Arsenic, chromium and NaCl induced artemisinin biosynthesisin Artemisia annua L.: A valuable antimalarial plant

Shilpi Paul n, Kanika ShakyaG.B. Pant Institute of Himalayan Environment and Development, Kosi-Katarmal, Almora 263643, Uttarakhand, India

a r t i c l e i n f o

Article history:Received 21 March 2013Received in revised form19 September 2013Accepted 20 September 2013Available online 26 October 2013

Keywords:Artemisia annuaArtemisinin biosynthesisHeavy metalsOxidative stressSuperoxide dismutase

a b s t r a c t

Effect of As(III), Cr(VI) and NaCl on plant growth, antioxidant enzymes, SOD, TBRAS, protein, cDNAamplification of key genes of artemisinin pathway and artemisinin biosynthesis have been investigatedto explore the actual changes in total herb and artemisinin yield in a crop cycle of Artemisia annua.Enhanced TBARS and SOD activity (4 U mg�1), decreased catalase activity and total cholorophyll contentwere observed under metal(loid) and NaCl stress. Accumulation of As (III; mg mg�1 DW) was higher inroots (10.7570.00) than shoot (0.4370.00) at 10 mg ml�1. While Cr(VI; mg ml�1 DW) accumulated morein shoots (3779.6, 41.177.2 and 52.71719.6). cDNA template of these treated plants along with controlwere amplified with HMGR, ADS and CYP71AV1 genes (artemisinin biosynthetic pathway genes);showed very low expression with Cr(VI) while As(III) (5 and 7.5 mg ml�1) showed higher expressionthan control. The results obtained from this study suggest that A. annua can grow well with favoringartemisinin biosynthesis with treatment of As(III) 5, 7.5 mg ml�1 and NaCl, while 10 mg ml�1 As(III) andall doses of Cr(VI) affect artemisinin synthesis. Finally some evidence also suggests that As(III), Cr(VI) andNaCl induces stress affects on total herb yield of plant.

& 2013 Elsevier Inc. All rights reserved.

1. Introduction

Artemisinin (a sesqueterpene lactone containing natural endo-peroxide), is an effective antimalarial drug extracted from leaves ofChinese medicinal herb Artemisia annua L. (Asteraceae; Lui et al.,1979). Because of increasing resistance of Plasmodium falciparumto traditional antimalarial drugs (quinine and chloroquine), arte-misinin and its derivatives have become the most importantagents in the treatment of cerebral malaria. It is a single drugwhich can be used against sensitive and resistance malariaparticularly in the form of artemisinin-based combination thera-pies (ACTs). A. annua is the only source of artemisinin but lowcontent (0.01–1.0 percent) of artemisinin makes it a relativelyexpensive drug and also received attention for enhancement by

using different breeding (Paul et al., 2010) and biotechnologicaltools. Artemisinin is also effective against a variety of otherdiseases, such as hepatitis B (Romero et al., 2005), parasites thatcause schistosomiasis (Borrmann et al., 2001), and a range ofcancer cell lines (Efferth et al., 2001; Singh and Lai, 2001).

A number of reports on food crops, vegetables, medicinal plantsand agricultural/fertile lands showing gradual and persistent effectof heavy metal toxicity. Higher or excess uptake of heavy metalsmay affect the natural resistance of plants to disease and secondarymetabolite synthesis (Nasim and Dhir, 2010). Moreover, someresearch results suggest that heavy metals may play an importantrole in triggering plant genes to alter the nature of secondarymetabolites, although the exact mechanism by which this happensis still unclear. Toxic effects of heavy metal on plant growth,development and metabolism were reported by many workers,which may affect total dry mass production and yield (Nasim andDhir, 2010; Manara, 2012). Heavy metals like As, Cr, Pb etc. causesdeleterious effects on plant physiological processes such as photo-synthesis, water relations and mineral nutrition. Metabolic altera-tions due to Cr exposure have also been described in plants by adirect effect on enzymes or other metabolites or by its ability togenerate reactive oxygen species which may cause oxidative stress.Formation of stress proteins is induced by any stress factorsincluding toxic metals (Manara, 2012). Alternatively there are alsoreports of increase of secondary metabolites in plant under stressconditions (Ramakrishna and Ravishankar, 2011).

Contents lists available at ScienceDirect

journal homepage: www.elsevier.com/locate/ecoenv

Ecotoxicology and Environmental Safety

0147-6513/$ - see front matter & 2013 Elsevier Inc. All rights reserved.http://dx.doi.org/10.1016/j.ecoenv.2013.09.025

Abbreviations: As(III), arsenic; Cr(VI), chromium; HNS, Hoagland's nutrientsolution; NaCl, sodium choloride; TBARS, 2-thiobarbituric acid reactive sub-stances; MDA, malondialdehyde; TCA, trichloroacetic acid; TBA, thiobarbituric acid;SOD, superoxide dismutase; NBT, nitroblue tetrazolium salt; HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase gene; ADS, amorpha-4, 11-diene synthase gene;CYP71AV1, amorpha-4, 11-diene 12-hydroxylase gene; DMRT, Duncan's multiplerange test; DW, dry weight; FW, fresh weight

n Correspondence to: Biotechnological Applications, G.B. Pant Institute ofHimalayan Environment and Development, Kosi-Katarmal, Almora 263 643,Uttarakhand, India. Fax: þ91 5962 241014, þ91 5962 241150.

