aquatic invasions in the black, caspian, and mediterranean seas (2004) ww

Aquatic Invasions in the Black, Caspian, andMediterranean Seas

NATO Science SeriesA Series presenting the results of scientific meetings supported under the NATO ScienceProgramme.

The Series is published by IOS Press, Amsterdam, and Kluwer Academic Publishers in conjunctionwith the NATO Scientific Affairs Division

Sub-Series

I. Life and Behavioural Sciences IOS PressII. Mathematics, Physics and Chemistry Kluwer Academic PublishersIII. Computer and Systems Science IOS PressIV. Earth and Environmental Sciences Kluwer Academic PublishersV. Science and Technology Policy IOS Press

The NATO Science Series continues the series of books published formerly as the NATO ASI Series.

The NATO Science Programme offers support for collaboration in civil science between scientists ofcountries of the Euro-Atlantic Partnership Council. The types of scientific meeting generally supportedare “Advanced Study Institutes” and “Advanced Research Workshops”, although other types of meetingare supported from time to time. The NATO Science Series collects together the results of these mee-tings. The meetings are co-organized bij scientists from NATO countries and scientists from NATO’sPartner countries – countries of the CIS and Central and Eastern Europe.

Advanced Study Institutes are high-level tutorial courses offering in-depth study of latest advances ina field.Advanced Research Workshops are expert meetings aimed at critical assessment of a field, and iden-tification of directions for future action.

As a consequence of the restructuring of the NATO Science Programme in 1999, the NATO ScienceSeries has been re-organised and there are currently five sub-series as noted above. Please consult thefollowing web sites for information on previous volumes published in the Series, as well as details of ear-lier sub-series.

http://www.nato.int/sciencehttp://www.wkap.nlhttp://www.iospress.nlhttp://www.wtv-books.de/nato-pco.htm

Series IV: Earth and Environmental Sciences – Vol. 35

Aquatic Invasions in the Black,Caspian, and Mediterranean SeasThe Ctenophores Mnemiopsis leidyiand Beroe in the Ponto-Caspian and otherAquatic Invasions

edited by

Henri DumontUniversity of Ghent,Institute of Animal Ecology, Ghent, Belgium

Tamara A. ShiganovaShirshov Institute of Oceanology,Russian Academy of Sciences, Moscow, Russia

and

Ulrich NiermannMarine Ecology,Heiligenhafen, Germany

KLUWER ACADEMIC PUBLISHERSNEW YORK, BOSTON, DORDRECHT, LONDON, MOSCOW

http://www.springerlink.com

eBook ISBN: 1-4020-2152-6Print ISBN: 1-4020-1866-5

©2004 Springer Science + Business Media, Inc.

Print ©2004 Kluwer Academic Publishers

All rights reserved

No part of this eBook may be reproduced or transmitted in any form or by any means, electronic,mechanical, recording, or otherwise, without written consent from the Publisher

Created in the United States of America

Visit Springer's eBookstore at: http://www.ebooks.kluweronline.comand the Springer Global Website Online at: http://www.springeronline.com

Dordrecht

http://www.ebooks.kluweronline.com

http://www.springeronline.com

Contents

Preface

Henri J. Dumont, Tamara A. Shiganova & Ulrich Niermann . . . . . . . . . . . . . . ix

PART 1. Mnemiopsis leidyi, Beroe ovata, and their interaction

1. Mnemiopsis leidyi: distribution and effect on the Black Sea ecosystem during the first years of invasion in comparison with other gelatinous blooms

Ulrich Niermann . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .3

2. Interactions between the invading Ctenophores Mnemiopsis leidyi(A. Agassiz) and Beroe ovata Mayer 1912, and their influence on the Pelagic Ecosystem of the Northeastern Black Sea

Tamara A. Shiganova, Henri J. Dumont, Alexander Mikaelyan, Dmitry M. Glazov, Yulia V. Bulgakova, Eteri I. Musaeva, Pavel Y. Sorokin, Larisa A. Pautova, Zinaida A. Mirzoyan & Ekaterina I. Studenikina . . . . . . . . . . . . . . . . . . . . . . 33

3. Population dynamics of Mnemiopsis leidyi in the Caspian Sea, and effects on the Caspian Ecosystem

Tamara A. Shiganova, Henri J. Dumont, Arkadyi F. Sokolsky, Andrey M. Kamakin, Dariga Tinenkova & Elena K. Kurasheva . . . . . . . . . . . 71

4. Distribution and biology of Mnemiopsis leidyi in the Northern Aegean Sea, and comparison with the indigenous Bolinopsis vitrea

Tamara A. Shiganova, Epaminondas D. Christou, Julia V. Bulgakova, Ioanna Siokou-Frangou, Soultana Zervoudaki & Apostolos Siapatis . . . . . . .113

5. Effects of Beroe cf ovata on gelatinous and other zooplankton along the Bulgarian Black Sea Coast

Lyudmilla Kamburska. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .137

6. Decreased levels of the invasive ctenophore Mnemiopsis in the Marmara Sea in 2001

Melek Isinibilir, Ahmet N. Tarkan & Ahmet E. Kideys . . . . . . . . . . . . . . . . . .155

vi

7. Preliminary investigation on the molecular systematics of the invasive ctenophore Beroe ovata

Keith M. Bayha, G. Richard Harbison, John H. McDonald & Patrick M. Gaffney . . . . . . . . . . . . . . . . . . . . . . . . . . . 167

8. Introduction of Beroe cf. ovata to the Caspian Sea

needed to control Mnemiopsis leidyi

Stanislav P. Volovik & Irina G. Korpakova. . . . . . . . . . . . . . . . . . . . . . . . . . 177

9. Feeding, respiration and growth of Ctenophore Beroe cf ovata in the low salinity conditions of the Caspian Sea

Ahmet E. Kideys, Galina A. Finenko, Boris E. Anninsky, Tamara A. Shiganova, Abdolghasem Roohi, Mojgan Rowshan Tabari, M. Youseffan, Mohammad T. Rostamiya. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193

10. A brief résumé of the status of the Mnemiopsis population in the Turkmen sector of the Caspian Sea according to observations during the first half of 2002

Firdouz M. Shakirova. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201

11. Dynamics of Mnemiopsis distribution in the Azerbaijan sector of the Caspian Sea in 2001-2002

Zulfugar M. Kuliyev . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203

12. Investigation on the distribution and biomass of Mnemiopsis in the Kazakhstan sector of the Caspian Sea in May 2002

Yulia A. Kim, L.V. Kwan & G. Demesinova . . . . . . . . . . . . . . . . . . . . . . . . . . 205

PART 2. Ponto-Caspian species invading Europe; information network

13. Range extensions of Ponto-Caspian aquatic invertebrates in Continental Europe

Henk A.M. Ketelaars . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209

14. Living in a sea of exotics – the Baltic Case

Erkki Leppäkoski . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237

15. Internet-based information resources of aquatic alien species relevant to the Ponto-Caspian Region

Vadim E. Panov . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257

vii

PART 3. Other Mediterranean invaders

16. Invasion of the jellyfi sh Pelagia noctiluca in the Northern Adriatic: a non-success story

Alenka Malej & Alenka Malej Jr. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 273

17. Caulerpa taxifolia: 18 years of infestation in the Mediterranean Sea

Thierry Thibaut & Alexandre Meinesz . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 287

PART 4. Conclusions from the meeting

18. Conclusions from the meeting

Henri J. Dumont, Tamara A. Shiganova & Ulrich Niermann. . . . . . . . . . . . . .301

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307

This page intentionally left blank

ix

Preface

The present volume contains the presentations of a NATO advanced Research Workshop (ARW) entitled “The invasion of the Black, Mediterranean and Caspian Seas by the American Ctenophore, Mnemiopsis leidyi Agassiz: a multidisciplinary perspective and a comparison with other aquatic invasions”, held on 24 - 26 June 2002 in Baku (Azerbaijan). The meeting was financed by the NATO Division for Scientific and Environmental Affairs (Brussels); substantial logistic support was provided by the CEP (Caspian Environmental Program) of the GEF in Baku.

The Mediterranean, Black, and Caspian Seas represent three fragments of the former Tethys Sea, and are thus of great interest to understanding the evolution of the entire region where Eurasia, Africa and the Arabian Peninsula meet. While the Mediterranean is a typical marine environment, with salinity even a little above the world ocean’s, the Black Sea is a brackish meromictic lake, and the Caspian is a lake with a saline gradient extending from a freshwater basin in the North to a brackish water basin in the South.

Intense fishing activity takes place in all three seas, while maritime traffic through the Dardanelles and Bosporus, and via the Lenin Canal (between the Don and Volga rivers) to the Caspian Sea has become greatly intensified in the course of the last few decades. Other events of interest are the 20th century achievement of linking of all major European rivers by canals, making it possible for ships to navigate from the mouth of the Volga to the Baltic, from the Danube to the Rhine, and from there to all other major European Rivers. Such an anastomosed system does not only allow ships to pass between basins, however. Biota follow in their wake, either by active migration, or by attaching to the hulls of ships, and thus the Black Sea and Caspian faunas and floras, long sequestered in their closed basins, all of a sudden were given an opportunity to “escape”.

On the other hand, alien invaders increasingly found their way to the three seas in question, often as stowaways in the ballast water tanks of larger ships, occasionally attacked to their hulls. Some of the newcomers expanded to enormous numbers in the receiving ecosystem, where they may - and indeed do - cause great economic damage.

The main objective of the workshop was to provide an up-to-date overview of the situation in the Ponto-Caspian with regard to the jelly invasions that have been perturb-ing the local pelagic ecosystems since the early 1980s, and contrast that with biological invasions elsewhere, in an effort to try and identify general underlying principles.

The workshop brought together a group of experts from the region itself, beside others from a number of NATO - or NATO-associated countries. For help before, during, and after the meeting, the editors are grateful to Alain Jubier of NATO, to Tim Turner and Vladymyr Vladymyrov of the CEP, and particularly to Ms. Shafaq Karaeva, Secretary of the CEP, who skilfully took care of the practical aspects of the meeting, solving unantici-pated problems even before anybody had become aware of their existence.

Henri J. Dumont, Tamara A. Shiganova & Ulrich NiermannThe Editors

PART 1

Mnemiopsis leidyi, Beroe cf ovata, and their interaction

Ulrich Niermann Mnemiopsis leidyi: distribution and effect . . . . . . 3on the Black Sea ecosystem during the first years of invasion in comparison with other gelatinous blooms

Tamara A. Shiganova, et al. Interactions between the invading . . . . . . . . . . . .33Ctenophores Mnemiopsis leidyi(A. Agassiz) and Beroe ovata Mayer 1912, and their influence on the Pelagic Ecosystem of the Northeastern Black Sea

Tamara A. Shiganova, et al. Population dynamics of Mnemiopsis leidyi . . . . .71in the Caspian Sea, and effects on the Caspian Ecosystem

Tamara A. Shiganova, et al. Distribution and biology of . . . . . . . . . . . . . . . . .113Mnemiopsis leidyi in the northern Aegean Sea, and comparison with the indigenous Bolinopsis vitrea

Lyudmilla Kamburska Effects of Beroe cf ovata on gelatinous . . . . . . .137and other zooplankton along the Bulgarian Black Sea Coast

Melek Isinibilir, et al. Decreased levels of the invasive ctenophore. . . . 155Mnemiopsis in the Marmara Sea in 2001

Keith M. Bayha, et al. Preliminary investigation on . . . . . . . . . . . . . . . .167the molecular systematics of the invasive ctenophore Beroe ovata

Stanislav P. Volovik Introduction of Beroe cf. ovata to the . . . . . . . . . 177& Irina G. Korpakova Caspian Sea needed to control

Mnemiopsis leidyi

Ahmet E. Kideys, et al. Feeding, respiration and growth of . . . . . . . . . . .193the Ctenophore Beroe cf ovata in the conditions of low salinity of the Caspian Sea

Firdouz M. Shakirova A brief résumé of the status of . . . . . . . . . . . . . . . 201the Mnemiopsis population in the Turkmen sector of the Caspian Sea according to observations during the first half of 2002

Zulfugar M. Kuliyev Dynamics of Mnemiopsis distribution . . . . . . . . .203in the Azerbaijan sector of the Caspian Sea in 2001-2002

Yulia A. Kim, et al. Investigation on the distribution and . . . . . . . . . 205biomass of Mnemiopsis in the Kazakhstan sector of the Caspian Sea in May 2002

Chapter 1

Mnemiopsis leidyi: Distribution and Effect on the Black Sea Ecosystem During the First Years of Invasion in Comparison with Other Gelatinous Blooms

ULRICH NIERMANNMarine EcologyAm Sackenkamp 37, 23774 Heiligenhafen, GermanyTel: (0049) 04362 900237 - E-mail: [email protected]

Keywords: Black Sea, anchovy, Engraulis encrasicolus, Mnemiopsis leidyi, teleconnections, regime shift

We review the possible sources and effects of the outburst of Mnemiopsis in the Black Sea in comparison with other gelatinous blooms in the Black and Baltic Seas, and in comparison with the dramatic increase of jellyfish biomass (Chrysaora melanaster) in a quite different ecosystem, the arctic Bering Sea, starting in the same period (the early 1990s). Similar patterns were obvious in both ecosystems and these could be useful to understand the Mnemiopsis plague in the Black and Caspian Seas.

During 1988/89, the pelagic part of the Black Sea ecosystem experienced the out-burst of the accidentally introduced zooplanktivorous ctenophore Mnemiopsis leidyi.Concurrently, drastic changes in the Black Sea ecosystem, i.e. dramatic changes in the zooplankton and a strong decline of the Black Sea fi shery, occurred. These changes have been most often attributed to the invasion of Mnemiopsis leidyi, which is a voracious feeder on small fish larvae and mesozooplankton, and competes with zooplanktivorous fishes for food. The enormous impact of Mnemiopsis on the Black Sea ecosystem in the late 1980s and early 1990s became possible due to a shortage of predators and competi-tors there. Also, zooplanktivorous fish populations (mainly anchovy) had been severely reduced by overfishing prior to the ctenophore outbreak.

But beside overfishing and other man-made events, such as pollution, eutrophication, regulation of river outflows, the changes in the Black Sea ecosystem also seem con-nected with particular changes in the climatic regime at the end of the 1980s. These may have triggered the changes in the phyto - and mesozooplankton communities that led to favourable conditions for the outburst of M. leidyi, and to the decline of the anchovy.

3

H. Dumont et al. (eds.),Aquatic Invasions in the Black, Caspian, and Mediterranean Seas, 3–31.© 2004 Kluwer Academic Publishers. Printed in the Netherlands.

4 Ponto-Caspian aquatic invasions

1. Introduction

The outburst of the accidentally introduced ctenophore Mnemiopsis leidyi, the strong decline of the mesozooplankton, and the collapse of the anchovy (Engraulis encrasi-colus) fishery were the key events which marked the history of the Black Sea at the end of the 1980s. Due to the high economic losses in anchovy landings, a large number of investigations were carried out on Mnemiopsis increase and anchovy decline. The results of these studies, as well as a number of comprehensive papers and reviews can be found in Kideys et al. (1999), Mutlu (1999), Shiganova & Bulgakova (2000), Kideys & Romanova (2001), Purcell et al. (2001), Gücü (2002), Kideys (2002), and Kamburska, et al. (in press).

Scientific agreement has it that pollution, eutrophication and many anthropogenic alterations of the natural environment have vastly altered the Black Sea ecosystem since the early 1960s (Zaitsev & Mamaev, 1997). This resulted in changes in the trophic chain (phytoplankton zooplankton planktivorous fish), which were obvious already in the 1970s, when the scyphozoan Aurelia aurita became a progressively more dominant member of the planktonic community. Instead of the overfi shed fish stocks, the jelly organisms directly tap in the secondary production, fi rst Aurelia during the 1970s and 1980s, and next Mnemiopsis in the 1990s (Gücü, 2002). Laboratory experiments and in situ mesocosm studies on the predation and relative predation potential of Mnemiopsishave shown that this ctenophore is an important predator of zooplankton, anchovy eggs and larvae, especially yolk-sac larvae (Burrell &Van Engel, 1976; Mountford, 1980; Cowan & Houde, 1993; Purcell, et al., 1993; Sergeeva, et al., 1990; Tsikhon-Lukanina, et al., 1991; Tsikhon-Lukanina & Reznitchenko, 1991). Mnemiopsis could, therefore, be a threat to the fishery by compromising year-class recruitment (Monteleone & Duguay, 1988). The high fecundity (an average of 8000 eggs within 23 days in native waters; about 12000 eggs in 10 days in the Black Sea) and the huge growth rates (up to a daily doubling of individual biomass) observed in this ctenophore can only be sustained by high feeding rates (Reeve et al., 1978; Purcell et al., 2001 and references therein).

Since the seasonal bloom of Mnemiopsis starts as well in the main spawning season of the anchovy in July/August and continues until late autumn (Shushkina & Vinogradov, 1991), M. leidyi is well-placed to decimate a stock of fish larvae either by predation or by food competition. Concerning the decline of the anchovy, four main hypothesis have been advanced. In situ, a combination of all four is imaginable.1. Due to the predation of Mnemiopsis leidyi on fish eggs and larvae, the anchovy

stock collapsed during 1989/90 (Zaika & Sergeeva, 1990; Vinogradov et al., 1989, Niermann et al., 1994)

2. Due to the voracious predation of M. leidyi on mesozooplankton, the main food of anchovy, Mnemiopsis outcompeted the anchovy. The anchovy stock starved (Vinogradov, et al., 1992).

3. Due to a fast increasing fishery since the mid 1980s the anchovy stock was over-fished and collapsed by end of the 1980s. Thus the mesozooplankton stock, which was used before by anchovy was now available for M. leidyi and led to the bloom of the ctenophore (Mills, 1995).

Distribution and effect on the Black Sea ecosystem 5

4. The collapse of the anchovy fishery and the outbreak of M. leidyi were triggered by a regime shift, which started in the mid to end 1980s, and affected both the phyto-plankton and zooplankton communities.

The first hypothesis was an attempt to explain the drastic decrease of the anchovy stock, but it was discredited because the anchovy stock collapsed in the same year in which M. leidyi bloomed. If the ctenophore had annihilated the early life stages of anchovy during 1989, then the collapse of the anchovy should have occurred with a delay of about 1 - 2 years, the time needed for anchovy to grow adult and get recruited to the fishery, at a size of about 8-11 cm (F. Bingel, pers. com.). The second hypothesis better explains the harsh decline of the mesozooplankton and the anchovy fishery. It was also supported by the finding of Shulman & Yuvena (2002), that the sprat stock (Sprattussprattus, a plankton-feeder) of the north-western shelf of the Black Sea was starving. The same was true for small anchovy larvae during 1989-91, as indicated by a very high percentage of empty guts in comparison with 1955-65 (Tkach et al. 1998).

Although the overfishing hypothesis had much explanatory power, it was not well received in the papers during the first years after the M. leidyi outburst. In the recent literature, it is more often taken into consideration (Gücü, 1997; Prodanov et al., 1997; Purcell et al., 2001; Gücü, 2002).

The hypothesis that the changes in the Black Sea ecosystem at the end of the 1980s could have been triggered by world-wide changes in climate, which in their turn led to changes in the planktonic structure of the Black Sea, was advanced as early as the mid 1990s (Niermann et al., 1999). At present this hypothesis has moved to the forefront, since other papers related to a regime shift over the northern hemisphere were pub-lished by the end of the 1990s, stating among others that the abundance and timing of Mnemiopsis in Narragansett Bay may be correlated with the North Atlantic Oscillation (NAO) (Kremer, 2002). Such teleconnection patterns are spatial modes of variation in the atmosphere that may persist for months to decades and can be used to quantify atmo-spheric circulation changes. Striking changes were observed in the NAO (North Atlantic Oscillation), SO (Southern Oscillation), ENSO (Southern Oscillation (El Niño Index), and ALPI (Aleutian Low Pressure Index) in the second half of the 1980s, resulting in changes of the hydrological and meteorological regime (river run off, salinity, sea - and air temperature, atmospheric pressure, precipitation and strength of westerly winds) in the northern hemisphere.

