ars.els-cdn.com · web viewthe mass spectrum analyzed by maldi-tof/ms were previously reported. 1...
TRANSCRIPT
Journal of Controlled Release
Supporting Information
A study of the endocytosis mechanism and transendothelial activity
of lung-targeted GALA-modified liposomes
Sarochin Santiwarangkool,a,1 Hidetaka Akita,b,1 Ikramy A. Khalil,c,d Mahmoud M. Abd Elwakil,c Yusuke
Sato,a Kenji Kusumoto,e Hideyoshi Harashimaa,c,*
aLaboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences, Hokkaido
University, Sapporo 060-0812, Japan
bLaboratory of Pharmacology and Toxicology, Graduate School of Pharmaceutical Sciences, Chiba
University, Chiba 260-8675, Japan
cLaboratory of Innovative Nanomedicine, Faculty of Pharmaceutical Sciences, Hokkaido University,
Sapporo 060-0812, Japan
dDepartment of Pharmaceutics, Faculty of Pharmacy, Assiut University, Assiut 71526, Egypt
eFormulation Research Lab., Taiho Pharmaceutical Co., Ltd., 224-2, Ebisuno, Hiraishi, Kawauchi-cho,
Tokushima 771-0194, Japan.
1These authors equally contributed to this work.
*Address correspondence to (H. Harashima) at Faculty of Pharmaceutical Sciences, Hokkaido University,
Kita 12, Nishi 6, Kita-ku, Sapporo 060-0812, Japan. Tel.: +81 11 706 3919; fax: +81 11 706 4879. E-mail
address: [email protected]
Supplementary Methods
Materials
Anti-podoplanin siRNA (Anti-Pdpn) siRNAs were purchased from Hokkaido System
Science Co., Ltd. (Sapporo, Japan). Primers and probes for Pdpn and GADPH were ordered
from Sigma-Aldrich (St. Louis, MO, USA). Sequence information of siRNAs, primers, and
probes was listed in Supplementary Table S3 and S4, respectively. Cysteine-terminated GALA
(Cys-GALA) was purchased from PolyPeptide Laboratories (San Diego, CA, USA). Egg
phosphatidylcholine (EPC) and Cholesterol (Chol) was ordered from AVANTI Polar Lipids
(Alabaster, AL, USA). Hank’s balanced salt solution (HBSS) and purified normal mouse serum
IgG (Whole Molecule) were purchased from Wako Pure Chemicals (Osaka, Japan). EGMTM-
2MV BulleKitTM medium was purchased from Lonza, Ltd. (Basel, Switzerland). 1,1’-dioctadecyl-
3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzene sulfonate salt (DiD) and 1,1’-
dioctadecyl-3,3,3’,3’-tetramethyl indocarbocyanine-5,5’-di-sulfonic acid (DiI) were purchased
from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). 1,2-distearoyl-sn-glycero-N-
[maleimide(polyethylene glycol)-2000] (DSG-PEG2000-MAL) and N-[(3-Maleimide-1-
oxopropyl)aminopropyl polyethyleneglycol-carbamyl] distearoyl phosphatidyl-ethanolamine
(MW=5,000; DSPE-PEG5000-MAL) were purchased from NOF Corporation (Tokyo, Japan).
Alexa Fluor® 488-conjugated Dextran (MW=10,000), Alexa Fluor® 488-conjugated
Cholera Toxin Subunit B (Recombinant; CTB) and Alexa Fluor® 647-conjugated Transferrin (Tf)
From Human Serum were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).
Filipin III from Streptomyces filipinensis, chlorpromazine hydrochloride, and amiloride
hydrochloride hydrate was purchased from Sigma-Aldrich, Co., LLC. (St.Louis, Missouri, USA).
Hoechst 33342 and 2-[4-(2-Hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) were
obtained from Dojindo Laboratories (Kumamoto, Japan). Trizol® Reagent and Quant-iTTM
RiboGreen assay were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).
ThunderbirdTM SYBR® qPCR Mix and ReverTra Ace® qPCR RT Master Mix with gDNA
Remover was purchased from Toyobo Co., Ltd. (Osaka, Japan). RPMI-1640 medium, 1 M
HEPES buffer, RBC lysis buffer and Triton X-100 were purchased from Sigma-Aldrich (St.