E-mail addresses: shilpipaul77@yahoo.com, shilpipaul01@gmail.com (S. Paul).

Ecotoxicology and Environmental Safety 98 (2013) 59–65

African and some Asian countries are prone to malaria andheavy metal contaminations are also reported from these areasespecially Pb, As, Cr and Cd etc. It is reported that secondarymetabolite synthesis is affected when plant is growing underdifferent biotic, abiotic (including heavy metal) and environmentalstress. A dose of arsenic may enhance artemisinin biosynthesis(Rai et al., 2011) but higher dose may affect plant growth andmetabolism. Similarly under salinity stress (NaCl) artemisinincontent has also been enhanced (Qian et al., 2007) but there wereno reports on the effect of these metals in total herb andartemisinin yield in a crop cycle which was grown in suchcontaminated areas. Hence, an attempt has been made with thefollowing objectives. (1) To determine the impact of As(III), Cr(VI)and NaCl on the growth and overall physiological changes inplants, (2) effect of these compounds (at different doses) inartemisinin and total herb yield in a crop cycle and (3) study oncomparative cDNA amplification with artemisinin biosyntheticpathway genes in treated and untreated plants.

2. Materials and methods

2.1. Plant material and experimental procedure and design

The plant material was collected from institute's experimental field wherepopulation of A. annua have been maintained and material of parent plants weretaken from arboretum of the Institute (GBPIHED Kosi-Katarmal, Almora, Uttarak-hand, India) and analyzed for artemisinin content. The experiments were carriedout at poly house of Institute (1150 m amsl 29o38'15” N and 79o38'10” E). Based onartemisinin content, seeds of high yielding (0.3–0.5 percent) A. annua plants weredisinfected with 0.1 percent HgCl2 for 1 min and washed thoroughly for 5 times.Seeds were transferred in a tray between moist filter paper for 15–20 d in dark with2572 1C. Then seedlings were transferred in acid treated sand with continuoussupply of 30 percent Hoagland's nutrient solution (HNS) for 2 months beforetreatment. Three arsenic {As (III)}, chromium {Cr(VI)} and two NaCl treatmentswere made using K2Cr2O7, As2O3 (5.0, 7.5, and 10 mg ml�1) and NaCl (2 and 4 g l� l)along with control were used, respectively. The experiment was conducted withfive replicates for 180 d. Fresh leaves were used for biochemical analysis.

2.2. Plant growth parameters

Quantitative characters in the form of plant height (cm), number of primaryand secondary branches, leaf length (cm), leaf width (cm), fresh weight (mg) androot length (cm) were recorded at the time of harvesting of each replicates. Theharvested root and shoot biomass were subjected to different biochemical andmolecular analysis and air shade dried leaf (approximately 15–20 percent moisture)material was subjected for chemical analysis (artemisinin).

2.3. Chlorophyll content

Total chlorophyll content in fresh leaves was estimated following method ofLichtenthaler and Buschmann (2001). The fresh tissue of leaf was ground using amortar and pestle containing 2 ml of 80 percent acetone. The absorbance ofsolution was recorded at 662 and 645 nm for chlorophyll estimation usingspectrophotometer (Amersham Biosciences, Ultrospec 2100 pro, USA).

2.4. Lipid peroxidation (TBARS) and protein content

Oxidative damage in leaf lipids was estimated by content of total2-thiobarbituric acid reactive substances (TBARS; nmol g�1) expressed as equiva-lents of malondialdehyde (MDA). TBARS content (fresh weight) was estimated bymethod of Cakmak and Horst (1991). TBARS was extracted from 0.5 g fresh leaves,ground in 5 ml of 0.1 percent (w/v) trichloroacetic acid (TCA). Ground material wascentrifuged at 12000g for 5 min, 1 ml from supernatant was taken and added to4 ml of 0.5 percent (w/v) TBA in 20 percent (w/v) TCA. Samples were incubated at90 1C for 30 min. The reaction was stopped in ice bath and centrifuged at 10000gfor 5 min. Absorbance of the supernatant was taken at 532 nm on a spectro-photometer (Amersham Biosciences, Ultrospec 2100 pro, USA) and corrected fornon-specific turbidity by subtracting the absorbance at 600 nm. Protein wasisolated following the protocol of Ni et al. (1996) using QB buffer and estimatedwith Bradford (1976) method.

2.5. Antioxidant enzymes assay

Catalase activity was measured following method of Chandlee and Scandalios(1984) with small modification. The assay mixture contained 2.6 ml of 50 mMpotassium phosphate buffer (pH 7.0), 0.4 ml of 15 mM H2O2 and 0.04 ml of enzymeextract. The decomposition of H2O2 was followed by decline in absorbance at240 nm. The enzyme activity was expressed in U mg�1 protein (U¼1 mM of H2O2

reduction min�1 mg�1 protein).Superoxide dismutase activity was assayed as given by Beauchamp and

Fridovich (1971). The reaction mixture contained 1.17�10�6 M riboflavin,5.6�10�5 M nitroblue tetrazolium salt (NBT) dissolved in 3 ml of 0.05 M sodiumphosphate buffer (pH 7.8) and 3 ml of reaction medium was added to 1 ml ofenzyme extract. The mixtures were kept under fluorescent light (Philips 40 W). Thereaction was initiated at 30 1C for 1 h. Identical solutions that were kept under darkserved as blanks. The absorbance was taken at 560 nm in spectrophotometeragainst the blank and the activity of SOD has been measured in U/mg FW.