In the recent literature, most authors agree that the collapse of the anchovy fi shery should not be explained by the voracious grazing of the ctenophore alone, but to an interlocking of all events. Nevertheless, depending of the field of interests of different authors, the hypothesis which fits best to their ongoing research programmes is pushed to the foreground. Here, we will start with the fluctuations of the anchovy stocks in the Mediterranean and Black Sea, to review the possible impacts of gelatinous blooms on mesozooplankton and small pelagics. The findings in the Black Sea will be compared with findings in the Baltic Sea, where extraordinary jellyfish blooms are a normal feature of the ecosystem, and with the Bering Sea where, like in the Black Sea, the fish stock decreased, whereas the jellyfish increased by end of the 1980s.


2. Anchovy landings in the Mediterranean and Black Seas

Anchovy occupy lower trophic levels feeding chiefly on zooplankton. Anchovy larvae strongly depend on certain groups of phytoplankton such as diatoms (Lasker 1988). Due to this feeding behavior anchovy is highly dependent on the annual fluctuation of the seasonal phyto - and zooplankton blooms. This dependence on lower tropic levels is one of the reasons for the high annual fluctuation of anchovy stocks. Since anchovies spawn already in the second year of life, there is always a potential danger of recruit-ment overexploitation. That means that anchovy stock can become easily overfished by not respecting a minimum length in fishing. The trends in anchovy landings in different parts of the Mediterranean and in the Black Sea highlight the characteristic fl uctuation of this species (Fig. 1).The Balearic anchovy stock declined as early as the mid eighties, from 80.000 metric

tons to 20.000 tons (Fig. 1a). In the beginning of the 1980s, the anchovy stock from the Ionian Sea decreased by one third (Fig. 1b). In the Adriatic, the anchovy stock displayed high fluctuation and finally decreased from 1985 to 1986 by a factor five to fluctuate at a very low level till 1995 (Fig. 1c). In 1988, one year earlier than in the Black Sea, a simi-lar decrease in anchovy landings was obvious in the Aegean Sea (Fig. 1d). In the Black Sea, the decline was the most striking one of the whole Mediterranean area. The Turkish anchovy catch of the Black Sea fell by a factor 4, from 295.000 to 66.000 metric tons in 1991. The total anchovy catch of the Black Sea collapsed from about 526.000 tons to 161.000 tons between 1988 and 1989, and to 85 000 tons in 1991. (Fig. 2)

Obviously, all anchovy stocks in the Mediterranean displayed pronounced fl uctua-tions, similar to those in the Black Sea, although slightly displaced in time. Similar to all regions was, that all stocks collapsed after a short period of high exploitation. Except for the Balearic zone, where catches did not recover, all landings including the Black Sea ones recovered since mid 1992. It should also be pointed out that the stocks of the Mediterranean collapsed without the occurrence of jellies. Only in the Black Sea did the collapse of the anchovy fishery coincide with a mass occurrence of the accidentally introduced Mnemiopsis leidyi. Comparison of the anchovy catches in different upwell-ing systems of the world showed that the anchovy stock of South Africa (Shelton, et al., 1993), Benguela, and California (Hunter & Alheit, 1995) collapsed in the same period as the anchovy stock of the Black Sea, viz. the second half of the 1980s, without impact of M. leidyi (Niermann et al., 1999).

Knowing that M. leidyi is a voracious feeder on zooplankton, fish eggs and larvae of anchovy, Mnemiopsis was immediately suspected to be guilty of the decline of the anchovy in the Back Sea. This seemed obvious, because the extremely high numbers of M. leidyi, about 840000000 tons for the entire Black Sea, reported by Vinogradov et al. (1989) should have had a deep impact on the standing stock of mesozooplankton and larval fishes. That enormous biomass was estimated by extrapolating the biomass found at 32 stations all over the Black Sea, but seemingly without much consideration for patchiness in the distribution of gelatinous zooplankton. The extrapolation was aimed at showing the enormous development of the ctenophore, but it was henceforth used to emphasize the extraordinary biomass of Mnemiopsis (see Weisse et al., 2002 for a critical review of the Mnemiopsis biomass estimation in the Black Sea). Ecosystem modelling


Figure 1. Trends in the landings of anchovy (Engraulis encrasicolus) in statistical divisions of the Mediterranean (FAO Statistic area 37). Annual nominal catches (in metric tons). Landings of the fi shing fleets of Spain, Algeria, France, Italy, and Greece. (Redrawn from P. Oliver, 2001)

8P

onto-Caspian aquatic invasions

Figure 2. Black Sea total and Turkish anchovy catch and biomass of Mnemiopsis leidyi (Turkish catch data from DIE, 1968-2000; total anchovy catch from FAO; data for M. leidyi from Mutlu et al., 1994, Kideys et al., 1999, and Kideys, unpublished


suggests that neither the carrying capacity nor the trophodynamic structure of the Black Sea can support a biomass value of M. leidyi as high as that reported in 1989 (Gücü & Oguz, 1998). Modelling results of Gücu, 2002 also showed that much less zooplankton than observed, was needed to support the ecosystem at the end of the eighties. Thus, there was enough food for the small pelagics at the time of the fisheries collapse (1989-1990). If this is so, then the hypothesis that the anchovy stock collapsed only due to competi-tion and predation on its eggs and larvae by M. leidyi is flawed, and the discussion of the collapse of the anchovy stock should consider as well the fishery impact.

The data of Y. Artemov, IBSS, Sevastopol, Ukraine reveal that the juveniles of ancho-vy were already low by the beginning of the 1980s, while the fishery pressure increased (Fig. 3). That indicates that the fishery removed more fish during the 1980s than the fish stock was able to produce, which may have led to collapse of the stock. The data of YugNIRO, Russia (Shiganova 1997) show the same tendency: the spawning stock of anchovy, still high in the beginning of 1987, decreased due to overfishing during 1987 and therefore produced only one quarter of juveniles in 1988 compared to 1987. The, again very high, exploitation of the anchovy stock during 1988 then led to its col-lapse in 1989.

In Turkey, the first signs of overfishing on anchovy were felt as well during the 1987/88 fishing season (Gücü 2002): “The total landing of the Turkish fleet during the 1987/88 and the 1988/89 fishing seasons was almost the same, but the size of the fi sh caught in 1988/89 was remarkably lower. This indicates that the anchovy stock had already exceeded a sustainable level in 1987/88. In order to reach the same catch level, the fleet caught mainly newly recruited, small-sized fishes and juveniles in 1988/89 (Fig. 4). Consequently, the stock collapsed the year after. As a result, in 1989/90, the total anchovy catch of Turkey was only 90000 tons. Moreover, the catch included anchovies, which had not yet attained sexual maturity. The analysis of the gonadosomatic indices of the anchovies in Turkish waters before and after the collapse of the fisheries industry (Gücü, 1997) suggested that the newly recruited anchovies at the period of the fi sheries crisis (1989/90) were in better condition compared to before the crisis. This is hardly surprising, because as the size of the anchovy stock depleted, food availability to the juvenile anchovies, as well as other planktivorous organisms increased. This indicates that the Black Sea anchovy faced a recruitment failure”.

The same seems true for the anchovy of the north-western shelf of the Black Sea. Shiganova & Bulganova (2000) collected the long-term data (1951-1990) on the “stom-ach fullness” of various authors. It seems that, especially the anchovy, had enough food during the years of collapse 1998/90 (Fig. 5).

The biomass of mesozooplankton, which was not consumed by the overfi shed anchovy stock could now used by Mnemiopsis leidyi and this is what led to the enor-mous bloom of this ctenophore (Gücü, 2000, Prodanov et al., 1997). Once established, M. leidyi outcompeted the anchovy for the subsequent 2 years till 1992. Then the anchovy stock increased again, because the fishery reduced the pressure in subsequent years (Fig. 1, 2). According to Gücü (2002), a sufficient stock of small pelagics is able to control Mnemiopsis leidyi, because they are more successful in competing for the same food source, due to their speed and activity.

10P


Figure 3. Anchovy in the Black Sea: total catch 1972-1991 and number of juveniles 1954 – 1991. (data from Artemov, Institute forBiology of the Southern Seas, IBSS, pers. communication)


Figure 4. Time series of the length composition of anchovy landed by the Turkish Black Sea fleet (redrawn from Gücü, 2002)

12P


Figure 5. Stomach fullness of anchovy ( %) in the north western Black Sea (data of various authors, summarised by Shiganova & Bulganova, 2000)


3. Impact of gelatinous zooplankton on zoo - and ichtyoplankton

The disastrous impact of M. leidyi on the zooplankton and larval fish cannot be denied, especially on the eastern and north-western shelf, where densities of M. leidyi culminatedin 1988-1990 with a biomass of 4.5 kg m-2. A maximum value of 12 kg m-2 was found along the Bulgarian shelf in April 1990 (Vinogradov & Tumantseva, 1993).

It is well documented that mass occurrence of jellyfish and ctenophores may deplete the zooplankton and affect the recruitment of fish (Purcell, 1992; Purcell at al., 2001). Scyphozoa and ctenophores have a strong predation potential. Aurelia aurita can consume about 10 000 copepods per individual per day in the Kiel Bight and maximal ingestion of Chrysaora quinquecirrha is 19 000 indiv. medusa-1 day-1 (Purcell, 1992). These rates indicate that scyphomedusans and ctenophores are perfectly capable of inducing a collapse of the zooplankton when the individuals occur at sufficient densi-ties.

Results of long-term studies have shown that mesozooplankton and herring larval abundance in the Kiel Bight is significantly lower during years rich in Aurelia auritamedusae than in years with low medusa stocks. (Möller, 1984, Schneider & Behrends, 1994). Schneider & Behrends (1994) calculated that in bloom years A. aurita may consume about two-thirds of the daily secondary production in the Kiel Fjord. In the Chesapeake Bay, densities of Mnemiopsis leidyi of about 12 individual m-3 could remove 23-32% of the zooplankton stock per day (Purcell at al., 2001); at low densities (3-6 indiv m-3), M. leidyi still removes 11-17% zooplankton d-1. Further, M. leidyi was estimated to consume also a high amount of (about 20-40% d-1) bay anchovy eggs and larvae (Cowan & Houde, 1993). Estimations of Purcell at al., (2001) show that M. leidyi is capable of clearing 30–100% d-1 of fish eggs, but < 5% of the fish larvae in Chesapeake Bay.

Observations on the decline of the zooplankton at the end of the 1980s – beginning of the 1990s in the Black Sea agree well with the foregoing findings (Vinogradov et al., 1992, Petranu, 1997, Shiganova et al., 1998, Shiganova et al., 2001a, Kamburska, et al., in press).

Taking these enormous clearance rates into account it seems possible for M. leidyi to have had a high regional impact on the decline of the anchovy in the Black Sea. This hypothesis was supported by the finding of Shulman & Yuvena (2002) that the fat content of the sprat stock (Sprattus sprattus, plankton-feeder) of the north western shelf of the Black Sea was very low, indicating starvation. The same was found for anchovy larvae. Stomach analyses of Tkach et al. 1998 revealed that in smaller larvae (<6 and also 6-12 mm) in 1989-91 the percentage of empty guts was very high in comparison with 1955-65, while this was less true for bigger larvae (12-25 mm). In addition, the species composition in the gut contents had changed: while preferred species as certain copepods decreased (Oithona nana had disappeared), Acartia clausi had come up, compelling the larvae to eat less preferred food items.

However, the mass development of Aurelia aurita in the 1970s and mid 1980s, reached about the same biomass in terms of carbon as the M. leidyi bloom in 1989 (Shiganova et al., 1998), yet a similar impact on the anchovy stock did not occur. This may be due to the fact that at that time the anchovy was not overfished and it could control the medusa, which occupies the same trophic level and competes for the same food source.


How, then, was it possible, that after the collapse of anchovy in 1989, Mnemiopsisleidyi could take the leading position as the top mesozooplanktivourous species and not native Aurelia aurita, after its blooms of the 1960-1970s and 1980s (Weisse & Gomoiu, 2000). The biomass of Aurelia had risen with increasing eutrophication since 1950 (Caddy & Griffith, 1990) and reached one million tons of wet weight (wwt) in the early 1960s. Further and accelerated anthropogenic stress led the population size of Aurelia to increase even further in the late 1970s, reaching a total wet weight of 300-500 million tons in the 1980s (Gomoiu, 1980; Zaitsev, 1993) with a peak biomass of about 1.5 kg wwt m-2

in 1988 (Shushkina & Vinogradov, 1991). This corresponds to 1.5-4.5 g C m-2 (Weisse & Gomoiu, 2000). Probably, the absence of parasites and predators and its hermaphro-ditic reproduction mode is what gave the newcomer M. leidyi an edge in the interspecies competition with Aurelia. The medusa’s life-cycle involves an asexually reproducing polyp, which requires a substrate to settle. Reproduction is, therefore, restricted to coastal waters, where a substrate within the oxygenated zone is available. In contrast, the cteno-phore, M. leidyi sheds its gametes directly into the surrounding seawater where fertilisa-tion takes place (Brusca, 1990). Thus, M. leidyi can occupy as well inshore as offshore waters, while the spread of A. aurita starts from coastal water in spring.

4. Regime shift

The question remains why the outburst of Mnemiopsis leidyi and the subsequent col-lapse of the anchovy fishery occurred specifically at the end of the 1980s and not before or after. M. leidyi was observed already in the Black Sea at the beginning of the 1980s (Vinogradov & Tumantseva, 1993). It could be assumed that, due to the man-made and natural environmental changes occurring since the end of the 1960s, the pelagic ecosys-tem was driven to an ever more unstable state, with a changed prey-predator relationship (Zaitzev & Mamaev, 1997, Moncheva & Krastev, 1997, Bodeanu, in press), and that the outburst of M. leidyi required only a trigger, which was favoured by the altered trophic structure. This trigger could have been overfishing, as above mentioned, or a climatic signal, during or at the end of the 1980s. After comparing the long-term fluctuations of plankton and anchovy of the Black Sea with fluctuations in other regions of the world, Niermann et al. (1999) hypothesized that the changes in the Black Sea at the end of the 1980s could be linked to large-scale meteorological events. Indeed, pronounced changes in the ecosystem in the late 1980s - early 1990s were not only observed in the Black Sea (Mankovsky et al., 1996; Niermann & Greve, 1997; Ozsoy & Ünlüata, 1997; Polonsky et al., 1997; Yunev et al., 2002, Moncheva et al., 2002), but as well in the north Atlantic, North Sea, Baltic Sea, and European fresh water lakes (summarised in Niermann et al., 1999), and even in the North Pacific (Brodeur et al., 1999 and references therein). For the description of large, decadal scale switches in the abundance and composition of com-munities as plankton and fish, the term “regime shift” is used (Hare et al., 2000).


4.1. REGIME SHIFT IN THE NORTH SEA

The major change which occurred in the North Sea ecosystem circa 1988 affected all trophic levels, from phytoplankton to fish and birds (Reid & Edwards, 2001 and refer-ences therein).

Reid & Edwards (2001) summarized the changes in the North Atlantic and North Sea as follows:

- Since 1988 sea surface temperatures remained above average.- The levels of the annual Phytoplankton Colour in the North Sea and in oceanic

waters west of the British Isles, as measured on the silks of the Continuous Plankton Recorder (CPR) almost doubled after 1987, and more than a 90% rise in colour intensity occurred during the winter months (Edwards et al., 2001).

- Species of zooplankton and fish (Fig. 6) normally found in more southerly latitudes migrated into the North Sea and developed (Corten & van de Kamp, 1996). For example, a small fishery on the ‘Mediterranean’ red mullet is now operational for the first time in the central North Sea (Dunn & Reid, in prep.).

- the Biomass of the North Sea fish stocks decreased as in the Black Sea during 1989 (Fig. 7).

Figure 6. Abundance of southern fish species in the southern North Sea (Corten & Kamp, 1996)

Reid & Edwards (2001) conclude: „The hydrometeorological events that took place in the 1987/88 period appear to have impacted terrestrial and marine systems and are likely to have exacerbated coastal eutrophication effects due to enhanced riverine inputs of nutrients. While the coincident timing of all these events does not prove a relationship,

16P


Figure 7. Biomass of North Sea fish stocks: 1976-1998. Data from ICES (Reid & Edwards, 2001)


the large-scale nature of the changes suggests that they are part of a regional and possibly Atlantic- wide climatic change. The timing of the regime shift of 1988 coincides with the beginning of a period with the most persistent and high NAO index since at least the mid 19th century and with the beginning of the most consistently positive phase of the NAO in more than 150 years of measured record (Dickson & Turrell, 2000)”. NAO stands for: North Atlantic Oscillation, an index which expresses the pressure difference between the Azores high and Iceland low. A highly positive NAO index is associated with strong wind circulation in the North Atlantic. The state of the NAO determines the speed and direction of the westerlies across the North Atlantic, as well as the winter temperatures on both sides of the North Atlantic and its effects can be traced to the Black Sea and Caspian Sea, Asia (Rodionov, 1994).

4.2. REGIME SHIFT IN THE BLACK SEA

Hypotheses on teleconnections with global atmospheric events which influence the eastern Mediterranean and Black Sea regions have recently been put forward (Ozsoy & Ünlüata, 1997). Polonsky et al. (1997) found a good correlation between the Black Sea hydrology, the North Atlantic sea surface temperature (SST) variability and the ENSO-type variability of the tropical Pacific Ocean, which indicates a global ocean-atmosphere coupling. Both types of variability lead to changes of the cyclone trajectories, precipi-tation over the river drainage basins and changes in the river discharges, resulting in changes in the north-western Black Sea hydrography, which may finally lead to changes in the Black Sea plankton community.

After a cold period between 1984-1987, the air temperature in the Black Sea region increased during 1988-93, with exceptional warm years during 1989-1991. This was reflected by the sea surface temperature (SST) of the western Black Sea, which was extremely cold during 1985 and 1987, followed by a warm period during 1988-1991 with an exceptionally warm year in 1989. During 1987-1992, the salinity was well below the 40 year average. In the same period the Black Sea level displayed a strong decline in the mid 1980s and a sharp increase during 1988-1990 (Niermann, et al., 1999). The cold winter temperatures (“winter sea upper quasi-homogeneous layer temperature”) 1987/88 caused intense water uplift in the centres of both Black Sea gyres and intensified the circulation of the rim current. These patterns carried more nutrients to the upper mixed layer, created favourable conditions for phytoplankton growth and led to an increase in chlorophyll (Yunev, et al., 2002). Phytoplankton characteristics differed significantly in the period 1988-1992 from the periods before 1988 and after 1992 and could be charac-terised by an increase of chlorophyll during this period (Yunev et al., 2002). Zooplankton monitored off Bulgaria, Romania and Ukraine displayed an increase during the mid 1980s, followed by a sharp decline in total individual numbers at the end of the 1980s. This trend was similar to trends in other regions of the world (Petranu, 1997; Shiganova et al., 1998; Kovalev et al. 1998; Niermann, et al., 1999; Kamburska, et al., in press). In the Black Sea, major changes in species composition had become obvious already during the second half of the 1980’s. Valuable food species as big copepod species, decreased and more opportunistic species as Acartia clausi increased, compelling the juvenile and adult anchovy to eat less preferred food (Kovalev et al., 1998, Gordina et al.


1998, Tkach et al. 1998, Goubanova et al., 2001). According to Shulman & Yuvena 2002, the changes in their gut contents reflect the major changes in the zooplankton composi-tion of the second half of the 1980s.

The mechanism through which weather patterns influence the pelagic community are explained by Fromentin & Planque (1996): a high NAO pattern leads to high wind stress, generating a strong mixing of the surface layer during winter and spring. Enhanced mix-ing delays the spring phytoplankton bloom and reduces the primary production, lead-ing to a general decrease of calanoid copepods due to lack of food. Additionally, the westerlies are pushed further south and the air and sea surface temperatures are higher than normal. This is unfavourable for cold-water species and so more tolerant species are favoured. The situation is reversed by weak NAO patterns. Since copepod species constitute the main food resources for juvenile fish and small pelagics, like anchovy and sprat, a change in the copepod stock in terms of species composition and biomass has consequences for the pelagic fish stocks. In the life cycle of fish, the larval stage is the most critical phase. Fish larvae are strongly dependent on the availability of food. Anchovy, for example, eat only certain species of diatoms. This critical phase begins immediately after hatching when the young larvae still have the remnants of the yolk sac on which to subsist. In order to survive they must begin to eat sufficient planktonic food before the yolk gets exhausted. This means that the larvae must hatch in phase with plankton concentrations. If a larval fish hatches too early or too late relative to its food supply (Lasker, 1988), it will die. Additionally wind-induced turbulence (dilution effect of prey organisms) and temperature influence the capture efficiency, growth and develop-ment of fish larvae (Conover et al., 1995).