Louis, MO, USA). Glycogen (M.B.) was acquired from GMbiolab Co., Ltd. (Taichung, Taiwan).
Type I collagenase and crystallized elastase from porcine pancreas (High purity) was
purchased from EMD Millipore Corp. (Billerica, MA, USA). DNase I from bovine pancreas was
ordered from Worthington Biochemical Corp. (Lakewood, NJ, USA). Purified anti-mouse
CD16/CD32 antibody (Clone: 2.4G2) and FITC anti-mouse CD45 antibody (Clone: 30-F11)
were ordered from Tonbo Biosciences (San Diego, CA, USA). FITC anti-mouse CD31 antibody
(Clone: 390), PE anti-mouse CD31 (Clone: 390), PE anti-mouse Podoplanin antibody (Clone:
8.1.1) and PE-Cy7 EpCAM (CD326) antibody (Clone: G8.8) were purchased from Biolegend
(San Diego, CA, USA). FITC Rat IgG 2b, κ isotype control (Clone: RTK4530), FITC Rat IgG 2a,
κ isotype control (Clone: RTK2758), PE Rat IgG 2a, κ isotype control (Clone: RTK2758), PE
Syrian hamster IgG isotype control (Clone: SHG-1) and PE/Cy7 Rat IgG 2a, κ isotype control
(Clone: RTK2758) were purchased from Biolegend (San Diego, CA, USA). PELCO®
NanoXactTM 5 nm 5 Cap Gold was purchased from TED PELLA, Inc. (Redding, CA, USA).
Cells
Human lung microvascular endothelial cells (HMVEC-L; Lonza, USA) were cultured with
EGMTM-2MV BulleKitTM medium (Lonza, USA) at 37 C, 5% CO⁰ 2. Cells between passages 2-8
were used for experiments.
Mice
Male C57BL6/J mice (6-8 weeks, 20-25 grams) were from Nihon Clea Co., Ltd. (Tokyo,
Japan). The experimental protocols were reviewed and approved by the Hokkaido University
Animal Care Committee in accordance with the “Guide for Care and Use of Laboratory
Animals.” In all experiments, the animals were used without fasting.
Synthesis of GALA/PEG2000-DSG
Cys-GALA and DSG-PEG2000-MAL were dissolved in 99% EtOH at concentrations of 3 mM
and mixed at a molar ratio of 1:1. The reaction was carried out under shaking at 900 rpm, 30 ⁰C
for 24 hours. The molecular weight of Cys-GALA, DSG-PEG2000-MAL and the reaction product
was determined by Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-
TOF/MS). The mass spectrum analyzed by MALDI-TOF/MS were previously reported.1 The
aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid, was used as
the matrix solution. GALA/PEG2000-DSG was kept at 1.5 mM concentration in ethanol at -20 ⁰C.
Synthesis of GALA/PEG5000-DSPE
Cys-GALA and DSPE-PEG5000-MAL were dissolved in 99% EtOH at concentrations of 10
mM and mixed at a molar ratio of 1:1. The reaction was carried under shaking at 900 rpm, 30 ⁰C
for 24 hours. The molecular weight of Cys-GALA, DSPE-PEG5000-MAL and the reaction product
was determined by MALDI-TOF/MS. The mass spectrum analyzed by MALDI-TOF/MS is shown
in Supplementary Figure S1 and S2. The aqueous solution of 30% acetonitrile, containing
0.1% TFA and 1% sinapic acid, was used as the matrix solution. GALA/PEG5000-DSPE was kept
at 5 mM concentration in ethanol at -20⁰C.
WST-8 assay
The cytotoxicity of the inhibitors was evaluated by WST-8 assay. 5x103 HMVEC-L cells were
seeded in a 96-well plate and grown to 80-90% confluency for 24 hours. For inhibitors
treatment, filipin III, amiloride in DMSO and chlorpromazine in aqueous solutions were diluted in
10 µL of serum-free endothelial basal medium (EBM-2) to reach certain concentrations. The
cells were co-incubated with the inhibitor for 3.5 hours. The cck-2 reagent was then added by 10
µL/well, and the incubation continued for 2 hours. Finally, the absorbance was measured at
λmax of 450 nm using a plate reader (EnSpire 2300 multi label reader; Perkin Elmer, Waltham,
MA, USA).
