Experimental and Molecular Pathology 99 (2015) 360–364

Contents lists available at ScienceDirect

Experimental and Molecular Pathology

j ourna l homepage: www.e lsev ie r .com/ locate /yexmp

Arsenic toxi-RNomics has the ability to tailor the host immune response

S. Sharma a,b, D. Kaul a,⁎, D. Singh b

a Department of Experimental Medicine & Biotechnology, Postgraduate Institute of Medical Education & Research, Chandigarh 160012, Indiab Department of Forensic Medicine, Postgraduate Institute of Medical Education & Research, Chandigarh 160012, India

⁎ Corresponding author.E-mail address: dkaul235@gmail.com (D. Kaul).

http://dx.doi.org/10.1016/j.yexmp.2015.08.0080014-4800/© 2015 Elsevier Inc. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 18 August 2015Accepted 18 August 2015Available online 22 August 2015

Keywords:ArsenicmiR-2909RNomicsImmunomodulationIgA class-switchingBalb/C mice

Arsenic biology has caught the imagination of scientists across the globe because of its unique association withdegenerative diseases in general and cancer in particular. Recent findings have added a newdimension to arsenicbiology by revealing thatmost of the arsenic epigenomic effects aremediated through its ability to induce cellularmiR-2909 expression at low doses. The present study was addressed to explore the molecular link that mightexist between arsenic exposure, miR-2909 RNomics involving immunomodulatory genes and effector IgA classswitching, revealed that arsenic-exposed Balb/c mice exhibited predominant Th1 immune response coupledwith effector IgA class switching thereby tailoring their immune system to ensure increased risk to infectionsand chronic diseases like cancer.

© 2015 Elsevier Inc. All rights reserved.

1. Introduction

Arsenic biology has caught the imagination of scientist across theglobe because of its inherent capacity to influence various cellularprocesses like apoptosis, proliferation, inflammation, angiogenesis andimmune response (Abernathy et al., 2003; Ghosh et al., 2008; Jomovaet al., 2011; Ren et al., 2011; States et al., 2009). Most of these cellulareffects of arsenic were shown to be mediated through its ability tomodulate NFkB activity (Felix et al., 2005; Ghosh et al., 2008; Kaulet al., 2014; Sharma et al., 2013). Another dimension was added to thearsenic biology by the recent findings that revealed a direct associationbetween the activation of NFkB family member Rel A and miR-2909RNomics involving genes coding for KLF4, p53, AATF, SP1 and Bmi-1(Kaul and Sharma, 2015). Arsenic exposure ensured sustained cellularexpression of miR-2909 which, in turn, induced sustained expressionof Bmi-1 gene responsible for sustained NFkB activation as well asdegradation of p53 (Calao et al., 2013). FurthermiR-2909 expression en-sured the suppression of KLF4 gene (Malik et al., 2014) which has beenshown to induce CD4+ cells to secrete IL-17 (Lebson et al., 2010). Keep-ing in view the fact that there exists a direct molecular link between ar-senic exposure, cellular NFkB activation and miR-2909 RNomics as wellas the established role of p53 and KLF4 in the regulation of T-cell plastic-ity (Kawashima et al., 2013; Muñoz-Fontela et al., 2008; Murphy et al.,2011), it became imperative for us to understand two specific issues:a) how low doses of sodium arsenite feeding to BALB/c mice influencestheir immune response; and b) what mechanism is responsible for thearsenic mediated immune-regulation in these animals.

2. Material and methods

2.1. Animal model employed

Five to eight week old Adult Balb/cmice (weight ranged between 20and 25 g) were obtained from the animal house facility of the Instituteafter approval by animal ethics committee of institute. The animalswere housed at the laboratory condition; at 25 ± 2 °C, humidity of60 ± 2% and 12 h light/dark cycle. Animals had access to standardlaboratory diet and were acclimatized to the laboratory conditions1 week prior to experimentation.