In the Black Sea, sprat recruitment is related to the strength of western winds dur-ing November-December and January-March. Prodanov et al. (1998), who analysed the long-term fluctuation of sprat (1957-1992) and whiting (1976-1992) in the Black Sea, stated that westerly winds force the upwelling of deep waters and their progress shore-wards. The upwelled waters are rich in nutrients and organic matter, and contribute much to productivity in the Black Sea.

4.3. REGIME SHIFT IN THE NORTH PACIFIC

Evidence is accumulating that there was an abrupt change in atmospheric and oceanic conditions in the North Pacific beginning around 1989-90 (for details see Brodeur et al., 1999 and Brodeur et al., 2002 and the citations therein). The effects of this recent climate shift can be observed in marine populations. An increase in the biomass of jellyfish that may be related to climate changes has been reported for the western Bering Sea in the early 1990s. Since these jellyfish increased in the same period as the M. leidyi bloomin the Black Sea, the discussion on the jellyfish increase in the Bering Sea is presented here:

The arctic Bering Sea is the most northern semi enclosed sea of the Pacific Ocean between east Siberia and Alaska and the Aleutian Islands, connected with the North Polar Sea by the street of Bering. The continental shelf of the eastern Bering Sea is the second largest in the world, and provides rich stock of walleye pollock (Gadidae). The biomass of medusae on the eastern Bering Sea shelf was relatively stable from 1975 to 1989


(< 50.000 metric tons) (Brodeur et al., 1999). Since the beginning of the 1990s it increased dramatically and averaged over 150.000 mt. (Fig. 8). The rapid increase in jellyfish biomass followed the decline of age 1 pollock and other forage fishes in each region of the SE Bering Sea after 3 to 7 yr (Fig. 9).

Figure 8. Bering Sea: Biomass (metric tons) of jellyfish collected in the total national marine fisheries service (NMFS) sampling area in 1975 and from 1979 to 1999 on the eastern Bering Sea shelf. Also shown are the totals for the SE shelf and NW middle shelf (Brodeur et al., 2002)

Figure 9. Bering Sea: Forage fish and jellyfish biomass (both 3 year running mean) based on summer bottom trawl surveys on eastern Bering Sea shelf from 1979 to 1999 (Brodeur et al., 2002)


The dominant jellyfish in this region is the scyphomedusa Chrysaora melanaster,which dominates the catch (generally > 80% of the total). Chrysaora melanaster can be an important consumer and may deplete the zooplankton standing stocks on a local scale. As M. leidyi in the Black Sea, C. melanaster feeds on early life stages of fish and shares similar diets with juvenile and adult fish (e.g. pollock). Therefore, an abundance of C. melanaster may affect the biomass of pollock through competition for prey. The inverse relationship between the biomass of forage fishes and jellyfishes suggests the possibility of a competitive interaction. Once established, jellyfishes can apparently outcompete fi sh populations because many jellyfish have higher consumption rates, respond more rapidly to pulses of food than their competitors, and have the potential to prey upon the early life stages of many fishes (Purcell et al. 1999, Purcell & Arai 2001).

Brodeur, et al., 2002 discussed two main reasons which could have triggered the increase in biomass of gelatinous zooplankton: overfishing and changes in the physical regime. Whether this increase in biomass of gelatinous zooplankton is a consequence of human intervention, perhaps related to overfishing or is a result of changes in the physi-cal regime, is unclear at this time.

4.3.1. OverÞ shing

The increase of jellyfish in the Bering Sea may be due to overfishing. The walleye pol-lock fishery removes millions of tonnes of production from the eastern Bering Sea each year and these removals have likely affected the pelagic ecosystem to some undeter-mined extent. The increase in jellyfishes may have resulted from a release from competi-tion with Age 1 pollock, juvenile herring Clupea pallasi, and capelin Mallotus villosus for zooplankton resources. Jellyfish, with their rapid growth rates and turnover times, are highly opportunistic and can easily become a dominant component of perturbed pelagic ecosystems (Mills, 2001).

4.3.2. Teleconnection patterns

As in the Black Sea, the onset of the increase of the jellyfish in the Bering Sea was around 1989, a period of change in atmospheric/oceanographic regimes in the north Pacific (Hare & Mantua, 2000) as in the North Atlantic (Reid & Edwards 2001). The increased biomass of medusae in the Bering Sea coincides with changes in the general circulation of the atmosphere, which helps determine sea surface temperature (SST) and annual extent of sea ice. The dominant pattern over the Bering Sea in spring is referred to as the North Pacific(NP) index. This index has a north-south dipole in pressure, with higher pressure over the Bering Sea and lower pressure south of the Aleutian Islands in its positive phase, and the opposite pattern (i.e. lower pressure over the Bering Sea) in its negative phase (Fig. 10). A shift toward more years with positive values of the NP (red) after the late 1980s, implied reduced cloud cover and increased solar radiation at the sea surface. Years with positive values of the NP tend to correspond to years with positive summer SST anoma-lies, including longer ice coverage. Over the north-west Middle shelf, ice persisted from 0.5 to >3 weeks longer during 1990-1997 (associated with increasing jellyfish biomass) than during the earlier period 1982-189 (associated with low jellyfish biomass).

Distribution and effect on the B

lack Sea ecosystem

21Figure 10. North Pacific (NP) index: April-July mean value shown as the first-rotated empirical orthogonal function (EOF) of 700 mb height field. A positive value corresponds to higher heights over the Bering Sea and lower heights for the region south of the AleutianIslands (Brodeur et al., 1999)


The weather patterns can influence the plankton production in the Bering Sea as fol-lows: during years (1982-1989) with early ice retreat, the spring bloom starts as late as May, by solar heating. Winds, mixing the water column, hamper stratification, and thus the phytoplankton sinks to a deeper, unproductive region. The greater ice extent over the SE Bering Sea persisting to April in the years 1990-1997 may have led to a more stable and productive surface layer following the spring ice retreat (Hunt et al., 2002). Due to the melting ice, the salinity of the surface water decreases and the stratification of the water column increases, as more as the surface water becomes warmer do to the increas-ing air temperature. The stability of the surface water column inhibits the sinking of the phytoplankton below the unproductive layer, thus enhancing primary production. The bloom associated with sea ice can account for a large fraction of the total annual phyto-plankton production. A good phytoplankton production enhances the mesozooplankton production, leading to a good food resource for the developing jellyfi sh.

5. Alternation of the plankton composition by jellyfish blooms

In the Bering Sea, another event was observed that may be put to a certain extent in relation to the jellyfish increase. It was obvious as well in the Black Sea. Extensive coc-colithophore blooms occurred in the summers 1997-1999 (Napp & Hunt 2001, Stockwell et al. 2001). Coccolithophores are a unicellular phytopankton that forms part of the nano-plankton. Most of the species are smaller than 20 µm. Characteristic is an external shell composed of calcareous plates.

Blooms of coccolithophores (Emiliana huxleyi), with a biomass 1.5-2 orders of mag-nitude larger than in normal years, were observed in the Black Sea during 1989-1992, the years during and after the Mnemiopsis bloom (Mankovsky et al., 1996, Fig. 11).

Whether these extraordinary coccolithophoride blooms can be put into relation to the increase of mesozooplanktivorous jelly organisms or to changes in the hydrological structure of the water column should be carefully investigated.

According to Behrends & Schneider (1995), continuous strong jellyfish blooms lead to a shift of the plankton composition towards nanoplankton. These authors studied the impacts of Aurelia aurita blooms to the mesozooplankton in the Baltic Sea in different years between 1978-1993. As in the Black Sea, Aurelia aurita medusae are conspicuous members of the summer zooplankton in the Baltic Sea (Schneider & Behrends, 1994). Similarities in their seasonal and annual distribution, growth, food demand and effects to the mesozooplankton are obvious in both seas. Like the Black Sea, the Baltic Sea is an enclosed sea with similar hydrography. In both seas the dominant mesozooplankton species are largely identical.

Total zooplankton numbers, i.e. the total copepod number and that of other zooplankton groups such as cladocerans, chaetognaths, polychaets, appendicular-ians and gastropod larvae were inversely related to Aurelia-abundance (Behrends & Schneider, 1995). Copepod species, which are shared with the Black Sea, as the genus Pseudocalanus, Paracalanus and the species Oithona similis, and the appendicularian Oikopleura dioica were rather affected by increasing abundance of medusae, whereas the copepods Centropages hamatus and the Acartia spp. showed no major difference

Distribution and effect on the B

lack Sea ecosystem

23Figure 11. Phytoplankton concentration in the photic zone of the western deep part of the Black Sea during 1950-1992. The phytoplanktonblooms consisted mainly of coccolithophorids. Years without bars: no measurements. (redrawn from Mankovsky et al., 1996)


in abundance during the studied period. Thus, in years with low abundance of A. auritamore than 90% of all copepods belonged to Pseudocalanus, Paracalanus and Oithonasimilis, whereas these taxa made up only 20% in a bloom year of the medusa. The abundance of the highly productive Acartia. spp. and Centropages hamatus increasedfrom 10% to 80% in a bloom year.

According to Behrends & Schneider (1995) the reason for this shift in the copepod community is not due to selectivity for the different copepod species, but to different bio-logical and ecological features of the species. Species able to compensate for losses by reproduction, were not reduced by predation of medusae. Pseudocalanus minutus elon-gatus develops and reproduces in late spring. This period coincides with the main season of A. aurelia. Consequently, the spring peak of the copepod is suppressed in bloom years of the medusa. The spawning of 0. similis in the Kiel Bight appears to occur through-out summer, at a moderate level, increasing sharply in autumn. Predation by abundant medusae on adults and developmental stages of this copepod can, therefore, hinder population build-up during summer. Both Acartia spp. and C. hamatus are known to be typical summer species, reproducing and attaining their annual peak in mid-summer. Nevertheless, their reproduction will, perhaps, be slightly affected by Aurelia predation. The larval stages of bivalves did not show a trend with increasing population densities of A. aurita, although they make up a high portion of A. aurita gut contents (up to 80% of total numbers). It seems that the high production of newly liberated larvae by the benthic adults compensates the losses due to consumption by medusae (Schneider & Behrends, 1994), although it is also possible that the larvae survive gut passage, as observed by Purcell et al. (1991).

The different response of mesozooplankton to varying abundances of medusae could have the following consequences for the zooplankton community: high abundance of medusae can modify zooplankton composition and lead finally to a modified trophic structure. The dominant copepods mentioned above represent three different feeding types: Pseudocalanus minutus elongatus and Paracalanus parvus are fi ne-filter feeders, the Acartia species and Centropages hamatus are coarse-filter feeders or omnivores, whereas Oithona similis is a raptorial predator which also needs plant material. An abun-dance of Aurelia caused reduced numbers of Pesudocalanus, Paracalanus, 0. similis, and Oikopleura. This triggers an increase of their prey, the smallest plankton size classes (ultraplankton <15 µm), including the so-called µ-flagellates (<12 µm).

These general findings in the Baltic Sea were observed as well in the Black Sea after the mass invasion of M. leidyi at the end of the 1980s (Shiganova, et al., 1988, Purcell et al., 2001, Kideys, et al., 2000). After the Mnemiopsis leidyi-invasion, a strong decline of mesozooplankton including Acartia clausi and the appendicularian Oikopleura was obvious all over the Black Sea (Purcell et al., 2001). Badly affected were the same spe-cies as in the Baltic Sea, namely Pesudocalanus, Paracalanus and 0ithona similis. Like in the Baltic Sea, Acartia clausi became the dominant species of the copepod community (Shiganova et al., 1998, Kovalev et al. 1998; Goubanova et al. 2001; Petranu, 1997).

The postulated increase in nanoplankton (Behrends & Schneider, 1995) during heavy blooms of gelatinous macroplankton seems to be in line with the observations of exten-sive blooms of coccolithophores in the Bering Sea and in the Black Sea. Since coccolitho-phores are smaller than diatoms, the usual dominant primary producers in the Bering Sea


and Black Sea, herbivores that consume coccolithophores might also be expected to be small. The number of trophic levels between primary producers and secondary consum-ers should be higher in a coccolithophore-dominated system than in a diatom-dominated ecosystem (Olson & Strom, 2002). Thus, heavy blooms of gelatinous macrozooplankton have more far-reaching consequences than the simple reduction of zooplankton prey alone. They influence, as a result of trophic cascading, the abundance and composition of both the secondary and the primary producers (Behrends & Schneider, 1995).

6. Conclusion

Around the end of the 1980s - beginning of the 1990s, the Black Sea ecosystem under-went major changes: a decrease in mesozooplankton stock, severe changes in zooplank-ton composition, an extraordinary bloom of the introduced ctenophore Mnemiopsisleidyi, and the collapse of its anchovy stock.

The root causes of these changes are not easy to identify. It seems that a combination of factors triggered them. Anthropogenic activities like pollution and eutrophication, overfishing and the accidental introduction of M. leidyi in the beginning of the 1980s may have paved the way for the changes in the Black Sea ecosystem. M. leidyi livedfor about five years in the Black Sea without notable effects, until it burst out in the years 1988-1990. It is possible that the regime shift, of which effects on hydrology and organisms were documented for the North Atlantic and North Pacific region, affected the ecosystem of the Black Sea as well. Hydrologic changes (especially an increase in water temperature), which influenced the primary production, were registered in the Black Sea too. These changes should have an impact the secondary producers and on fish larvae, due to changes in the available food composition. It may be assumed that M. leidyi ben-efited most from these changes and took over the position of Aurelia aurita.

In the Black Sea, the impact of the regime shift on the second trophic level is dif-ficult to prove, since overfishing and the voracious predation of Mnemiopsis leidyi had an impact on the mesozooplankton too. The removal of biomass of anchovy since mid 1980s may have presented the developing ctenophore with a good food resource, and so it started to deplete the zooplankton. Since 1992, in line with the changing hydrology of the Black Sea, the situation improved: the M. leidyi stock started to decrease, while the mesozooplankton stock and anchovy stock increased.

Similar effects of extraordinary jellyfish and ctenophore blooms in the Baltic Sea and in the Black Sea were obvious: a high abundance of medusae caused a decrease in mesozooplankton and ichthyoplankton, coupled with major changes in the zooplankton community. Opportunistic copepod species like Acartia spp. became dominant. The changes of the dominant mesozooplankton species finally led to modified trophic struc-ture, resulting in blooms of nanoplankton coccolithophores (Emiliana huxleyi). Blooms of this species where observed in the Black and Bering Seas together with large assem-blages of ctenophores and medusae, respectively. This may implicate that the number of trophic levels increases due to the grazing of the gelatinous plankton. Equivocal at pres-ent is whether the dominance of opportunistic copepods and coccolithophore blooms can be attributed to the grazing of gelatinous zooplankton in the Black Sea, or if they were


a result of changes in the physical regime.The sudden collapse of the anchovy fishery in the Black Sea during 1989 is in line

with the life patterns of small pelagics, which display strong fluctuation in abundance as seen in the Mediterranean and in other regions of the world. A sudden collapse of a fish stock in a whole ecosystem as large as the Black Sea due to a bloom of ctenophores or jellyfish had to date not been reported from any other sea in the world (except the Mnemiopsis invasion into the Caspian Sea which appeared to coincide with the collapse of the kilka fishery; Shiganova et al., 2001). The impact of jellyfish and ctenophores on fi n fish as previously documented was, as a rule, restricted to smaller areas. In conclu-sion, it is more likely that the collapse of the Black Sea anchovy, including the decrease of the zooplankton, was not a mere consequence of the Mnemiopsis invasion, but as well of overfishing and a shift in the oceanographic and meteorological regime at the end of the 1980s.

References

Behrends G. & G. Schneider, 1995. Impact of Aurelia aurita medusae (Cnidaria, Scyphozoa) on the stand-

ing stock and community composition of mesozooplankton in Kiel Bight (western Baltic Sea). Marine

Ecology Progress Series 127: 39-45.

Bodeanu, N., in press - Algal blooms in Romanian Black Sea waters in the last two decades of the XXth cen-

tury. Cercetari marine-Recherches marines, IRCM, 32.

Brodeur, R. D., C. E. Mills, J. E. Overland, G. E. Walters & J. D. Schumacher, 1999. Evidence for a substantial

increase in gelatinous zooplankton in the Bering Sea, with possible links to climate change. Fisheries and

Oceanography 8: 296-306.

Brodeur, R. D., H. Sugisaki & G. L. Hunt Jr, 2002. Increases in jellyfish biomass in the Bering Sea: implications

for the ecosystem. Marine Ecology Progress Series 233: 89-103.

Brusca, R. C., 1990. Invertebrates. Sinauer Associates, USA: 922 pp.

Burrell, V. G. & W. A. Van Engel, 1976. Predation by and distribution of a ctenophore, Mnemiopsis leidyi

A. Agassiz, in the York River estuary. Estuarine and Coastal Marine Sciences 4: 235-242.

Caddy J. F. & R. C. Griffiths 1990. Recent trends in the fisheries and environment in the General Fisheries

Council for the Mediterranean (GFCM) area. Studies and reviews. General Fisheries Council for the

Mediterranean No 63. Rome, FAO, 71 pp.

Conover, R. J., S. Wilson, G. C. H. Harding & W. P. Vass, 1995. Climate, copepods and cods: some thought on

the long-range prospects for a sustainable northern cod fishery. Climate Research 5: 69-82.

Corten, A. & G. van de Kamp, 1996. Variation in the abundance of the southern fish species in the southern

North Sea in relation to hydrography and wind. ICES Journal of Marine Science 53: 1113-1119.

Cowan, Jr. V. G. & E. D. Houde, (1993) Relative predation potentials of scyphomedusae, ctenophores and

planktivorous fish on ichthyoplankton in Chesapeake Bay. Marine Ecology Progress Series 95: 55-65.

Dickson, R. R. & W. R. Turrel, 2000. The NAO: the dominant atmospheric process affecting oceanic variability

in home, middle and distant waters of European Salmon. In Mills, D. [ed]: The Ocean life of Atlantic

Salmon: Environmental and biological factors influencing survival; Oxford (Fishing News Books).

Dunn, M. R. & P. C. Reid, in prep. Relationships between the environment and the fisheries for red mullet,

Mullus surmuletus (Linne 1758), in the North Sea.

Edwards, M., P. C. Reid & B. Planque, 2001. Long-term and regional variability of phytoplankton biomass in


the Northeast Atlantic (1960-1995). ICES Journal of Marine Sciences 58: 39-49.

Fromentin, J. M. & B. Planque, 1996. Calanus and environment in the eastern North Atlantic. II. Influence of

the North Atlantic Oscillation on C. Þ nmarchicus and C. helgolandicus. Marine Ecology Progress Series

134: 111-118.

Gomoiu, M. T., 1980. Ecological observations on the jellyfi sh Aurelia aurita (L.) populations from the Black

Sea. Cercetari Marine-Recherches Marines, IRCM Constanta 13:91-102.

Gordina, A. D., U. Niermann, A. E. Kideys, A. A. Subbotin, Y. G. Artyomov, 1998. State of ichtyoplankton of

the Black Sea and features of its distribution depending on dynamics of waters. in Ivanov, L.I. & Oguz, T.

(eds). Ecosystem modeling as a management tool for the Black Sea, Vol.1; Kluver Academic Publishers:

367-378.

Goubanova, A. D., I. Y. Prusova, U. Niermann, N. V. Shadrin & I. G. Polikarpov, 2001. Dramatic change in the

copepod community in Sevastopol Bay (Black Sea) during two decades (1976-1996). Senckenbergiana

maritima 31: 17-27.

Gücü, A. C., 1997. Role of fishing in the Black Sea ecosystem, in: E. Ozsoy and A. Mikaelyan (eds), Sensitivity

to change: Black Sea, Baltic Sea and North Sea, NATO ASI Series, Kluwer Academic Publishers,

pp. 149-162.

