ars.els-cdn.com · web viewthe mass spectrum analyzed by maldi-tof/ms were previously reported. 1...

32
Journal of Controlled Release Supporting Information A study of the endocytosis mechanism and transendothelial activity of lung-targeted GALA- modified liposomes Sarochin Santiwarangkool, a,1 Hidetaka Akita, b,1 Ikramy A. Khalil, c,d Mahmoud M. Abd Elwakil, c Yusuke Sato, a Kenji Kusumoto, e Hideyoshi Harashima a,c,* a Laboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812, Japan b Laboratory of Pharmacology and Toxicology, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan c Laboratory of Innovative Nanomedicine, Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo 060-0812, Japan d Department of Pharmaceutics, Faculty of Pharmacy, Assiut University, Assiut 71526, Egypt

Upload: others

Post on 28-Aug-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Journal of Controlled Release

Supporting Information

A study of the endocytosis mechanism and transendothelial activity

of lung-targeted GALA-modified liposomes

Sarochin Santiwarangkool,a,1 Hidetaka Akita,b,1 Ikramy A. Khalil,c,d Mahmoud M. Abd Elwakil,c Yusuke

Sato,a Kenji Kusumoto,e Hideyoshi Harashimaa,c,*

aLaboratory for Molecular Design of Pharmaceutics, Faculty of Pharmaceutical Sciences, Hokkaido

University, Sapporo 060-0812, Japan

bLaboratory of Pharmacology and Toxicology, Graduate School of Pharmaceutical Sciences, Chiba

University, Chiba 260-8675, Japan

cLaboratory of Innovative Nanomedicine, Faculty of Pharmaceutical Sciences, Hokkaido University,

Sapporo 060-0812, Japan

dDepartment of Pharmaceutics, Faculty of Pharmacy, Assiut University, Assiut 71526, Egypt

eFormulation Research Lab., Taiho Pharmaceutical Co., Ltd., 224-2, Ebisuno, Hiraishi, Kawauchi-cho,

Tokushima 771-0194, Japan.

1These authors equally contributed to this work.

*Address correspondence to (H. Harashima) at Faculty of Pharmaceutical Sciences, Hokkaido University,

Kita 12, Nishi 6, Kita-ku, Sapporo 060-0812, Japan. Tel.: +81 11 706 3919; fax: +81 11 706 4879. E-mail

address: [email protected]

Page 2: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Methods

Materials

Anti-podoplanin siRNA (Anti-Pdpn) siRNAs were purchased from Hokkaido System

Science Co., Ltd. (Sapporo, Japan). Primers and probes for Pdpn and GADPH were ordered

from Sigma-Aldrich (St. Louis, MO, USA). Sequence information of siRNAs, primers, and

probes was listed in Supplementary Table S3 and S4, respectively. Cysteine-terminated GALA

(Cys-GALA) was purchased from PolyPeptide Laboratories (San Diego, CA, USA). Egg

phosphatidylcholine (EPC) and Cholesterol (Chol) was ordered from AVANTI Polar Lipids

(Alabaster, AL, USA). Hank’s balanced salt solution (HBSS) and purified normal mouse serum

IgG (Whole Molecule) were purchased from Wako Pure Chemicals (Osaka, Japan). EGMTM-

2MV BulleKitTM medium was purchased from Lonza, Ltd. (Basel, Switzerland). 1,1’-dioctadecyl-

3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzene sulfonate salt (DiD) and 1,1’-

dioctadecyl-3,3,3’,3’-tetramethyl indocarbocyanine-5,5’-di-sulfonic acid (DiI) were purchased

from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). 1,2-distearoyl-sn-glycero-N-

[maleimide(polyethylene glycol)-2000] (DSG-PEG2000-MAL) and N-[(3-Maleimide-1-

oxopropyl)aminopropyl polyethyleneglycol-carbamyl] distearoyl phosphatidyl-ethanolamine

(MW=5,000; DSPE-PEG5000-MAL) were purchased from NOF Corporation (Tokyo, Japan).

Alexa Fluor® 488-conjugated Dextran (MW=10,000), Alexa Fluor® 488-conjugated

Cholera Toxin Subunit B (Recombinant; CTB) and Alexa Fluor® 647-conjugated Transferrin (Tf)

From Human Serum were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).

