article title:

Article title:Deficiency in riboflavin biosynthesis affects tetrapyrrole biosynthesis in etiolated Arabidopsis tissue

Journal: Plant Molecular Biology

Authors:Boris Hedtke, Ali Alawady, Alfonso Albacete, Koichi Kobayashi, Michael Melzer, Thomas Roitsch, Tatsuru Masuda, Bernhard Grimm

Corresponding author:Bernhard GrimmHumboldt University, Institute of Biology/Plant Physiology, Philippstr.13, Building 12, 10115 Berlin, Germany Email: [email protected]

mailto:[email protected]

Supplemental Figure S1:Partial alignments of Arabidopsis RibA genes with A: GTP cyclohydrolase II from E. coli (EC_GCHII, acc. nr. BAA 14831, 196 aa) and B: 3,4-dihydroxy-2-butanone-4-phosphate synthase from Methanocaldococcus jannaschii (MJ_DHBPS, NP 247019, 227 aa). Amino acids identical in all 4 sequences are shaded, residue numbers are given at the right margin. Herz et al. (2000) demonstrated both enzymatic activities for recombinant AtRIBA1 protein. Important residues and domains for both enzymes have been identified previously (highlighted in yellow, Fischer et al., 2002; Kaiser et al., 2002; Steinbacher et al., 2003; Ren et al., 2005). Substitutions and deletions in the catalytic or binding domains of RIBA2 and RIBA3 (marked in red) allow the prediction that only RIBA1 and RIBA3 are able to catalyse the GTP cyclohydrolase II reaction, while only RIBA1 and RIBA2 function as 3,4-dihydroxy-2-butanone-4-phosphate synthase. A similar difference in enzyme activity was found between the Bacillus subtilis RibD encoded dual-functional protein with pyrimidine deaminase and reductase activity and the homologous A. thaliana gene At4g20960, which encodes a protein of similar size with deamination reaction only (Fischer et al., 2004).

A:

B:

Supplemental Table S1: Differentially expressed genes showing at least two-fold reduction in rfd1 compared to wild type. All candidate genes show a logged expression coefficient (coef.) smaller than -1 and a probability (p-) value smaller or equal 0.01. Gene names (AGI ID) numbers and and a description based on the most recent TAIR annotation are given. LEA proteins are numbered according to Hundertmark and Hincha (2007, numbers in italics)

coef. p-value AGI ID description

1 - 4.77 0.001 At2g36640 ATECP63 (EMBRYONIC CELL PROTEIN 63), LEA#19

2 - 4.77 0.005 At3g15670 late embryogenesis abundant protein, putative, LEA#29

3 - 4.77 0.005 At5g40420 OLE2 (OLEOSIN 2)

4 - 4.67 0.003 At3g51810 AT3_ATEM1_GEA1__EM1 (LATE EMBRYOGENESIS ABUND.1), LEA#35

5 - 4.51 0.001 At3g54940 cysteine-type endopeptidase/ cysteine-type peptidase

6 - 3.98 0.008 At2g21490 LEA (DEHYDRIN LEA); , LEA#14

7 - 3.93 0.004 At5g66780 unknown protein

8 - 3.84 0.003 At5g66400 ATDI8__RAB18 (RESPONSIVE TO ABA 18) , LEA#51

9 - 3.82 0.004 At1g43800 acyl-(acyl-carrier-protein) desaturase, putative


11 - 3.65 0.008 At3g17520 late embryogenesis abundant domain-containing protein, LEA#30

12 - 3.59 0.004 At5g62490 ATHVA22B

13 - 3.55 0.006 At2g28490 cupin family protein

14 - 3.47 0.009 At1g48130 ATPER1; antioxidant/ thioredoxin peroxidase

15 - 3.46 0.003 At5g06760 late embryogenesis abundant group 1 domain-containing protein, LEA#46


17 - 3.25 0.003 At1g73190 ALPHA-TIP__TIP3;1; water channel


19 - 3.02 0.007 At1g04560 AWPM-19-like membrane family protein


21 - 2.99 0.007 At4g16160 ATOEP16-2 mitochondrial import inner membrane translocase subunit

22 - 2.94 0.006 At3g02480 ABA-responsive protein-related , LEA#28



25 - 2.86 0.003 At2g23240 plant EC metallothionein-like family 15 protein



28 - 2.72 0.004 At5g01300 phosphatidylethanolamine-binding family protein

29 - 2.62 0.002 At1g67100 LBD40 (LOB DOMAIN-CONTAINING PROTEIN 40)


31 - 2.56 0.005 At2g25890 glycine-rich protein / oleosin

32 - 2.53 0.010 At4g36880 CP1 (CYSTEINE PROTEINASE1); cysteine-type endopeptidase

33 - 2.47 0.007 At3g29970 germination protein-related

34 - 2.47 0.006 At4g36700 cupin family protein

35 - 2.44 0.008 At1g48660 auxin-responsive GH3 family protein

36 - 2.41 0.003 At4g24150 AtGRF8 (GROWTH-REGULATING FACTOR 8)

37 - 2.37 0.007 At5g03860 MLS (MALATE SYNTHASE)