2.6. Extraction of artemisinin

Artemisinin content was estimated at three different stages (before treatment,7 d after treatment and at time of harvesting i.e., 180 d). Air shade dried plantmaterial of all plants were powdered and 0.1 g each were extracted in 10 ml hexaneby initial heating at 50 1C for 3 min and left overnight at room temperature. Theextract was then filtered and evaporated on water bath at 50 1C. After evaporation,extract was dissolved in 1 ml acetonitrile and 20 ml was injected in HPLC (KontronInstruments, Milan, Italy) using RP18 column (Lichrosort, 250�4.6 mm2 id, 5 mm)and eluted isocratically with acetonitrile and water (70:30 v/v, flow rate 0.75 ml/min).Detection was carried out at 210 nm using an online UV detector, the results werecompared and level of artemisinin was estimated using a dose response curve madewith standard Artemisinin (Sigma, USA).

2.7. Metal accumulation

The oven-dried tissue samples were ground and acid digested and As(III) andCr(VI) were estimated following the method of Sinha et al. (2010).

2.8. Isolation and amplification of RNA

Total RNA was isolated from leaf tissue of treated along with control plants byusing total RNA isolation kit (Merck Biosciences Germany). First strand cDNAsynthesis was done following the manufacturer's protocol (Biorad, USA). Primers ofthree key genes of artemisinin biosynthetic pathway (encoding HMGR, 3-hydroxy-3-methylglutaryl-CoA reductase Chen et al., 2000 Gene bank no AF142473) ofMevalonate (MVA) pathway, ADS (amorpha-4,11-diene synthase; Mercke et al.,2000, Gene bank no EF197888), and CYP71AV1 (CYP71AV1, amorpha-4,11-diene 12-hydroxylase enzymes; Ro et al., 2005 and Teoh et al., 2006; Gene bank no DQ268763)were used for amplification. Polymerase chain reactions (PCR) were carried out in25 μl volume. A reaction tube contained 1 mg of cDNA, 0.3 units of Taq DNApolymerase, 5 mM of each dNTPs, 1.5 mM MgCl2 and 10 pmol of HMGR (F(forward)-5′GGTCAGGATCCGGCCCAAAACATT3′; R (reverse)-5′CCAGCCAACACCGAACCAGCAACT3′), ADS (F-5′ATACAACGGGCACTAAAGCAAC C3′; R-5′GAAAACTCTAGCCCGGGAATACTG3′) and CYP71AV1 (F-5′GGTCAGGATCCG GCCCAAAACATT3′; R-5′CCAGCCAACACCGAACCAGCAACT3′) primers. The amplification was carried out using94 1C for 5 min, 94 1C for 30 s, 56 1C for 30 s, 72 1C for 2 min and final extension was72 1C for 8 min for 35 cycles in thermal cycler (Biometra, Germany). Furtherquantification of different genes was determined by comparing with equal amountof cDNA template on formaldehyde gel.

2.9. Statistical analysis

Each plant in pot was treated as one replication and all treatments werereplicated five times. The data was analyzed statistically using SPSS-17 statisticalsoftware (SPSS Inc., Chicago, IL, USA). Mean values were statistically compared byDuncan's Multiple Range Test (DMRT) at po0.05 percent level using differentletters.

3. Results

3.1. Plant growth parameters

The presence of As(III) and Cr(VI) in acid wash sand supple-mented with Hoaglands solutions showed significantly lowerplant height, branching pattern in terms of number of primaryand secondary branches and leaf morphology than the control.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–6560

Arsenic treated plants showed reverse trend in plant height(72719.28, 69712.66, and 60.33717.61), number of primarybranches (87.5727.18, 79.33735.90 and 72714.79) and leafwidth with increase in As(III) supplementation and increasingtrend with number of secondary branches (2078.54, 21.6675.5,and 2872.64) and leaf length (5.6670.57, 6.071 and 7.371.5).No specific trend was observed in Cr(VI) exposed plants. Rootlength was severely affected with supplementations of both heavymetals. Similarly, with the supplement of NaCl (2 and 4 g l� l), at adose of 4 g l� l showed only 47 cm of plant height which wasalmost half of the control, while no change was observed in root

length. Significant effect was also found in growth parameters(plant height, number of primary and secondary branches, leafmorphology and fresh weight) of plants treated with 4 gm l� l NaCl(Fig. 1a, b and c). The presence of As(III) and Cr(VI) in sand mediumsignificantly lowered the values for growth attributes (herb para-meters). Shoot length noted in all As(III) and Cr(VI) treated plantswas more than 25 percent lower than control plants suggestingreduced growth under toxic effect. The total herb yield and rootlength were also affected by both the metal toxicity compared toother phenotypic attributes.