Filipin III from Streptomyces filipinensis, chlorpromazine hydrochloride, and amiloride

hydrochloride hydrate was purchased from Sigma-Aldrich, Co., LLC. (St.Louis, Missouri, USA).

Hoechst 33342 and 2-[4-(2-Hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) were

obtained from Dojindo Laboratories (Kumamoto, Japan). Trizol® Reagent and Quant-iTTM

RiboGreen assay were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).

ThunderbirdTM SYBR® qPCR Mix and ReverTra Ace® qPCR RT Master Mix with gDNA

Page 3: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Remover was purchased from Toyobo Co., Ltd. (Osaka, Japan). RPMI-1640 medium, 1 M

HEPES buffer, RBC lysis buffer and Triton X-100 were purchased from Sigma-Aldrich (St.

Louis, MO, USA). Glycogen (M.B.) was acquired from GMbiolab Co., Ltd. (Taichung, Taiwan).

Type I collagenase and crystallized elastase from porcine pancreas (High purity) was

purchased from EMD Millipore Corp. (Billerica, MA, USA). DNase I from bovine pancreas was

ordered from Worthington Biochemical Corp. (Lakewood, NJ, USA). Purified anti-mouse

CD16/CD32 antibody (Clone: 2.4G2) and FITC anti-mouse CD45 antibody (Clone: 30-F11)

were ordered from Tonbo Biosciences (San Diego, CA, USA). FITC anti-mouse CD31 antibody

(Clone: 390), PE anti-mouse CD31 (Clone: 390), PE anti-mouse Podoplanin antibody (Clone:

8.1.1) and PE-Cy7 EpCAM (CD326) antibody (Clone: G8.8) were purchased from Biolegend

(San Diego, CA, USA). FITC Rat IgG 2b, κ isotype control (Clone: RTK4530), FITC Rat IgG 2a,

κ isotype control (Clone: RTK2758), PE Rat IgG 2a, κ isotype control (Clone: RTK2758), PE

Syrian hamster IgG isotype control (Clone: SHG-1) and PE/Cy7 Rat IgG 2a, κ isotype control

(Clone: RTK2758) were purchased from Biolegend (San Diego, CA, USA). PELCO®

NanoXactTM 5 nm 5 Cap Gold was purchased from TED PELLA, Inc. (Redding, CA, USA).

Cells

Human lung microvascular endothelial cells (HMVEC-L; Lonza, USA) were cultured with

EGMTM-2MV BulleKitTM medium (Lonza, USA) at 37 C, 5% CO⁰ 2. Cells between passages 2-8

were used for experiments.

Mice

Male C57BL6/J mice (6-8 weeks, 20-25 grams) were from Nihon Clea Co., Ltd. (Tokyo,

Japan). The experimental protocols were reviewed and approved by the Hokkaido University

Animal Care Committee in accordance with the “Guide for Care and Use of Laboratory

Animals.” In all experiments, the animals were used without fasting.

Synthesis of GALA/PEG2000-DSG

Page 4: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Cys-GALA and DSG-PEG2000-MAL were dissolved in 99% EtOH at concentrations of 3 mM

and mixed at a molar ratio of 1:1. The reaction was carried out under shaking at 900 rpm, 30 ⁰C

for 24 hours. The molecular weight of Cys-GALA, DSG-PEG2000-MAL and the reaction product

was determined by Matrix-assisted laser desorption/ionization mass spectrometry (MALDI-

TOF/MS). The mass spectrum analyzed by MALDI-TOF/MS were previously reported.1 The

aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid, was used as

the matrix solution. GALA/PEG2000-DSG was kept at 1.5 mM concentration in ethanol at -20 ⁰C.

Synthesis of GALA/PEG5000-DSPE

Cys-GALA and DSPE-PEG5000-MAL were dissolved in 99% EtOH at concentrations of 10

mM and mixed at a molar ratio of 1:1. The reaction was carried under shaking at 900 rpm, 30 ⁰C

for 24 hours. The molecular weight of Cys-GALA, DSPE-PEG5000-MAL and the reaction product

was determined by MALDI-TOF/MS. The mass spectrum analyzed by MALDI-TOF/MS is shown

in Supplementary Figure S1 and S2. The aqueous solution of 30% acetonitrile, containing

0.1% TFA and 1% sinapic acid, was used as the matrix solution. GALA/PEG5000-DSPE was kept

at 5 mM concentration in ethanol at -20⁰C.