40 - 2.27 0.009 At3g03450 RGL2 (RGA-LIKE 2); transcription factor

41 - 2.22 0.008 At3g58450 universal stress protein (USP) family protein

42 - 2.18 0.000 At4g30140 GDSL-motif lipase/hydrolase family protein

43 - 2.13 0.007 At2g25980 jacalin lectin family protein

44 - 2.12 0.004 At1g62710 BETAVPE cysteine-type endopeptidase

45 - 2.10 0.005 At5g22470 NAD+ ADP-ribosyltransferase

46 - 2.09 0.006 At5g13930 ATCHS TT4 (TRANSPARENT TESTA 4); naringenin-chalcone synthase


48 - 2.03 0.004 At2g38905 hydrophobic protein/ low temperature and salt responsive protein

49 - 2.03 0.002 At2g34080 cysteine proteinase, putative

50 - 1.99 0.000 At1g29090 peptidase C1A papain family protein

51 - 1.91 0.002 At5g38780 S-adenosyl-L-methionine:carboxyl methyltransferase family protein

52 - 1.81 0.001 At4g15910 DI21__ATDI21 (ARABIDOPSIS THALIANA DROUGHT-INDUCED 21), LEA#41

53 - 1.77 0.002 At2g43510 ATTI1; serine-type endopeptidase inhibitor

54 - 1.73 0.007 At5g64120 peroxidase, putative


56 - 1.68 0.008 At3g03620 MATE efflux family protein

57 - 1.66 0.000 At4g19810 glycosyl hydrolase family 18 protein

58 - 1.65 0.007 At3g14880 similar to DOG1 (DELAY OF GERMINATION 1)

59 - 1.64 0.006 At5g17820 peroxidase 57 (PER57) (P57) (PRXR10)

60 - 1.57 0.005 At5g65360 histone H3

61 - 1.52 0.008 At1g69880 ATH8 (thioredoxin H-type 8)

62 - 1.50 0.005 At1g32900 starch synthase, putative

63 - 1.49 0.007 At5g22460 esterase/lipase/thioesterase family protein

64 - 1.46 0.009 At4g18650 transcription factor-related

65 - 1.44 0.006 At2g31980 cysteine proteinase inhibitor-related


67 - 1.40 0.002 At1g30700 FAD-binding domain-containing protein

68 - 1.35 0.003 At5g23840 MD-2-related lipid recognition domain-containing protein

69 - 1.35 0.007 At5g10120 ethylene insensitive 3 family protein

70 - 1.29 0.002 At2g43570 chitinase, putative

71 - 1.28 0.001 At3g20210 DELTAVPE; cysteine-type endopeptidase

72 - 1.28 0.003 At2g22470 ATAGP2 (ARABINOGALACTAN PROTEIN 2)

73 - 1.25 0.004 At4g36010 pathogenesis-related thaumatin family protein

74 - 1.24 0.005 At5g43770 proline-rich family protein

75 - 1.24 0.005 At5g59870 HTA6; DNA binding

76 - 1.23 0.008 At2g38870 protease inhibitor, putative

77 - 1.22 0.006 At4g31840 plastocyanin-like domain-containing protein

78 - 1.21 0.008 At2g41850 ADPG2__PGAZAT (POLYGALACTURONASE)

79 - 1.20 0.010 At2g02120 LCR70__PDF2.1; peptidase inhibitor

80 - 1.19 0.002 At3g56060 glucose-methanol-choline (GMC) oxidoreductase family protein

81 - 1.19 0.003 At5g46950 invertase/pectin methylesterase inhibitor family protein

82 - 1.16 0.005 At3g46970 ATPHS2 (ALPHA-GLUCAN PHOSPHORYLASE 2)

83 - 1.16 0.003 At5g64100 peroxidase, putative

84 - 1.15 0.002 At3g20370 meprin and TRAF homology domain-containing protein

85 - 1.15 0.002 At5g40780 LTH1; amino acid transmembrane transporter



88 - 1.10 0.001 At2g46740 FAD-binding domain-containing protein

89 - 1.08 0.001 At3g09220 LAC7 (laccase 7)

90 - 1.07 0.001 At5g53660 AtGRF7 (GROWTH-REGULATING FACTOR 7)

91 - 1.05 0.004 At4g38210 ATEXP20 (ARABIDOPSIS THALIANA EXPANSIN A20)

92 - 1.04 0.002 At2g02990 RNS1 (RIBONUCLEASE 1)

93 - 1.04 0.006 At2g23620 ATMES1

94 - 1.01 0.009 At1g80090 CBS domain-containing protein

95 - 1.01 0.004 At2g29380 protein phosphatase 2C


Supplemental Table S1, continued

Supplemental Table S2: Differential expression of tetrapyrrole biosynthesis genes in etiolated rfd1 seedlings. The expression coefficient (coef.) indicates logged expression differences in rfd1 compared to wild type. Genes with an coefficient > 0.3 are given in bold.