Lung digestion
Enzyme solutions were prepared for one mouse by the following procedures. Solution A
(1 mL) contains of DNase I (0.02 mg/mL) in RPMI-1640 supplemented with 25 mM HEPES (pH
7.4). Solution B (6 mL) contains Type I collagenase (4 mg/mL), Elastase (4.5 U/mL), Dextran
(10% w/v), DNase I (0.02 mg/mL) and 3 mM CaCl2 in RPMI-1640 supplemented with 25 mM
HEPES (pH 7.4). Solution C (20 mL) contains fetal bovine serum (50% v/v) in RPMI-1640
supplemented with 25 mM HEPES (pH 7.4). After a mouse was sacrificed by CO2 asphyxiation,
the lung was cleaned by ventricular perfusion with 15 mL of ice-cold HBSS. The lung was
intratracheally lavaged with 5 mL of 5 mM EDTA solution in PBS (-), followed by 1 mL of
solution A. Then, the lung was infused with 1 mL of solution B and 1 mL of low-melting-point
agarose solution (1% w/v) which was preheated at 70ºC. Then it was cooled down on ice to
solidify the agarose. After that, the lung was incubated at 37ºC, 45 minutes in the 6-well plate
containing 2 mL/well of solution B. The lung was minced and incubated for more 15 minutes in a
new 6-well plate containing 2 mL/well of solution B. The digested lung tissues were transferred
into Falcon tubes containing 20 mL of solution C. The tissues were further treated with mouse
serum IgG (10 µg/mL) and then incubated on ice for 10 minutes.2, 3 Subsequently, the resulting
cell population was further incubated at room temperature for 5 minutes on the shaker at 300
rpm. Cell suspensions were filtered through 100 µm nylon mesh (BD Biosciences, North
Carolina, USA), and the cells remained on the nylon mesh were collected by an additional wash
of the filter with 2 mL of PBS(-). The cells were washed for once by repeating the centrifugation
at 2000 rpm, 4ºC for 5 minutes, and resuspension with 5 mL of RPMI-1640 supplemented with
25 mM HEPES (pH 7.4). To remove an erythrocyte fraction, cell population were treated with 1
mL of RBC lysis buffer at room temperature for 2 minutes and washed once with 5 mL of
solution C. Cells were further washed with 5 mL of RPMI-1640 supplemented with 25 mM
HEPES (pH 7.4), and by centrifugation at 2000 rpm at 4ºC for 5 minutes. Finally, the cells were
filtered through the 70-µm nylon mesh (BD Biosciences, North Carolina, USA). The final cell
population was resuspended in 5 mL FACS buffer. The number of the cells was counted by the
cell counter (LUNA™ Automated Cell Counter; Logos Biosystems, Inc., USA).