WST-8 assay

The cytotoxicity of the inhibitors was evaluated by WST-8 assay. 5x103 HMVEC-L cells were

seeded in a 96-well plate and grown to 80-90% confluency for 24 hours. For inhibitors

treatment, filipin III, amiloride in DMSO and chlorpromazine in aqueous solutions were diluted in

10 µL of serum-free endothelial basal medium (EBM-2) to reach certain concentrations. The

cells were co-incubated with the inhibitor for 3.5 hours. The cck-2 reagent was then added by 10

µL/well, and the incubation continued for 2 hours. Finally, the absorbance was measured at

λmax of 450 nm using a plate reader (EnSpire 2300 multi label reader; Perkin Elmer, Waltham,

MA, USA).

Lung digestion

Page 5: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Enzyme solutions were prepared for one mouse by the following procedures. Solution A

(1 mL) contains of DNase I (0.02 mg/mL) in RPMI-1640 supplemented with 25 mM HEPES (pH

7.4). Solution B (6 mL) contains Type I collagenase (4 mg/mL), Elastase (4.5 U/mL), Dextran

(10% w/v), DNase I (0.02 mg/mL) and 3 mM CaCl2 in RPMI-1640 supplemented with 25 mM

HEPES (pH 7.4). Solution C (20 mL) contains fetal bovine serum (50% v/v) in RPMI-1640

supplemented with 25 mM HEPES (pH 7.4). After a mouse was sacrificed by CO2 asphyxiation,

the lung was cleaned by ventricular perfusion with 15 mL of ice-cold HBSS. The lung was

intratracheally lavaged with 5 mL of 5 mM EDTA solution in PBS (-), followed by 1 mL of

solution A. Then, the lung was infused with 1 mL of solution B and 1 mL of low-melting-point

agarose solution (1% w/v) which was preheated at 70ºC. Then it was cooled down on ice to

solidify the agarose. After that, the lung was incubated at 37ºC, 45 minutes in the 6-well plate

containing 2 mL/well of solution B. The lung was minced and incubated for more 15 minutes in a

new 6-well plate containing 2 mL/well of solution B. The digested lung tissues were transferred

into Falcon tubes containing 20 mL of solution C. The tissues were further treated with mouse

serum IgG (10 µg/mL) and then incubated on ice for 10 minutes.2, 3 Subsequently, the resulting

cell population was further incubated at room temperature for 5 minutes on the shaker at 300

rpm. Cell suspensions were filtered through 100 µm nylon mesh (BD Biosciences, North

Carolina, USA), and the cells remained on the nylon mesh were collected by an additional wash

of the filter with 2 mL of PBS(-). The cells were washed for once by repeating the centrifugation

at 2000 rpm, 4ºC for 5 minutes, and resuspension with 5 mL of RPMI-1640 supplemented with

25 mM HEPES (pH 7.4). To remove an erythrocyte fraction, cell population were treated with 1

mL of RBC lysis buffer at room temperature for 2 minutes and washed once with 5 mL of

solution C. Cells were further washed with 5 mL of RPMI-1640 supplemented with 25 mM

HEPES (pH 7.4), and by centrifugation at 2000 rpm at 4ºC for 5 minutes. Finally, the cells were

filtered through the 70-µm nylon mesh (BD Biosciences, North Carolina, USA). The final cell

Page 6: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

population was resuspended in 5 mL FACS buffer. The number of the cells was counted by the

cell counter (LUNA™ Automated Cell Counter; Logos Biosystems, Inc., USA).

Evaluation of the in vivo gene knockdown

MEND was intravenously administered at a dose of 1.5 mg siRNA/kg dose via a tail vein. At

24 hours after administration, mice were sacrificed to collect the lung into Eppendorf tubes and

were frozen in liquid nitrogen. 30-40 mg of organ tissues were used for RNA extraction, and

were stored at - 80⁰C. In the RNA extraction, lung samples were fully thawed at room

temperature. RNA extraction was performed by using Trizol® reagent following the

manufacturer's protocol. Final RNA concentration was measured with a UV spectrophotometer

(Nanodrop; Thermo Fisher Scientific, Inc., Massachusetts, USA). RNA solution equivalent to

250 ng of RNA was diluted with RNase-free water to 3 µL in a PCR tube. Reverse transcription

was performed by using ReverTra Ace® qPCR RT Master Mix with gDNA Remover in S1000

