete nucleotide sequence of type 6 M protein of the group A Streptococcus. Repetitive structure and membrane anchor. J. Biol. Chem. 261: 1677-1686.

Holo, H., Nilssen, O., Nes, I. F. (1991) Lactococcin A, a new bacteriocin from Lactococcus lactis subsp. cremoris: isolation and characterisation of the protein and its gene. J. Bacteriol. 173: 3879-3887.

Hung, J., Turner, M. S., Walsh, T., Giffard, P. M. (2005) BspA (CyuC) in Lactobacillus fermentum BR11 is a highly expressed high-affinity L-cystine-binding protein. . Curr. Microbiol. 50: 33-37.

Hyink, O., Wescombe, P. A., Upton, M., Ragland, N., Burton, J. P., Tagg, R. F. (2007) Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Appl. Environ. Microbiol. 73: 1107-1113.

Hynonen, U., Westerlund-Wikstrom, B., Palva, A., Korhonen, T. K. (2002) Identification by flagellum display of an epithelial cell- and fibronectin-binding function in the SlpA surface protein of Lactobacillus brevis. J. Bacteriol. 184: 3360-3367.

Jana, S., Deb, J. K. (2005) Strategies for efficient production of heterologous proteins in Escherichia coli. Appl. Microbiol. Biotechnol. 67: 289-298.

Jankovic, I., Ventura, M., Meylan, V., Rouvet, M., Elli, M., Zink, R. (2003) Contribution of aggregation-promoting factor to maintenance of cell shape in Lactobacillus gasseri 4B2. J. Bacteriol. 185: 3288-3296.

121

Jarvis, A.W., Jarvis, B. D. (1981) Deoxyribonucleic acid homology among lactic acid streptococci. Appl. Environ. Microbiol. 41: 77-83.

Joerger, M.C., Klaenhammer, T. R. (1986) Characterisation and purification of helveticin J and evidence for a chromosomally determined bacteriocin produced by Lactobacillus helveticus 481. J. Bacteriol. 167: 439-446.

Jonsson, K., Signas, C., Muller, H. P., Lindberg, M. (1991) Two different genes encode fibronectin binding protein in Staphylococcus aureus. The complete nucleotide sequence and characterisation of the second gene. Eur. J. Biochem. 202: 1041-1048.

Jung, G. (1991) Lantibiotics: a survey. In Nisin and Novel Lantibiotics. Jung, G., Sahl, H. G. (ed). Leiden, The Netherlands: Escom Science Publishers.

Kaatz, G.W., Seo, S. M., Dorman, N. J., Lerner, S. A. (1990) Emergence of teicoplanin resistance during therapy of Staphylococcus aureus endocarditis. J. Infect. Dis. 162: 103-108.

Kanatani, K., Oshimura, M., Sano, K. (1995) Isolation and characterisation of acidocin A and cloning of the bacteriocin gene from Lactobacillus acidophilus. Appl. Environ. Microbiol. 61: 1061-1067.

Kellner, R., Jung, G., Horner, T., Zahner, H., Schnell, N., Entian, K. D., Gotz, F. (1988) Gallidermin: a new lanthionine-containing polypeptide antibiotic. Eur. J. Biochem. 177: 53-59.

Kelly, C.G., Todryk, S., Kendall, H. L., Munro, G. H., Lenher, T. (1995) T-cell, adhesion and B-cell epitopes of the cell surface Streptococcus mutans protein antigen I/II. Infect. Immun. 63: 3649-3658.

Kelly, C.G., Younson, J. S., Hikmat, B. Y., Todryk, S. M., Czisch, M., Haris, P. I., Flindall, I. R., Newby, C., Mallet, A. I., Ma, J. K., Lehner, T. (1999) A synthetic peptide adhesion epitope as a novel antimicrobial agent. Nat. Biotechnol. 17: 42-47.

Kelly, C.G., Younson, J. S. (2000) Anti-adhesive strategies in the prevention of infectious disease at mucosal surfaces. Expert. Opin. Investig. Drugs. 9: 1711-1721.

Kelly, C.G., Medaglini, D., Younson, J. S., Pozzi, G. (2001) Biotechnological approacjes to fight pathogens at mucosal sites. Biotechnol. Genet. Eng. Rev. 18: 329-347.

Kilpper-Balz, R., Fischer, G., Schleifer, K. H. (1982) Nucleic acid hybridisation of group N and group D streptococci. Curr. Microbiol. 7: 245-250.

Klaenhammer, T.R. (1988) Bacteriocins of lactic acid bacteria. Biochimie. 70: 337-349.

Klaenhammer, T.R. (1993) Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 12: 39-85.

Kleerebezem, M., Beerthuyzen, M. M., Vaughan, E., de Vos, W. M., Kuipers, O. P. (1997) Controlled gene expression systems for lactic acid bacteria: transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus sp. Appl. Environ. Microbiol. 63: 4581-4584.

Kleerebezem, M., Boekhorst, J., van Kranenburg, R., Molenaar, D., Kuipers, O. P., Leer, R., Tarchini, R., Peters, S. A., Sandbrink, H. M., Fiers, M. W., Stiekema, W., Lankhorst, R. M., Bron, P. A., Hoffer, S. M., Groot, M. N., Kerkhoven, R., de Vries, M., Ursing, B., de Vos, W. M., Siezen, R.

122

J. (2003) Complete genome sequence of Lactobacillus plantarum WCFS1. Proc. Natl. Acad. Sc. U. S. A. 100: 1990-1995.

Kloos, W.E., Schleifer, K. H. (1975) Isolation and characterisation of staphylococci from human skin. Description of four new species: Staphylococcus warneri, Staphylococcus capitits, Staphylococcus hominis and Staphylococcus simulans. Int. J. Syst. Bacteriol. 25: 62-79.

Kluytmans, J., van Belkum, A., Verburgh, H. (1997) Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clin. Microbiol. Rev. 10: 505-520.

Kock, H., Gerth, U., Hecker, M. (2004) MurAA, catalysing the first committed step in peptidoglycan biosynthesis, is a target of Clp-dependent proteolysis in Bacillus subtilis. Mol. Microbiol. 51: 1087-1102.

Kokai-Kun, J.F., Walsh, S. M., Chanturiya, T., Mond, J. J. (2003) Lysostaphin cream eradicates Staphylococcus aureus nasal colonisation in a cotton rat model. Antimicrob. Agents Chemother. 47: 1589-1597.

Kokai-Kun, J.F., Chanturiya, T., Mond, J. J. (2007) Lysostaphin is a treatment for systemic Staphylococcus aureus infection in a mouse model. J. Antimicrob. Chemother. 60: 1051-1059.

Kolenbrander, P.E., Andersen, R. N., Ganeshkumar, N. (1994) Nucleotide sequence of the Streptococcus gordonii PK488 coaggregation adhesin gene, scaA, and ATP-binding cassette. Infect. Immun. 62: 4469-4480.

Kolenbrander, P.E., Andersen, R. N., Baker, R. A., Jenkinson, H. F. (1998) The adhesion-associated sca operon in Streptococcus gondonii encodes an inducible high-affinity ABC transporter for Mn2+ uptake. J. B180: 290-295.