3.2. Metal accumulation

Arsenic level was significantly high (10.75) in roots at a dose of10 mg ml�1. A dose of 5 mg ml�1 was not affect the stem and leaf,while 0.43 and 0.56 mg mg�1 (dry weight) was observed whensupplemented with 10 mg ml�1. Although very little amount(0.1570) was found in stem supplemented with As(III) 7.5 mg ml�1.Accumulation of Cr(VI) was higher (3779.6, 41.177.2 and52.7719.6) in treated shoot than roots and control (Fig. 2).

3.3. Artemisinin content

As A. annua is open pollinated crop hence artemisinin contentis differs from plant to plant. Before treatment estimation ofartemisinin content was required to determine the actual effectof dose in artemisinin synthesis. Therefore, artemisinin contentwas estimated at three different stages. Increased artemisinincontent was observed in As(III) 5 and 7.5 mg ml�1 (0.3–0.37–0.3and 0.48–0.50–0.45 percent) from before treatment to 7 d aftertreatment, while slightly decreased at the time of harvesting i.e.180 d. Decreasing trend was observed in As(III) 10 mg ml�1(0.4–0.37–0.37 percent) as compared with the control. Cr(VI) showedvery low artemisnin content in all the treated plants in every stageof treatment. Interestingly, increasing trend was observed in NaCltreated (Fig. 3).

3.4. Biochemical activity

Plants have evolved a well regulated mechanism which effectsthe general production of antioxidant enzymes (SOD and catalase),TBARS, total protein and chlorophyll. Catalase activity wasdecreased with increase amount of As(III), while with Cr(VI),it was on higher side at 7.5 mg ml�1. When plants were treatedwith 2 and 4 g l� l NaCl, increasing trend was observed whilecontrol had high catalase activity (Fig. 4A and A1). Compared tocontrol, the activity of SOD was significantly increased with 5 and7.5 mg ml�1 dose of As(III) and NaCl (4 g l� l) while significantly

Fig. 1. (a) Effect of different doses of As(III) on morphological characters of plants,(b) effect of different doses of Cr(VI) on morphological characters of plants and(c) morphological variations in NaCl treated and control plants.Note: PH — plant height; NPB — number of primary branches; NSB — number ofsecondary branches; LL — leaf length; LW— leaf width; FW — fresh weight of plant;RL — root length. All values are mean of five replicates ±SD and values marked withsimilar letters are not significantly different (Duncan’s test, po0.05).Values withsame Letters are not significantly different (po0.05, DMRT).

Fig. 2. Accumulation of As(III) and Cr(VI) (µg mg-1) in different parts of treated andcontrol plants. All values are mean of five replicates ±SD and values marked withsimilar letters are not significantly different (Duncan’s test, po0.05).Values withsame Letters are not significantly different (po0.05, DMRT).

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65 61

decreased in all the doses of Cr(VI) treated plants (Fig. 4B and B1).Unlike the above parameters, values of TBARS content and anti-oxidant enzymes were significantly enhanced in plants subjectedto As(III), Cr(VI) and NaCl stress. The TBARS content was measuredas an indicator of oxidative stress/membrane damage and itincreased progressively in plants treated with different concentra-tions of As(III) and Cr(VI). There was high TBARS activity in plantsreceiving 10 mg ml�1 As(III) and Cr(VI) treatments (89.94 and 88.7

percent), most pronounced effect was found on 10.0 mg ml�1

concentration. Similar observation was also noted with NaCltreated plants (Fig.4C and C1). Chlorophyll content was alsoreduced in As(III) and Cr(VI) stressed plants and the most toxiceffect was noted at 10.0 mg mg�1 concentration (Fig.5A and A1).The total soluble protein slightly (12.5 percent) decreased withincrease in all the concentration of As(III) and Cr(VI) used in thestudy. Parallely increasing trend was also found in plants supple-mented with 2–4 gm l� l NaCl (Fig. 5B and B1).

3.5. RNA analysis

RNA amplification showed deferent level of amplificationHMGR, ADS, CYP71AV1 genes with different treatments of heavymetals and NaCl. Arsenic (5 and 7.5 mg ml�1) and NaCl showedmore expressions as compared with control while low expressionswas observed with As(III) 10 mg ml�1. Similarly significantly lowexpressions were observed with Cr(VI) treated plants (Fig. 6).

4. Discussion

These days contamination of ecosystems and metal (loids)toxicity to plants are one of the major problems in many placesof world. As a consequence of geological and/or anthropogenicactivities and other sources most of these metals are present in

Fig. 3. Effect of As(III), Cr(VI) and NaCl doses on artemisinin content (% dry wt) inplants. Note: 7 d: seventh day after treatment, 180 d: after 180 days of treatment orat the time of harvesting. All values are mean of five replicates ±SD and valuesmarked with similar letters are not significantly different (Duncan’s test, po0.05).Values with same Letters are not significantly different (po0.05, DMRT).

Fig. 4. Effect of different concentrations of As(III), Cr(VI) and NaCl treatment on the activities of different antioxidant enzymes in A. annua. (A and A1) catalase activity; (B andB1) SOD; (C and C1) TBARS. All values are mean of five replicates ±SD and values marked with similar letters are not significantly different (Duncan’s test, po0.05).Valueswith same Letters are not significantly different (po0.05, DMRT).