Thermal cycler (Bio-rad Laboratories, USA). cDNA solution was diluted to 2.5 ng/µL by

deionized distilled water . In each sample, 1 µL of diluted cDNA solution was mixed with 4 µL of

primer mixture solution (1 µM) which consisted of the following components; ThunderbirdTM

SYBR® qPCR Mix 2.5 µL, a set of primers (10 µM) 0.5 µL each and DDW 1.5 µL. The mixture

was subject to PCR reaction using LightCycler® 480 Multiwell Plate 384; Clear (Roche

Diagnostics, Basel, Switzerland). Quantitative PCR was performed with LightCycler® 480

Instrument II, 384-well (Roche Diagnostics, Basel, Switzerland) under the following conditions;

pre-incubation for 1 cycle at 95ºC for a minute, amplification for 40 cycles by repeating a set of

incubation at 95ºC for 15 seconds, 55ºC for 30 seconds and 60ºC for 30 seconds, melting curve

plotting for 1 cycle at 95ºC for 5 seconds and 65ºC for 1 minute, and finally cooling at 40ºC for

15 seconds. Gene expression was analyzed by the ∆∆Ct method, comparing to GAPDH as a

reference gene.

Preparation of GALA/MEND encapsulating gold nanoparticles (GALA/MEND-AuNPs)

Page 7: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Lipid solution consisted of DOTMA, Cholesterol, and EPC at molar lipid ratio of 3/4/3 plus 5

mole% STR-PEG2000 and 2 mole% GALA/Chol in ethanol was prepared (total lipid concentration:

8 mM). Meanwhile, 3.67 mL of gold nanoparticle (AuNP) solution (PELCO® NanoXactTM 5 nm

5 Cap Gold; 5 mg/mL) was mixed with 334 µL of 100 mM HEPES buffer (pH 7.4) containing 5%

glucose, to prepare an aqueous solution of AuNPs. The lipid and aqueous solutions were mixed

together through a microfluidic mixer4 by using YSP-301 syringe pump (YMC, Japan) at a flow

rate of 375 µL/min and 1,125 µL/min, respectively to obtain the GALA/MEND encapsulating gold

nanoparticles (GALA/MEND-AuNPs). The mixture solution was then transferred to a dialysis

bag, and dialyzed in 20 mM MES buffer (pH 6.0) and subsequently PBS(-) for 1 hour each. After

that, the dialysate was concentrated to 1 mL by the centrifugation for 15 minutes at 1000 g at

25ºC. Size and zeta potential were measured with a Nano-ZS Zeta Sizer (Malvern instrument,

UK).

Page 8: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figures

Supplementary Figure S1

Supplementary Figure S1

A schematic illustration representing the synthesis of GALA/PEG5000-DSPE

Page 9: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S2

Supplementary Figure S2

MALDI-TOF MS spectra of (A) Cys-GALA, (B) DSPE-PEG5000-MAL and (C) GALA/PEG5000-DSPE

Page 10: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S3

Supplementary Figure S3

Cell viability of HMVEC-L cells after treating with various pharmacological inhibitors at different concentrations. Data were represented as mean ± SD; n= 3-6.

0

20

40

60

80

100

120

140

160

180

% V

iabi

lity

Page 11: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S4

Supplementary Figure S4

Gene silencing of GALA/Chol-LP encapsulating antiCD31 siRNA in the presence or the absence of different endocytosis inhibitors. HMVEC-L cells were incubated with different inhibitors for 30 min before addition of GALA-MEND encapsulating siRNA (100 nM) followed by incubation for 3 hr. The medium was then removed and cells were washed 3 times and supplemented with fresh medium. Gene silencing was evaluated after 24 hr (normalized to the case of no inhibitors). Error bars represent the mean ±SD (n=4).

Page 12: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S5

Supplementary Figure S5

(A) Schematic representation of GALA/Chol-LP or GALA/PEG2000-LP. The lipid layer is composed of EPC and Cholesterol. (B) Stability of DiD labeled GALA/Chol-LP. Liposomes were incubated with PBS in the presence or absence of serum at 37°C and the fluorescence was measured at different time points. (C) Biodistribution of DiD liposomes prepared with or without GALA/Chol (H = heart, Lg = lung, Lv = liver, K = kidney, S = spleen). The fluorescence was quantified and expressed as % injected dose/organ. Error bars represent the mean ±SD.