Evaluation of the in vivo gene knockdown
MEND was intravenously administered at a dose of 1.5 mg siRNA/kg dose via a tail vein. At
24 hours after administration, mice were sacrificed to collect the lung into Eppendorf tubes and
were frozen in liquid nitrogen. 30-40 mg of organ tissues were used for RNA extraction, and
were stored at - 80⁰C. In the RNA extraction, lung samples were fully thawed at room
temperature. RNA extraction was performed by using Trizol® reagent following the
manufacturer's protocol. Final RNA concentration was measured with a UV spectrophotometer
(Nanodrop; Thermo Fisher Scientific, Inc., Massachusetts, USA). RNA solution equivalent to
250 ng of RNA was diluted with RNase-free water to 3 µL in a PCR tube. Reverse transcription
was performed by using ReverTra Ace® qPCR RT Master Mix with gDNA Remover in S1000
Thermal cycler (Bio-rad Laboratories, USA). cDNA solution was diluted to 2.5 ng/µL by
deionized distilled water . In each sample, 1 µL of diluted cDNA solution was mixed with 4 µL of
primer mixture solution (1 µM) which consisted of the following components; ThunderbirdTM
SYBR® qPCR Mix 2.5 µL, a set of primers (10 µM) 0.5 µL each and DDW 1.5 µL. The mixture
was subject to PCR reaction using LightCycler® 480 Multiwell Plate 384; Clear (Roche
Diagnostics, Basel, Switzerland). Quantitative PCR was performed with LightCycler® 480
Instrument II, 384-well (Roche Diagnostics, Basel, Switzerland) under the following conditions;
pre-incubation for 1 cycle at 95ºC for a minute, amplification for 40 cycles by repeating a set of
incubation at 95ºC for 15 seconds, 55ºC for 30 seconds and 60ºC for 30 seconds, melting curve
plotting for 1 cycle at 95ºC for 5 seconds and 65ºC for 1 minute, and finally cooling at 40ºC for
15 seconds. Gene expression was analyzed by the ∆∆Ct method, comparing to GAPDH as a
reference gene.
Preparation of GALA/MEND encapsulating gold nanoparticles (GALA/MEND-AuNPs)
Lipid solution consisted of DOTMA, Cholesterol, and EPC at molar lipid ratio of 3/4/3 plus 5
mole% STR-PEG2000 and 2 mole% GALA/Chol in ethanol was prepared (total lipid concentration:
8 mM). Meanwhile, 3.67 mL of gold nanoparticle (AuNP) solution (PELCO® NanoXactTM 5 nm
5 Cap Gold; 5 mg/mL) was mixed with 334 µL of 100 mM HEPES buffer (pH 7.4) containing 5%
glucose, to prepare an aqueous solution of AuNPs. The lipid and aqueous solutions were mixed
together through a microfluidic mixer4 by using YSP-301 syringe pump (YMC, Japan) at a flow
rate of 375 µL/min and 1,125 µL/min, respectively to obtain the GALA/MEND encapsulating gold
nanoparticles (GALA/MEND-AuNPs). The mixture solution was then transferred to a dialysis
bag, and dialyzed in 20 mM MES buffer (pH 6.0) and subsequently PBS(-) for 1 hour each. After
that, the dialysate was concentrated to 1 mL by the centrifugation for 15 minutes at 1000 g at
25ºC. Size and zeta potential were measured with a Nano-ZS Zeta Sizer (Malvern instrument,
UK).
Supplementary Figures
Supplementary Figure S1
Supplementary Figure S1
A schematic illustration representing the synthesis of GALA/PEG5000-DSPE
Supplementary Figure S2
Supplementary Figure S2
MALDI-TOF MS spectra of (A) Cys-GALA, (B) DSPE-PEG5000-MAL and (C) GALA/PEG5000-DSPE
Supplementary Figure S3
Supplementary Figure S3
Cell viability of HMVEC-L cells after treating with various pharmacological inhibitors at different concentrations. Data were represented as mean ± SD; n= 3-6.
0
20
40
60
80
100
120
140
160
180
% V
iabi
lity
Supplementary Figure S4
Supplementary Figure S4
Gene silencing of GALA/Chol-LP encapsulating antiCD31 siRNA in the presence or the absence of different endocytosis inhibitors. HMVEC-L cells were incubated with different inhibitors for 30 min before addition of GALA-MEND encapsulating siRNA (100 nM) followed by incubation for 3 hr. The medium was then removed and cells were washed 3 times and supplemented with fresh medium. Gene silencing was evaluated after 24 hr (normalized to the case of no inhibitors). Error bars represent the mean ±SD (n=4).
Supplementary Figure S5
Supplementary Figure S5
(A) Schematic representation of GALA/Chol-LP or GALA/PEG2000-LP. The lipid layer is composed of EPC and Cholesterol. (B) Stability of DiD labeled GALA/Chol-LP. Liposomes were incubated with PBS in the presence or absence of serum at 37°C and the fluorescence was measured at different time points. (C) Biodistribution of DiD liposomes prepared with or without GALA/Chol (H = heart, Lg = lung, Lv = liver, K = kidney, S = spleen). The fluorescence was quantified and expressed as % injected dose/organ. Error bars represent the mean ±SD.