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–6562

environment. In plant, uptake of metal and its accumulations aredifferent characteristics which can affect metabolism of plants.Heavy metals can affect secondary metabolite synthesis; some-times they produce specific metabolites which can detoxify someof toxic metals (Nasim and Dhir, 2010). These days a number ofheavy metals are reported which can play specific role in plantgrowth and essential plant mineral transport system (Shankeret al., 2005). Since plants do not have defined transport system fortoxic metals hence it is transported by various transporters ofessential ions such as sulfate or iron and phosphorous. Toxiceffects of Cr(VI) on plant growth and development include altera-tions in the germination process as well as the growth of roots,

stems and leaves, which may affect total production and artemi-sinin yield. However Cr(VI) has also been reported to increasesecondary metabolites in Datura inoxia (Vernay et al. 2008).Another important threat of agricultural ecosystem world over isthe presence of salt in soil. Based on FAO/ UNESCO report about394 million hectare land is saline and 434 million hectare land issodic (Massoud, 1977).

The present investigation is preliminary study on effect ofmajor heavy metal in artemisinin biosynthesis. Although, Raiet al. (2011) studied the effect of As(III) in biosynthesis ofartemisinin but they have not reported the effect on the plantgrowth, total herb and artemisinin yield in a complete crop cycle.In the present study a dose dependent decrease in artemisinincontent was observed in plants; however, accumulation was notproportional to supplied As(III). This phenomenon may not beattributed solely to unavailability of As(III) due to adsorption ofthis metal to sand which affect the level of biochemical para-meters like lipid peroxidation, SOD catalase activity etc. Similarobservations were also made by Gulz et al. (2005) in commonplants from contaminated soil. Higher accumulation of As(III) inthe roots of A. annua did not affect significantly in artemisininbiosynthesis at the time of harvesting however a decreasing trendwas observed. Accumulation of As in different parts of plants mayvary in different genotypes in Holcus lantus (Meharg and Macnair,1992). When plants are exposed to toxic metals, tolerancemechanism exhibited by the plant stops uptake of metal, henceas a results metal gets accumulated in roots (Artus, 2006).

Decline in growth parameters has been considered to be ameasure of toxicity of heavy metal and salinity doses, as no otherstress was provided. The percentage decline in fresh weight androot length in presence of NaCl was more than As(III) and Cr(VI).

Fig. 5. Effect of different concentrations of As(III), Cr (VI) and NaCl treatment on the activities of total chlorophyll and soluble proteins in A. annua. ((A and A1) totalchlorophyll (mg g�1 FW) and (B and B1) total soluble protein (mg g�1 FW). All values are mean of five replicates 7SD and values marked with similar letters are notsignificantly different (Duncan's test, po0.05). Values with the same letters are not significantly different (po0.05, DMRT).

HMGR

ADS

CYP71AV1

As(III) NaCl Cr(VI)1 2 3 4 1 2 3 1 2 3 4

As(III) NaCl Cr(VI)1 2 3 4 1 2 3 1 2 3 4

As(III) NaCl Cr(VI)1 2 3 4 1 2 3 1 2 3 4

Fig. 6. cDNA amplification of key genes of artemisinin biosynthetic pathway intreated and non treated plants.As:- Arsenic: – 1:- 5 mg ml�1; 2:- 7.5 mg ml�1; 3:- 10 mg ml�1; 4:- Control.NaCl:- 1:- 2 g l�1; 2:- 4 g l�1; 3:- Control.Cr:- Chromium: – 1:- 5 mg ml�1; 2:- 7.5 mg ml�1; 3:- 10 mg ml�1; 4:- Control.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65 63

The decrease in total chlorophyll was more in As(III) than Cr(VI)after 180 d, which demonstrates that As(III) and Cr(VI) castedmore biochemical, affect while NaCl casted more morphologicalaffect on plants. Very low concentrations of As may not affect plantgrowth and pigments, which has been reported in several plantslike tomato (Carbonell-Barrachina et al., 1998) and bean(Carbonell-Barrachina et al., 1997) etc. However, with furtherincreased As(III) concentration, it becomes toxic to whole plantcausing chlorosis, necrosis, inhibition of growth and finally death.Hence, the observed higher As(III) and Cr(VI) doses leading todeclining the total chlorophyll content in the fresh weight and rootlength after 180 d indicates that plants were significantly affectedby these metalloids. Lipid peroxidation has been identified as asensitive indicator of heavy metal (loid) toxicity, and is being usedas a toxicity bioassay for plants. It is suggested that inhibition ofkey enzyme systems, together with electron leakage during con-version of As(V)–As(III), leads to formation of ROS, which in turncauses lipid peroxidation (Zhao et al., 2009). Both levels of TBARSand SOD are indicative of status of oxidative stress prevalent in alltreated plant. The higher levels of TBARS and SOD in plants weresuggestive of the fact that plant was undergoing through a higheroxidative stress, which was in agreement with other parameters,i.e. heavy metal uptake and its accumulation, chlorophyll andgrowth parameters. Similarly, Gunes et al. (2009) observed con-centrations of H2O2 and lipid peroxidation increase in chickpeaplants against As(III) treatment. Singh et al. (2007) observedincrease in MDA content in Phaseolus aureus exposed to 10.0 and50.0 mM of As(V) without any significant change in H2O2 content.It has been well documented that exposure of plants to As(III) andAs(V) induces production of ROS, including superoxide (O�

2 ),hydroxyl radical (OH), and H2O2 (Hartley-Whitaker et al., 2001;Singh et al., 2006; Mallick et al., 2011). ROS can damage proteins,amino acids, purine and nucleic acids and also cause peroxidationof membrane lipids (Moller et al., 2007).