Kruger, C., Hu, Y., Pan, Q., Marcotte, H., Hultberg, A., Delwar, D., van Dalen, P. J., Pouwels, P. H., Leer, R. J., Kelly, C. G., van Dollenweerd, C., Ma, J. K., Hammarstrom, L. (2002) In situ delivery of passive immunity by lactobacilli producing single-chain antibodies. Nat. Biotechnol. 20: 702-706.

Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M., Alloni, G., Azevedo, V., Bertero, M. G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., Brans, A., Braun, M., Brignell, S. C., Bron, S., Brouillet, S., Bruschi, C. V., Caldwell, B., Capuano, V., Carter, N. M., Choi, S. K., Codani, J. J., Connerton, I. F., Cummings, N. J., Daniel, R. A., Denizot, F., Devine, K. M., Dusterhoft, A., Ehrlich, S. D., Emmerson, P. T., Entian, K. D., Errington, J., Fabret, C., Ferrari, E., Foulger, D., Fritz, C., Fujita, M., Fujita, Y., Fuma, S., Galizzi, A., Galleron, N., Ghim, S. Y., Glaser, P., Goffeau, A., Golightly, E. J., Grandi, G., Guiseppi, G., Guy, B. J., Haga, K., Haiech, J., Harwood, C. R., Henaut, A., Hilbert, H., Holsappel, S., Hosono, S., Hullo, M. F., Itaya, M., Jones, L., Joris, B., Karamata, D., Kasahara, Y., Klaerr-Blanchard, M., Klein, C., Kobayashi, Y., Koetter, P., Koningstein, G., Krogh, S., Kumano, M., Kurita, K., Lapidus, A., Lardinois, S., Lauber, J., Lazarevic, V., Lee, S. M., Levine, A., Liu, H., Masuda, S., Mauel, C., Medigue, C., Medina, N., Mellado, R. P., Mizuno, M., Moestl, D., Nakai, S., Noback, M., Noone, D., O'Reilly, M.,Ogawa, K., Ogiwara, A., Oudega, B., Park, S. H., Parro, V., Pohl, T. M., Portetelle, D., Porwollik, S., Prescott, A. M., Presecan, E., Pujic, P., Purnelle, B., Rapoport, G., Rey, M., Reynolds, S., Rieger, M., Rivolta, C., Rocha, E., Roche, B., Rose, M., Sadaie, Y.,

123

Sato, T., Scanlan, E., Schleich, S., Schroeter, R., Scoffone, F., Sekiguchi, J., Sekowska, A., Seror, S. J., Serror, P., Shin, B. S., Soldo, B., Sorokin, A., Tacconi, E., Takagi, T., Takahashi, H., Takemaru, K., Takeuchi, M., Tamakoshi, A., Tanaka, T., Terpstra, P., Tognoni, A., Tosato, V., Uchiyama, S., Vandenbol, M., Vannier, F., Vassarotti, A., Viari, A., Wambutt, R., Wedler, E., Wedler, H., Weitzenegger, T., Winters, P., Wipat, A., Yamamoto, H., Yamane, K., Yasumoto, K., Yata, K., Yoshida, K., Yoshikawa, H. F., Zumstein, E., Yoshikawa, H., Danchin, A. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature. 390: 249-256.

Langella, P., Le Loir, Y. (1999) Heterologous protein secretion in Lactococcus lactis: a novel antigen delivery system. Braz. J. Med. Biol. Res. 32: 191-198.

Larsen, A.G., Vogensen, F. K., Josephsen, J. (1993) Antimicrobial activity of lactic acid bacteria isolated from sour doughs: purification and chacterisation of bavaricin A, a bacteriocin produced by Lactobacillus bavaricus MI401. J. Appl. Bacteriol. 75: 113-122.

Le Loir, Y., Gruss, A., Ehrlich, S. D., Langella, P. (1994) Direct screening of recombinants in Gram-positive bacteria using the secreted staphylococcal nuclease as a reporter. J. Bacteriol. 176: 5135-5139.

Le Loir, Y., Azvedo, V., Oliveira, S., Freitas, D., Miyoshi, A., Bermudez-Humaran, L., Nouaille, S., Ribeiro, L., Leclercq, S., Gabriel, J., Guimaraes, V., Oliveira, M., Charlier, C., Gautier, M., Langella, P. (2005) Protein secretion in Lactococcus lactis: an efficient way to increase overall heterologous protein production. Microb. Cell Factories. 4: 2. doi: 10.1186/1475-2859-1184-1182.

Lee, Y.-L., Cesario, T., Pax. A., Tran, C., Ghouri, A., Thrupo, L. (1999) Nasal colonization by Staphylococcus aureus in active, independent community seniors. Age Ageing. 28: 229-232.

Leverentz, B., Conway, W. S., Camp, M. J., Janisiewicz, W. J., Abuladze, T., Yang, M., Saftner, R., Sulakvelidze, A. (2003) Biocontrol of Listera monocytogenes on fresh-cut produce by treatment with lytic bacteriophages and a bacteriocin. Appl. Environ. Microbiol. 69: 4519-4526.

Liu, J.J., Reid, G., Jiang, Y., Turner, M. S., Tsai, C.C. (2007) Activity of HIV entry and fusion inhibitors expressed by the human vaginal colonising probiotic Lactobacillus reuteri RC-14. Cell. Microbiol. 9: 120-130.

Loeffler, J.M., Nelson, D., Fischetti, V. A. (2001) Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase. Science. 294: 2170-2172.

Loesche, W.J. (1986) Role of Streptococcus mutans in human dental decay. Microbiol. Rev. 50: 355-380.

Loessner, M.J., Wendlinger, G., Scherer, S. (1995) Heterogeneous endolysins in Listeria monocytogenes bacteriophages: a new class of enzymes and evidence for conserved holin genes within the siphoviral lysis cassettes. Mol. Microbiol. 16: 1231-1241.

Loessner, M.J., Maier, S. K., Daubek-Puza, H., Wendlinger, G., Scherer, S. (1997) Three Bacillus cereus bacteriophage endolysins are unrelated but reveal high homology to cell wall hydrolases from different bacilli. J. Bacteriol. 179: 2845-2851.

124

Lopez, R., Garcia, E. (2004) Recent trends on the molecular biology of pneumococcal capsules, lytic enzymes, and bacteriophages. FEMS Microbiol. Rev. 28: 553-580.

Lucchini, S., Sidoti, J., Brussow, J. (2000) Broad-range bacteriophage resistance in Streptococcus thermophilus by insertional mutagenesis. Virology. 275: 267-277.

Lunn, J.V., Rahman, K. J., Macey, A. C. (2001) Streptococcus milleri infection. J. Hand Surg [Br]. 26: 56-57.

Lupas, A., Engelhardt, H., Peters, J., Santarius, U., Volker, S., Baumeister, W. (1994) Domain structure of the Acetogenium kivui surface layer revealed by electron crystallography and sequence analysis. J. Bacteriol. 176: 1224-1233.

Madigan, M.T., Martinko, J. M., Parker, J. (2000) Brock Biology of Microorganisms, 9th Ed. Upper Saddle River, New Jersey, U. S. A.: Prentice-Hall Inc.