Gücü., A. C., 2002. Can overfishing be responsible for the successful establishment of Mnemiopsis leidyi in the

Black Sea? Estuarine, Coastal and Shelf Science 54: 439-451.

Gücü A. C. & T. Oguz, 1998. Modeling trophic interrelationships in the Black Sea. In: Ivanov L. & T. Oguz

(eds), Ecosystem modelling as a management tool for the Black Sea. NATO-TU – Black Sea Project, Vol.

2: 359-371. Kluwer Academic Publishers.

Hare S. R & N. J. Mantua, 2000. Empirical indicators for North Pacific regime shifts in 1977 and 1989.

Progress in Oceanography 47: 103-146.

Hare, S. R., S. Minobe & W. S. Wooster, 2000. The nature and impacts of North Pacific climate regime shifts.

Progress in Oceanography 47: 99-408.

Hunt G. L Jr, P. Stabeno, G. Walters, E. Sinclair, R. D. Brodeur, J. M. Napp, N. A. Bond, 2002. Climate change

and control of the southeastern Bering Sea pelagic ecosystem. Deep-Sea Research II (in press).

Hunter, J. R., J. Alheit, 1995. International GLOBEC small pelagic fishes and climate change program. Report

of the First Planning Meeting, La Paz, Mexico, June 20-24, 1994. GLOBEC Report No. 8, 72 pp.

Kamburska L., S. Moncheva, A. Konsulov, A. Krastev & K. Prodanov, in press. The Invasion of Beroe ovata in

the Black Sea. Why a Warning for Ecosystem Concern? Mediterranean Marine Science, Vol.3.

Kideys, E. A, 2002. Fall and rise of the Black Sea ecosystem. Science 297: 1482-1483.

Kideys A. E. & Z. Romanova, 2001. Distribution of gelatinous macrozooplankton in the southern Black Sea

during 1996-1999. Marine Biology 139: 535-547.

Kideys, E. A, A. D. Gordina, U. Niermann & F. Bingel, 1999. The effect of environmental conditions on

the distribution of eggs and larvae of anchovy (Engraulis encrasicolus L.) in the Black Sea. ICES Journal

of Marine Science, 56 Supplement: 58-64.

Kideys A. E., Kovalev A. V., Shulman G. E., Gordina A. D. & Bingel F., 2000. A review of zooplanktons of

the Black Sea over the last decade. Journal of Marine Systems 24: 355-371.

Kovalev A. V., A. D. Gubanova, A. E Kideys, V. V. Melnikov, U. Niermann, N. A. Ostrovskaya, I. Y. Prusova,

V. A. Skryabin, Z. Uysal & J. A. Zagorodnyaya, 1998. Long-term changes in the biomass and composition

of fodder zooplankton in coastal regions of the Black Sea during the period 1954 and 1996. In Ivanov, L. I.

& T. Oguz (eds), Ecosystem modeling as a management tool for the Black Sea, Vol.1. Kluwer Academic

Publishers, pp. 209-219.

Kremer, 2002. Comments in Report of the Working Group on Zooplankton Ecology, Aberdeen, UK.


Oceanography Committee ICES CM 2002/C:07 Ref. ACME, ACE

Lasker, R., 1988. Studies on the Northern Anchovy; biology, recruitment and fishery oceanography. Reprint

from the studies on fishery oceanography, edited by the Japanese Society of Fisheries and Oceanography:

24 - 41.

Mankovsky, V. I., V. L. Vladimirov, E. I. Afonin, A. V. Mishonov, M. V. Solovev, B. E. Anninsky, L. V. Georgieva,

& O. A. Yunev, 1996. Long-term variability of the Black Sea water transparency and reasons for its strong

decrease in the late 1980s and early 1990s, MHI & IBSS, Sevastopol, 32 pp. (in Russian).

Mills, C. E., 1995. Medusae, siphonophores and ctenophores as planktovorous predators in changing global

ecosystems. ICES Journal of marine Sciences 52: 575-581.

Mills, C. E., 2001. Jellyfish blooms: are populations increasing globally in response to changing ocean condi-

tions. Hydrobiologia 541: 55-68.

Möller, H., 1984. Reduction of larval herring populations by jellyfish predation. Science. 224: 621-622.

Moncheva S. & A. Krastev, 1997. Some aspects of phytoplankton long term alterations off Bulgarian Black

Sea shelf. NATO ASI Series 2/27, Environment, E. Oszoy & E. Mykaelian, (eds), Kluwer Academic


Moncheva S., L. Senichkina, V. Doncheva, D. Altukov, A. D. Ivanova & A. M. Manova, 2002. Time-spatial

variability of phytoplankton dominance (Bulgarian Black Sea) - an insight to the paradiagram of anthro-

pogenic versus natural impacts. in Yilmaz, A. E. Salihoglu & E. Mutlu, 2002. Oceanography of the eastern

Mediterranean and Black Sea. Abstracts of the second international conference, METU, Ankara, Turkey:

276-277.

Monteleone, D. M. & L. E. Duguay, 1988. Laboratory studies of the predation by the ctenophore Mnemiopsis

leidyi on early stages in the life history of the bay anchovy, Anchoa mitchilli. Journal of Plankton Research

10: 359-372.

Mountford, K., 1980. Occurrence and predation by Mnemiopsis leidyi in Barnegat Bay, New Jersey. Estuarine

and Coastal Marine Sciences 10: 393-402.

Mutlu, E., 1999. Distribution and abundance of ctenophores and their zooplankton food in the Black Sea. 11.

Mnemiopsis leidyi. Marine Biology 135: 603-613.

Mutlu E., F. Bingel, A. C. Gücü, V. V. Melnikov, U. Niermann, N. A. Ostr. & V. E. Zaika, 1994. Distribution of

the new invader Mnemiopsis sp. and the resident Aurelia aurita and Pleurobrachia pileus populations in

the Black Sea in the years 1991-1993. ICES Journal of Marine Sciences 51: 407-421.

Napp, J. M. & G. L. Hunt Jr., 2001. Anomalous conditions in the SE Bering Sea, 1997: linkages among climate,

weather, ocean, and biology. Fisheries and Oceanography 10: 61-68.

Niermann U. & W. Greve, 1995. Distribution and fluctuation of dominant zooplankton species in the southern

Black Sea in comparison to the North Sea and Baltic. Ozsoy & Mikaelean (eds): Sensitivity to change:

Black Sea, Baltic Sea and North Sea. NATO ASI Series, 2. Environment-Vol.27. Kluwer Academic

Publishers: 65-77.

Niermann U., F. Bingel, A. Gorban, A. D. Gordina, A. C. Gücü, A. E. Kideys, A. Konsulov, G. Radu,

A. A. Subbotin & V. E. Zaika, 1994. Distribution of anchovy eggs and larvae (Engraulis encrasicolus

Cuv.) in the Black Sea in 1991 and 1992 in comparison to former surveys. ICES Journal of Marine

Sciences 51: 395-406.

Niermann, U., A. E. Kideys, A. V. Kovalev, V. Melnikov & V. Belokopytov, 1999. Fluctuation of pelagic spe-

cies of the open Black Sea during 1980-1995 and possible teleconnections. in: Besiktepe S., Ü. Ünlüata

& S. Bologa (eds), Environmental degradation of the Black Sea: Challenges and Remedies. Kluwer

Academic Publishers: pp. 147-173.

Oliver, P., 2001. Review on the progress of stock assessment studies in the Mediterranean. Unit 4. Fisheries


Management 1; Outcome 5: Current fisheries management practices used in the Mediterranean Part 3.1:

Review of the progress of Stock assessment studies in the Mediterranean: 1-12 (www.faocopemed.org/

vldocs/0000487/hnd_4.5.3.1.pdf).

Olson, M. B. & S. L. Strom, 2002. Phytoplankton growth, microzooplankton herbivory and conununity struc-

ture in the SE Bering Sea: insight into the formation and temporal persistence of an Emiliania huxleyi

bloom. Deep-Sea Research II (in press)

Ozsoy, E. & Ü. Ünlüata, 1997. Oceanography of the Black Sea: a review of some recent results. Earth-Science

Reviews 42: 231-272.

Petranu, A., 1997. Black Sea biological diversity. Romania. BSEP. 4.UN Publications. New York: 315 pp.

Polonsky, A., E. Voskresenskaya & V. Belokopytov, 1997. Variability of northwestern Black Sea hydrography

and the river discharges as part of global ocean-atmosphere fluctuations. In E. Ozsoy and A. Mikaelyan

(eds), Sensitivity to change: Black Sea, Baltic Sea and North Sea. NATO ASI Series, Kluwer Academic


Prodanov, K., K. Mikhailov, G. Daskalov, C. Maxim, A. Chashchin, A. Arkhipov, V. Shlyakhov & E. Ozdamar,

1997. Environmental management of fish resources in the Black Sea and their rational exploitation.

Studies and reviews. General Fisheries Council for the Mediterranean No. 68. Rome, FAO: 178 pp.

Prodanov, K, G. Daskalov, K. R. Mikhailov, K. Maxim, E. Ozdamar, V. Shljakhov, A. Chashchin & A. Arkhipov,

1998. Stock assessment of sprat and whiting in the Western Black Sea in relation to global and local

anthropogenic factors. in: Durand, M. H., P. Cury, R. C. Mendelssohn, A. Bakun & D. Pauly (eds), Global

versus local changes in upwelling systems - - international conference under the auspices of the Climate

and Eastern Ocean Systemes Project (CEOS). ORSTOM, Paris (France): 345-358.

Purcell, J. E., 1992. Effects of predation by the scyphomedusan Chrysaora quinquecirrha on zooplankton

populations in Chesapeake Bay, USA. Marine Ecology Progress Series, 87: 67-76.

Purcell J. E & M. N. Arai, 2001. Interactions of pelagic cnidarians and ctenophores with fish: a review.

Hydrobiologia 451: 27-44.

Purcell J. E, F. P. Cresswell, D. G. Cargo & V. S. Kennedy, 1991. Differential ingestion and digestion of bivalve

larvae by the Scyphozoan Chrysaora quinquecirrha and the ctenophore Mnemiopsis leidyi. Biological

Bulletin 180: 103-111.

Purcell, J. E., D. A. Nemazie, S. Dorsey, J. C. Gamble & E. D. Houde, 1993. In situ predation rates on bay

anchovy eggs and larvae by scyphomedusae and ctenophores in Chesapeake Bay, USA, ICES CM 1993/

L:42, 22 pp.

Purcell J. E, A. Malej & A. Benovid, 1999. Potential links of jellyfish to eutrophication and fisheries. Coastal

and Estuarine Studies 55: 241-263.

Purcell, J. E., T. A. Shiganova, M. B. Decker & E. D. Houde, 2001. The ctenophore Mnemiopsis in native and

exotic habitats: U.S. estuaries versus the Black Sea basin. Hydrobiologia 451: 145-176.

Reeve, M. R., M. A. Walter & T. Ikeda, 1978. Laboratory studies of ingestion and food utilization in lobate and

tentaculate ctenophores. Limnology and Oceanography 23: 740-751.

Reid, P. C. & M. Edwards, 2001. Long-term changes in the pelagos, benthos and fisheries of the North Sea.

Senckenbergiana maritima 31: 107-115.

Rodionov, S. N. (1994) Global and regional climate interaction: the Caspian Sea experience. Kluwer

Academic Publishers, The Netherlands: 241pp.

Schneider G. & G. Behrends, 1994. Population dynamics and the tropic role of Aurelia aurita medusae in

Kiel Bight and western Baltic. ICES Journal of Marine Sciences 51: 359-367.

Sergeeva, N. G., V. E. Zaika & T. V. Mikhailova, 1990. Nutrition of ctenophore Mnemiopsis mccradyi under

conditions of the Black Sea. Ekologya Morya (Kiev) 35: 18-22, (in Russian).


Shelton, P. A., M. J. Armstrong & B. A. Roel, 1993. An overview of the application of the daily egg produc-

tion method in the assessment and management of anchovy in the southeast Atlantic. Bulletin of Marine

Science 53: 778-794.

Shiganova, 1997. Mnemiopsis leidyi abundance in the Black Sea and its impact on the pelagic community.

In E. Ozsoy & A. Mikaelyan (eds), Sensitivity to change: Black Sea, Baltic Sea and North Sea. NATO ASI

Series, Kluwer Academic Publishers, pp 117-131.

Shiganova T. A. & Y. V. Bulganova, 2000. Effects of gelatinous plankton on Black Sea and Sea of Azov fi sh

and their food resources. ICES Journal of Marine Sciences, 57: 641-648.

Shiganova T. A., A. E. Kideys, A. C. Gücü, U. Niermann & V. S. Khoroshilov, 1998. Changes in species diver-

sity and abundance of the main components of the Black Sea pelagic community during the last decade.

In L. I. Ivanov & T. Oguz (eds), Ecosystem modeling as a management tool for the Black Sea, Vol.1;

Kluwer Academic Publishers: 171-188.

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushitsev, A. B. Dulimov & E. I. Musaeva, 2001. The

invader into the Caspian Sea Ctenophore Mnemiopsis and its initial effect on the pelagic ecosystem.

Oceanology 41: 517-524.

Shiganova T. A., Z. A. Mirzoyan, E. A. Studenikina, S. P. Volovik, I. Siokou-Frangou, S. Zervoudaki, E. D.

Christou, A. Y. Skirta & H. J. Dumont, 2001a. Population development of the invader ctenophore

Mnemiopsis leidyi in the Black Sea and other seas of the Mediterranean basin. Marine Biology 139:

431-445.

Shulman, G. & T. V. Yuvena, 2002. Fishes as indicator of of state of the Black Sea and Mediterranean ecosys-

tems. in Yilmaz, A., I. Salihoglu & E. Mutlu, 2002. Oceanography of the eastern Mediterranean and Black

Sea. Abstracts of the second international conference, METU, Ankara, Turkey: 175.

Shushkina, E. A. & M. Y. Vinogradov, 1991. Long-term changes in the biomass of plankton in open areas of

the Black Sea. Oceanology 31: 716-721.

Stockwell D. A, T. E. Whitledge, S. I. Zeeman, K. O. Coyle, J. M. Napp, R. D. Brodeur, A. I. Pinchuk &

G. R. Hunt Jr., 2001. Anomalous conditions in the SE Bering Sea, 1997: nutrients, phytoplankton, and

zooplankton. Fisheries and Oceanography 10: 99-116.

Tkach, A. V., A. D Gordina, U. Niermann, A. E. Kideys & V. E. Zaika, 1998. Changes in feeding parameters

of fish larvae in the Black Sea during last decade comparing 1950-1960s. In L. I. Ivanov & T. Oguz (eds),

Ecosystem modeling as a management tool for the Black Sea, Vol.1; Kluwer Academic Publishers: 235-248.

Tsikhon-Lukanina, Y. A. & O. G. Reznitchenko, 1991. Diet of the ctenophore Mnemiopsis in the Black Sea as

a function of size. Oceanology 31: 320-323.

Tsikhon-Lukanina, Y. A., O. G. Reznitchenko & T. A. Lukasheva, 1991. Quantitative patterns of feeding of

the Black Sea ctenophore Mnemiopsis leidyi. Oceanology 31: 196-199.

Vinogradov, M. Y., E. A. Shuskina, E. I. Musayeva & P. Y. Sorokin, 1989. A newly acclimated species in

the Black Sea: The ctenophore Mnemiopsis leidyi (Ctenophora: Lobata). Oceanology 29: 220-224.

Vinogradov, M. E., V. V. Sapozhnikov & E. A. Shushkina, 1992. The Black Sea ecosystem. Moscow. Russia.

Nauka, 112 p. (in Russian).

Vinogradov, M. E & N. Tumantseva, 1993. Some results of investigations of the Black Sea biological com-

munities. Black Sea research country profiles (level II), Intergovernmental Oceanographic Commission,

no. 3, UNESCO, Paris, pp. 80-91.

Weisse, T & M. T. Gomoiu, 2000. Biomass and size structure of the Scyphomedusa Aurelia aurita in the north-

western Black Sea during spring and summer. Journal of Plankton Research 22: 223-239.

Weisse T., M. T. Gomoiu, U. Scheffel & F. Brodrecht, 2002. Biomass and size composition of the comp jelly

Mnemiopsis sp. in the north-western Black Sea during spring 1997 and summer 1995. Estuarine, Coastal


and Shelf Science 54: 423-437.

Yunev, O., Y. A. Yilmaz, M. Shokurov, A. Haliulin & S. Konovalov, 2002. Long-term variability of vertical

chlorophyll profile in the open Black Sea during warm month: consequence of anthropogenic eutrophica-

tion or climatic changes? - In A.I. Yilmaz, I. Salihoglu & E. Mutlu, (eds), Oceanography of the eastern

Mediterranean and Black Sea. Abstracts of the second international conference, METU, Ankara, Turkey:

276-277.

Zaika, V. Y. & N. G. Sergeeva, 1990: Morphology and development of Mnemiopsis mccradyi (Ctenophora:

Lobata) in the Black Sea. Zoologichesky Zhurnal 69: 5-11 (Abstract in English).

Zaitzev, Y. P, 1993. Impact of eutrophication on the Black Sea fauna. Studies and reviews. Fisheries and

environment studies in the Black Sea system. FAO Report 64: 64-86.

Zaitzev, Y. P & V. Mamaev, 1997. Biological diversity in the Black Sea.-A study of change and decline. GEF,

United Nations Publications, Black Sea Environmental series, vol.3: 208 pp.

Chapter 2

Interactions between the invading ctenophores Mnemiopsis leidyi(A. Agassiz) and Beroe ovata Mayer 1912, and their infl uence on the Pelagic ecosystem of the Northeastern Black Sea

TAMARA A. SHIGANOVA1, HENRI J. DUMONT2,ALEXANDER MIKAELYAN1, DMITRY M. GLAZOV, YULIA V. BULGAKOVA1, ETERI I. MUSAEVA1, PAVEL Y SOROKIN1, LARISA A. PAUTOVA1,ZINAIDA A. MIRZOYAN3 & EKATERINA I. STUDENIKINA3

1Shirshov Institute of Oceanology, Russian Academy of Sciences, Nakhimovskii pr. 36, Moscow, 117851 Russia, e-mail: [email protected] Ecology, Ghent University, Ledeganckstraat, 35, B-9000 Ghent, Belgium3Azov Research Institute of Fisheries, ul. Beregovaya 21/2, Rostov-on-Don, 344077 Russia

Keywords: Black Sea, invasive species, Mnemiopsis leidyi, Beroe ovata, predation, ecosystem effects.

The state of the northeastern Black Sea, affected by an invasion of Beroe cf ovata in 1999-2002, is compared with the period of the M. leidyi invasion, before and after the arrival of Beroe. Development of Beroe considerably depressed Mnemiopsis leidyi,which had destabilized the Black Sea ecosystem for over a decade. The relationship between the seasonal populations of the two comb-jellies is discussed. Changes at all trophic levels after the arrival of M. leidyi and after that of Beroe are analyzed. With a reduction of M. leidyi a near-immediate recovery of the main components of the pelagic ecosystem-zooplankton (including meroplankton), phytoplankton, dolphins and fish as well as their eggs and larvae occurred. Microplankton biomass became even higher than under the presence of M. leidyi.

The M. leidyi invasion caused cascading effects: bottom-up effects included a decreas-ing zooplankton stock, linked to collapsing planktivorous fish, to vanishing dolphins. Top-down effects included a decrease in zooplankton stock, causing an increase in phy-toplankton, relaxed from grazing pressure, and increasing bacterioplankton triggering increases in zooflagellates and infusoria.

The development of Beroe reversed the situation: promptly, the ecosystem began to recover, at all trophic levels.