Arsenic(III) is 10 times more toxic than As(V) hence theobserved changes were reduction in size of plants, mainly in As(III)treated plants; however, there were no visible sign of As toxicity inplants at 5.and 7.5 mg ml�1 concentration. PCs synthase gene mayaffect the artemisinin biosynthesis which was measured after 7 dof treatment (Rai et al., 2011). Significant increase in the levels ofthiols, GSH, and pcs gene transcript up to 3,000 μg l�1 and level ofexpression of artemisinin biosynthetic pathway gene like HMGR,FDS, ADS, and CYP71AV1 were reported. In the present investiga-tion artemisinin content was increase with the increase of As(III)at 5 and 7.5 µg ml-1 level but the total herb yield was decreasedwith increase of artremisinin content along with the expression ofthese genes.

It was observed in the present investigation artemisinin andherb yield were severely affected with Cr(VI) doses. It also affectsmechanisms of metabolism of alkaloids derivative of quinolizidine,tropane, isoquinoline, and indole. Some of the approaches relatedto the physical stress have been previously attempted to enhanceartemisinin production (Mannan et al., 2010). Chromium uptakeand transport are dependent on its chemical form and hexavalentspecies is more mobile than the trivalent one. (de la Rosa et al.,2005; Han et al., 2004). De la Rosa et al. (2005) reported thataccumulation of Cr(VI) in the upper plant parts was 12–18 timeshigher for hexavalent than for trivalent Cr. The uptake of Cr(VI) ispassive diffusion and this ion interacts with cell walls throughcation-exchange sites (Han et al., 2004). Absorption moves moreeasily from roots to upper plants tissues and probably correlateswith sulfate transport system located in plasma membrane (Kimet al., 2006). Being a non-essential element and also toxic forplants, there is no specific mechanism for Cr(VI) transport throughplants and this metal is known to compete with iron andmanganese for transport binding sites. In Bacopa, DNA damage

was observed in presence of Cr (Saikia et al., 2012) which affectsthe level of expression of genes.

There were a number of reports on other nutrient compoundslike NO3/NH4, NaCl etc. which affects artemisinin biosynthesis.In hairy root culture; Wang and Tan (2002) has regulated the ratioof NO3/NH4 and total initial nitrogen concentration to increase theartemisinin concentration (57 percent). The enhancement ofartemisinin content caused by 2 g l�1 NaCl stress was not sig-nificantly compared to control, but enhancement caused by 4 g l�1

NaCl stress was extremely significant (Po0.01) compared to thecontrol (Qian et al., 2007). Salinity stress may inhibit the devel-opment of A. annua plants, but influences the contents of artemi-sinin in plants while low level salinity stress (2–4 g l� l) does nothamper much growth and metabolism of plants.

5. Conclusions

Artemisinin content is major concern in A. annua cultivation,studies on heavy metal and salinity stress tolerant plants canprovide information on total artemisinin and herb yield for largescale production especially for African and Asian countries, wheremalaria is prone and lands were affected with heavy metal andsalinity. The inference drawn from this study is that artemisininbiosynthesis is affected with application of 10 mg ml�1 As (III), 5,7.5 and 10 mg ml�1 Cr(VI). Whereas NaCl and As(III) 5, 7.5 mg ml�1

may help to enhance artemisinin biosynthesis. Plant growth wasaffected with all the doses of heavy metal and NaCl. This suggestedthat where arsenic toxicity is near/more than 10 mg ml�1 level,A. annua plant can survive and artemisinin synthesis will bedecrease. Similarly plant growth and artemisinin will also beaffected in Cr(VI) rich area. In saline areas artemisinin contentmay be enhanced but plant growth will be affected negatively.

Acknowledgments

The authors are grateful to Director of G. B. Pant Institute ofHimalayan Environment Development (An autonomous instituteof the Ministry of Environment and Forestry, MoEF, Govt. of India)Almora for availing the necessary resources towards this study.Thanks is due to Dr. Shekhar Mallick (Scientist, NBRI) for criticalsuggestion and editing. Thanks are also due to Drs. RS Rawal, AnitaPandey, SK Nandi, and central facility of the institute for providinginitial plant material from arboretum, HPLC, spectrophotometerand other instruments. Thanks are also due to MoEF for providingfinancial support for this study.

References

Artus, N.N., 2006. Arsenic and cadmium phytoextraction potential of crambecompared with Indian mustard. Journal of Plant Nutrition 29, 667–679.

Beauchamp, C.O., Fridovich, I., 1971. Superoxide dismutase: improved assays and anassay applicable to acrylamide gels. Annual Review of Biochemistry 44,276–287.