Page 13: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S6

Supplementary Figure S6

A dot plot representing the gated population of lung endothelium after staining pulmonary cells with (A) FITC-conjugated anti-CD45 mAb and PE-conjugated anti-CD31 mAb or (B) Isotype control antibodies

Gate Statistics

File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

R1

100 101 102 103 104FL1-H

Data.028

R2

Total cell population

0 200 400 600 800 1000FSC-H

Data.025

0 200 400 600 800 1000FSC-H

Data.025

0 200 400 600 800 1000FSC-H

Data.025

R1

100 101 102 103 104FL1-H

Data.025

R2

Gate Statistics

File: Data.025 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 17666 58.89 58.89G2 31 0.10 0.10G3 21 0.07 0.07G4 979 3.26 3.26

Gated population

CD

31

CD45

(A)

(B)

Gate Statistics

File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

R1

100 101 102 103 104FL1-H

Data.028

R2

Total cell population

Gate Statistics

File: Data.028 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16897 56.32 56.32G2 8406 28.02 28.02G3 6256 20.85 20.85G4 3617 12.06 12.06

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

0 200 400 600 800 1000FSC-H

Data.028

R1

100 101 102 103 104FL1-H

Data.028

R2

CD

31CD45

Lung endotheliumCD31(+)/CD45(-)

Gated population

Page 14: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S7

Supplementary Figure S7

A dot plot representing the gating population of type I alveolar epithelium after staining pulmonary cells with (A) FITC-conjugated anti-CD45 mAb, FITC-conjugated anti-CD31 mAb, PE-conjugated anti-podoplanin mAb and PE-Cy7 conjugated anti-EpCAM (CD326) mAb or with (B) Isotype control antibodies

(A)

(B)

0 200 400 600 800 1000FSC-H

Data.018

Gate Statistics

File: Data.018 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16041 53.47 53.47G2 1870 6.23 6.23G3 1497 4.99 4.99G4 5622 18.74 18.740 200 400 600 800 1000

FSC-H

Data.018

0 200 400 600 800 1000FSC-H

Data.018

R1

Total cell population

0 200 400 600 800 1000FSC-H

Data.017

0 200 400 600 800 1000FSC-H

Data.017

0 200 400 600 800 1000FSC-H

Data.017

R1

Gate Statistics

File: Data.017 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16241 54.14 54.14G2 22 0.07 0.07G3 8 0.03 0.03

100 101 102 103 104FL2-H

Data.017

R3

100 101 102 103 104FL1-H

Data.017R2

Gated population

Podo

plan

in

CD31+CD45

Podoplanin+ cells

Podoplanin

EpCA

M

100 101 102 103 104FL1-H

Data.018R2

100 101 102 103 104FL2-H

Data.018

R3

Podo

plan

in

CD31+CD45 Podoplanin

EpCA

M

Podoplanin+ cellsPodoplanin/CD31(-)/CD45(-)

Type I alveolar epitheliumPodoplanin(+)/EpCAM(+)/CD31(-)/CD45(-)

Gated population Podoplanin+ cells

0 200 400 600 800 1000FSC-H

Data.018

Gate Statistics

File: Data.018 Log Data Units: Linear ValuesSample ID: Patient ID: Tube: Untitled Panel: Untitled Acquisition Tube ListAcquisition Date: 08-Jul-16 Gate: No GateGated Events: 30000 Total Events: 30000X Parameter: FSC-H (Linear) Y Parameter: SSC-H (Linear)

Gate Events % Gated % TotalG1 16041 53.47 53.47G2 1870 6.23 6.23G3 1497 4.99 4.99G4 5622 18.74 18.740 200 400 600 800 1000

FSC-H

Data.018

0 200 400 600 800 1000FSC-H

Data.018

R1

Total cell population

Page 15: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S8

Supplementary Figure S8

Histograms showing the accumulation of DiD-labaled liposome in (A) lung endothelium and (B) Type I alveolar epithelium. Filled gray: non-treated, Red: PEG-LPs, Blue: GALA/Chol-LPs, Light Blue: GALA/PEG2000-LPs, Green: GALA/PEG5000-LPs

100 101 102 103 104FL4-H

M1 M2

Uptake of the GALA-modified particles in EC

(A)

(B)Uptake of the GALA-modified particles in ATI

100 101 102 103 104FL4-H

M1 M2

Particle-positive cells

Particle-positive cells

Page 16: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S9

Supplementary Figure S8

(A) Serum turbidity assay. GALA-MEND encapsulating siRNA were incubated with PBS in the presence or absence of serum. An initial time (t=0), the absorbance at 660 nm was measured. The plates were incubated at 37°C and the absorbance was measured at different times. All readings were normalized to the corresponding absorbance at t=0. (B) In vivo podoplanin knockdown activity of GALA/MEND encapsulating scrambled control siRNA. Data are represented as the mean ± SD (n = 3).