Maguin, E., Prévost, H., Ehrlich, S. D., Gruss, A. (1996) Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 178: 931-935.

Majamaa, H., Isolauri, E., Saxelin, M., Vesikari, T. (1995) Lactic acid bacteria in the treatment of acute rotavirus gastroenteritis. J. Pediatr. Gastroenterol. Nutr. 20: 333-338.

Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova, N., Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D., Lucas, S., Huang, K., Goodstein, D. M., Hawkins, T., Plengvidhya, V., Welker, D., Hughes, J., Goh, Y., Benson, A., Baldwin, K., Lee, J. H., Diaz-Muniz., I., Dosti, B., Smeianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E., Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H., Tamir, D., Parker, C., Briedt, F., Broadbent, J., Hutkins, R., O'Sullivan, D., Steele, J., Unlu, G., Saier, M., Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D. (2006) Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sc. U. S. A. 103: 15611-15616.

Makino, S., Yamamoto, K., Murakami, S., Shirahata, T., Uemura, K., Sawada, T., Wakamoto, H., Morita, H. (1998) Properties of repeat domain found in a novel protective antigen, SpaA, of Erysipelothrix rhysiopathiae. Microb. Pathog. 25: 101-109.

Marciset, O., Jeronimus-Stratingh, M. C., Mollet, B., Poolman, B. (1997) Thermophilin 13, a nontypical antilisterial poration complex bacteriocin, that functions without a receptor. J. Biol. Chem. 272: 14277-14284.

Marquardt, J.L., Siegele, D. A., Kolter, R., Walsh, C. T. (1992) Cloning and sequencing of Escherichia coli murZ and purification of its product, a UDP-N-acetylglucosamine enolpyruvyl transferase. J. Bacteriol. 174: 5748-5752.

Mazmanian, S.K., Liu, G., Ton-That, H., Schneewind, O. (1999) Staphylococcus aureus sortase, an enzyme that anchors surface proteins to the cell wall. Science. 285: 760-763.

Mbelle, N., Huebner, R. E., Wasas, A. D., Kimura, A., Chang, I., Klugman, K. P. (1999) Immunogenicity and impact on nasopharyngeal carriage of a nonavalent pneumococcal conjugate vaccine. J. Infect. Dis. 180: 1171-1176.

125

Mcfarlane, G., Cummings, J. H. (1999) Probiotics and prebiotics: can regulating the activities of intestinal bacteria benefit health? BMJ 318: 999-1003.

Mesnage, S., Fontaine, T., Mignot, T., Delepierre, M., Mock, M., Fouet, A. (2000) Bacterial SLH domain proteins are non-covalently anchored to the cell surface via a conserved mechanism involving wall polysaccharide pyruvylation. EMBO J. 19: 4473-4484.

Michener, H.D. (1953) The bactericidal action of subtilin on Bacillus stearothermophilus. Appl. Microbiol. 1: 215-517.

Mierau, I., Leij, P., van Swam, I., Blommestein, B., Floris, E., Mond, J., Smid, E. J. (2005a) Industrial-scale production and purification of a heterologous protein in Lactococcus lactis using the nisin-controlled gene expression system NICE: The case of lysostaphin. Microb. Cell. Fact. 4: 15. doi: 10.1186/1475-2859-1184-1115.

Mierau, I., Olieman, K., Mond, J., Smid, E. J. (2005b) Optimisation of the Lactococcus lactis nisin-controlled gene expression system NICE for industrial applications. Microb. Cell. Fact. 4: 16. doi: 10.1186/1475-2859-1184-1116.

Mortvedt, C.I., Nissen-Meyer, J., Sletten, K., Nes, I. F. (1991) Purification and amino acid sequence of lactocin S, a bacteriocin produced by Lactobacillus sakei L45. Appl. Environ. Microbiol. 57: 1829-1834.

Mota-Meira, M., Lapointe, G., Lacroix, C., Lavoie, M. C. (2000) MICs of mutacin B-Ny266, nisin A, vancomycin, and oxacillin against bacterial pathogens. Antimicrob. Agents Chemother. 44: 24-29.

Mullan, W.M., Crawford, R. J. (1985) Partial purification and some properties of phi C2(W) lysin, a lytic enyme produced by phage-infectede cells of Streptococcus lactis C2. J. Dairy Res. 52: 123-138.

Muriana, P.M., Klaenhammer, T. R. (1991) Purification and partial characterisation of lactacin F, a bacteriocin produced by Lactobacillus acidophilus 11088. . Appl. Environ. Microbiol. 57: 114-121.

Naidu, A.S., Bidlack, W. R., Clemens, R. A. (1999) Probiotic spectra of lactic acid bacteria (LAB). Crit. Rev. Food. Sci. Nutr. 39: 13-126.

Nakano, S., Kuster-Schock, E., Grossman, A. D., Zuber, P. (2003) Spx-dependent transcriptional control is induced by thiol-specific oxidative stress in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 100: 13603-13608.

Navarre, W.W., Schneewind, O. (1994) Proteolytic cleavage and cell wall anchoring at the LPXTG motif of surface proteins in Gram-positive bacteria. Mol. Microbiol. 14: 115-121.

Navarre, W.W., Schneewind, O. (1999) Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev. 63: 174-229.

Nelson, D., Loomis, L., Fischetti, V. A. (2001) Prevention and elimination of upper respiratory colonisation of mice by group A streptococci by using a bacteriophage lytic enzyme. Proc. Natl. Acad. Sc. U. S. A. 98: 107-112.

Nes, I.F., Tagg, J. R. (1996) Novel lantibiotics and their pre-peptides. Antonie Van Leeuwenhoek. 69: 89-97.

Nilsen, T., Nes, I. F., Holo, H. (2003) Enterolysin A, a cell wall-degrading bacteriocin from Enterococcus faecalis LMG2333. Appl. Environ. Microbiol. 69: 2975-2984.

126

Niu, W.W., Neu, H. C. (1991) Activity of mersacidin, a novel peptide, compared with that of vancomycin, teicoplanin and daptomycin. Antimicrob. Agents Chemother. 35: 998-1000.

Nouaille, S., Ribeiro, L. A., Miyoshi, A., Pontes, D., Le Loir, Y., Oliveira, S. C., Langella, P., Azevedo, V. (2003) Heterologous protein production and delivery systems for Lactococcus lactis. Gen. Mol. Res. 2: 102-111.

Nouaille, S., Commissaire, J., Gratadoux, J. J., Ravn, P., Bolotin, A., Gruss, A., Le Loir Y., Langella, P. (2004) Influence of lipoteichoic acid D-alanylation on protein secretion in Lactococcus lactis as revealed by random mutagenesis. Appl. Environ. Microbiol. 70: 1600-1607.

Nouaille, S., Morello, E., Cortez-Peres, N., Le Loir, Y., Commissaire, J., Gratadoux, J. J., Poumerol, E., Gruss, A., Langella, P. (2006) Complementation of the Lactococcus lactis secretion machinery with Bacillus subtilis SecDF improves secretion of staphylococcus nuclease. Appl. Environ. Microbiol. 72: 2272-2279.

O'Brien, L.M., Walsh, E. J., Massey, R. C., Peacock, S. J., Foster, T. J. (2002) Staphylococcus aureus clumping factor B (ClfB) promotes adherence to human type I cytokeratin 10: implications for nasal colonisation. Cell. Microbiol. 4: 759-770.