2.2. Arsenic exposure and estimation

These animals were divided into two groups: one control group(n = 25) and one test group (n = 25) [eight control and eight treatedmice were used and each experiment was performed in triplicates.Therefore, a total of 25 mice were included in each group]. Test groupwas given drinking water containing 5 μM sodium arsenite (inorganicarsenic (III)) and the control group was given pure water withoutarsenic. Drinkingwater was changed twice weekly. After the completionof exposure period of 5 weeks arsenic concentration in the blood of ex-posed mice was determined by Graphite Furnace Atomic AbsorptionSpectrophotometer using standard wet digestion method (Sysalovaand Spevackova, 2003).

2.3. Cellular model employed and cell culture experiments

Human peripheral blood mononuclear cells (PBMCs) were obtainedfrom 25 normal healthy volunteers using density gradient centrifugation

Table 1Mouse specific primers.

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)

IFN-γ AGGAAGCGGAAAAGGAGTCG CCCAGATACAACCCCGCAATCCl5 TGCTGCTTTGCCTACCTCTC CCATTTTCCCAGGACCGAGTIL-4 CCATATCCACGGATGCGACA AAGCCCGAAAGAGTCTCTGCIL-6 GCCTTCTTGGGACTGATGCT CTGCAAGTGCATCATCGTTGTIL-8 CTAGGCATCTTCGTCCGTCC CAGAAGCTTCATTGCCGGTGAATF GAAACAACGAAAGGCCCCAC GGTTCTCCTGGCAAGGTCTCIL-17 AAAGTGAGCTCCAGAAGGCC GGGTTTCTTAGGGGTCAGCCTGF β ACTGGAGTTGTACGGCAGTG AGAAGTTGGCATGGTAGCCCβ-Actin GTACCCAGGCATTGCTGACA AGCTCAGTAACAGTCCGCCT

Table 2Human specific primers.

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)

IL-17 CGGACTGTGATGGTCAACCT GGGTCGGCTCTCCATAGTCTBmi-1 TCTGCAGCTCGCTTCAAGAT AGTGGTCTGGTCTTGTGAACTGFβ GGGACTATCCACCTGCAAGA CCTCCTTGGCGTAGTAGTCGIL-4 GCACCGAGTTGACCGTAACA CCAACGTACTCTGGTTGGCTIFN-γ GTTTGGGTTCTCTTGGCTGTT CTCCTTTTTCGCTTCCCTGTTTTCCL5 CGTGCCCACATCAAGGAGTA CTTCTCTGGGTTGGCACACAp53 GAAGACCCAGGTCCAGATGA CTGCCCTGGTAGGTTTTCTGIL-6 GATGTCTGAGGCTCATTCTGC TGGAAGCATCCATCTTTTTCAIL-8 ATGACTTCCAAGCTGGCCGTGGCT TCTCAGCCCTCTTCAAAAACTTCTβ-Actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT

361S. Sharma et al. / Experimental and Molecular Pathology 99 (2015) 360–364

method (Sharma et al., 2013) (with their prior informed consent as performat approved by institute ethics committee (Carlson et al., 2004)),who were fasting for 12 h and had abstained from any medication for2weeks before blood donation. Isolated human PBMCsweremaintainedin invitro RPMI 1640 culturemediumand exposed tofixed concentrationof sodium arsenite (2 μM) and incubated at 37 °C in humidified 5% CO2

atmosphere for 48 h. miR-2909 knock-down PBMCs were generated bytransfecting mercuryLNA™miR-2909 inhibitor (EXIQON) using K2transfection reagent (Biontex) and subsequently these PBMCs were ex-posed to medium enriched with or without sodium arsenite (2 μM)and incubated for 36 h at 37 °C in 5% CO2 atmosphere.

2.4. Gene expression analysis

Total cellular as well as small non-coding RNA was extracted fromPBMCs isolated from mice exposed to arsenic for 5 weeks and fromPBMCs maintained in culture medium for 36 and 48 h using miReasymini kit (Qiagen). The isolated RNA from mice PBMCs was subjectedto expression analysis of genes coding for miR-2909, AATF, TGFβ, IL-6,IL-8, CCL5, IFNγ, IL-4, and IL-17 (Table 1) and RNA isolated from cul-tured PBMCs was proceeded for expression analysis of genes codingfor Bmi-1, p53, TGFβ, IL-6, IL-8, CCL5, IFNγ, IL-4, and IL-17 using gene-specific primers and Real-Time PCR method. U6 and β actin were used

Fig. 1. Arsenic induce blood cellular AATF Genome Expression: sustained blood arsenic level awithin blood PBMCs (A–C) in Balb/c mice exposed to sodium arsenite for 5 weeks.

as invariant controls for the expression analysis of miR-2909 andother genes respectively. The isolated proteins from each culture wellmedia and frommice serumwere subjected to secretory IgA protein es-timation using antibody specific to IgA (Sigma) by ELISA reader follow-ing standard protocol (van Loon et al., 1983) (Table 2).