Borrmann, S.N., Szlezak, J.F., Faucher, P.B., Matsiegui, R., Neubauer, R.K., Biner, B.L.,Kremsner, P.G., 2001. Artesunate and praziquantel for the treatment ofSchistosoma haematobium infections: a double blind, randomized, placebo-controlled study. Journal of Infectious Diseases 184, 1363–1366.

Bradford, M.M., 1976. A rapid and sensitive method for the quantization ofmicrogram quantities of protein utilizing the principle of protein dye binding.Analytical Biochemistry 72, 248–254.

Cakmak, I., Horst, J., 1991. Effect of aluminium of lipid peroxidation, superoxidedismutase, catalase and peroxidase activities in root tips of soybean (Glycinemax). Physiologia Plantarum 83, 463–468.

Carbonell-Barrachina, A.A., Burlo, F., Lopez, E., Mataix, J., 1998. Tomato plantnutrition as affected by arsenic concentration. Journal of Plant Nutrition 21,235–244.

Carbonell-Barrachina, A.A., Burlo Carbonell, F., Mataix-Beneyto, J., 1997. Effect ofsodium arsenite and sodium chloride on bean plant nutrition (macronutrients).Journal of Plant Nutrition 20, 1617–1633.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–6564

Chandlee, J.M., Scandalios, J.G., 1984. Analysis of variants affecting the catalasedevelopment program in maize scutellum. Theoretical and Applied Genetic 69,71–77.

Chen, D.H., Ye, H.C., Li, G.F., 2000. Expression of a chimeric farnesyl diphosphatesynthase gene in Artemisia annua L. transgenic plants via Agrobacteriumtumefaciens-mediated transformation. Plant Science 155, 179–185.

de la Rosa, G., Peralta-Videa, J.R., Montes, M., Gardea-Torresdey, J.L., 2005. A studyof the differential uptake and transportation of trivalent and hexavalentchromium by tumbleweed (Salsola kali). Archives of Environmental Contam-ination and Toxicology 48, 225–232.

Efferth, T., Dunstan, H., Sauerbrey, A., Miyachi, H., Chitambar, C.R., 2001. The anti-malarial artesunate is also active against cancer. International Journal ofOncology 18, 767–773.

Gulz, P.A., Gupta, S.K., Schulin, R., 2005. Arsenic accumulation of common plantsfrom contaminated soils. Plant and Soil 272, 337–347.

Gunes, A., Pilbeam, D.J., Inal, A., 2009. Effect of arsenic–phosphorus interaction onarsenic-induced oxidative stress in chickpea plants. Plant and Soil 314,211–220.

Han, F.X., Maruthi, Sridhar, B.B., Monts, D.L., Su, Y., 2004. Phytoavailability andtoxicity of trivalent and hexavalent chromium to Brassica juncea. New Phytol-ogist 162, 489–499.

Hartley-Whitaker, J., Ainswort, G., Meharg, A.A., 2001. Copper and arsenate inducedoxidative stress in Holcus lanatus L. clones with differential sensitivity. Plant,Cell and Environment 24, 713–722.

Kim, Y.J., Kim, J.H., Lee, C.E., Mok, Y.G., Choi, J.S., Shin, H.S., Hwang, S., 2006.Expression of yeast transcriptional activator MSN1 promotes accumulation ofchromium and sulfur by enhancing sulfate transporter level in plants. FEBSLetter 580, 206–210.

Lichtenthaler, H.K., Buschmann, C., 2001. Chlorophylls and carotenoids: measure-ment and characterization by UV–vis spectroscopy, Current Protocols in FoodAnalytical Chemistry. John Wiley and Sons, New York, pp. F4.3.1–F4.3.8.

Liu, J.M., Ni, M.Y., Fan, J.F., Tu, Y.Y., Wu, Z.H., Wu, Y.L., Chou, W.S., 1979. Structure andreaction of arteannuin. Acta Chimica Sinica 37, 120–143.

Mallick, S., Sinam, G., Sinha, S., 2011. Study on arsenate tolerant and sensitivecultivars of Zea mays L.: differential detoxification mechanism and effect onnutrients status. Ecotoxicology and Environmental Safety 74, 1316–13220.

Manara, A., 2012. Plant Responses to Heavy Metal Toxicity A. Furini (ed.), Plants andHeavy Metals, Springer Briefs in Biometals, 10.1007/978-94-007-4441-7_2.

Mannan, A., Liu, C., Arsenault, P.R., Towler, M.J., Vail, D.R., Lorence, A., Weathers, P.J.,2010. DMSO triggers the generation of ROS leading to an increase in artemisininand dihydroartemisinic acid in Artemisia annua shoot cultures. Plant CellReports 29 (2), 143–152.

Meharg, A.A., Macnair, M.R., 1992. An altered phosphate uptake system in arsenate-tolerant Holcus lanatus L. New Phyto 116, 29–35.

Massoud, F.I., 1977. Basic principles for prognosis and monitoring of salinity andsodicity. In: Proceedings of the International Conference on Managing SalineWater for Irrigation. Texas Tech. University, Lubbock, Texas. 16–20 August 1976.pp. 432–454.