33

H. Dumont et al. (eds.),, 33–70.

© 2004 Kluwer Academic Publishers. Printed in the Netherlands.Aquatic Invasions in the Black, Caspian, and Mediterranean Seas


1. Introduction

During the 1970s and 1980s, the community structure of the Black Sea became subject to deep changes. It first moved from a system where top-down control by a number of migrant predators secured a balance between ecological groups, to a system dominated by small pelagic fish and invertebrates (Caddy & Griffiths, 1990; Ivanov & Beverton, 1985). In the early 1980s these were substituted by omnivores such as Noctiluca scintil-lans (Zaitsev & Alexandrov, 1997) and zooplanktivorous medusae like Aurelia aurita,(Lebedeva & Shushkina, 1991). In the mid 1980s, finally, the Sea was invaded by a ctenophore, Mnemiopsis, assigned to the polymorphic species M. leidyi (A. Agassiz) (Seravin, 1994).

A steep decline in ichthyo - and mesozooplankton, including meroplankton, and a change in species composition followed in its wake (Vinogradov et al., 1989; 1992; Niermann et al., 1994; Shiganova, 1997; 1998; Kovalev, 1993, Konsulov & Kamburska, 1998), since zooplankton and fish eggs and larvae are the main prey of M. leidyi(Tsikhon-Lukanina et al., 1991, 1993). The stocks of zooplanktivorous fi sh, M. leidyi’s food competitors, plummeted; their diet composition changed to low caloric food, and their rations decreased. Their biological parameters - length and weight - of course declined too (Shiganova & Bulgakova, 2000), and the catches of zooplanktivorous fi sh sharply dropped (Volovik et al., 1993; Kideys, 1994; Prodanov et al., 1997; Shiganova, 1997, 1998). Consequently, representatives of higher trophic webs including piscivorous fish and dolphins, feeding mostly on anchovy and sprat, were also affected (Shiganova, 1997; Shiganova & Bulgakova, 2000).

By the late 1980s, the pelagic ecosystem of the Black Sea had become a dead-end gelatinous food-web (Vinogradov et al., 1992). M. leidyi expanded to the Seas of Azov and Marmara and was regularly carried out to the Aegean Sea with Black Sea currents (Studenikina et al., 1991; Shiganova et al., 1994, 2001a). In 1999, it was first observed in the Caspian Sea (Ivanov et al., 2000; Shiganova et al., 2001c).

One of the factors that provoked the enormous development of M. leidyi in the Black Sea, never observed in its natural estuarial waters of North America, was the absence of a predator controlling its population size (Purcell et al., 2001).

In 1997, this predator appeared spontaneously: it was another ctenophore, Beroe cfovata (Konsulov & Kamburskaya, 1998). Like its predecessor, it was carried with ballast waters from coastal waters of North America (Seravin et al., 2002). Within few years, individuals were observed in the Black Sea in August-September or October-November, at first only in the northwest (Konsulov & Kamburska, 1998) and later, in the northeast (N. Lupova, St. Petersburg State University, personal communication). M. leidyi had initially been limited to the coastal northwest (Pereladov, 1988; Zaitsev et al., 1988) and only later appeared in the northeast as well. The first massive development of B. cfovata was observed in the northeastern (Shiganova et al., 2000a, b, 2001b), northwest-ern (Finenko et al., 2000, 2001), and southern regions (A. Kideys, Institute of Marine Research, Turkey, personal communication) in August 1999.

Here, we analyze the dynamics of B. cf ovata, the annual and seasonal variability of the development of both M. leidyi and B. cf ovata, and their influence on the pelagic northeastern Black Sea biota.

Ctenophores Mnemiopsis leidyi and Beroe cf ovata and their influence 35

2. Materials and methods

Data were collected during expeditions of the R/V “Aqvanavt” in September 1999 (52 sta-tions, 148 hauls), March and April 2000 (37 stations, 82 hauls), March 2001 (49 stations, 148 hauls) as well as the R/V “Quaint” expeditions of August 2000 (12 stations, 48 hauls), September 2002 (8 stations, 24 hauls) and expeditions of the Azov Sea Research Institute for Fisheries in September 2000 (21 stations, 44 hauls), September 2001 (18 stations, 42 hauls), May 2002 (22 stations, 48 hauls), August-September 2002 (17st., 34 hauls). The expeditions of the R/V “Aqvanavt” were conducted in the Russian part of the Black Sea, from Kerch Strait to Sochi using a grid of stations accepted by the Institute of Oceanology, Russian Academy of Sciences, in cooperation with the Department of Hydrophysics, Southern Branch of Institute of Oceanology, Russian Academy of Sciences, and Azov Sea Research Institute for Fisheries (Fig. 1). The transects of the R/V “Quaint” were taken from the Blue Bay towards the open sea, while the surveys of the Azov Sea Research Institute for Fisheries ran from the Kerch Strait to Sochi. In addition, we analyzed data on ichthyoplankton obtained in an ichthyoplankton survey of the Azov Sea Research Institute for Fisheries from Kerch Strait to Tuapse in August 15-19, 1999 (29 stations, 24 hauls) and in a cruise of the R/V “Aqvanavt” in March 2000 (25 stations), April 2001 (50 stations, 150 hauls).

The zooplankton was collected by a Juday net (0.1 m2 opening, 180 µm mesh size), while jelly - and ichthyoplankton were collected by a Bogorov-Rass net (1 m2 opening, 500 µm mesh size). The samplings were performed from the upper boundary of the anoxic layer to the surface. For vertical distribution study, samplings were also carried out with a Juday net from thermocline to surface, from pycnocline to thermocline, and from the anoxic layer to the pycnocline. Vertical stratification of the water and the sam-pling layers were determined from the data of CTD “Sea Bird”. In the inshore waters, sampling from bottom to surface was performed. Coefficients of catchability were applied to correct the density and biomass of the gelatinous plankton (equal to 2 for M.leidyi individuals with the size <45 mm and 2.3 for individuals >45 mm; it was 2 for Aurelia individuals with size <50 mm, 2.3 for Aurelia 50-100 mm in size; 3 for Aureliaindividuals >100 mm; and 2 for Pleurobrachia pileus) (Vinogradov et al., 1989). The size of zooplankton organisms was calculated to the nearest 0.25 µm. Weight of zooplankton organisms was determined from W = aL3, where L is length (mm), and a is calculated from the nomograms of Chislenko (1968). Biomass of comb-jellies was determined from the wet weight-length equations W = 0.0056L 1.85 and W = 0.0085L 1.83 for B. cf ovata and M. leidyi, respectively; W is wet weight (g) and L is body length (mm) (including lobes in M. leidyi) (Shiganova, 2000; Shiganova et al., 2000b).

In parallel, pelagic fish were collected in the northeastern Black Sea using pelagic and bottom-pelagic trawls in August 1999 and 2000 (11 trawls in total) at the fishing vessel. Percentage indices of gut fullness were estimated as the ratio of stomach content weight to fish weight. Annual changes were determined using our previous long-term data on the same region (Shiganova, 1997, 1998; Shiganova et al., 2001a; Shiganova et al., 2003a), and for 1984-1991 (Vinogradov et al., 1989, 1992).

Long-term data of phytoplankton was used for analyses of interannual changes. Samples of phytoplankton were collected by the P. P. Shirshov Institute of Oceanology


surveys. Cells of phytoplankton from 1 to 5 l were concentrated over 1.0 µm nuclepore filters. Concentrates (from 30 to 40 ml) were fixed in formaldehyde or glutaraldehyde (2% final concentration). Cells were identified and enumerated under a light microscope 1-2 months after collection. In some cruises phytoplankton cells were enumerated in non-fixed concentrates upon collection. Microplankton was collected in 5 l water bottles taken from different depths during surveys or from bottles of a rosette of CTD “Sea Bird”. Bacterioplankton was identified and calculated by epifluorescence (Hobbie et al., 1977), using acridin staining. Heterotrophic flagellates were stained by primuline and studied by epifluorescence (Caron, 1983). Live infusoria were identified in camera Penali under a light microscope.

Figure 1. Map of the stations of the main surveys in 1999-2001 (regardless of ichthyoplankton survey), 1, cruise of R/V “Akvanavt” September 5-17, 1999; 2, cruise of R/V “Akvanavt” April 13-18, 2000 and April 10-17, 2001; 3, survey on R/V “Kvant” August 6-20, 2000; 4, cruise of the Azov Sea Research Institute for Fishery September 1-5 and 11-18, 2000 and September 1-11, 2001, 13 August-3 September, 2002

Ctenophores Mnemiopsis leidyi and Beroe cf ovata and their infl uence 37

Dolphins were enumerated by visual observation during surveys from 1995 to 2001 in the northeast along a standard route of survey.

3. Results

Development of B. cf ovata and M. leidyi in 1999-2002

We first found B. cf ovata during coastal observations in mid-August 1999 in Gelendzhik Bay. By late August-early September, its population considerably increased; it spread widely in the coastal waters of Golubaya Bay as well as across Gelendzhik Bay. However, it was not common in deep-sea regions according to the survey on R/V “Aqvanavt” on September 7-15 in the northeastern Black Sea. Its mean biomass and abundance was 31 ± 5 g m-2 (1.5 g m-3) (Fig. 2) and 1.1 ± 1 ind. m-2 (0.055 ind. m-3). M. leidyi sharply decreased in this period as compared to the previous years. Its abundance in inshore and offshore areas was 59.5 ± 50 (4 ind. m-3) and 197 ind. m-2 ± 170 (10 ind. m-3), while its biomass was 5.3 ± 5 (0.33 g m-3) and 21.7 ± 20 g m-2 (1.2 g m-3) (Fig. 2A).

Figure 2. Changes in abundance of B. cf ovata and M. leidyi in 1999-2002 in the inshore waters of northeastern Black Sea: 1 - biomass of M. leidyi, g m-2; 2 - biomass of B. cf ovata, g m-2; A - in 1999-2000; B - in 2001


In March-April 2000, B. cf ovata was absent from the northeast Black Sea. M. leidyiwas found only in April in the area with the warmest water, from Tuapse to Sochi; its abundance and biomass were low: 1.1 ± 1 ind. m-2 and is 3.2 ± 3 g m-2. These were the lowest spring values for M. leidyi since it appeared in the Black Sea (Fig. 3B). The size of the specimens was larger than in any other spring; their mean length was 100.2 mm, perhaps attributable to a warm winter and high concentration of zooplankton. (Fig. 4). However, an increase in M. leidyi population was observed in August 2000 (Fig. 2 A, 3A). Because of the huge numbers of small specimens, reproduction was surely taking place. In inshore and offshore areas, biomass was 2397 ± 295 (120) and 1016 ± 589 g m-2

(41 g m-3), while abundance reached 1793 ± 387 ind. m-2 (90 ind. m-3) and 1009 ± 102 ind. m-2 (40 ind. m-3) (Fig. 2). Such high values had not been observed in the Black Sea since 1995 (Fig. 3A). But high standard deviations suggest that the summer spatial distribution of M. leidyi was more heterogeneous than the spring one, which may be related to local-ized areas of reproduction (Fig. 3B).

In 2000, B. cf ovata appeared in Gelendzhik Bay on 26 August, later than in 1999. Later, it spread in the northeastern Black Sea from Kerch Strait to Tuapse. In the fi rst decade of September, its abundance and biomass reached higher values than in the previous year: 15 ± 7 ind. m-2 (0.8 ind. m-3) and 46 ± 18 g m-2 (24 g m-3) (Fig. 2A). Next, the abundance and biomass of M. leidyi started to decrease, but they remained high in early September, higher than the corresponding values of 1996-1998, preceding the appearance of Beroe ovata (928 ± 423 ind. m-2 (37 ind. m-3) and 1002 ± 542 g m-2

(41 g m-3). At stations where B. cf ovata was not observed, M. leidyi biomass was still high (1200-1300 g m-2), but it decreased to 48-135 g m-2 at stations with abundant Beroe.This explains the high standard deviation of M. leidyi biomass in early September (Fig. 5, 2A). The biomass of Beroe increased tenfold by mid-September (495 ± 186 g m-2),

Figure 2C. Changes in abundance of B. cf ovata and M. leidyi in 1999-2002 in the inshore waters of northeastern Black Sea: 1 - biomass of M. leidyi, g. m-2; 2 - biomass of B. cf ovata, g. m-2 in 2002

C


Figure 3. A - Population dynamics of M. leidyi in spring, and surface water temperature in the surface layer in winter: 1. M. leidyi abundance in the offshore waters; ind. m-2; 2. M. leidyi abundance in the inshore waters, ind. m-2 (1988-1991; Vinogradov et al., 1989, 1992); 3. minimal monthly average air temperature in winter. B - Population dynamics of M. leidyi and water temperature in the surface layer in August: 1. M. leidyi abundance in the offshore waters, ind. m-2; 2. M. leidyi abundance in inshore waters, ind. m-2 (1988-1991; Vinogradov et al., 1989, 1992); 3. temperature of the surface water layer in August


while abundance increased to 47 ± 18 ind. m-2. In parallel, the biomass and abundance of M. leidyi dropped to 334 ± 180 g m-2 and 126 ± 60 ind. m-2 (Fig. 2A).

Only single M. leidyi were seen in spring 2001; its abundance was 0.55 ± 1.3 ind. m-2

(Fig. 3, 2B). But by mid-August, it regained a high abundance (2400 ± 547 ind. m-2

(96 ind. m-3) and biomass (2900 ± 669 g m-2 (116 g m-3) (Fig. 2B) during an unusu-ally hot summer and with a good supply of zooplankton. B. cf ovata appeared earlier than in 2000 - after August 10 - and quickly depressed M. leidyi in September (Fig. 5) while reaching the highest abundance and biomass since its appearance in the Black Sea: 72 ± 54 ind. m-2 (3.6 ind. m-3) and 510 g m-2 (Fig. 2 B).

In early May 2002, M. leidyi was scarce, with single individuals only found in the open sea. In late August, it rose to 1000 ± 238 ind. m-2 (43.4 ind. m-3), yet in early September, due to development of Beroe, M. leidyi dropped back to 233 ind. m-2 ± 134 (9 ind. m-3)and its biomass to 445 ± 121 g m-2, at a Beroe abundance of only 27 ± 25 ind. m-2

(1.5 ind. m-3) and biomass of 49.4 ± 33 g m-2 (Fig. 2C, 5). By 10-14 September M. leidyi almost disappeared from Gelendzhik Bay. We observed individual Beroe trying to fi nd Mnemiopsis and biting at plastic bags. Already on 14 September motionless swarms of Beroe was observed sank to the bottom at a depth of about 15 m.

From 4 to 14 September, experiments on Beroe reproduction were performed in aquaria. At good prey concentration in natural conditions, freshly collected individuals of Beroe of 48-70 mm length had a fecundity (egg production per day) of 513-3000 eggs at a salinity of 17‰ and temperature 23°C. Beroe smaller than 40 mm did not reproduce (Fig. 6). At a reduced offer of M. leidyi prey, the reproduction rate of Beroe came to a standstill (Fig. 7). Thus, observations showed that B. cf ovata regulates its own popula-tion size through a reproductive rate adjusted to prey availability.

Figure 4. Dynamics of the mean length of Mnemiopsis in spring and minimal temperature in winter: 1, length, mm; 2, temperature


Figure 5. Mnemiopsis abundance (ind. m-2) and biomass (g m-2) in September

Figure 6. Reproduction rate of Beroe in experiments in 2002


3.1. STATE OF THE INDIGENOUS GELATINOUS ANIMALS IN THE BLACK SEA: THE JELLYFISH AURELIA AURITA AND THE COMB-JELLY PLEUROBRACHIA PILEUS IN 1999-2002

In 1999-2002, the biomass of Aurelia aurita remained comparable with the preceding years (140-360 g m-2); the biomass of Pleurobrachia pileus, in contrast, was lower in 1999-2001 than before (61-128 g m-2) (Fig. 8). This could reflect consumption of P. pile-us by B. cf ovata. In aquarium conditions, Beroe indeed readily eats P. pileus (Shiganova et al., 2000a,b).

3.2. STATE OF THE PHYTOPLANKTON

Phytoplankton composition, abundance and biomass were investigated in early September 2002 while B. cf ovata development came in full swing. There were 54 algal species in all, among which 17 diatoms, 34 dinoflagellates, Dinophyceae and Chrysophyceae. Chlorophyta, Cyanophyceae and Cryptophyceae had one species each. Diatoms contributed the highest individual numbers. They made up 40% of total abundance and 90% of total biomass. Small Flagellata comprised up to 60% of abundance and 90% of biomass of nanoplankton. In spite of a strong development of picoplankton (size 1.5-2.0 µm), its contribution to total biomass was only 2.6%.

Diatoms were represented by Nitzschia and Pseudonitzschia (four species), Dinoflagellata as by Protoperidinium (six species) and Gymnodinium (five species). Late summer - early autumn phytoplankton mainly included warm-water, mostly neritic species. The predominant diatoms were the brackish-water Nitzschia tenui-rostyris (3·105 cell l-1), Pseudonitzschia delicatissima (1·104 cells l-1), Dactyliosolenfragilissimus (2·104 cells l-1), and Pseudosolenia calcar-avis (1·103 cells l-1). Small Dinoflagellates followed in abundance, with dominants Gymnodinium sanguineum

Figure 7. Temporal change of Beroe reproduction rate in September 2002


(1300 cells l-1) and Glenodinium pilula (600 cells l-1). Mean total phytoplankton was 300.000-1.000.000 cells l-1 and biomass 250-740 mg m-3 (0.2-0.7 g m-3). Comparing these data with those before B. cf ovata we found them to be lower and comparable with 1999-2001, at times when the Beroe peak had passed (Fig. 9).

Figure 8. Annual population dynamics of Aurelia aurita (1) and Pleurobrachia pileus (2) biomass, (g. m-2)

Figure 9. Total phytoplankton biomass (rectangles), and average winter air temperature (dots, every dot is a sliding average from 5 points). Lines show the trends


3.3. STATE OF THE MICROPLANKTON.

We analyzed the monocellular microplankton in mid -August 2000 in Gelendzhik Bay (up to 800 m depth). The numbers of heterotrophic microplankton were three times those of the autotrophics. The indices of bacterioplankton, zooflagellates and infusoria were high (Fig. 10), with values corresponding to mesotrophic waters.

In the inshore waters of the Blue Bay, Mnemiopsis continuously evacuated mucus from the surface of its body, leading to an additional input of organics to the water. This input was maximum when M. leidyi was most abundant (2397 ± 295 g m-2) (Figs 2,3) in the mid August and was utilized by bacteria whose numbers increased to 1.4 106 ml-1.That bacterioplankton was consumed by zooflagellates, dominated by Strombiumspp. (size 15-30 µm.) and by Infusoria. These groups of heterotrophic microplankton increased to 0.6-0.8 10 3 ml-1 and 12.3-19.5 ml-1, respectively. (Fig. 10).

In early September 2002, we analyzed the same area in the presence of B. cf ovata(Fig. 2 C). The abundance and biomass of microplankton and bacterioplankton was even higher (Fig. 10). Our experimental data support these results: in mesocosm experiments, B. cf ovata excretes even more mucus than M. leidyi (Fig. 10).

3.4. STATE OF THE ZOOPLANKTON

A considerable increase in edible zooplankton was observed in September 1999, the first population explosion of B. cf ovata, as compared with the same period in 1998 and the ten preceding years with M. leidyi (Fig. 11 A, B). In September 1999, the biomass of zooplankton was 11 and 13 g m-2 in offshore and inshore regions. The biomass of Calanus euxinus and Pseudocalanus elongatus remained virtually unaltered, but that of copepods living in near-surface water more than tripled and reached 1.2 g m-2. The most abundant species were Acartia clausi, Centropages ponticus, and Paracalanus parvus.

Figure 10. Changes of microplankton biomass, (mg m-3) in the inshore waters 1 - with M. leidyi in mid August 2000; 2 - with B. cf ovata in early September 2002


Many nauplii and early copepodite stages (I-IV) of A. clausi and C. ponticus were found, which indicates reproduction. The abundance of Sagitta setosa increased manyfold and reached 6-15 thousand ind. m-2. But it was the Cladocera that increased most, chiefly due to Penilia avirostris. In contrast, Noctiluca scintillans decreased strongly (Fig. 11 A).

In March-April 2000, the abundance and biomass of zooplankton rose relative to the spring of the preceding years (Fig. 12). The amounts of P. parvus, P. elongatus, and C. euxinus, represented by nauplii and copepodites, increased. The biomass of S. setosaalso increased. As a matter of fact, C. euxinus and S. setosa contributed most to the bio-mass of the edible zooplankton (25.37 g m-2) in April 2000.