2.5. Immuno-phenotyping

Blood cells from arsenic exposed mice were subjected to flow cyto-metric analysis using combination of antibodies (Biolegend) againstCD4 (PE), CD8 (FITC), and IL-10 (PE) and the cellular phenotypicexpression of these genes was detected using fluorescent dye FITC orphycoerythrin (PE). T-regulatory population of cells was analysedusing antibodies against CD4+ (APC), CD25+ (PE) and FoxP3+(Alexa Fluor) cells. The CD4+ and CD25+ dual labelled cells weregated, and from these gated cells, the FoxP3 positive cells were record-ed. All samples were acquired on BD LSRII (BD Biosciences), and resultswere analysed with BD FACS Divav6 Software (BD Biosciences).

2.6. Statistical analysis

Statistical analyses were performed by SPSS version19. Data waspresented as mean ± S.D. Statistical comparison between two groupswas made by student t test and between multiple groups by ANOVAfollowed by appropriate post-hoc test. P-value b0.05 was consideredstatistically significant.

3. Results

In order to study the “Arsenic-Immunotoxicity” at low doses in vivo.The concentration of arsenic exposure to the animal model systemwasevaluated based upon our earlier observations (Sharma et al., 2013).

3.1. Arsenic regulates AATF genome

Exposure of Balb/C mice to arsenic (III) resulted in the sustainedlevels of arsenic in their blood around 1 μM in concentration (Fig. 1A)and this phenomenon was accompanied by the increased expressionof AATF gene encoding both AATF mRNA and miR-2909 (Fig. 1B,C)within their blood peripheral mononuclear cells (PBMCs).

3.2. Arsenic governs immunomodulatory genes & effector class-switching

In our earlier studies, we had observed that arsenic possesses the in-herent capacity to regulate various genes through miR-2909 RNomics(Kaul et al., 2014; Sharma et al., 2013). Consequently, an attempt wasmade to explore the effect of arsenic (III) upon in vivo expression ofvarious immunomodulatory genes as well as on the effector classswitching. The results of such a study not only revealed significant

chieved together with transcriptional expression of AATF gene and its encoded miR-2909

Fig. 2. Immunomodulatory gene expression: influence of arsenic: transcriptional expression of genes coding for TGFβ (A), IFNγ (B), CCL5 (C), IL-4 (D), IL-17 (E), IL-8 (F), and IL-6 (G) inmice PBMCs exposed to arsenic for 5 weeks serum levels of IgA (H) in mice exposed to arsenic. Each bar represents mean ± S.D. of the experiment performed in triplicate, **P b 0.05 rel-ative to control.

362 S. Sharma et al. / Experimental and Molecular Pathology 99 (2015) 360–364

decreased expression of genes coding for TGFβ, IL-4 and IL-17(Fig. 2A,D,E) coupled with increased expression of genes coding forIFN-γ, CCL5, IL-8, and IL-6 (Fig. 2B,C,F,G) within Balb/c derived bloodPBMCs but also arsenic exposed mice exhibited significantly higherserum levels of IgA (Fig. 2H). Keeping in view the fact that p53 andBmi1 are also known to regulate the immunoregulatory genes studiedhere (Calao et al., 2013), an attempt was also made to explore whetheror not arsenic induce miR-2909 RNomics is responsible for the regula-tion of these genes as well as effector IgA class switching. Such a

Fig. 3. Transcriptional expression of genes: influence of arsenic in human PBMCs: transcriptiowithin human PBMCs exposed tomediumenriched eitherwith 2 μMsodium arsenite or antagomof IgA protein secreted by the cells into themedium under the abovementioned conditions (C)ative to control.