Supplementary Figure S6
Supplementary Figure S6
A dot plot representing the gated population of lung endothelium after staining pulmonary cells with (A) FITC-conjugated anti-CD45 mAb and PE-conjugated anti-CD31 mAb or (B) Isotype control antibodies
Gate Statistics
File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
R1
100 101 102 103 104FL1-H
Data.028
R2
Total cell population
0 200 400 600 800 1000FSC-H
Data.025
0 200 400 600 800 1000FSC-H
Data.025
0 200 400 600 800 1000FSC-H
Data.025
R1
100 101 102 103 104FL1-H
Data.025
R2
Gate Statistics
File: Data.025 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 17666 58.89 58.89G2 31 0.10 0.10G3 21 0.07 0.07G4 979 3.26 3.26
Gated population
CD
31
CD45
(A)
(B)
Gate Statistics
File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
R1
100 101 102 103 104FL1-H
Data.028
R2
Total cell population
Gate Statistics
File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
0 200 400 600 800 1000FSC-H
Data.028
R1
100 101 102 103 104FL1-H
Data.028
R2
CD
31CD45
Lung endotheliumCD31(+)/CD45(-)
Gated population
Supplementary Figure S7
Supplementary Figure S7
A dot plot representing the gating population of type I alveolar epithelium after staining pulmonary cells with (A) FITC-conjugated anti-CD45 mAb, FITC-conjugated anti-CD31 mAb, PE-conjugated anti-podoplanin mAb and PE-Cy7 conjugated anti-EpCAM (CD326) mAb or with (B) Isotype control antibodies
(A)
(B)
0 200 400 600 800 1000FSC-H
Data.018
Gate Statistics
File: Data.018 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16041 53.47 53.47G2 1870 6.23 6.23G3 1497 4.99 4.99G4 5622 18.74 18.740 200 400 600 800 1000
FSC-H
Data.018
0 200 400 600 800 1000FSC-H
Data.018
R1
Total cell population
0 200 400 600 800 1000FSC-H
Data.017
0 200 400 600 800 1000FSC-H
Data.017
0 200 400 600 800 1000FSC-H
Data.017
R1
Gate Statistics
File: Data.017 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16241 54.14 54.14G2 22 0.07 0.07G3 8 0.03 0.03
100 101 102 103 104FL2-H
Data.017
R3
100 101 102 103 104FL1-H
Data.017R2
Gated population
Podo
plan
in
CD31+CD45
Podoplanin+ cells
Podoplanin
EpCA
M
100 101 102 103 104FL1-H
Data.018R2
100 101 102 103 104FL2-H
Data.018
R3
Podo
plan
in
CD31+CD45 Podoplanin
EpCA
M
Podoplanin+ cellsPodoplanin/CD31(-)/CD45(-)
Type I alveolar epitheliumPodoplanin(+)/EpCAM(+)/CD31(-)/CD45(-)
Gated population Podoplanin+ cells
0 200 400 600 800 1000FSC-H
Data.018
Gate Statistics
File: Data.018 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)
Gate Events % Gated % TotalG1 16041 53.47 53.47G2 1870 6.23 6.23G3 1497 4.99 4.99G4 5622 18.74 18.740 200 400 600 800 1000
FSC-H
Data.018
0 200 400 600 800 1000FSC-H
Data.018
R1
Total cell population
Supplementary Figure S8
Supplementary Figure S8
Histograms showing the accumulation of DiD-labaled liposome in (A) lung endothelium and (B) Type I alveolar epithelium. Filled gray: non-treated, Red: PEG-LPs, Blue: GALA/Chol-LPs, Light Blue: GALA/PEG2000-LPs, Green: GALA/PEG5000-LPs
100 101 102 103 104FL4-H
M1 M2
Uptake of the GALA-modified particles in EC
(A)
(B)Uptake of the GALA-modified particles in ATI
100 101 102 103 104FL4-H
M1 M2
Particle-positive cells
Particle-positive cells
Supplementary Figure S9
Supplementary Figure S8
(A) Serum turbidity assay. GALA-MEND encapsulating siRNA were incubated with PBS in the presence or absence of serum. An initial time (t=0), the absorbance at 660 nm was measured. The plates were incubated at 37°C and the absorbance was measured at different times. All readings were normalized to the corresponding absorbance at t=0. (B) In vivo podoplanin knockdown activity of GALA/MEND encapsulating scrambled control siRNA. Data are represented as the mean ± SD (n = 3).
