ars.els-cdn.com · web viewlong and short chain ahls affect aoa and aob microbial community...

18
Appendix A. Supplementary data Long and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao 1,2,** , Yu Duan 3,** , Ying Liu 1,4 , Xuliang Zhuang 1,2 , Yichen Liu 5 , Zhihui Bai 1,2 , Wenlin Ma 5 , Guoqiang Zhuang 1,2,* 1. CAS Key Laboratory of Environmental Biotechnology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China 2. College of Resources and Environment, University of Chinese Academy of Sciences, Beijing 100049, China 3. Beijing Enterprises Water Group Limited, Beijing 100124, China

Upload: others

Post on 09-Aug-2020

1 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Appendix A. Supplementary data

Long and short chain AHLs affect AOA and AOB microbial community

composition and ammonia oxidation rate in activated sludge

Jie Gao1,2,**, Yu Duan3,**, Ying Liu1,4, Xuliang Zhuang1,2, Yichen Liu5, Zhihui Bai1,2,

Wenlin Ma5, Guoqiang Zhuang1,2,*

1. CAS Key Laboratory of Environmental Biotechnology, Research Center for Eco-

Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China

2. College of Resources and Environment, University of Chinese Academy of

Sciences, Beijing 100049, China

3. Beijing Enterprises Water Group Limited, Beijing 100124, China

4. School of Life Sciences, University of Science and Technology of China, Hefei

230026, China

5. Beijing Climate Change Response Research and Education Center, Department of

Environment and Energy Engineering, Beijing University of Civil Engineering and

Architecture, Beijing 100044, China

------------------------------------

*Corresponding author.: Email: [email protected] (Guoqiang Zhuang)

** These authors have contributed equally to this work.

Page 2: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Materials and Methods454 pyrosequencing and sequence analysis

Bacterial 16S rRNA gene fragment, covering the V1–V3 region (506 bp), was

selected to construct community library through tag pyrosequencing. The bar-coded

universal bacterial primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 533R

(5’-TTACCGCGGCTGCTGGCAC-3’) incorporating the FLX Titanium A and B

sequencing adaptors (Roche 454 Life Sciences, USA) were used to amplify bacterial

16S rRNA region. The PCRs were carried out in triplicate independent PCR assays

(20 µL) using TransStart Fastpfu DNA Polymerase (TransGen, China). The bacterial

16S rRNA gene PCR cycling parameter was performed as follows: 95 °C for 2 min;

25 cycles of 30 s denaturation at 95 °C, 30 s annealing at 55 °C, 1 min extension at 72

°C; and a final extension at 72 °C for 10 min. The replicate PCR products of the same

sample were combined after PCR. The amplicons were purified with a DNA gel

extraction kit (TaKaRa Biotechnology, China) and quantified. The products from

different samples were used for pyrosequencing on the Roche 454 FLX Titanium

platform according to the manufacturer’s recommendations.

Raw sequences generated from the pyrosequencing run were denoised by using the

Titanium Pyronoise software. Preliminary quality control steps included: (1) checking

those valid barcodes-sequences in different samples; (2) removing the sequences

shorter than 150 bp, average quality value less than 25, or with ambiguous

nucleotides. The high-quality sequences were aligned in accordance with SILVA

alignment protocols (http://www.arb-silva.de) and clustered into operational

taxonomic units (OTUs). The OTUs clustering was performed by setting a 0.03

Page 3: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

distance limit (equivalent to 97% similarity) using the Mothur program

(http://www.mothur.org). On the basis of these clusters, rarefaction curves, richness

(ACE, Chao), and alpha-diversity (Shannon, Simpson) were calculated by using

Mothur. Rarefaction and curves were performed on R (http://www.r-project.org/).

Sequences were phylogenetically assigned to taxonomic classification down to the

phylum level with a set confidence threshold of 80%, and relative abundance of a

given phylogenetic group was calculated.

Page 4: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Table S1. PCR approaches used for characterization of ammonia oxidiser communities in activated sludge samples

Primer set Description Sequences Annealing temperature (°C)

Extension time (s)

Reference

27f-1492r Primary PCR amplification for bacterial 16S rDNA gene

27f: AGAGTTTGATCMTGGCTCAG1492r: TACGGYTACCTTGTTACGACTT

50 90 (Lane, 1991)

CTO189f-CTO654r Nested PCR amplification for AOB

CTO189fAB: GGAGRAAAGCAGGGGATCGCTO189fC: GGAGGAAAGTAGGGGATCGCTO654r: CTAGCYTTGTAGTTTCAAACGC

55 45 (Kowalchuk, et al., 1997)

357f-GC-518r* Final amplification for AOB DGGE analysis

357f-GC: CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG518r: ATTACCGCGGCTGCTGG

55 30 (Muyzer, et al., 1993)

A109f-A1492r Primary PCR amplification for archaeal 16S rDNA gene

A109f: ACKGCTCAGTAACACGTA1492r: GYYACCTTGTTACGACTT

55 90 (Großkopf, et al., 1998, Nicol, et al., 2008)

771f-957r-GC* Nested PCR amplification for AOA DGGE analysis

771f: ACGGTGAGGGATGAAAGCT957r-GC: CGCCCGCCGCGCGCGGCGGGCGGG

55 30 (Muyzer, et al., 1993, Ochsenreiter, et al., 2003)

Page 5: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

GCGGGGGCACGGGGGGCGGCGTTGACTCCAATTG

The following thermocycling conditions were used: 5 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at the specified annealing temperature, and the specified extension time at 72°C, followed by a 10 min final extension at 72°C.*: The GC-clamp attached at the 5’ end of primer 357f or 957r for DGGE analysis. Primers 357f-518r or 771f-519r, lacking the GC clamp were used to reamplify AOB and AOA fragments.