In August 2000, before the seasonal development of B. cf ovata, abundance and bio-mass of zooplankton (162312 ind. m2 and 2.25 g m-2) decreased relatively to spring levels and were close to those of August 1993-1998, before the appearance of B. cf ovata (Fig. 11 A, B). This is explained by a high M. leidyi population size and a late development of Beroe. Usually, the zooplankton biomass increases in August by the development of summer Copepoda and Cladocera and builds a second annual peak by late August - early September (Kovalev, 1993). In inshore and slope waters, Acartia clausi predominated,Pseudocalanus elongatus was second, Paracalanus parvus third, and Centropages ponti-cus rare. Among Cladocera, Penilia avirostris predominated. Pleopis tergestina was less abundant, and other species were represented by single specimens. In mid-September 2000, after the appearance of Beroe and drop of M. leidyi, this zooplankton increased. Such a considerable rise within a short period (1 month) can be due to patchiness, con-trolled by hydrodynamic conditions. However, here the upward trend occurred across the whole region of investigation (Fig. 11). The abundance of Cladocera was due to a contin-ued development of P. avirostris and, to a lesser extent, Pleopis tergestina; while that of Copepoda was due to A. clausi and P. parvus copepodites. The abundance of Oikopleuradioica and meroplankton also jumped up. The meroplankton increased chiefly due to bivalve and gastropod larvae. But on the whole, the abundance and biomass of zooplank-ton were still lower than in 1999 (Fig. 11 B).

In spring 2001, zooplankton biomass was again higher than in spring 2000 (Fig. 12). In September, it was high although lower than in 1999 (Fig. 11). The near-surface Copepoda and Cladocera species were prominent, and active development of Paracalanusparvus and Centropages ponticus was observed. Beroe appeared early; however, M. leidyihad time to reach a high abundance and inflict losses on the zooplankton.

In 2002, zooplankton samples were collected on 4 September, when M. leidyi was still rather abundant, therefore probably values were lower, particularly in inshore waters, than in 2001. We recorded low numbers of Cladocera and small Copepoda, which are the main food of M. leidyi (Fig. 11).

3.5. STATE OF THE ICHTHYOPLANKTON

In the second part of August 1999, the ichthyoplankton was represented by eggs and larvae of 24 summer-spawning species. The order of egg frequency was: anchovy Engraulis encrasicolus ponticus, 323 eggs m-2; Mediterranean horse mackerel, Trachurus mediterraneus ponticus, 11.1 eggs m-2; and grey mullet, Mugil saliens as well as annular bream, Diplodus annularis, 1.2 eggs m-2 each. Such abundances of anchovy

46P


Figure 11A. Interannual dynamics of various zooplankton groups in August-September, 1995-2002 in the northeastern Black Sea: 1. Noctiluca scintillans; 2. Calanus euxinus; 3. other Copepoda; 4. Cladocera; 5. meroplankton; 6. Sagitta setosa; 7. others

Ctenophores M

nemiopsis leidyi and B

eroe cf ovata and their infl uence 47

Figure 11B. Interannual variations in zooplankton biomass (g. m-2)


and Mediterranean horse mackerel eggs as well as number of ichthyoplankton species have not been observed in the northeastern region since 1988 (Fig. 13A).

In August 2000, the number of ichthyoplankton species and abundance of eggs and larvae of the summer-spawning species was lower than in 1999; however, the egg quantity of anchovy (130 eggs m-2) and shad (8 eggs m-2) was higher in the northeast than in the years before the appearance of Beroe (Fig. 13A). Nevertheless, the number of species remained at the same level as in the period before Beroe (7 species of eggs and larvae). In 2001, apparently due to an earlier appearance of Beroe and hot summer, the abundances of the main mass species of eggs and larvae were high in early August; the eggs of anchovy, mediterranean horse mackerel, and bream were particularly abun-dant. In contrast to the two first years of B. cf ovata expansion, increased abundance of larvae was now observed (Fig. 13B).

In 2002, ichthyoplankton samples were collected on September 4, when most summer spawning was over; therefore the numbers of eggs were lower than in 1999 and 2001 (85 eggs m-2) and represented by six species, (Fig. 13 A) but numbers of larvae were higher than in previous “Beroe” years (Fig. 13 B). Most abundant were larvae of Engraulis encrasicolus ponticus, Trachurus mediterraneus ponticus, Mullus barbatusponticus, and Diplodus annularis.

In March and April of 2000-2001 we observed enlarged eggs and larvae in the winter-spawning species. In March 2001, abundant eggs in the samples indicated active spawn-

Figure 12. Dynamics of zooplankton biomass, (g. m-2) in the northeastern Black Sea in spring


ing of sprat, Sprattus sprattus phalericus, and Black Sea whiting, Merlangus merlangus euxinus. The abundances of their eggs (72 and 70 egg.m-2 (Fig. 14), was considerably higher than in the 1990s (the “M. leidyi years”). In late March 2001, the abundance of their eggs reached 96 and 82 egg.m-2, respectively.

Figure 13. A. Long-term variation in the abundance of fish eggs in the northeastern Black Sea in July-August: 1. shad; 2. anchovy; 3. other species and B. Larvae (1962 data, Dekhnik, 1973; 1991 data, Gordina et al., 1995): 1. shad; 2. anchovy; 3. other species


Figure 14. Long-term variation in the abundance of fish eggs of sprat and whiting in the northeastern Black Sea

3.6. STATE OF THE ICHTHYOFAUNA

In the northeastern Black Sea in August 1999, 96-98% of the trawl catch was comprised of large sprat, Sprattus sprattus phalericus, 3.0-3.5% of Black Sea whiting, Merlangus merlangus euxinus, and 0.03% of red mullet, Mullus barbatus ponticus; other species were presented by single specimens: turbot, Psetta maxima maeotica, thornback ray Raja clavata, and dogfi sh Squalus acanthias. In 2000, sprat also amounted to 97-98% of the trawl catch; 50% of those trawled close to the shore at 100-150 m depth were juveniles. Whiting, mullet, and anchovy composed 2-3, 0.1, and 0.01% of the catch, respectively. The abundance of red mullet was higher than in 1999, while anchovy was a first found for the last five years.

We studied the feeding of whiting and sprat in August-September 1998-2000 (Figs 15A, B). In August 1998 (prior to Beroe), sprat in the northeastern region of the sea fed exclusively on C. euxinus and the indices of stomach fullness were low (0.37%). In August 1999, the diet was extended by other copepods and by Sagitta setosa, the share of C. euxinus decreased to 75%, and the index of stomach fullness was 1.6%. In August 2000, the diet kept widening with Copepoda (C. euxinus, Acartia clausi, etc.), Cladocera, shrimp and fish larvae. Only the index of stomach fullness was lower (0.91%) than in August 1999.

Whiting predominantly fed on sprat in 1998. Copepoda, Amhipoda, Decapoda, Polychaeta, and Isopoda composed a small fraction in its diet. In 1999, the share of copepods sharply increased, while in August 2000, sprat composed 95-100% of it again. Copepoda and Decapoda contributed little; however, the index of whiting stomach full-ness was high (3%) (Fig. 15B).


Figure 15. Long-term changes in the diet of sprat (A) and whiting (B) in August-September in the northeastern Black Sea (1949-1951 data, Chayanova, 1958; 1957-1958 data, Burdak, 1960; 1975-1976 data, Sirotenko and Sorokolit, 1979; 1986 data, Gapishko and Malyshev, 1990; 1987-1992, Oven et al., 1996): 1, Calanus euxinus; 2, other Copepoda; 3, Polychaeta; 4, Sagitta setosa; 5, Pisces; 6, Isopoda; 7, Decapoda; 8, Cladocera; 9, Amphipoda; 10, others; abscissa: years; ordinate: diet composition, %


Since 2000, the landings of Russia, Ukraina and Georgia began to increase. First of all the small pelagic fish sprat and two subspecies of anchovy started recovering. Before Beroe, Black Sea anchovy had been almost absent from Russian catches.

The stock of Black Sea whiting, Merlangus merlangus euxinus in 2002 was estimated at about 7.6-8 103 t, of wich 4.3 103 t. in the Russian area, but this species is poorly used commercially (Volovik & Agapov, 2003).

The stocks of the Black Sea red mullet, Mullus barbatus ponticus, increased to 60 106 ind., with a biomass of 1200 t. in the Russian zone. The Black-Azov Sea mullets comprise five species, all found in Russian commercial catches, but in 2002 only three species Mugil soiuy, M. cephalis and Liza aurata became abundant enough for commer-cial fishing (the TAS calculated makes up 150 t year now).

Demersal species too appeared in Russian catches, represented by two species of ray, Rajya clavata and Dasyatis pactinaka. Their stocks now reach about 100 t. The Black Sea turbot, Psetta maxima maeotica, began to recover after the closing of com-mercial fishing. Its stock now amounts to about 1000-1700 t (Volovik & Agapov, 2003). Total catches continue to be unstable due to other reasons (see catch of 2002), but the trend for recovery is intact (Fig. 16)

3.7. THE DOLPHINS

We performed visual observations of dolphins in the sea during our cruises in daytime. There are three species of dolphins in the Black Sea: common dolphin, Delphinus

Figure 16. Catches of Russia, Ukraine, and Georgia: 1. Azov anchovy, Engraulis encrasicolus maeoticus; 2. anchovy, Engraulis encrasicolus ponticus; 3. sprat, Sprattus sprattus phalericus; 4. total catch


delphis L.; harbour porpoise dolphin, Phocoena phocoena L., and bottlenose dolphin, Tursiops truncatus ponticus Barabash.

Our data suggest an increase in sightings of dolphins in the northeastern Black Sea (Table 1). The most abundant was common dolphin, usually seen close to the shore. Second in line was bottlenose dolphin, and third, harbour porpoise dolphin found only near Kerch Strait in low numbers. In 1995, 98 hours of observations led to only four schools recorded, among which three represented common dolphins, one bottlenose dol-phins. All schools had from two to maximum 20 dolphins. All dolphins were found above depths of about 400 m, not far from the shore (Fig. 17). In 1998, 128 hours of observation identifi ed five schools, among which four were common dolphins (20 ind. and more), met near the shore; and one bottlenose dolphin (2-3 individuals, met further from the shore over depths of about 1000 m (Fig. 17). In 1999, during 82 hours 18 schools were found: 13 of them were common dolphins (two schools with 1-2 dolphins, 12 with about 20, three with c. 100 individuals and one with more than 100 ind.). Bottlenose dolphin was found in five schools (2-8 ind. per school). All individuals were seen nearshore, above depths of about 200 m. Common dolphins were found at variable distances offshore, but most above depths not exceeding 1000 m (Fig. 17).

Figure 17. Dolphin findings in the northeastern Black Sea in 1995, 1998, 1999


Table 1. Frequency of dolphin sightings in the northeastern Black Sea

Year 1995 1998 1999 2000 2001

Duration of observation (hours) 98 128 82 93 100

Number of findings 4 5 18 17 9

In 2000 (93 hours of observation), 17 schools were seen. Fifteen of them were com-mon dolphins (three schools of 2 ind.; 10 schools per 20 ind.; two of more than 50 ind.),two bottlenose dolphins (one of about 7 ind., a second one of about 50 ind.). Common dolphins were met above depths of 1000-1100 m. Bottlenose dolphins were found near the shore, at depths of about 100 m (Fig. 18).

Figure 18. Dolphin findings in the northeastern Black Sea in 2000 and 2001


In 2001 (100 hours), of 12 observed schools, 10 were common dolphins (six schools of about 20 ind.; three of about 50 ind.; one of more them 100 ind), found above depths of about 1000 m and less. Bottlenose dolphins were found in two schools per 5-7 ind. near the shore (Fig. 18). In spring 2000-2001, the highest number of dolphins was seen close to Sochi (Fig. 18). These may have been schools migrating to the Azov Sea.

Thus, sightings of dolphins became more frequent after 1999. But these data do not mean that dolphin abundance increased. Likely, larger schools migrated to locations with more fish, themselves attracted by the high zooplankton concentrations which appeared after B. cf ovata expanded.

4. Discussion

M. leidyi reached high abundance and biomass values in some years (1989-1990 and 1994-1995) (Figs 3, 5) (Vinogradov et al., 1989, 1992; Shiganova, 1997, 1998; Shiganova et al., 2001a). The main factors affecting its abundance include temperature (mostly winter temperature) and concentration of zooplankton, its main food (Figs 3, 5) (Shiganova, 1997, 1998; Shiganova et al., 2001a). Cold winters (1992-1993) sharply thinned it out in spring (Fig. 3A). A cold winter was usually followed by a relatively warm summer with a moderate temperature of the surface layer (Fig. 3B). Therefore, a low abundance of M.leidyi in spring corresponded to a low abundance in summer. High water temperature in summer favored reproduction and rapid growth (Fig. 3B). We observed warm summers in 1999-2001, and high population sizes of M. leidyi until B. ovata arrived (Fig. 3B). This was particularly pronounced in 2001, both in winter and summer (Krivoshea at al., 2002).

Mnemiopsis leidyi affected the ecosystem at all levels, from top predators to plank-tivorous fish, to zooplankton, to phytoplankton and from microplankton to detritus (Fig. 22). Feeding on zooplankton and fish eggs and larvae, M. leidyi created a cascading effect, both bottom up and top down, across the trophic web.

Summarizing the effects of M. leidyi on the ecosystem, we find the impacts detailed hereunder.

4.1. DIRECTLY IMPACTED BIOTA (FIG. 22)

4.1.1. Pelagic groups

zooplankton

A collapse was recorded in the density, biomass (Figs 11 A, B, 12) and species diversity of the zooplankton (Shiganova et al., 1998), and in the eggs and larvae of all pelagic species fish (Figs 13, 14).

First and foremost, M. leidyi consumes zooplankton. Field and experimental data allow an estimation of its predation rate. In 2000-2001, when M. leidyi reached extreme values in August, mean predation rate exceeded 50%, and in some locations more than 100%. In early September 2002, when its population was already smaller (Figs 2, 3) predation rate was from 5 to 26%.


During recent decades, the composition of the zooplankton had changed, due to a variety of factors, such as eutrophication, pollution, reduced freshwater inflow, and the invasion of Mnemiopsis. Some species disappeared, while new ones arrived from the Mediterranean Sea (Kovalev et al., 1998).

After the invasion of Mnemiopsis, a sharp decline occurred in the numbers of meso-zooplankton (Fig. 11 B). The changes were greatest in the northern region, which already was severely damaged by eutrophication and Aurelia aurita predation (Shiganova et al., 1998). Since the summer of 1989, the abundance of Sagitta setosa, Paracalanus parvus,Oithona similis, Acartia clausi, all species of cladocerans, and appendicularians had strongly decreased, particularly in the upper layer and in the coastal areas. The disappear-ance of S. setosa can be explained by direct consumption by M. leidyi and exploitative competition for small zooplankton. Other species, such as O. nana and representatives of the family Pontellidae, also disappeared (Kovalev et al., 1998). By autumn 1989, zoo-plankton biomass in the open sea was 4.4 times less than in summer 1988, and as of 1990, the abundance of Calanus euxinus began to fall too (Vinogradov et al., 1992).

Reciprocal oscillations of ctenophores and zooplankton show the effects of Mnemiopsispredation (Fig. 3B, 11B). During years of low ctenophore abundance, such as 1992-1993, zooplankton, including Calanus euxinus and Pseudocalanus elongatus, began to recover. Zooplankton biomass dropped again in autumn 1994, when Mnemiopsis biomass again was high. In 1996, when Mnemiopsis abundance was low, significant increases in zooplankton biomass occurred, particularly of C. euxinus, as well as of other copepod species, including Paracalanus parvus. Species that had disappeared, such as Pontellamediterranea and Centropages ponticus, reappeared in small numbers (Shiganova et al. 1998).

Benthic groups (meroplankton and demersal plankton)

A decrease in the density, biomass and species diversity of the meroplankton (= benthic species with pelagic larvae, among them Bivalvia, Polychaeta and gastropod larvae) was registered.

Also demersal plankton (=benthic species which migrate to the pelagic for feed-ing, mostly at night) decreased. Among them were Amphipods, Mysids, and Cumacea (Fig. 11).

macrophytes

A decrease, triggered by a decreasing transparency, was noted (Maximova & Luchina, 2002).

4.2. INDIRECTLY IMPACTED GROUP OF SPECIES COMPETING FOR FOOD WITH MNEMIOPSIS (SECOND LEVEL) (Fig. 22)

Small pelagic zooplanktivorous Þ sh

Engraulis encrasicolus ponticus, E. encrasicolus maeoticus, Sprattus sprattus phalericus


and Trachurus mediterraneus ponticus showed declining stocks (Fig. 19), a decreased individual length and weight, poor diet composition and rations (sprat: Fig. 15 A) (Shiganova & Bulgakova, 2000).

Figure 19. Fish catch before Beroe cf ovata development

During the first years of M. leidyi blooms in the Black and Azov seas, the stocks and catches of all planktivorous species declined greatly. The most severe decline was recorded in warm-water species spawning during summer (Black Sea anchovy, E. encrasicolus ponticus and Azov Sea anchovy, E. encrasicolus maeoticus). Their diet compositions and rations were adversely affected owing to the decrease in zooplankton abundance. Copepoda and Cladocera had always been the main food of the Black Sea anchovy. When M. leidyi abundance increased towards the end of the summer, about 30% of its food comprised larvae of Cirripedia, Ostracoda and Bivalvia, which have a low caloric content. As a consequence, growth rate, weight-at-age, fecundity and frequency of spawning of anchovy decreased (Lisovenko et al., 1997).

During the M. leidyi outbreak of 1989-1991, the biomass of sprat and whiting, species typical of more temperate waters, declined but increased again after the first drop in M. leidyi abundance in 1992-1993 (Prodanov et al., 1997). The share of warm water Copepoda, which was their main food, dropped greatly in 1990s and sprat became almost monophagous, consuming only C. euxinus (Fig. 15 A).

A similar influence was noted on the diet of Black Sea whiting. The share of Amphipoda, Decapoda and Polychaeta in its stomachs decreased from 55 to less than 10% in the northwestern region (Shiganova & Bulgakova, 2000). Apparently, demersal plankton decreased in abundance owing to its consumption and that of its larvae by M.leidyi (Fig. 15 B).


Demersal Þ sh species

Decreased stocks had lower indexes of fullness, changed their diet composition, and decreased in length and weight (Fig. 15B) (Shiganova & Bulgakova, 2000).

4.3. INDIRECTLY IMPACTED SPECIES, CONSUMING SMALL PELAGIC FISH (THIRD LEVEL)

Piscivorous fish and dolphins suffered from a decreasing availability of small pelagic fish. The main food of dolphins was sprat and anchovy (Kleinenberg, 1956), but during the 1990s they turned to mullets, mainly the alien Mugil soiuy which is most abundant in the northeast (Glazov, in preparation). The medusa Aurelia aurita also decreased in abundance and biomass.

4.4. INDIRECTLY AFFECTED GROUPS AT A LOWER TROPHIC LEVEL

Microplankton

In the 1980s-1990s, bacterioplankton increased from 300 to 800 103 ml-1. In the open sea oxygenated layer, it exceeded 106 cells ml-1 and its biomass reached 100 mg m-3. These indices are typical of mesotrophic waters (Sorokin, 2002). This remarkable increase was provoked by the development of M. leidyi, in the open sea but particularly in inshore areas, in two ways. One is the depletion of filtering zooplankton such as Penilia aviro-stris, Paracalanus parvus and Oikopleura dioica; the second is mucus excretion by the ctenophores themselves.

In fact, M. leidyi stimulates the bacterial loop through the polysaccharides in the mucus it releases. Organic compounds thus excreted are utilized by bacteria and their numbers and biomass increase. This bacterioplankton is consumed by zoofl agellates, dominated by Strombium spp (Fig. 10), while regeneration of inorganic nitrogen, phos-phorus and silicates occurs by bacterial activity. These nutrients are again taken up by the phytoplankton, increasing total algal biomass (Fig. 9). Such processes are particu-larly pronounced in warm seasons (Shiganova et al., in preparation). On the other hand, M. leidyi larvae consume as well authotrophic as heterotrophic microplankton (Sullivan & Gifford, 2003). Thus, more microplankton creates a more favorable environment for M. leidyi larval growth.