Supplementary Figure S10
Supplementary Figure S10
TEM images of an alveolar macrophage inside the lung treated with GALA/MEND-AuNPs at the magnification of (A) x30,000 and (B) x60,000. The image (B) shows the magnified area from the box in (A). Black and yellow circles represent single AuNPs and clusters of AuNPs, respectively. These images were taken at 1-hour post-administration.
Alveolus(A)
(B)
Supplementary Figure S11
Supplementary Figure S11
A schematic illustration representing a possible role of the blood-gas barrier (BGB) to restrict the uptake of GALA-LPs in Type I alveolar epithelium.
Supplementary Table S1
Characterization of different GALA-modified liposomes
Diameter [nm] PDI Z-potential [mV]
GALA/Chol-LP 85 ± 7 0.26 ± 0.02 (-) 23 ± 3
GALA/PEG2000-LP 82 ± 14 0.18 ± 0.03 (-) 28 ± 4
Supplementary Table S2
Characterization of GALA-MENDs encapsulating podoplanin siRNA or Au-NPs
Diameter [nm] PDI Z-potential [mV]
GALA/Chol-MEND (siRNA) 116 0.27 21
GALA/Chol-MEND (AuNPs) 73 0.19 11
Supplementary Table S3
Anti-Pdpn siRNA used was a mixture of the following 4 sequences:
siRNA Name Sequences (5’→3’)
Pdpn1 Sense: AAUCAUAGUUGGCGUCUUG(dTdT)
Antisense: CAAGACGCCAACUAUGAUU(dTdT)
Pdpn2 Sense: GAGCUAAACAGAACAGGUU(dTdT)
Antisense: AACCUGUUCUGUUUAGCUC(dTdT)
Pdpn3 Sense: GGACUAUAGGCGUGAAUGA(dTdT)
Antisense: UCAUUCACGCCUAUAGUCC(dTdT)
Pdpn4 Sense: UGUAAAGGUUUGGGGUUAA(dTdT)
Antisense: UUAACCGCAAACCUUUACA(dTdT)
Supplementary Table S4
The sequences of primers used are shown in the following table:
siRNA Name Sequences (5’→3’)
Mm_podoplanin-F CCCAATAGAGATGGCTTGCCAG
Mm_podoplanin-R GCGAGAACCTTCCAGAAATCTTC
GAPDH-F1 AGCAAGGACACTGAGCAAG
GAPDH-R1 TAGGCCCCTCCTGTTATTATG
Supplementary References
1. Santiwarangkool, S.; Akita, H.; Nakatani, T.; Kusumoto, K.; Kimura, H.; Suzuki, M.; Nishimura, M.; Sato, Y.; Harashima, H., PEGylation of the GALA Peptide Enhances the Lung-Targeting Activity of Nanocarriers That Contain Encapsulated siRNA. Journal of Pharmaceutical Sciences 2017, 106 (9), 2420-2427.2. Chen, J.; Chen, Z.; Narasaraju, T.; Jin, N.; Liu, L., Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab Invest 2004, 84 (6), 727-735.3. Gonzalez, R. F.; Dobbs, L. G., Isolation and Culture of Alveolar Epithelial Type I and Type II Cells from Rat Lungs. Methods in molecular biology (Clifton, N.J.) 2013, 945, 145-159.4. Sato, Y.; Note, Y.; Maeki, M.; Kaji, N.; Baba, Y.; Tokeshi, M.; Harashima, H., Elucidation of the physicochemical properties and potency of siRNA-loaded small-sized lipid nanoparticles for siRNA delivery. Journal of Controlled Release 2016, 229, 48-57.