O'Brien, L.M., Walsh, E. J., Massey, R. C., Peacock, S. J., Foster, T. J. (2002) Staphylococcus aureus clumping factor B (ClfB) promotes adherence to human type I cytokeratin 10: implications for nasal colonisation. Cell. Microbiol. 4: 759-770.

O'Keeffe, T., Hill, C., Ross, R. P. (1999) Characterisation and heterologous expressionof the genes encoding enterocin A production, immunity and regulation in Enterococcus faecium DPC1146. Appl. Environ. Microbiol. 65: 1506-1515.

Olabarria, G., Carrascosa, J. L., Depedro, M. A., Berenguer, J. (1996) A conserved motif in S-layer proteins is involved in peptidoglycan binding in Thermus thermophilus. J. Bacteriol. 178: 4765-4772.

Oluola, O., Kong, L., Fein, M., Weisman, L. E. (2007) Lysostaphin in treatment of neonatal Staphylococcus aureus infection. Antimicrob. Agents Chemother. 51: 2198-2200.

Osaki, T., Yamaguchi, H., Taguchi, H., Fukuda, M., Kawakami, H., Hiramo, H., Watanabe, S., Takagi, A., Kamiya, A. (1998) Establishment and characterisation of a monoclonal antibody to inhibit adhesion of Helicobacter pylori to gastric epithelial cells. J. Med. Microbiol. 47: 505-512.

Patron, R.L., Climo, M. W., Goldstein, B. P., Archer, G. L. (1999) Lysostaphin treatment of experimental aortic valve endocarditis caused by a Staphylococcus aureus isolate with reduced susceptibility to vancomycin. Antimicrob. Agents Chemother. 43: 1754-1755.

Patti, J.M., Hook, M. (1994) Microbial adhesins recognising extracellular matrix macromolecules. Curr. Opin. Cell. Biol. 6: 752-758.

Peacock, S.J., Foster, T. J., Cameron, B. J., Berendt, A. R. (1999) Bacterial fibronectin-binding proteins and endothelial cell surface fibronectin mediate adherence of Staphylococcus aureus to resting human endothelial cells. Micrbiology. 145: 3477-3486.

Piard, J.C., Kuipers, O. P., Rollema, H. S., Desmazeaud, M. J., de Vos, W. M. (1993) Structure, organisation, and expression of the lct gene for lacticin

127

481, a novel lantibiotic produced by Lactococcus lactis. J. Biol. Chem. 268: 16361-16368.

Piard, J.C., Hautefort, I., Fischetti, V. A., Ehrlich, S. D., Fons, M., Gruss, A. (1997) Cell wall anchoring of the Streptococcus pyogenes M6 protein in various lactic acid bacteria. J. Bacteriol. 179: 3068-3072.

Platteeuw, C., de Vos, W. M. (1992) Location, characterisation and expression of lytic enzyme-encoding gene, lytA, of Lactococcus lactis bacteriophage phi US3. Gene. 118: 115-120.

Polack, J., Latta, P. D., Blackburn, P. (1993) In vitro activity of recombinant lysostaphin-antibiotic combination toward methicillin-resistant Staphylococcus aureus. Diagn. Microbiol. Infect. Dis. 17: 265-270.

Price, M., N., Huang, K. H., Alm, E. J., Arkin, A. P. (2005) A novel method for accurate operon predictions in all sequenced prokaryotes. Nucleic Acids. Res. 33: 880-892.

Pridmore, D., Rekhif, N., Pittet, A. C., Suri, B., Mollet, B. (1996) Variacin, a new lantibiotic-containing bacteriocin produced by Micrococcus varians: comparison to lacticin 481 of Lactococcus lactis. Appl. Environ. Microbiol. 62: 1799-1802.

Pridmore, R.D., Berger, B., Desiere, F., Vilanova, D., Barretto, C., Pittet, A. C., Zwahlen, M. C., Rouvet, M., Altermann, E., Barrangou, R., Mollet, B., Mercenier, A., Klaenhammer, T., Arigoni, F., Schell, M. A. (2004) The genome sequence of the probiotic intestinal bacterium Lactobacillus johnsonii NCC 533. Proc. Natl. Acad. Sc. U. S. A. 101: 2512-2517.

Pritchard, D.G., Gong, S., Baker, J. R., Engler, J. A. (2004) The bifunctional peptidoglycan lysin of Streptococcus agalactiae bacteriophage B30. Microbiology. 150: 2079-2087.

Pugsley, A.P., Possot, O. (1993) The general secretory pathway of Klebsiella oxytoca: no evidence for relocalisation or assembly of pilin-like PulG protein into a multiprotein complex. Micrbiology. 10: 665-674.

Quadri, L.E.N., Sailer, M., Terebiznik, M. R., Roy, K. L., Vederas, J. C., Stiles, M. E. (1995) Characterisation of the protein conferring immunity to the antimicrobial protein carnobacteriocin B2 and expression of carnobacteriocins B2 and BM1. J. Bacteriol. 177: 1144-1151.

Que, Y.A., Francois, P., Haefliger, J. A., Entenza, J. M., Vaudaux, P., Moreillon, P. (2001) Reassessing the role of Staphylococcus aureus clumping factor and fibronectin-binding protein by expression in Lactococcus lactis. Infect. Immun. 69: 6296-6302.

Ravn, P., Arnau, J., Madsen, S. M., Vrang, A., Israelsen, H. (2003) Optimisation of signal peptide SP310 for heterologous protein production in Lactococcus lactis. Microbioloy. 149: 2198-2201.

Recsei, P.A., Gruss, A. D., Novick, R. P. (1987) Cloning, sequence, and expression of the lysostaphin gene from Staphylococcus simulans. Proc. Natl. Acad. Sci. U. S. A. 84: 1127-1131.

Reid, G., Cuperus, P. L., Bruce, A. W., Tomeczek, L., van der Mei, H. C., Khoury, A. H., Busscher, H. J. (1992) Comparison of contact angles and adhesion to hexadecane of urogenital, dairy and poultry lactobacilli: effect of serial culture passages. Appl. Environ. Microbiol. 58: 1549-1553.

Ribeiro, L.A., Azevedo, V., Le Loir, Y., Oliveira, S. C., Dieye, Y., Piard, J. C., Gruss, A., Langella, P. (2002) Production and targeting of the Brucella

128

abortus antigen L7/L12 in Lactococcus lactis: a first step towards food-grade live vaccines against brucellosis. Appl. Environ. Microbiol. 68: 910-916.

Ries, W., Hotzy, C., Schocher, I., Sleytr, U. B., Sara, M. (1997) Evidence that the N-terminal part of the S-layer protein from Bacillus stearothermophilus pv72/p2 recognises a secondary cell wall polymer. J. Bacteriol. 179: 3892-3898.

Robinson, J.M., Hardman, J. K., Sloan, G. L. (1979) Relationship between lysostaphin endopeptidase production and cell wall composition in Staphylococcus staphylolyticus. J. Bacteriol. 137: 1158-1164.