Page 17: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S10

Supplementary Figure S10

TEM images of an alveolar macrophage inside the lung treated with GALA/MEND-AuNPs at the magnification of (A) x30,000 and (B) x60,000. The image (B) shows the magnified area from the box in (A). Black and yellow circles represent single AuNPs and clusters of AuNPs, respectively. These images were taken at 1-hour post-administration.

Alveolus(A)

(B)

Page 18: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Figure S11

Supplementary Figure S11

A schematic illustration representing a possible role of the blood-gas barrier (BGB) to restrict the uptake of GALA-LPs in Type I alveolar epithelium.

Page 19: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Table S1

Characterization of different GALA-modified liposomes

Diameter [nm] PDI Z-potential [mV]

GALA/Chol-LP 85 ± 7 0.26 ± 0.02 (-) 23 ± 3

GALA/PEG2000-LP 82 ± 14 0.18 ± 0.03 (-) 28 ± 4

Supplementary Table S2

Characterization of GALA-MENDs encapsulating podoplanin siRNA or Au-NPs

Diameter [nm] PDI Z-potential [mV]

GALA/Chol-MEND (siRNA) 116 0.27 21

GALA/Chol-MEND (AuNPs) 73 0.19 11

Page 20: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Table S3

Anti-Pdpn siRNA used was a mixture of the following 4 sequences:

siRNA Name Sequences (5’→3’)

Pdpn1 Sense: AAUCAUAGUUGGCGUCUUG(dTdT)

Antisense: CAAGACGCCAACUAUGAUU(dTdT)

Pdpn2 Sense: GAGCUAAACAGAACAGGUU(dTdT)

Antisense: AACCUGUUCUGUUUAGCUC(dTdT)

Pdpn3 Sense: GGACUAUAGGCGUGAAUGA(dTdT)

Antisense: UCAUUCACGCCUAUAGUCC(dTdT)

Pdpn4 Sense: UGUAAAGGUUUGGGGUUAA(dTdT)

Antisense: UUAACCGCAAACCUUUACA(dTdT)

Page 21: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary Table S4

The sequences of primers used are shown in the following table:

siRNA Name Sequences (5’→3’)

Mm_podoplanin-F CCCAATAGAGATGGCTTGCCAG

Mm_podoplanin-R GCGAGAACCTTCCAGAAATCTTC

GAPDH-F1 AGCAAGGACACTGAGCAAG

GAPDH-R1 TAGGCCCCTCCTGTTATTATG

Page 22: ars.els-cdn.com · Web viewThe mass spectrum analyzed by MALDI-TOF/MS were previously reported. 1 The aqueous solution of 30% acetonitrile, containing 0.1% TFA and 1% sinapic acid,

Supplementary References

1. Santiwarangkool, S.; Akita, H.; Nakatani, T.; Kusumoto, K.; Kimura, H.; Suzuki, M.; Nishimura, M.; Sato, Y.; Harashima, H., PEGylation of the GALA Peptide Enhances the Lung-Targeting Activity of Nanocarriers That Contain Encapsulated siRNA. Journal of Pharmaceutical Sciences 2017, 106 (9), 2420-2427.2. Chen, J.; Chen, Z.; Narasaraju, T.; Jin, N.; Liu, L., Isolation of highly pure alveolar epithelial type I and type II cells from rat lungs. Lab Invest 2004, 84 (6), 727-735.3. Gonzalez, R. F.; Dobbs, L. G., Isolation and Culture of Alveolar Epithelial Type I and Type II Cells from Rat Lungs. Methods in molecular biology (Clifton, N.J.) 2013, 945, 145-159.4. Sato, Y.; Note, Y.; Maeki, M.; Kaji, N.; Baba, Y.; Tokeshi, M.; Harashima, H., Elucidation of the physicochemical properties and potency of siRNA-loaded small-sized lipid nanoparticles for siRNA delivery. Journal of Controlled Release 2016, 229, 48-57.