study, indeed, confirmed that arsenic induced miR-2909 RNomics hasthe ability to regulate genes coding for Bmi-1, p53, TGFβ, CCL5, IL-4,IL-17, IL-6, IL-8 and IFN-γ as well as effector IgA class-switching inhuman blood PBMCs exposed to arsenic invitro culture (Fig. 3A,B&C)

3.3. Arsenic regulates T-cell plasticity

Arsenic (III) exposed mice exhibited decreased level of IL-10 withslightly increased number of CD8+ cells with no significant effect on

nal expression of genes coding for Bmi-1, p53, TGFβ, CCL5, IL-4, IL-17, IL-6, IL-8, and IFNγiR-2909/scramble sequence followed by 2 μMsodiumarsenite for 48 h (A,B). The amount

. Each bar represents mean± S.D. of the experiment performed in triplicate, **P b 0.05 rel-

Fig. 4. Immunomodulation: influence by arsenic: analysis of cytokine IL-10 and cell surface marker like CD4 and CD8 (A–C) within PBMCs of mice exposed to arsenic as compared to cor-responding control PBMCs. P1 represents the whole population of cells (PBMCs), P2 depicts CD8 positive cells and P3 shows the CD4+ cells. Each bar represents mean ± S.D. of the ex-periment performed in triplicate, **P b 0.05 relative to control.

363S. Sharma et al. / Experimental and Molecular Pathology 99 (2015) 360–364

the cell number of CD4+ cells within their blood as compared to corre-sponding control mice (Fig. 4A–D). Therewas significant increase in theexpression of regulatory T-cells (Treg cells CD4+CD25+ and FoxP3+)within the mice blood exposed to the arsenic as compared to controlmice (Fig. 5).

4. Discussion

There exists a general recognition of the fact that chronic exposureto arsenic has the potential to impair vital immune responses whichcould lead to various diseases in general and cancer in particular(Abernathy et al., 2003; Ghosh et al., 2008; Ren et al., 2011; Stateset al., 2009). Recently a new dimension was added to arsenic-biologyby the findings that revealed the ability of arsenic to govern miR-2909RNomics through the sustained activation of NFkB at low doses(Sharma et al., 2013). It is pertinent to note that the polycomb groupprotein Bmi-1 has been shown to reduce p53 protein half-life (Calaoet al., 2013) as well as ensure sustained activation of NFkB (Jiang et al.,2013) whereas KLF4 restricts the transcriptional expression of Bmi-1gene (Yu et al., 2012). The tumour suppressor p53 not only inhibitsNFkB activation (Murphy et al., 2011) but also induces the type-1 inter-ferons, CCL5 and regulatory T-cells (Kawashima et al., 2013;Muñoz-Fontela et al., 2008) as well as inhibits the translational expres-sion of IFNγ (Chang et al., 2013). KLF4, on the other hand, has beenshown to play crucial role in the development of IL-17 producingCD4+ T-cells independently of RORrt (Lebson et al., 2010). Interesting-ly, miR-2909 has been shown to programme cellular immune responsethrough its ability to regulate genes coding for AATF, C-myc, p53, IFNγand KLF4 (Arora et al., 2014; Kaul and Sharma, 2015; Malik et al.,

2014). It is in the context of the abovementionedfindings, the results re-ported here assume importance. Arsenic-induced miR-2909 RNomicsinvolving master genes coding for KLF4 and p53 ensures predominantTh1 response coupled with effector IgA class-switching (Figs. 2H, 3C);such a phenomenon can not only restrict the “delayed type hypersensi-tivity” (DTH) response but also may force the host immune system to“adopt” the tumour as an immune-privileged novel organ. Hence, it isnot unlikely that such arsenic-modulated immune response can ensureincreased risk of infections and chronic diseases especially cancer.

Compliance with ethical standards

All human and animal studies had been approved by the appropriateethics committee and were in accordance with the ethical standardslaid down in the 1964 Declaration of Helsinki and its later amendments.

Conflict of interest

This is to certify that there is no conflict of interest including any fi-nancial, personal or other relationships with other people or organiza-tions within three years from the date of submitted work in the formof present manuscript.