Rodriguez, J.M., Martinez, M. I., Kok, J. (2002) Periodicin PA-1, a wide-spectrum bacteriocin from lactic acid bacteria. Crit. Rev. Food. Sci. Nutr. 42: 91-121.

Rogers, L.A. (1928) The inhibiting effect of Streptococcus lactis on Lactobacillus bulgaricus. J. Bacteriol. 16: 321-325.

Rojas, M., Ascencio, F., Conway, P. L. (2002) Purification and characterisation of a surface protein from Lactobacillus fermentum 104R that binds to porcine small intestine mucus and gastric mucin. Appl. Environ. Microbiol. 68: 2330-2336.

Romero, D.A., Klaenhammer, T. R. (1990) Characterisation of insertion sequence IS946, and Iso-ISS1 element isolated from the conjugative lacotococcal plasmid pTR2030. J. Bacteriol. 172: 4151-4160.

Roos, S., Jonsson, H. (2002) A high-molecular-mass cell-surface protein from Lactobacillus reuteri 1063 adheres to mucus components. . Microbiology. 148: 433-442.

Ross, K.F., Ronson, C. W., Tagg, J. R. (1993) Isolation and characterisation of the lantibiotic salivaricin A and its structural gene salA from Streptococcus salivarius 20P3. Appl. Environ. Microbiol. 59: 2014-2021.

Ross, R.P., Galvin, M., McAuliffe, O., Morgan, S. M., Ryan, M. P., Twomey, D. P., Meaney, W. J., Hill. C. (1999) Developing applications for lactococcal bacteriocins. Antonie Van Leeuwenhoek. 76: 337-346.

Rost, B., Casadio, R., Fariselli, P., Sander, C. (1995) Transmembrane helices predicted at 95% accuracy. Protein Sci. 4: 521-533.

Rouff, K.L. (1988) Streptococcus anginosus ("Streptococcus milleri"): the unrecognised pathogen. Clin. Microbiol. Rev. 1: 102-108.

Rush, C.M., Hafner, L. M., Timms, P. (1994) Genetic modifications of a vaginal strain of Lactobacillus fermentum and its maintenance within the reproductive tract after intravaginal administration. J. Med. Microbiol. 41: 272-278.

Ryser, E.T., Marth, E. H (1999) Listeria, listeriosis, and food safety. New York City, New York, U. S. A.: Marcel Dekker.

Sahl, H.G., Bierbaum, G. (1998) Lantibiotics: biosynthesis and biological activities of uniquely modified peptides from Gram-positive bacteria. Ann. Rev. Microbiol. 52: 41-79.

Saitou, N., Nei, M. (1987) The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406-425.

Salk, A.J. (1973) Fundamental Principles of Bacteriology, 7th Ed. San Fancisco, California, U. S. A.: McGraw-Hill Book Co.

129

Salminen, S., Von Wight, A., Ouwehand, A. (2004) Lactic Acid Bacteria: Microbiological and Functional Aspects, 3rd Ed. Boca Raton, Florida, U. S. A.: Marcel Dekker.

Sanchez, J., Borrero, J., Gomez-Sala, B., Basanta, A., Herranz, C., Cintas, L. M., Hernandez, P. E. (2008) Cloning and heterologous production of Hiracin JM79, a Sec-dependent bacteriocin produced by Enterococcus hirae DCH5, in lactic acid bacteria and Pichia pastoris. Appl. Environ. Microbiol. 74: 2471-2479.

Sanders, M.E. (1999) Probiotics. Food Technol. 53: 67-77. Schaffer, A.C., Solinga, R. M., Cocchiaro, J., Portoles, M., Kiser, K. B., Risley,

A., Randall, S. M., Valtulina, V., Speziale, P., Walsh, E., Foster, T., Lee, J. C. (2006) Immunisation with Staphylococcus aureus clumping factor B, a major determinant in nasal carriage, reduces nasal colonisation in a murine model. Infect. Immun. 74: 2145-2153.

Schallmey, M., Singh, A., Ward, O. P. (2004) Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 50: 1-7.

Scheppler, L., Vogel, M., Marti, P., Muller, L., Miescher, S. M., Stadler, B. M. (2005) Intranasal immunisation using recombinant Lactobacillus johnsonii as a new strategy to prevent allergic disease. Vaccine. 23: 1126-1134.

Schillinger, U., Lucke, F. K. (1989) Antibacterial activity of Lactobacillus sake isolated from meat. Appl. Environ. Microbiol. 55: 1901-1906.

Schindler, C.A., Schuhardt, V. T. (1964) Lysostaphin: a new bacteriolytic agent for the Staphylococcus. Proc. Natl. Acad. Sci. U. S. A. 51: 414-421.

Schleifer, K.H., Fischer, U. (1982) Description of a new species of the genus Staphylococcus: Staphylococcus carnosus. Int. J. Syst. Bacteriol. 32: 153-156.

Schleifer, K.H., Kilpper-Balz, R. (1987) Molecular and chemotaxonomic approaches to the classification of streptococci, enterococci and lactococci: a review. Syst. Appl. Microbiol. 6: 1-19.

Schneewind, O., Fowler, A., Faull, K. F. (1995) Structure of the cell wall anchor of surface proteins in Staphylococcus aureus. Science. 268: 103-106.

Schotte, L., Steidler, L., Vandekerckhove, J., Remaut, E. (2000) Secretion of biologically active murine interleukin-10 by Lactococcus lactis. Enzyme Microb. Technol. 27: 761-765.

Schuch, R., Nelson, D., Fischetti, V. A. (2002) A bacteriolytic agent that detects and kills Bacillus anthracis. Nature. 418: 884-889.

Shah, A., Mond, J., Walsh, S. (2004a) Lysostaphin-coated catheters eradicate Staphylococcus aureus challenge and block surface colonisation. Antimicrob. Agents. Chemother. 48: 2704-2707.

Shah, D.S., Joucla, G., Remaud-Simeon, M., Russell, R. R. (2004b) Conserved repeat motifs and glucan binding by glucansucrases of oral streptococci and Leuconostroc mesenteroides. J. Bacteriol. 186: 8301-8308.

Sheehan, M.M., Garcia, J. L., Lopez, R, Garcia, P. (1997) The lytic enzyme of the pneumococcal phage Dp-1: a chimeric lysin of intergeneric origin. Mol. Microbiol. 25: 717-725.

Shuttleworth, H.L., Duggleby, C. J., Jones, S. A., Atkinson, T., Minton, N. P. (1987) Nucleotide sequence analysis of the gene for protein A from Staphylococcus aureus Cowan 1 (NCTC8530) and its enhanced expression in Escherichia coli. . Gene. 58: 283-295.

130

Signas, C., Raucci, G., Jonsson, K. Lindgren, P. E., Anantharamaiah, G. M., Hook, M., Lindberg, M. (1989) Nucleotide sequence of the gene for a fibronectin-binding protein from Staphylococcus aureus: use of this peptide sequence in the synthesis of biologically active peptides. Proc. Natl. Acad. Sci. U. S. A. 86: 699-703.

Siitonen, S., Vapaatalo, H., Salminen, S., Gordin, A., Saxelin, M., Wikberg, R., Kirkkola, A. L. (1990) Effect of Lactobacillus GG yoghurt in prevention of antibiotic associated diarrhoea. Ann. Med. 22: 57-59.