Mercke, P., Bengtsson, M., Bouwmeester, H.J., Posthumus, M.A., Brodelius, P.E.,2000. Molecular cloning, expression, and characterization of amorpha-4,11-diene synthase, a key enzyme of artemisinin biosynthesis in Artemisia annua L.Archives of Biochemistry and Biophysics 381, 173–180.

Møller, I.M., Jensen, P.E., Hansson, A., 2007. Oxidative modifications to cellularcomponents in plants. Annual Review of Plant Biology 58, 459–481.

Nasim, S.A., Dhir, B., 2010. Heavy metals alter the potency of medicinal plants.Reviews of Environmental Contamination and Toxicology 203, 139–149, http://dx.doi.org/10.1007/978-1-4419-1352-4_5.

Ni, M., Dehesh, K., Tepperman, J.M., Quail, P.H., 1996. GT-2: in vivo transcriptionalactivation activity and definition of novel twin DNA binding domains withreciprocal target sequence selectivity. Plant Cell 8, 1041–1059.

Paul, S., Khanuja, S.P.S., Shasany, A.K., Gupta, M.M., Darokar, M.P., Saikia, D., Gupta, A.K.,2010. Enhancement of artemisinin content through four cycles of recurrentselection with relation to heritability, correlation and molecular marker inArtemisia annua L. Planta Medica 76, 1468–1472.

Qian, Z., Ling, Ke Gong., Jianbing, Z., Fuyuan, L., Yueyue, J., Shaobo, W., Guofeng, G.,Kexuan, T. A, W., 2007. Simple and efficient procedure to enhance artemisinincontent in Artemisia annua L by seeding to salinity stress. African Journal ofBiotechnology 6 (12), 1410–1413.

Rai, R., Pandey, S., Rai, S.P., 2011. Arsenic-induced changes in morphological,physiological, and biochemical attributes and artemisinin biosynthesis inArtemisia annua, an antimalarial plant. Ecotoxicology 20 (8), 1900–1913.

Ramakrishna, A., Ravishankar, G.A., 2011. Influence of abiotic stress signalson secondary metabolites in plants. Plant Signaling and Behavior 6 (11),1720–1731.

Romero, M.R., Efferth, T., Serrano, M.A., Macias, R.I., Briz, O., Marin, J.J., 2005. Effectof artemisinin/artesunate as inhibitors of hepatitis B virus production in an “invitro” replicative system. Antiviral Research 68 (2), 75–83.

Ro, D.K., Arimura, G., Lau, S.Y., Piers, E., Bohlmann, J., 2005. Loblolly pineabietadienol/abietadienal oxidase PtAO (CYP720B1) is a multifunctional, multi-substrate cytochrome P450 mono oxygenase. PNAS, USA 102, 8060–8065.

Shanker, A.K., Cervantes, C., Loza-Tavera, H., Vudainayagam, S., 2005. Chromiumtoxicity in plants. Environment International 31, 739–753.

Saikia, S.K., Mishra, A.K., Tiwari, S., Pandey, R., 2012. Hexavalent chromium inducedhistological alterations in Bacopa monnieri (L.) and assessment of geneticvariance. Journal of Cytology and Histology 3, 2–8.

Singh, H.P., Batish, D.R., Kholi, R.K., Arora, K., 2007. Arsenic-induced root growthinhibition in mung bean (Phaseolus aureus Roxb.) is due to oxidative stressresulting from enhanced lipid peroxidation. Journal of Plant Growth Regulation53, 65–73.

Singh, N., Lai, P., 2001. Selective toxicity of dihydroartemisinin and holo transferr intoward human breast cancer cells. Life Science 70, 49–56.

Singh, N., Ma, L.Q., Srivastava, M., Rathinasabapathi, B., 2006. Meta- bolic adaptationsto arsenic induced oxidative stress in Pteris vittata L. and Pteris ensiformis L. PlantScience 170, 274–282.

Sinha, S., Sinam, G., Mishra, R.K., Mallick, S., 2010. Metal accumulation, growth,antioxidants and oil yield of Brassica juncea L. exposed to different metals.Ecotoxicology and Environmental Safety 73, 1352–1361.

Teoh, K.H., Polichuk, D.R., Reed, D.W., Nowak, G., Covello, P.S., 2006. Artemisia annua L.(Asteraceae) trichome-specific cDNAs reveal CYP71AV1, a cytochrome P450 witha key role in the biosynthesis of the antimalarial sesquiterpene lactone artemi-sinin. FEBS Letters 580, 1411–1416.

Vernay, P., Gauthier-Moussard, C., Jean, L., Bordas, F., Faure, O., Ledoigt, G., Hitmi, A.,2008. Effect of chromium species on phytochemical and physiological para-meters in Datura innoxia. Chemosphere 72 (5), 763–771.

Wang, J.W., Tan, R.X., 2002. Artemisinin production in Artemisia annua hair rootcultures with improved growth by altering the nitrogen source in the medium.Biotechnology Letters 24, 1153–1156.

Zhao, F.J., Ma, J.F., Meharg, A.A., McGrath, S.P., 2009. Arsenic uptake and metabolismin plants. New Phytologist 181, 777–794.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65 65