Phytoplankton

During the last two decades, inter-annual changes in phytoplankton biomass were observed. The changes from 1978 to 2002 are shown on Fig. 9. Data were collected from late May to mid October, when the community consisted of the same set of species (Georgieva, 1993). The data were averaged for sea area deeper than 500 m.

The highest phytoplankton biomasses were recorded at the beginning of the 1990’s. Average phytoplankton biomass in 1991 and 1992 was as high as 20-21 g m-2. Before and after this period the values were much lower. One of the explanations of such sharp


increases in phytoplankton biomass is the predation pressure by M. leidyi on the zoo-plankton.

In addition, input of nutrients excreted by M. leidyi stimulates phytoplankton blooms (Deason & Smayta, 1981), as currently observed in the Caspian Sea, which supports our idea (Shiganova et al., 2003b). On the other hand, the long-term fluctuations of phytoplankton biomass could have a climatic origin (Niermann, this volume). The hydro-logical regime of the Black Sea depends on the intensity of winter convection (Fillipov, 1968). This, in its turn depends of winter air temperature. Average winter air temperature in the Black Sea region shows quasi-periodic 20-22 year oscillations (Ovchinnikov & Osadchiy, 1991). During the coldest periods, the low winter temperature uplifts water in the center of the Eastern and Western gyres, governs the deep winter convection and intensifies the circulation of a “Rim Current”. These processes enrich the upper mixed layer and create conditions favorable for phytoplankton growth from spring to autumn.

The values of average winter air temperature in the northeast are shown on Fig. 9. The lowest and highest phytoplankton biomasses correspond to high and low tempera-tures, respectively. The decrease in biomass from 1978 to 1980 and from 1992 to 2002 corresponds to mirror changes in air temperature (Fig. 9). The cold winters of 1985 to 1995 correspond to high phytoplankton biomass. The trends of phytoplankton biomass and winter air temperatures show absolutely opposite changes. These variations con-firm cold and warm weather periods, with corresponding low and high hydrodynamic activity, as determinants of the level of phytoplankton development in the Black Sea. The same pattern could be traced for even earlier periods, from 1948 to 1976 (Vinogradov et al., 1899).

The increase in phytoplankton biomass in the early 1990’s coincided with a decrease in zooplankton grazing. Because of that, the influence of climatic changes on phyto-plankton dynamics was not evident from long-term changes in total phytoplankton bio-mass. Nevertheless, some phytoplankton species in the Black Sea are not consumed by zooplankton at all. One of them is the widespread dinofl agellate Ceratium fusus. This large thick-walled cell has no known grazers. Hence, the dynamics of this species should depend on abiotic factors only. The changes of numbers of C. fusus from 1982 to 2002 are presented in Fig. 20. Its maximum abundance fell in 1991 and 1992, when the cold-est winters occurred. Up to 30% of a population of C. fusus may consist of heterotrophic cells (Zavyalova & Mikaelyan, 1997). But even with this correction, its dynamics support the dependence of phytoplankton abundance in the Black Sea on climate variability.

The two factors responsible for the increase of phytoplankton biomass, climate and man, operated simultaneously in the Black Sea in the early 1990s. Possibly, due to this, the peak of phytoplankton biomass was extremely high. According to 20-22 years oscil-lations in air temperature, the next cold extreme is expected in 2010-2012. With the abundance of M. leidyi under control by Beroe ovata, it could be that the next increase in phytoplankton biomass will not be so high as at the beginning of the 1990’s.

Detritus

An increase occured in free mucus, released by live M. leidyi and by ctenophores that die after reproduction, in addition to increased input to detritus from phytoplankton biomass.


This situation was that before Beroe cf ovata arrived. The suggestion to introduce Beroe, formulated by GESAMP (1997) was not implemented, since soon after the docu-ment was released Beroe spontaneously appeared in the Black Sea. The first record was in 1997 and already in 1999 it had reached a considerable abundance in the northeast (Konsulov & Kamburska, 1998; Shiganova et al., 2000 a, b; 2001b), northwest, and south (Finenko et al., 2000; Finenko et al., 2001). In October 1999, Beroe reached the Sea of Azov, but mainly near Kerch strait, where salinity is 14‰. Few individuals made it to the center of the sea, where salinity is only 11‰ (Volovik, 2000; Shiganova et al., 2000 b). Compared to previous years, in September 1999 a sharp drop in M. leidyi density and biomass occurred, suggesting Beroe as the source of that mortality (Figs 2, 3).

During the following years (2000-2001), only few M. leidyi were found in spring. Abundance began to increase in July to peak in mid-August at high temperature and zooplankton availability. Each appearance of Beroe in mid (2001) or late August (2000) entailed a sharp decrease of M. leidyi. Beroe henceforth increased year after year: each time there was a high M. leidyi abundance its reproduction rate soared. (Figs 2, 3). Its feeding, estimated from metabolic rate (Shiganova et al., 2000a) was very high and increased from year to year, from 21% in 1999, 70% in 2001, to more than 100% in 2002 (Fig. 21 A, B, C). In 2001, Beroe increased in density by a factor 50 in three weeks time; the correlative decrease of M. leidyi was a factor 20 (Fig. 11). At such a high foraging rate there were not enough prey by end October, and reproduction rate (Fig. 12) and density

Figure 20. Abundance of dinoflagellates (cells l-1, average for the upper mixed layer)


began to decrease (Shiganova et al., 2003b). But if the density of M. leidyi drops faster, as in 2002, reproduction rate decreases earlier, by mid September (Fig. 7).

Studies in 1999-2002 established a seasonal pattern of development in Beroe.The first specimens appeared in mid- or late August; reproduction took place in September-October and rapidly inflated the population; later, it decreased (Fig. 7) (Arashkevich et al., 2001). The rate of decrease depended on the presence of M. leidyi

Figure 21. Mnemiopsis leidyi biomass, g. m-2 (1) and predation pressure of Beroe cf ovata, % (2). A - in 1999-2000; B - in 2001; C - in 2002


(Fig. 2). Any reduction in M. leidyi decreased the rate of Beroe reproduction and, accord-ingly, its population size. Large mature specimens are eliminated after reproduction, while a small fraction of the population, composed of specimens of a new generation, is believed to descend to near-bottom horizons in November and spend time in torpor until the next burst of M. leidyi. Such behavior is specific for representatives of Beroe from other regions (Siferd & Conover, 1992; Falkenhaug, 1996). Within four years, B. cf ovata was not found in the pelagic Black Sea in winter, spring, or summer before August, although single specimens were sporadically seen in the shelf zone in spring.

Thus, Beroe controls its own population size. In conditions of high M. leidyi con-centration, it amplifies its population through an increased rate of reproduction; but it reduces its abundance when prey (M. leidyi) gets rare through a decreased or even sus-pended rate of reproduction.

What was the effect of Beroe on the pelagic ecosystem? Although before its arrival, the abundance, biomass, and species diversity of edible zooplankton and ichthyoplankton had gradually started to recover with the decreased abundance of M. leidyi in 1993 and, particularly, after 1996, this process was quite slow (Figs 11-14) (Shiganova et al., 1998; Shiganova, 1998).

The appearance of Beroe cf. ovata, consuming M. leidyi sharply enhanced ecosystem recovery. Starting from September 1999, the abundance and biomass of edible zooplank-ton considerably increased.

Particularly high quantitative values of zooplankton were observed in spring 2000-2002. These data are comparable with spring data from times before the appearance of M. leidyi in the Black Sea. However, M. leidyi made a comeback in August 2000 and 2001 under favorable nutritional conditions and high summer temperature, again infl ict-ing considerable loss to the zoo- and ichthyoplankton. Beroe was late, in these years, but when it came, it eliminated M. leidyi within a period as short as 2-4 weeks (Fig. 2). By the second half of September, the mean abundance and biomass of zooplankton had recovered.

In the second half of August 1999, many eggs of summer-spawning fish (24 spe-cies!) were observed. Similar or even higher abundances were observed for anchovy and Mediterranean horse mackerel eggs. However, if a late appearance of Beroe occurred (as in 2000), the number of eggs and larval species in the ichthyoplankton decreased to seven; egg abundance of anchovy and Mediterranean horse mackerel were now lower than in 1999 although still higher than in the years before Beroe (Fig. 13). A big increase in the numbers of eggs and larvae of the mass winter-spawning sprat and whiting was recorded during spring 2000-2001; the abundance of their eggs even reached the same level as in the period before M. leidyi (Fig. 14).

The number of fish species in trawl samples increased during 1999-2000. Black Sea anchovy was observed for the first time in 2000 in out summer trawls; the abundances of red mullet and mediterranean horse mackerel increased. Sprat and whiting had always formed the basis of the trawl samples in summer. Anchovy does not form schools in summer but was always present in small quantities in samples before the appearance of M. leidyi; this also applies to mullet and mediterranean horse mackerel. Anchovy and mediterranean horse mackerel had disappeared from the summer catches in the northeast after 1990, but reappeared in 2000.

Ctenophores Mnemiopsis leidyi and Beroe cf ovata and their influence 63

The fish diets tended to recover and the indices of stomach fullness improved (Figs 15 A, B). Since sprat lives in the intermediate layer in summer and whiting feeds on small fish and demersal plankton, the relationship between their diet and M. leidyi popula-tion size was not always clear (Shiganova & Bulgakova 2000). However, in late August 1999, the indices of sprat stomach fullness (1.6%) were similar to those preceding the appearance of M. leidyi. In August 2000, they decreased (stomach fullness 0.91%) but still remained higher than in the first years of M. leidyi. The diet of sprat broadened in August 1999 and 2000 (Fig. 15A). In favorable years before the crisis, 90% of the diet of whiting in the northeastern region of the sea was small fish, chiefly sprat; small quanti-ties of decapods could also be found, and the mean index of stomach fullness was 1.5% (Burdak, 1960). After the appearance of M. leidyi, fish in the diet of whiting was replaced by decapods and demersal plankton (Oven et al., 1996; Shiganova & Bulgakova, 2000). With Beroe around, the indices of whiting stomach fullness increased (3% in 2000) and the share of sprat in its diet became restored (Figs 15A,B). Stocks of demersal fish began to recover (Volovik & Agapov, 2003). Schools of dolphins became more abundant as small fish increased. This recovery of the main components of the pelagic ecosystem is also starting to affect the fish catches; those of sprat and anchovy already are on the increase. The most pronounced increase is for total catch, due to a higher number of species caught (Fig. 16).

Interesting results occur at lower trophic levels. Phytoplankton biomass diminished with increasing pressure of zooplankton. As a result, values of chlorophyll “a” decreased, confirmed by the data scanner SeaWifS (Kopelevich at al., 2002) (Figs 23 A, B). In con-trast, the bacterioplankton (Fig. 10) rose, reflecting mucus release by Beroe.

5. Conclusion

Anthropogenic invasions of animals and plants in various regions of the World Ocean and, particularly, in semi-closed seas, have become one of the pressing problems of our time.

The comb-jelly M. leidyi deeply affected the ecosystem of the Black Sea (Fig. 22). The pelagic zone became impoverished in biodiversity, abundance, and biomass of its zooplankton and fish (Figs 11-15). Although one should also consider natural fl uctua-tions of populations such as variable high and low productivity in fish, the quantities of zoo - and ichthyoplankton as well as stocks and catches of fish reached an all-time low, particularly in those years when M. leidyi was most abundant. The appearance of yet another invader, Beroe, introduced a predator able to control M leidyi (Fig. 22). As a result, edible zooplankton, ichthyoplankton, and, consequently, the diet and stocks of fish recovered.

The data of 1999-2002 demonstrate that Beroe carved itself a niche in the Black Sea. Its seasonal development matches that in the coastal waters of the North Atlantic, with development in late summer-early autumn and a fading away in late autumn (Purcell et al., 2001). Although the pelagic ecosystem started to recover after the appearance of Beroe, M. leidyi may have time to reach a high biomass and again affect the pelagic ecosystem (a typical Lotka-Volterra oscillation between predator and prey). But now,

64P


Figure 22. The Black Sea food web as modified by the jelly invaders M. leidyi and B. cf ovata. Arrow thickness proportional to effects.


the duration of its influence on the ecosystem is limited to 1-2 months, down from 8-9 months before Beroe.

We conclude that, with the advent of Beroe cf ovata, the Black Sea entered a period of recovery.

5.1. DIRECTLY AFFECTED GROUPS

The ctenophore M. leidyi became depressed. Pleurobrachia pileus decreased less because it mainly lives in the intermediate layer, while Beroe prefers the layer above the thermocline (Shiganova et al., 2003).

5.2. INDIRECTLY AFFECTED GROUPS

level I: plankton

Pelagic zooplankton recovered in density, biomass, and diversity (Figs 11, 12). Pelagic fish eggs and larvae recovered in abundance and diversity (Figs 13, 14) (Shiganova et al., 2003b). Phytoplankton and thus eutrophication decreased (Fig. 9); chlorophyll a decreased (Fig. 23) (Kopelevich et al., 2002). Among benthic groups the density, biomassand species richness of meroplankton and demersal plankton began to rise (Figs 11, 12),

level II: food competitors

The stocks of pelagic planktivorous fi sh Engraulis encrasicolus ponticus, E. encrasi-colus maeoticus, Sprattus sprattus phalericus and Trachurus mediterraneus ponticus,recovered; their diet composition and biological parameters improved (Figs 15 A, B; 16) (Shiganova et al., 2003b).

level III: top predators

Piscivorous fish and dolphins began to recover with increasing prey (Figs 17, 18). Fisheries registered increased catches of small pelagic fish, while other groups re-appeared in the catches (Fig. 19). Detritus: little mucus was now produced by scarce M. leidyi, but Beroe produced even more.

Summarizing, we find that top-down control existed before M. leidyi by predators such as dolphins and fi sh-eating fish, on planktivorous fish, on zooplankton, and down to phytoplankton and from microplankton to detritus. All this was deeply modified by M. leidyi, but gradually began gradually to recover with Beroe (Fig. 22). Its outbreak has significantly advanced our understanding of the complex nature of the role of gelatinous plankton in (coastal) marine ecosystems. It offers an example of how lower organized gelatinous animals can affect a whole system: one of them completely suppressed a productive ecosystem, while the other recovered it. These events should be taken advan-tage of. An immediate example that comes to mind is that of the unique resources of the Caspian Sea, now threatened by M. leidyi (see other contributions in this volume) and in urgent need of biological rescue.


Figure 23. Chlorophyll concentration in September 1998 (A) and September 2000 (B), data from SeaWiFS Scanner (Kopelevich et al., 2002)


6. Acknowledgments

This study was supported by the Federal Target Program “Studies of the Ocean Nature”. The paper includes results of NATO linkage grant NATO CLG 979197 between the Shirshov Institute of Oceanology and NCMR and RFBI 02-0564844

References

Arashkevich, E. G., L. L. Anokhina, S. V. Vostokov, A. V. Drits, T. A. Lukasheva, N. E. Luppova, E. I. Musaeva

& A. N. Tolomeev, 2001. Reproduction Strategy of Beroe ovata (Ctenophora, Atentaculata, Beroida) A

New Invader in the Black Sea. Okeanologiya 41: 116-121.

Burdak, V. D., 1960. Nutrition of the Black Sea whiting Odontogadus merlangus euxinus (Nordmann), Trudy

Sevastopol biologicheskyi Stantsii 13: 208-215.

Caddy, J. F. & R. C. Griffiths, 1990. A Perspective on Recent Fishery-Related Events in the Black Sea. Studies

Rev. GFCM 63: 43-71.

Caron, D. A. 1983. Technique for enumeration of nanoplankton using epifluorescence microscopy. Applied

Environmental Microbiology 46: 491-498.

Chayanova, L. A., 1958. Nutrition of the Black Sea Sprat, Trudy Vses. Nauch.-Issled. Inst. Rybol. Okeanogr.

36: 106-127.

Chislenko, L. L., 1968. Nomogrammy dlya opredeleniya vesa vodnykh organizmov po razmeram i forme

tela (Nomograms for Determining Weight of Aquatic Animals from the Size and Shape of Their Body),

Leningrad: Nauka,

Dekhnik, T. V., 1973. Ikhtioplankton Chernogo morya, (Ichtyoplankton of the Black Sea). V. A. Vodyanitskii

(ed), 236 pp.

Deason E. E. & T. J. Smayda, 1982. Experimental evaluation of herbivory in the ctenophore Mnemiopsis leidyi

relevant to ctenophore-zooplankton - phytoplankton interactions in Narragansett Bay, USA. Journal of

Plankton Research 4: 219-236

Falkenhaug, T., 1996. Distribution and Seasonal Patterns of Ctenophores in Malangen, Northern Norvey,

Marine Ecology Progress Series 140: 59-70.

Fillipov, D. M. 1968 Circulation and structure of the Black Sea waters, Nauka, Moscow. (In Russian)

Finenko, G. A., B. E. Anninsky, Z. A. Romanova, G. I. Abolmasova & A. E. Kideys, 2001. Chemical

Composition, Respiration and Feeding Rates of the New Alien Ctenophore, Beroe ovata, in the Black

Sea. Hydrobiologia 451: 177-186.

Finenko, G. A., Z. A.Romanova & G. I. Abolmasova,, 2000. A New Invader in the Black Sea-comb jelly Beroe

ovata (Brunguiere). Ekologiya Morya Kiev 50: 21-25.

Gapishko, A. I. & D. I. Malyshev, 1990.Evaluation of Daily Diet of Sprat under Natural Conditions during

Fattening and Spawning, Biologicheskie resursy Chernogo morya (Biological Resources of the Black

Sea). Y. A. Shlyakhov (ed), Moscow, Vses. Inst. Rybov. Okeanogr.: 39-45.

Georgieva, L. V. 1993 Species composition of phytoplankton communities. In A. V. Kovalev & Z. Z. Finenko

(eds), Plankton of the Black Sea. Naukova Dumka, Kiev: 33-55. (In Russian)

GESAMP (IMO/FAO/UNESCO-IOC/WMO/WHO/IAEA/UN/UNEP Joint Group of Experts on the Scientifi c

Aspects of Marine Environmental Protection), 1997. Opportunistic settlers and the problem of the cteno-

phore Mnemiopsis leidyi invasion in the Black Sea. Reports and Studies of GESAMP 58: 84 pp.

Gordina, A. D. & T. N Klimova, 1995. Dynamics of the Species Composition and Population of Ichtyoplankton


in the Littoral and Open Water, Sovremennoe sostoyanie ikhtiofauny Chernogo morya (The Modern

Condition of Ichtyofauna in the Black Sea). S. M. Konovalov (ed), Kiev: Naukova Dumka, pp. 74-92.

Hobbie J. E., R. Daley & S. Jasper, 1977. Use of Nuclepore filters for counting bacteria by epifl uorescence

microscopy. Applied Environmental Microbiology 33:1225-1228.

Ivanov, L. R. & J. H. Beverton, 1985. The Fisheries Resources of the Mediterranean. Part Two.Black Sea.

GFCM. FAO, Rome, 70 pp

Ivanov P. I., A. M. Kamakim, V. B. Ushivtzev, T. A. Shiganova, O. Zhukova, N. Aladin, S. I. Wilson, G. R.

Harbison & H. J. Dumont, 2000. Invasion of Caspian Sea by the comb jellyfi sh M. leidyi leidyi

(Ctenophora). Biological Invasions 2: 255-258.

Kideys A. E. 1994. Recent dramatic changes in the Black Sea ecosystem: The reason for the sharp decrease in

Turkish anchovy fisheries. Journal of Marine Systems 5: 171-181.

Kideys, A. E., 2002. Fall and rise of the Black Sea ecosystem. Science 297 (5586): 1482-1484.

Kleinberg, S. E., 1956. Mammals of the Black and Azov Sea. Biologic-commercial investigations. V. I. Tsalkin

(ed), Academy of Sciences of the USSR, 287 pp.

Konsulov, A. & L. Kamburska., 1998 Ecological Determination of the New Ctenophora-Beroe ovata Invasion

in the Black Sea, Trudy Institute of Oceanology, BAN, Varna:195-197.