Silhavy, T.J., Benson, S. A., Emr, S. D. (1983) Mechanisms of protein localisation. Microbiol. Rev. 47: 313-344.

Sillanpaa, J., Martinez, B., Antikainen, J., Toba, T., Kalkkinen, N., Tankka, S., Lounatmaa, K., Keranen, J., Hook, M., Westerlund-Wikstrom, B., Pouwels, P. H., Korhonen, T. K. (2000) Characterisation of the collagen-binding S-layer protein of CbsA of Lactobacillus cripatus. J. Bacteriol. 182: 6440-6450.

Sinha, B., Francois, P., Que, Y. A., Hussain, M., Heilmann, C., Moreillon, P., Lew, D., Krause, K. H., Peters, G., Herrmann, M. (2001) Heterologously expressed Staphylococcus aureus fibronectin-binding proteins are sufficient for invasion of host cells. Infect. Immun. 68: 6871-6878.

Siren, N., Salonen, K., Leisola, M., Nyyssola, A. (2008) A new and efficient phosphate starvation inducible expression system for Lactococcus lactis. Appl. Microbiol. Biotechnol. 79: 803-810.

Sleytr, U.B., Messner, P. (1988) Crystalline surface layers in prokaryotes. J. Bacteriol. 170: 2891-2897.

Sloan, G.L., Robinson, J. M., Kloos, W. E. (1982) Identification of ‘Staphylococcus staphylolyticus’ NRRL B-2628 as a biovar of Staphylococcus simulans. Int. J. Syst. Bacteriol. 32: 107-174.

Slock, J., Stahly, D. P., Han, C. Y., Six, E. W., Crawford, I. P. (1990) An apparent Bacillus subtilis folic acid biosynthesis operon containing pab, an amphibolic trpG gene, a third gene required for synthesis of para-aminobenzoic acid, and the dihydropteroate synthase gene. J. Bacteriol. 172: 7211-7226.

Slos, P., Dutot, P., Reymund, J., Kleinpeter, P., Prozzi, D., Kieny, M. P., Delcour, J., Mercenier, A., Hols, P. (1998) Production of cholera toxin B subunit in Lactobacillus. FEMS Microbiol. Lett. 169: 29-36.

Smith, T.L., Pearson, M. L., Wilcox, K. R., Cruz, C., Lancaster, M. V., Robinson-Dunn, B., Tenover, F. C., Zervos, M. J., Band, J. D., White, E., Jarvis, W. R. (1999) Emergence of vancomycin resistance in Staphylococcus aureus. N. Eng. J. Med. 340: 493-501.

Spellerberg, B., Rozdzinski, E., Martin, S., Weber-Heynemann, J., Lutticken, R. (2002) rgf encodes a novel two-component signal transduction system of Streptococcus agalactiae. Infect. Immun. 70: 2434-2440.

Sperandio, B., Polard, P., Ehrlich, D. S., Renault, P., Guedon, E. (2005) Sulfur amino acid metabolism and its control in Lactococcus lactis IL1403. J. Bacteriol. 187: 3762-3778.

Stackebrandt, E., Teuber, M. (1988) Molecular taxonomy and phylogenetic position of lactic acid bacteria. Biochimie. 70: 317-324.

Steen, A., Buist, G., Leenhouts, K. J., El Khattabi, M., Grijpstra, F., Zomer, A. L., Venema, G., Kuipers, O. P., Kok, J. (2003) Cell wall attachment of a

131

widely distributed peptidoglycan binding domain is hindered by cell wall constituents. J. Biol. Chem. 278: 23874-23881.

Steidler, L., Viaene, J., Fiers, W., Remaut, E. (1998a) Functional display of a heterologous protein on the surface of Lactococcus lactis by means of a cell wall anchor of Staphylococcus aureus protein A. Appl. Environ. Microbiol. 64: 342-345.

Steidler, L., Robinson, K., Chamberlain, L., Schofield, K. M., Remaut, E., Le Page, R. W., Wells, J. M. (1998b) Mucosal delivery of murine interleukin-2 (IL-2) and IL-6 by recombinant strains of Lactococcus lactis coexpressing antigen and cytokine. Infect. Immun. 66: 3183-3189.

Stiles, M.E. (1994) Bacteriocins produced by Leuconostoc species. J. Dairy Sc. 77: 2718-2724.

Stranden, A.M., Ehlert, K., Labischinski, H., Berger-Bachi, B. (1997) Cell wall monoglycine cross-bridges and methicillin hypersusceptibility in a femAB null mutant of methicillin-resistance Staphylococcus aureus. J. Bacteriol. 179: 9-16.

Stroobant, P., Young, I. G., Gibson, F. (1972) Mutants of Escherichia coli K-12 blocked in the final reaction of ubiquinone biosynthesis: characterisation and genetic analysis. J. Bacteriol. 109: 134-139.

Switalski, L.M., Speziale, P., Hook, M. (1989) Isolation and characterisation of a putative collagen receptor from Staphylococcus aureus strain Cowan I. J. Biol. Chem. 264: 21080-21086.

Tagg, J.R., Dierksen, K. P. (2003) Bacterial replacement therapy: adapting 'germ warfare' to infection prevention. Trends Biotechnol. 21: 217-223.

Tahara, T., Oshimura, M., Umezawa, C., Kantani, K. (1996) Isolation, partial characterisation and mode of action of acidocin J1132, a two-component bacteriocin produced by Lactobacillus acidophilus JCM 1132. Appl. Environ. Microbiol. 62: 891-897.

Tahiri, I., Desbiens, M., Benech, R., Kheadr, E., Lacroix, C., Thibault, S., Ouellet, D., Fliss, I. (2004) Purification, characterisation and amino acid sequencing of divergicin M35: a novel class IIa bacteriocin produced by Carnobacterium divergens M35. Int. J. Food Microbiol. 97: 123-136.

Talay, S.R., Grammel, M. P., Chhatwal, G. S. (1996) Structure of a group C streptococcal protein that binds to fibrinogen, albumin and immunoglobulin G via overlapping modules. Biochem. J. 315: 577-582.

Tamura, K., Dudley, J., Nei, M., Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599.

Tenover, F.C., Lancaster, M. V., Hill, B. C., Steward, C. D., Stocker, S. A., Hancock, G. A., O’Hara, C. M., Clark, N. C., Hiramatsu, K. (1998) Characterisation of staphylococci with reduced susceptibility to vancomycin and other glycopeptides. . J. Clin. Microbiol. 36: 1020-1027.

Thibessard, A., Borges, F., Fernandez, A., Gintz, B., Decaris, B., Lelond-Bourget, N. (2004) Identification of Streptococcus thermophilus CNRZ368 genes involved in defense against superoxide stress. . Appl. Environ. Microbiol. 70: 2220-2229.

Thumm, G., Gotz, F. (1997) Studies on prolysostaphin processing and characterisation of the lysostaphin immunity factor (Lif) of

132

Staphylococcus simulans biovar staphylolyticus. Mol. Microbiol. 23: 1251-1265.

Tichaczek, P.S., Vogel, R. F., Hammes, W. P. (1994) Cloning and sequencing of sakP encoding sakacin P, the bacteriocin produced by Lactobacillus sake LTH 673. Microbiology. 140: 361-367.