Acknowledgement

This work was supported by Indian Council of Medical Research(ICMR) (5/8/4-4(Env) 13-NCD-I) New-Delhi as well as the UGC fellow-ship grant awarded to Ms. Sugandha Sharma.

Fig. 5. T-cell plasticity: representative images showing gating of CD4+ lymphocytes, from which percentages of CD4+/CD25+ and FoxP3+ cells were obtained within PBMCs of miceexposed to arsenic as compared to corresponding control mice PBMCs (A–G).Each bar represents mean ± S.D. of the experiment performed in triplicate, **P b 0.05 relative to control.

364 S. Sharma et al. / Experimental and Molecular Pathology 99 (2015) 360–364

References

Abernathy, C.O., Thomas, D.J., Calderon, R.L., 2003. Health effects and risk assessment ofarsenic. J. Nutr. 133, 1536S–1538S.

Arora, M., Kaul, D., Sharma, Y.P., 2014. Human coronary heart disease: importance ofblood cellular miR-2909 RNomics. Mol. Cell. Biochem. 392, 49–63. http://dx.doi.org/10.1007/s11010-014-2017-3.

Calao, M., Sekyere, E.O., Cui, H.J., Cheung, B.B., Thomas, W.D., Keating, J., Chen, J.B., Raif, A.,Jankowski, K., Davies, N.P., Bekkum,M.V., Chen, B., Tan, O., Ellis, T., Norris, M.D., Haber,M., Kim, E.S., Shohet, J.M., Trahair, T.N., Liu, T., Wainwright, B.J., Ding, H.F., Marshall,G.M., 2013. Direct effects of Bmi1 on p53 protein stability inactivates oncoproteinstress responses in embryonal cancer precursor cells at tumor initiation. Oncogene32, 3616–3626. http://dx.doi.org/10.1038/onc.2012.368.

Carlson, R.V., Boyd, K.M., Webb, D.J., 2004. The revision of the declaration of Helsinki: past,present and future. Br. J. Clin. Pharmacol. 57, 695–713. http://dx.doi.org/10.1111/j.1365-2125.2004.02103.x.

Chang, C.-H., Curtis, J.D., Maggi, L.B., Faubert, B., Villarino, A.V., O'Sullivan, D., Huang, S.C.-C., van der Windt, G.J.W., Blagih, J., Qiu, J., Weber, J.D., Pearce, E.J., Jones, R.G., Pearce,E.L., 2013. Posttranscriptional control of T cell effector function by aerobic glycolysis.Cell 153, 1239–1251. http://dx.doi.org/10.1016/j.cell.2013.05.016.

Felix, K., Manna, S.K., Wise, K., Barr, J., Ramesh, G.T., 2005. Low levels of arsenite activatesnuclear factor-κB and activator protein-1 in immortalized mesencephalic cells.J. Biochem. Mol. Toxicol. 19, 67–77. http://dx.doi.org/10.1002/jbt.20062.

Ghosh, P., Banerjee, M., Giri, A.K., Ray, K., 2008. Toxicogenomics of arsenic: classical ideasand recent advances. Mutat. Res. 659, 293–301. http://dx.doi.org/10.1016/j.mrrev.2008.06.003.

Jiang, L., Song, L., Wu, J., Yang, Y., Zhu, X., Hu, B., Cheng, S.-Y., Li, M., 2013. Bmi-1 promotesglioma angiogenesis by activating NF-κB signaling. PLoS One 8, e55527. http://dx.doi.org/10.1371/journal.pone.0055527.

Jomova, K., Jenisova, Z., Feszterova, M., Baros, S., Liska, J., Hudecova, D., Rhodes, C.J., Valko,M., 2011. Arsenic: toxicity, oxidative stress and human disease. J. Appl. Toxicol. 31,95–107. http://dx.doi.org/10.1002/jat.1649.

Kaul, D., Sharma, S., 2015. High glucose-induced human cellular immune response isgoverned by miR-2909 RNomics. Blood Cells Mol. Dis. 54, 342–347. http://dx.doi.org/10.1016/j.bcmd.2015.01.009.