name coef. p-value AGI ID

GLURS - 0.02 0.880 At5g64050

HEMA1 0.47 0.060 At1g58290

HEMA2 0.20 0.223 At1g09940

GSA1 0.08 0.519 At5g63570

GSA2 0.08 0.683 At3g48730

FLU 0.54 0.010 At3g14110

ALAD1 0.17 0.399 At1g69740

PBGD 0.10 0.556 At5g08280

PPOX1 0.16 0.357 At5g14220

PPOX2 0.26 0.121 At4g01690

CHLI1 0.32 0.136 At4g18480

CHLI2 0.29 0.209 At5g45930

CHLD - 0.00 0.980 At1g08520

CHLH 0.50 0.202 At5g13630

GUN4 0.57 0.108 At3g59400

CHLM 0.31 0.063 At4g25080

CHL27 0.20 0.175 At3g56940

DVR 0.16 0.366 At5g18660

PORA - 0.77 0.156 At5g54190

PORB - 0.35 0.289 At4g27440

PORC 0.01 0.989 At1g03630

CHLG 0.56 0.007 At3g51820

CHLP 0.38 0.050 At1g74470

FECH1 - 0.30 0.081 At5g26030

FECH2 0.18 0.290 At2g30390

HO1 - 0.03 0.858 At2g26670

HO2 0.04 0.770 At2g26550

HY2 0.27 0.252 At3g09150

Supplemental Table S3: Chloroplast encoded genes accumulating more than two-fold in etiolated rfd1 seedlings. Selection criteria are, as described for Table 1, a logged expression coefficient bigger than 1 and a p- value smaller 0.01.

name coef. p-value AGI ID

RPL20 1.91 0.001 AtCg00660

ATPI 1.65 0.004 AtCg00150

RPS15 1.47 0.000 AtCg01120

NDHJ 1.36 0.001 AtCg00420

NDHE 1.27 0.000 AtCg01070

ORF31 1.23 0.000 AtCg00590

NDHG 1.16 0.002 AtCg01080

PETA 1.14 0.001 AtCg00540

RPOC1 1.13 0.003 AtCg00180

RPOC2 1.12 0.003 AtCg00170

PSBN 1.08 0.008 AtCg00700

ATPH 1.04 0.003 AtCg00140

NDHD 1.03 0.001 AtCg01050

Supplemental Table S4: Oligonucleotides used in semi-quantitative and quantitative RT-PCR experiments.

gene primer 1 primer 2

semi-quantitative PCR:

RIBA1 aacgggagtatcagctcgtgacag cgcagaagcacgttccactaattt

RIBA2 gataatggcggcatctttggcta tctaaaccggccaacacagtcaa

RIBA3 gaggcctggtcatgtattccctct taacgagggcgatattttcggttc

HEMA1 catctctgctcttgaacaactc gttgacaaatctctgaaactggg

SAND taccaagatacaacgctcag tacatgaaatgccaaagtcc

CHLH gcaggttctttggatgattgg ctgatgttggctgagtatgac

FLU ttggctgctgagatatgtgag ctttctctggttcttggttcct

GUN4 acttctctttccctcaaacaacc gctgtatccgaatctaccatcac

ARR7 gccgtcgatgatagtattgtg ctcagatgacataatcactactgg

ARR16 cttagagcattggagtatttgg ggcttctgcataaacatttgag

TUA tggttctggattgggttctc acagcatgaaatggatacgg

ERF cttccttagacacctttgcc atgctttcctgcttcaagtg

GH3 ccagtgaacgataagtacatagag aaagcccacatagaagatgac

quantitative PCR:

LHCA4 aacccgcttaactttgctcctac caaaccctaagaatgccaacatc

HEMA1 taagattagcttccccacaaactc agctcgcttatagcttcacaacac

CHLH tggtagagagacagaagctcgaaa ccaaagaacctgcccaagag

ACTIN 8 actgtgcctatctacgagggtttc cccgttctgctgttgtggt

Supplemental References:

Fischer M, Romisch W, Schiffmann S, Kelly M, Oschkinat H, Steinbacher S, Huber R, Eisenreich W, Richter G, Bacher A (2002) Biosynthesis of riboflavin in archaea studies on the mechanism of 3,4-dihydroxy-2-butanone-4-phosphate synthase of Methanococcus jannaschii. J Biol Chem 277 :41410-41416Hundertmark M and Hincha DK (2008) LEA (late embryogenesis abundant) proteins and their encoding genes in Arabidopsis thaliana. BMC Genomics, 9, 118-141.Kaiser J, Schramek N, Eberhardt S, Püttmer S, Schuster M and Bacher A (2002) Biosynthesis of vitamin B2. Eur J Biochem 269:5264-70Ren J, Kotaka M, Lockyer M, Lamb HK, Hawkins AR, Stammers DK (2005) GTP cyclohydrolase II structure and mechanism. J Biol Chem 280:36912-36919Steinbacher S, Schiffmann S, Richter G, Huber R, Bacher A, Fischer M (2003) Structure of 3,4-dihydroxy-2-butanone 4-phosphate synthase from Methanococcus jannaschii in complex with divalent metal ions and the substrate ribulose 5-phosphate: implications for the catalytic mechanism. J Biol Chem 278:42256-42265

article title:

Documents