Tjalsma, H., Bolhuis, A., Jongbloed, J. D. H., Bron, S., van Dijl, J. M. (2000) Signal peptide-dependent protein transport in Bacillus subtilis: a genome-based survey of secretome. Microbiol. Mol. Biol. Rev. 64: 515-547.

Tuler, T.R., Callanan, M. J., Klaenhammer, T. R. (2002) Overexpression of peptidases in Lactococcus and evaluation of their release from leaky cells. J. Dairy Sci. 85: 2438-2450.

Turner, M.S., Timms, P., Hafner, L. M., Giffard, P. M. (1997) Identification and characterisation of a basic cell surface-located protein from Lactobacillus fermentum BR11. J. Bacteriol. 179: 3310-3316.

Turner, M.S., Giffard, P. M. (1998) Expression of chlamydial and HIV antigens on the surface of Lactobacillus fermentum BR11 as fusions to BspA. Infect. Immun. 67: 5486-5489.

Turner, M.S., Woodberry, T., Hafner, L. M., Giffard, P. M. (1999) The bspA locus of Lactobacillus fermentum BR11 encodes an L-cystine uptake system. J. Bacteriol. 181: 2192-2198.

Turner, M.S., Hafner, L. M., Walsh, T., Giffard, P. M. (2003) Peptide surface display and secretion using two LPXTG-containing surface proteins from Lactobacillus fermentum BR11. Appl. Environ. Microbiol. 69: 5855-5863.

Turner, M.S., Hafner, L. M., Walsh, T., Giffard, P. M. (2004a) Identification and characterisation of the novel LysM domain-containing surface protein Sep from Lactobacillus fermentum BR11 and its use as a peptide fusion partner in Lactobacillus and Lactococcus. Appl. Environ. Microbiol. 70: 3673-3680.

Turner, M.S., Hafner, L. M., Walsh, T., Giffard, P. M. (2004b) Identification, characterisation and specificity of a cell wall lytic enzyme from Lactobacillus fermentum BR11. FEMS Microbiol. 238: 9-15.

Turner, M.S., Tan, Y. P., Giffard, P. M. (2007a) Inactivation of an iron transporter in Lactococcus lactis results in resistance to tellurite and oxidative stress. Appl. Environ. Microbiol. 73: 6144-6149.

Turner, M.S., Waldherr, F., Loessner, M. J., Giffard, P. M. (2007b) Antimicrobial activity of lysostaphin and a Listeria monocytogenes bacteriophage endolysin produced and secreted by lactic acid bacteria. Syst. Appl. Microbiol. 30: 58-67.

Tynkkynen, S., Buist, G., Kunji, E., Kok, J., Poolman, B., Venema, G., Haandrikman, A. (1993) Genetic and biochemical characterisation of the oligopeptide transport system of Lactococcus lactis. . J. Bacteriol. 175: 7523-7532.

Uhlen, M., Guss, B., Nilsson, B., Gatenbeck, S., Philipson, L., Lindberg, M. (1984) Complete sequence of the staphylococcal gene encoding protein A. A gene evolved through multiple duplications. J. Biol. Chem. 259: 1695-1702.

Valent, Q.A., Scotti, P. A., High, S., de Gier, J. W., von Heijne, G., Lentzen, G., Wintermeyer, W., Oudega, B., Luirink, J. (1998) The Escherichia coli

133

SPR and SecB targeting pathways converge at the translocon. EMBO J. 17: 2504-2512.

van Asseldonk, M., de Vos, W. M., Simons, G. (1993) Functional analysis of the Lactococcus lactis Usp45 secretion signal in the secretion of a homologous proteinase and a heterologous alpha-amylase. Mol. Gen. Genet. 240: 428-434.

van Belkum, M.J., Stiles, M. E. (1995) Molecular characterisation of genes involved in the production of bacteriocin leucocin A from Leuconostoc gelidum. Appl. Environ. Microbiol. 61: 3573-3579.

van Belkum, M.J., Worobo, R. W., Stiles, M. E. (1997) Double-glycine-type leader peptides direct secretion of bacteriocins by ABC transporters: colicin V secretion in Lactococcus lactis. Mol. Microbiol. 23: 1293-1301.

van de Guchte, M., Penaud, S., Grimaldi, C., Barbe, V., Bryson, K., Nicolas, P., Robert, C., Oztas, S., Mangenot, S., Couloux, A., Loux, V., Dervyn, R., Bossy, R., Bolotin, A., Batto, J. M., Walunas, T., Gibrat, J. F., Bessières, P., Weissenbach, J., Ehrlich, S. D., Maguin, E. (2006) The complete genome sequence of Lactobacillus bulgaricus reveals extensive and ongoing reductive evolution. Proc. Natl. Acad. Sc. U. S. A. 103: 9274-9279.

Van der Vossen, J.M.B.M., van Herwijnen, M. H. M., Leer, R. J., ten Brink, B., Pouwels, P. H., Huis in't Veld, J .H. J. (1994) Production of acidocin B, a bacteriocin of Lactobacillus acidophilus M46 is a plasmid encoded trait: plasmid curing, genetic marking by in vivo plasmid integration, and gene transfer. FEMS Microbiol. Lett. 116: 333-340.

Vandenbergh, P.A. (1993) Lactic acid bacteria, their metabolic products and interference with microbial growth. FEMS Microbiol. Rev. 12: 221-238.

Vanderhoof, J.A., Whitney, D. B., Antonson, D. L., Hanner, T. L., Lupo, J. V., Young, R. J. (1999) Lactobacillus GG in the presention of antibiotic-associated diarrhea in children. J. Pediatr. 135: 564-568.

Vasala, A., Valkkila, M., Caldentey, J., Alatossava, T. (1995) Genetic and biochemical characterisation of the Lactobacillus delbrueckii subsp. lactis bacteriophage LL-H lysin. Appl. Environ. Microbiol. 61: 4004-4011.

Veehoven, R.H., Bogaert, D., Schilder, A. G., Rijkers, G. T., Uiterwaal, C. S., Kiezebrink, H. H., van Kempen, M. J., Dhooge, I. J., Bruin, J., Ijzerman, E. P., de Groot, R., Kuis, W., Hermans, P. W., Sanders, E. A. (2004) Nasopharyngeal pneumococcal carriage after combined pneumococcal conjugate and polysaccharide vaccination in children with a history of recurrent acute otitis media. . Clin. Infect. Dis. 39: 911-919.

Veiga, P., Bulbarela-Sampieri, C., Furlan, S., Maisons, A., Chapot-Chartier, M. P., Erkelenz, M., Mervelet, P., Noirot, P., Frees, D., Kuipers, O. P., Kok, J., Gurss, A., Buist, G., Kulakauskas, S. (2007) SpxB regulates O-acetylation-dependent resistance of Lactococcus lactis peptidoglycan to hydrolysis. J. Biol. Chem. 282: 19342-19354.

Ventura, M., Jankovic, I., Walker, D. C., Pridmore, R. D., Zink, R. (2002) Identification and characterisation of novel surface protein in Lactobacillus johnsonii and Lactobacillus gasseri. Appl. Environ. Microbiol. 68: 6172-6181.