Kaul, D., Sharma, S., Sharma, M., Arora, M., Arora, M., 2014. Arsenic programmes cellulargenomic-immunity through miR-2909 RNomics. Gene 536, 326–331. http://dx.doi.org/10.1016/j.gene.2013.12.004.

Kawashima, H., Takatori, H., Suzuki, K., Iwata, A., Yokota, M., Suto, A., Minamino, T., Hirose,K., Nakajima, H., 2013. Tumor suppressor p53 inhibits systemic autoimmune diseases

by inducing regulatory T cells. J. Immunol. 1950 (191), 3614–3623. http://dx.doi.org/10.4049/jimmunol.1300509.

Lebson, L., Gocke, A., Rosenzweig, J., Alder, J., Civin, C., Calabresi, P.A., Whartenby, K.A.,2010. Cutting edge: the transcription factor Kruppel-like factor 4 regulates the differ-entiation of Th17 cells independently of RORγt. J. Immunol. 1950 (185), 7161–7164.http://dx.doi.org/10.4049/jimmunol.1002750.

Malik, D., Kaul, D., Chauhan, N., Marwaha, R.K., 2014. miR-2909-mediated regulation ofKLF4: a novel molecular mechanism for differentiating between B-cell and T-cell pe-diatric acute lymphoblastic leukemias. Mol. Cancer 13, 175. http://dx.doi.org/10.1186/1476–4598–13–175.

Muñoz-Fontela, C., Macip, S., Martínez-Sobrido, L., Brown, L., Ashour, J., García-Sastre, A.,Lee, S.W., Aaronson, S.A., 2008. Transcriptional role of p53 in interferon-mediated an-tiviral immunity. J. Exp. Med. 205, 1929–1938. http://dx.doi.org/10.1084/jem.20080383.

Murphy, S.H., Suzuki, K., Downes, M., Welch, G.L., Jesus, P.D., Miraglia, L.J., Orth, A.P.,Chanda, S.K., Evans, R.M., Verma, I.M., 2011. Tumor suppressor protein (p)53, is a reg-ulator of NF-κB repression by the glucocorticoid receptor. Proc. Natl. Acad. Sci. 108,17117–17122. http://dx.doi.org/10.1073/pnas.1114420108.

Ren, X., McHale, C.M., Skibola, C.F., Smith, A.H., Smith, M.T., Zhang, L., 2011. An emergingrole for epigenetic dysregulation in arsenic toxicity and carcinogenesis. Environ.Health Perspect. 119, 11–19. http://dx.doi.org/10.1289/ehp.1002114.

Sharma, M., Sharma, S., Arora, M., Kaul, D., 2013. Regulation of cellular cyclin D1 gene byarsenic is mediated through miR-2909. Gene 522, 60–64. http://dx.doi.org/10.1016/j.gene.2013.03.058.

States, J.C., Srivastava, S., Chen, Y., Barchowsky, A., 2009. Arsenic and cardiovascular dis-ease. Toxicol. Sci. 107, 312–323. http://dx.doi.org/10.1093/toxsci/kfn236.

Sysalova, J., Spevackova, V., 2003. A study of sample mineralization methods for arsenicanalysis of blood and urine by hydride generation and graphite furnace atomic ab-sorption spectrometry. Cent. Eur. J. Chem. 1, 108–120. http://dx.doi.org/10.2478/BF02479263.

Van Loon, A.M., van der Logt, J.T., Heessen, F.W., van der Veen, J., 1983. Enzyme-linked im-munosorbent assay that uses labeled antigen for detection of immunoglobulin M andA antibodies in toxoplasmosis: comparison with indirect immunofluorescence anddouble-sandwich enzyme-linked immunosorbent assay. J. Clin. Microbiol. 17,997–1004.

Yu, T., Chen, X., Zhang, W., Colon, D., Shi, J., Napier, D., Rychahou, P., Lu, W., Lee, E.Y.,Weiss, H.L., Evers, B.M., Liu, C., 2012. Regulation of the potential marker for intestinalcells, Bmi1, by β-catenin and the zinc finger protein KLF4. J. Biol. Chem. 287,3760–3768. http://dx.doi.org/10.1074/jbc.M111.316349.