Großkopf R, Stubner S & Liesack W, 1998. Novel euryarchaeotal lineages detected on rice roots and in the anoxic bulk soil of flooded rice

microcosms. Appl. Environ. Microbiol. 64, 4983-4989.

Kowalchuk GA, Stephen JR, De Boer W, Prosser JI, Embley TM & Woldendorp JW, 1997. Analysis of ammonia-oxidizing bacteria of the beta

subdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified

16S ribosomal DNA fragments. Appl. Environ. Microbiol. 63, 1489-1497.

Lane D, 1991. 16S/23S rRNA sequencing. Nucleic acid techniques in bacterial systematics,(Stackebrandt E & Goodfellow M, ed. eds.), p. pp.

115-175. John Wiley & Sons, New York, N.Y.

Muyzer G, De Waal EC & Uitterlinden AG, 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis

analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695-700.

Nicol GW, Leininger S, Schleper C & Prosser JI, 2008. The influence of soil pH on the diversity, abundance and transcriptional activity of

Page 6: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

ammonia oxidizing archaea and bacteria. Environ. Microbiol. 10, 2966-2978.

Ochsenreiter T, Selezi D, Quaiser A, Bonch-Osmolovskaya L & Schleper C, 2003. Diversity and abundance of Crenarchaeota in terrestrial

habitats studied by 16S RNA surveys and real time PCR. Environ. Microbiol. 5, 787-797.

Page 7: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Table S2 amoA copy numbers of AOA and AOB from activated sludge

amoA gene of AOA (copies/L·sludge)4 days treatment

Control SEa C6+3-O-C6

SE C14+3-O-C14 SE All SE

Sample 1b 3.40E+051.21E+04

2.27E+054.60E+04

4.58E+058.13E+04

1.46E+053.20E+04Sample 2 3.59E+05 1.81E+05 7.21E+05 2.51E+05

Sample 3 3.17E+05 3.36E+05 5.02E+05 1.68E+05

amoA gene of AOB (copies/L·sludge)4 days treatment

Control SEC6+3-O-

C6SE C14+3-O-C14 SE All SE

Sample 1 2.61E+072.30E+06

3.16E+076.14E+06

2.63E+073.79E+06

3.45E+072.92E+06Sample 2 3.31E+07 4.91E+07 2.68E+07 3.93E+07

Sample 3 2.63E+07 2.99E+07 3.79E+07 2.92E+07

amoA gene of AOA (copies/L·sludge)16 days treatment

Control SEC6+3-O-

C6SE C14+3-O-C14 SE All SE

Sample 1 4.29E+052.73E+04

6.10E+051.10E+05

8.81E+055.83E+04

1.03E+068.84E+04Sample 2 3.64E+05 8.30E+05 9.50E+05 1.06E+06

Sample 3 3.37E+05 9.89E+05 1.08E+06 7.81E+05

amoA gene of AOB (copies/L·sludge)16 days treatment

Control SEC6+3-O-

C6SE C14+3-O-C14 SE All SE

Sample 1 2.60E+07 6.68E+06 5.21E+07 4.92E+06 5.81E+07 5.35E+06 7.39E+07 7.03E+06

Page 8: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Sample 2 3.87E+07 3.87E+07 5.08E+07 5.20E+07Sample 3 4.91E+07 3.63E+07 3.97E+07 7.22E+07

a SE: standard errorb All the qPCR experiments were performed in triplicate using the independent samples. Sample 1, 2, 3 represent triplicate treatment cultures.

Page 9: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Figure S1. The AHLs degradation studies in activated sludge by AHLs biosensor A.

tumefaciens A136. The seed sludge samples were respectively incubated with 2 µM solutions

of various AHLs for 1h, 2h, 4h or 14h after which the culture supernatants were either spotted

onto A. tumefaciens A136-agar plate (containing X-Gal).

KB: ethanol control; C14: long-chain AHLs (C14-HSL and 3-oxo-C14-HSL); All: combined

mixture of C6-HSL, 3-oxo-C6-HSL, C14-HSL, and 3-oxo-C14-HSL

Page 10: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Figure S2. Rarefaction analyses of 16S rRNA gene in bacteria communities from different

AHLs treated activated sludge samples. These icons represent treated with KB: ethanol

control; C6: short-chain AHLs (C6-HSL and 3-oxo-C6-HSL); C14: long-chain AHLs (C14-

HSL and 3-oxo-C14-HSL); All: total mixture of C6-HSL, 3-oxo-C6-HSL, C14-HSL, and 3-

oxo-C14-HSL in 4 days or 16 days.

Page 11: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Table S3 Coverage and diversity indices of bacterial 16S rRNA gene libraries of the activated sludge samples

Sample ID Reads0.97

OTU ace chao1 shannon simpsonAll-4d 8912 792 879 883 5.51 0.0138

All-16d 10104 798 943 952 5.34 0.0156C14-4d 10572 883 1010 1024 5.53 0.0118C14-16d 10690 819 950 959 5.41 0.0136C6-4d 11073 872 993 1009 5.6 0.0095

C6-16d 10828 857 981 992 5.41 0.0168KB-4d 11452 872 1013 1031 5.47 0.0133

KB-16d 9683 778 894 897 5.26 0.0193

Page 12: ars.els-cdn.com · Web viewLong and short chain AHLs affect AOA and AOB microbial community composition and ammonia oxidation rate in activated sludge Jie Gao1,2,**, Yu Duan3,**,

Figure S3 Hierarchical cluster analysis and relative abundance of bacterial communities from

activated sludge samples classified by Mothur at the phylum level. Sequences that could not

be classified into any known group were assigned as “Unclassified”, and other phylum parts

with the relative abundance lower than 1 % were assigned as “Others”.