134

Vidgren, G., Palva, I., Pakkanen, R., Lounatmaa, K., Palva, A. (1992) S-layer protein gene of Lactobacillus brevis: cloning by polymerase chain reaction and determination of the nucleotide sequence. J. Bacteriol. 174: 7419-7427.

von Eichel-Streiber, C., Saurbon, C., Kuramitsu, H. K. (1992) Evidence for a modular structure of the homologous repetitive C-terminal carbohydrate-binding sites of Clostridium difficile toxins and Streptococcus mutans glucosyltransferases. J. Bacteriol. 174: 6707-6710.

Vos, P., Simons, G., Siezen, R. J., de Vos, W. M. (1989) Primary structure and organization of the gene for a procaryotic, cell envelope-located serine proteinase. J. Biol. Chem. 264: 13579-13585.

Walker, S.A., Klaenhammer, T. R. (2001) Leaky Lactococcus cultures that externalizes enzymes and antigens independently of culture lysis and secretion and export pathways. Appl. Environ. Microbiol. 67: 251-259.

Walsh, E.J., O'Brien, L. M., Liang, X., Hook, M., Foster, T. J. (2004) Clumping factor B, a fibrinogen-binding MSCRAMM (microbial surface components recognising adhesive matrix molecules) adhesin of Staphylococcus aureus, also binds to the tail region of type I cytokeratin 10. J. Biol. Chem. 279: 50691-50699.

Walter, P., Blobel, G. (1980) Purification of a membrane-associated protein complex required for protein translocation across the endoplasmic reticulum. Proc. Natl. Acad. Sc. U. S. A. 77: 7112-7116.

Walter, P., Blobel, G. (1981) Translocation of proteins across the endoplasmic reticulum III. Signal recognition protein (SRP) causes signal sequence-dependent and site-specific arrest of chain elongation that is released by microsomal membranes. J. Cell. Biol. 91: 557-561.

Walter, P., Ibrahimi, I., Blobel, G. (1981) Translocation of proteins across the endoplasmic reticulum I. Signal recognition protein (SRP) binds to in vitro-assembled polysomes synthesising secretory protein. J. Cell. Biol. 91: 545-550.

Wang, I.N., Smith, D. L., Young, R. (2000) Holins: The protein clocks of bacteriophage infections. Ann. Rev. Microbiol. 54: 799-825.

Wegkemp, A., van Oorschot, W., de Vos, W. M., Smid, E. J. (2007) Characterisation of the role of para-aminobenzoic acid biosynthesis in folate production by Lactococcus lactis. Appl. Environ. Microbiol. 73: 2673-2681.

Wegmann, U., O'Connell-Motherway, M., Zomer, A. L., Buist, G., Sheaman, C., Canchaya, C., Ventura, M., Goesmann, A., Gasson, M. J., Kuipers, O. P., van Sinderen, I., Kok, J. (2007) Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J. Bacteriol. 189: 3256-3270.

Wells, J.M., Wilson, P. W., Norton, P. M., Gasson, M. J., Le Page, R. W. (1993) Lactococcus lactis: high-level expression of tetanus toxin fragment C and protection against lethal challenge. Mol. Microbiol. 8: 1155-1162.

Wells, J.M., Mercenier, A. (2008) Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nat. Rev. Microbiol. 6: 349-362.

Wescombe, P.A., Upton, M., Dierksen, K. P., Ragland, N. L., Sivabalan, S., Wirawan, R. E., Inglis, M. A., Moore, C. J., Walker, G. V., Chilcott, C.

135

N., Jenkinson, H. F., Tagg, J. R. (2006) Production of the lantibiotic salivaricin A and its variants by oral streptococci and use of a specific induction assay to detect their presence in human saliva. Appl. Environ. Microbiol. 72: 1459-1466.

Westers, L., Westers, H., Quax, W. J. (2004) Bacillus subtilis as a cell factory for pharmaceutical proteins: a biotechnological approach to optimise the host organism. Biochim. Biophys. Acta.

1694: 299-310. White, A., Smith, J. (1963) Nasal reservoir as the source of extranasal

staphylococci. Antimicrob. Agents. Chemother.: 679-683. Wood, B.J.B. (1992) Series Preface. In The Lactic Acid Bacteria, Volume 1: The

Lactic Acid Bacteria in Health and Disease. Wood, B.J.B. (ed). London, U. K.: Elsevier Applied Science.

Wren, B.W. (1991) A family of clostridial and streptococcal ligand-binding proteins with conserved C-terminal repeat sequences. Mol. Microbiol. 5: 797-803.

Wu, J.A., Kusuma, C., Mond, J. J., Kokai-Kun, J. E. (2003) Lysostaphin disrupts Staphylococcus aureus and Staphylococcus epidermidis biofilms on artificial surfaces. Antimicrob. Agents. Chemother. 47: 3407-3414.

Xu, Y., Li, Y. (2008) Construction of recombinant Lactobacillus casei efficiently surface displayed and secreted porcine parvovirus VP2 protein and comparison of the immune responses induced by oral immunisation. Immunology. 124: 68-72.

Yamane, K., Bunai, K., Kakeshita, H. (2004) Protein traffic for secretion and related machinery of Bacillus subtilis. Biosci. Biotechnol. Biochem. 68: 2007-2023.

Yokoi, K., Shinohara, M., Kawahigashi, N., Nakagawa, K., Kawasaki, K. I., Nakamura, S., Taketo, A., Kodaira, K. I. (2004) Molecular properties of the two-component cell lysis system encoded by prophage phi gaY of Lactobacillus gasseri JCM 1131(T): cloning, sequencing and expressing in Escherichia coli. Int. J. Food Microbiol. 99: 297-308.

Yoong, P., Schuch, R., Nelson, D., Fischetti, V. A. (2004) Identification of a broadly active phage lytic enzyme with lethal activity against antibiotic-resistant Enterococcus faecalis and Enterococcus faecium. J. Bacteriol. 186: 4808-4812.

Yoshimura, M., Asai, K., Sadaie, Y., Yoshikawa, H. (2004) Interaction of Bacillus subtilis extracytoplasmid function (ECF) sigma factors with the N-terminal regions of their potential anti-sigmal factors. Micrbiology. 150: 591-599.

Young, R. (1992) Bacteriophage lysis: mechanism and regulation. Microbiol. Rev. 56: 430-481.

Young, I., Wang, I., Roof, W. D. (2000) Phages will out: strategies of host cell lysis. Trends Microbiol. 8: 120-128.

Zhuang, Z., Wu, Z. G., Chen, M., Wang, P. G. (2008) Secretion of human interferon-beta 1b by recombinant Lactococcus lactis. Biotechnol. Lett. 25 doi: 10.1007/s10529-10008-19761-y.

Zimmer, M., Vukov, N., Scherer, S., Loessner, M. J. (2002) The murein hydrolase of the bacteriophage phi-3626 dual lysis system is active

136

against all tested Clostridium perfringens strains. Appl. Environ. Microbiol. 68: 5311-5317.

Zygmunt, W., Tavormina, P. (1972) Lysostaphin: model for specific enzymatic approach to infectious disease. Prog. Drug. Res. 16: 309-333.