Kopelevich, O. V., V. I. Burenkov, C. V. Ershova, et al., 2002. Biological characteristics the seas of Russia after

data of Satellite scanner SeaWiFs. GIS Moscow.

Kovalev, A.V., 1993. Mezozooplankton (Mesozooplankton). A. V. Kovalev, A Finenko, Z. Z., (eds), Kiev:

Naukova Dumka: 144-165.

Mikaelyan, A.S., 1997. Longtime variability in phytoplankton communities in the open Black Sea in rela-

tion to environmental changes. Sensitivity to change: Black Sea, Baltic Sea and North Sea. E. Ozoy &

A.Mikaelyan (eds), Kluwer Academic Publishers, pp. 105-116

Kovalev, A. V., S. Besiktepe, J. Zagorodnyaya, J. & A. Kideys, A. 1998. Mediterraneanization of the Black Sea

zooplankton is continuing. In Ecosystem Modeling as a Management Tool for the Black Sea. L. Ivanov

& T. Oguz (eds), Kluwer Academic Publishers: pp. 199-207

Krivoshea, V. G., I. M. Ovchinnikov & A. Y Skirta., 2002. Interannual variability of the Cold Intermediate

Layer renewal in the Black Sea. Multidisciplinary Investigations of the Northeastern part of the Black

Sea. A. G. Zatsepin & M. V. Flint (eds),. Moscow, Nauka, pp. 27-39.

Lebedeva, L. P. & E. A. Shushkina, 1991. The estimation of population characteristics of Aurelia aurita in the

Black Sea. Oceanology 31: 434-441.

Lisovenko, L. A., D. P. Andrianov & Y. V. Bulgakova, 1997. Reproductive ecology of the Black Sea anchovy

Engraulis encrasicolus ponticus. II. Quantitative parameters of spawning. Journal of Ichthyology 37:

639-646.

Maximova O. V. & N. P. Luchina 2002. Modern state of macrophytobentos off the northern Caucasian cost:

a response to eutrophication of the Black Sea basin. Multidisciplinary investigations of the northeastern

part of the Black Sea. Eds Zatsepin A. G., Flint M. V. Moscow, Nauka. 42: 297-309.

Niermann, U., F. Bingel, A. Gorban, A. D. Gordina, A. C. Gugu, A. E. Kideys, A. Konsulov, G. Radu,

A. A. Subbotin & V. E. Zaika, 1994. Distribution of anchovy eggs and larvae (Engraulis engrasicolus

Cuv.) in the Black Sea in 1991-1992. ICES Journal of marine Sciences 51: 395-406.

Oven, L. S., N. F. Shevchenko & S. V. Volodin, 1996. Dynamics of Age Distribution and Nutritional Range of

Whiting and Sprat in Various Regions of the Black Sea (1987-1992), Sovremennoe sostoyanie chernomor-

skoi ikhtiofauny (Modern Condition of the Black Sea Ichtyofauna). S. M. Konovalov (ed), Sebastopol:

9-39.

Ovchinnikov, I. M. & A.S.Osadchy, 1991 Secular variability of winter climatic conditions influencing pecu-


liarities of hydrological conditions in the Black Sea, Variability of the Black Sea ecosystem. Nauka,

Moscow, pp. 85-89. (In Russian).

Pereladov, M. V., 1988. Certain Observations on the Biota in the Sudak Bay, Black Sea, Tret’ya Vsesoyuz.

konf. po morskoi biologii (Third All-Union Conf. on Marine Biology). Kiev, Naukova Dumka, vol. 1:

237-238.

Prodanov, K., K. Mikhailov, G. Daskalov, K. Maxim, A. Chashchin, A. Arkhipov, V. Shlyakhov & E. Ozdamar,

1997. Environmental impact on fish resources in the Black Sea. In E. Ozsoy & A. Mikaelyan (eds),

Sensivity of North Sea, Baltic Sea and Black Sea to anthropogenic and climatic changes. Kluwer

Academic Publishers, Dordrecht/Boston/London: 163-181.

Purcell, J. E., T. A. Shiganova, M. B. Decker & E. D. Houde, 2001.The Ctenophore Mnemiopsis in Native and

Exotic Habitats: U. S. Estuaries Versus the Black Sea Basin. Hydrobiologia 451: 145-176.

Seravin, L. N., 1994. The systematic revision of the genus Mnemiopsis (Ctenophora, Lobata). Zoologichetskyi

Zhurnal 73: 9-18 (in Russian).

Seravin, L. N., T. A.Shiganova & N. E. Luppova, 2002. Investigation History of Comb Jelly Beroe Ovata

(Ctenophora, Atentaculata, Beroida) and Certain Structural Properties of Its Black Sea Representative.

Zoologichetskyi Zhurnal. 81: 1193-1201.

Shiganova, T. A., 1997.Mnemiopsis leidyi Abundance in the Black Sea and its Impact on the Pelagic

Community, Sensivity of the North, Baltic Sea and Black Sea to Antropogenic and Climatic Changes.

E. Ozsoy & A. Mikaelyan (eds), Kluwer Academic: 117-130.

Shiganova, T. A., 1998. Invasion of the Black Sea by the Ctenophore Mnemiopsis leidyi and Recent Changes in

Pelagic Community Structure, Fisheries Oceanography-GLOBEC Special Issue, S. Coombs (ed): 305-310.

Shiganova, T. A., 2000. Certain Results of Studying Biology of Invader M. leidyi (A. Agassiz) in the Black Sea,

Grebnevik Mnemiopsis leidyi (A. Agassiz) v Azovskom i Chernom moryakh i posledstviya ego vseleniya

(Comb Jelly Mnemiopsis leidyi (A. Agassiz) in the Sea of Azov and Black Sea and Consequences of

Its Settling). S. P. Volovik (ed), Rostov-on-Don, pp. 33-75.

Shiganova, T. A. & Y. V. Bulgakova, 2000. Effect of gelatinous plankton on the Black and Azov Sea fish and

their food resources. ICES Journal of marine Sciences 57: 641-648.

Shiganova, T. A., B. Ozturk & A.Dede, 1994. Distribution of the Ichthyo-, Jelly - and Zooplankton in the Sea

of Marmara, FAO Fisheries Report 495: 141-145.

Shiganova, T. A., A. Kideys, U. Niermann, A. C. Gugu & V. S. Ktioroshilov, 1998. Changes of Species

Diversity and Their Abundance in the Main Components of Pelagic Community after Mnemiopsis leidyi

Invasion, NATO Scientific Affairs Division. Kluwer Academic. L. Ivanov & T. Oguz (eds), pp. 171-188.

Shiganova, T. A., J. V. Bulgakova, S. P. Volovik, Z.A. Mirzoyan & S. I. Dudkin, 2000a. A New Invader Beroe

ovata and Its Influence on the Ecosystem of Azov-Black Sea Basin in August-September 1999, Grebnevik

Mnemiopsis leidyi (A. Agassiz) v Azovskom i Chernom moryakh i posledstviya ego vseleniya (Comb

Jelly Mnemiopsis leidyi (A. Agassiz) in the Sea of Azov and Black Sea and Consequences of Its Settling),

S. P. Volovik (ed), Rostov-on-Don, pp. 432-449.

Shiganova, T. A, J. V. Bulgakova, P. Y. Sorokin & Y. F. Lukashev, 2000b. Investigation of a new invader,

Beroe ovata in the Black Sea. Biology Bulletin 27: 247-255.

Shiganova, T. A., Z. A. Mirzoyan, E. A. Studenikina, S. P. Volovik, I. Siokou-Frangou, S. Zervoudaki,

E. D. Christou, A. Y. Skirta & H. J. Dumont, 2001a. Population development of the invader ctenophore


431-445.

Shiganova, T. A., J. V. Bulgakova, S. P. Volovik, Z.A. Mirzoyan & S. I. Dudkin, 2001b, A new invader,

Beroe ovata Mayer 1912 and its effect on the ecosystems of the Black and Azov Seas. Hydrobiologia


451: 187-197.

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushivtsev, A. B. Dulimov & E. I. Musaeva, 2001c.

The invader into the Caspian Sea Ctenophore Mnemiopsis and its initial effect on the pelagic ecosystem.

Oceanology 41: 542–549.

Shiganova, T. A, E. I. Musaeva, Y. V. Bulgakova et. al., 2003a. Ctenophores invaders Mnemiopsis leidyi (A.

Agassiz) and Beroe ovata Mayer 1912, and their effect on the pelagic ecosystem of the northeastern Black

Sea. Biological Bulletin 2: 225-235.

Shiganova, T. A., V. V. Sapognikov, E. I. Musaeva, M. M. Domanov, Y. V. Bulgakova, et al.,, 2003b. Factors

that determine pattern of distribution and abundance Mnemiopsis leidyi in the Northern Caspian.

Oceanology 43. N5

Siferd, T. D. & R. J. Conover, 1992. An Opening-Closing Net for Horizontal Sampling Under Polar Sea—Ice.

Sarsia 76: 273-276.

Sirotenko, M. D. & L. K. Sorokolit, 1979. Seasonal Dynamics of Nutrittion of Sprat Sprattus sprattus phaleri-

cus (Risso). Voprozy Ikhtiologyi 19: 813-829.

Studenikina, E. I., S. P. Volovik & Z. A. Mirzoyan, 1991. Comb Jelly Mnemiopsis leidyi in the Azov Sea,

Okeanologiya 31: 6: 722-725.

Sorokin, Y. I., 2002. The Black Sea. Ecology and Oceanography. Backhuys Publishers, 875 pp.

Sullivan, L. J & D.Gifford, 2003. Feeding by the Larval Ctenophore Mnemiopsis leidyi, on Microplankton.

Third International Zooplankton Production Symposium, Gijon, Spain: 208.

Tsikhon-Lukanina, E. A., O. G. Reznichenko & T. A. Lukasheva, 1991.Quantitative Aspects of Nutrition of

Comb Jelly Mnemiopsis leidyi in the Black Sea. Okeanologiya 31: 272-276.

Tsikhon-Lukanina, E. A., O. G. Reznichenko & T. A. Lukasheva, 1993. Level of Fish Fry Consumption by

Mnemiopsis in the Black Sea Shelf. Okeanologiya 33: 895-899.

Vinogradov, M. E., V. V. Sapozhnikov & E. A. Shushkina, 1992.Ekosistema Chernogo morya (Ecosystem of

the Black Sea), Moscow, Nauka, 112 pp. (in Russian).

Vinogradov, M. E., E. A. Shuskina, A. S. Mikaelyan & N. P. Nezlin 1999 Temporal (Seasonal and Interannual)

changes of ecosystem of the open waters of the Black Sea. In: Environmental Degradation of the Black

Sea: Challenges and Remedies (S. T. Besiktepe, U. Unluata & A. S. Bologa, eds). Kluwer Academic

Publishers. Vol 56: 109-130.

Vinogradov, M. E., E. A. Shushkina, E. I. Musaeva & P. Y. Sorokin, 1989. New Settler in the Black Sea-Comb

Jelly Mnemiopsis leidyi (Agassiz). Okeanologiya 29: 293-299.

Volovik, S. P. (ed). 2000. Ctenophore Mnemiopsis leidyi (A. Agassiz) in Azov and Black Seas: Biology and

Consequences of its Intrusion. S. P. Volovik (ed), Rostov-on-Don, 498 pp.

Volovik, S. P., I. A. Mirzoyan & G. S. Volovik, 1993. Mnemiopsis leidyi: biology, population dynamics, impact

to the ecosystem and fisheries. ICES. (Biol. Oceanogr. Committee) 69: 1-11.

Volovik, S. & S. Agapov 2003. Composition, state and stock of the demersal fish community of the Azov-Black

Seas relating to development of Russian sustainable fisheries. Workshop on demersal resourses in the

Black and Azov Sea. B. Ozturk & F. S.Karakulak (eds), pp. 82-92.

Zaitsev, Y. P. & B. G. Aleksandrov, 1997.Recent Man-Made Changes in the Black Sea Ecosystem, Sensivity of

North Sea, Baltic Sea and Black Sea to Antropogenic and Climatic Changes. E. Ozsoy & A. Mikaelyan

(eds), Kluwer Academic, pp. 25-32.

Zaitsev, Y. P., L. V. Vorob’eva & B. G. Aleksandrov, 1988. Novyi vid Ctenophora v Chernom more (A New

Ctenophora Species in the Black Sea). VINITI, Moscow, no. 11.11D36.

Zavyalova, T. A. & A. S. Mikaelyan, 1997. Heterotrophic phytoplankton of the Black Sea in summer. Spatial

distribution. Oceanology 3: 434-450.

Chapter 3

Population dynamics of Mnemiopsis leidyi in the Caspian Sea, and effects on the Caspian ecosystem

TAMARA A. SHIGANOVA1, HENRI J. DUMONT2,ARKADYI F. SOKOLSKY3, ANDREY M. KAMAKIN3,DARIGA TINENKOVA & ELENA K. KURASHEVA3.1P. P. Shirshov Institute of Oceanology RAS, 117997 Moscow, 36 Nakhimovsky pr.2Animal Ecology, Ghent University, Ledeganckstraat, 35, B-9000 Ghent, Belgium3Caspian Research Institute for Fisheries 414056 Astrakhan, 1, Savushkina, Russian Federation

Keywords: Caspian Sea, Black Sea, invasive species, Mnemiopsis leidyi, predation, ecosystem effects.

The ctenophore Mnemiopsis leidyi was introduced to the Caspian Sea, most probably from the Black Sea. In 2000, it spread across all areas of the Caspian with a minimum salinity of 4.3‰. In 2001-2002 its population size expanded to reach a critical wet mean biomass of about 1 kg. m-2 (55 g m-3). In 2001 (allowing a coefficient 2 to compensate for imperfect catchability), its abundance was in excess of the highest values ever recorded in the Black Sea. Yet, in 2002, its biomass again doubled.

Effects on the ecosystem were faster and stronger than in the Black Sea. In 2001, repercussions were felt at all trophic levels, including that of the top predator, the Caspian Seal.

The functioning of the ecosystem changed in the same way as that of the Black Sea. Cascading effect occurred at the higher trophic levels, from a decreasing zooplankton stock to collapsing planktivorous fish to vanishing predatory fish and seal. Similar effects occurred at lower trophic levels: from a decrease in zooplankton stock to an increase in phytoplankton, released from zooplankton grazing pressure. Part of these effects were top-down, part were bottom-up.

In conclusion, the Caspian Sea example provides yet another illustration of the fact that a lower gelatinous carnivore, well adapted to rapid expansion, can suppress whole ecosystems and their functioning.

71




1. Introduction

During the last 30 years, environmental conditions in the Caspian Sea signifi cantly degraded under the impact of various pressures, among which sea level changes and pollution from multiple sources (Ivanov, 2000; Salmanov, 1999). Additionally, a novel type of anthropogenic impact that became widespread across the world in recent years, started to affect the Caspian Sea, viz. invasions by undesirable alien species of animals and plants.

The most dramatic example of such an accident was the introduction of the ctenophore Mnemiopsis leidyi with ship ballast water from the Black Sea. At first, it was found together with large individuals of Aurelia aurita, which now inhabit only the Black Sea. The native habitat of the ctenophore Mnemiopsis leidyi is temperate to subtropical estu-aries along the Atlantic coast of North and South America, where it is found across an extremely wide range of environmental conditions (Mayer, 1912). At the beginning of the 1980s, it was accidentally introduced to the Black Sea. M. leidyi had an explosive outbreak here (Vinogradov et al., 1989) and expanded into the seas of Azov, Marmara, and the eastern Mediterranean through the straits (Studenikina et al., 1991; Shiganova et al., 1994; Shiganova et al., 2001a). Ultimately, what had to happen and had been predicted (Dumont, 1995) indeed took place: the comb-jelly made it to the Caspian Sea.

The Mnemiopsis invasion had been a real catastrophe for the Black and Azov Sea ecosystems (Vinogradov et al., 1992; Nierman et al., 1994; Shiganova, 1998; Shiganova et al., 2001a; Shiganova & Bulgakova, 2000; Kideys, 1994; Volovik, 2000), and now history repeated itself: the species was also invading the Caspian Sea. In 1999, it was recorded in Iranian waters in winter (Esmaeili et al., 2000), almost at the same time as a record in the Middle Caspian in November by scientists from the Caspian Institute for Fisheries (Ivanov et.al., 2000, Shiganova et al., 2001b). Most probably it was transported with ballast water aboard oil tankers or other ships in the Black Sea or the Sea of Azov (where Mnemiopsis occurs in warm months), and released to the salty Middle or South Caspian (Ivanov et al., 2000) after ships had passed through the Volga-Don Canal and the shallow freshwater North Caspian Sea.

2. Material and methods

A population study of Mnemiopsis leidyi in the Caspian Sea and the effect of this invader on the Caspian ecosystem was organized by the Caspian Institute for Fisheries, with the participation of the P. P. Shirshov Institute of Oceanology RAS in 2000-2002. Surveys were performed in the Northern, Middle and Southern Caspian Sea in July (2), in the Northern Caspian – in September (1) and October (1) 2000, and surveys of the whole Caspian Sea followed in May, June, July, August and October 2001, in January, February 2002 in the Middle and Southern Caspian and in August 2002 in the whole Caspian (1) and in the Northern Caspian (2).

Gelatinous plankton, and fish eggs and larvae were collected with an ichthyoplankton net with an opening diameter of 0.5 m, and mesh size 500 mm, taking vertical hauls from 50 m to the surface. In shallow zones, vertical hauls were performed from the bottom

Population dynamics and effects on the Caspian Ecosystem 73

to the surface. Mesozooplankton was collected using a Juday net (net opening 0.1 m2,mesh size 180 mm) by vertical hauls from 50 m to surface. Phytoplankton was sampled in 5 liter water bottles, from which a 1 liter sample was taken, filtered through 0.2 mm Nuclepore filters, and preserved in 2% buffered formaldehyde. Bacterial samples were collected in a five-liter water bottle, of which one liter was filtered and preserved in 2% neutralized formaldehyde. Fish samples were collected by 30 foot and 15 foot trawls from the near-bottom layer at a low velocity of the vessel. The catch was analyzed on board for species composition. Fish were also measured and weighed, and gut samples were taken for feeding analysis.

Mnemiopsis abundance and biomass were estimated using a coefficient of catchabil-ity of 2 (i.e. numbers collected are believed to be underestimating real numbers twice), exactly as done by Vinogradov et al. (1989) in the Black Sea. Ctenophores were divided in the following size groups: <5.0 mm, 5.1-10.0 mm, 10.1-20.0 mm, 20.1-30.0, 30.1-40.0 mm, >40.0 mm.

Estimations of M. leidyi abundance per cubic meter of water were made, presuming that it inhabits the full upper layer (about 20-25 m in thickness) above the thermocline. Eggs and larval abundances of M. leidyi were estimated from zooplankton samples col-lected by a Juday net. M. leidyi samples were counted and measured immediately upon collection on board of the ship. Length was measured including the lobes. Wet weight was used in all estimations.

The value of metabolic demands, obtained in our experiments (Shiganova et al., 2001b) was used in estimations of population grazing rate. Egg production was studied in the laboratory. Freshly collected ctenophores, after an acclimation of one hour, were put in two liter containers (one ctenophore per container) and kept there overnight at a temperature of 24°C. In the morning, the ctenophore was removed, the water was filtered, and the number of ovae spawned were counted. Another group of ctenophores were fed and next subjected to the same experiment. Species diversity was estimated after Margalef (1974)

3. Geomorphological and hydrological characteristics of the Caspian Sea

According to physical geography and bottom topography, the Caspian Sea can be sub-divided in three parts: the Northern, Middle and Southern Caspian. The long-term water surface fluctuates with an amplitude of about three meters, and is situated at 28 meters below ocean level on average. The boundary between the Northern and the Middle Caspian Sea runs along the line Chechen Island–Cape Tyur-Karagan. The boundary between the Middle and Southern Caspian Sea runs along the line of Zhiloi Island-Cape Kunli. The Northern Caspian is a shallow lake with average depth 5-6 m, and maximum depths of about 15-20 m are located close to its boundary with the Middle Caspian. The bottom relief includes banks (Fig. 1) (Terziev et al., 1992).

The Middle Caspian is a rift basin with an average depth of 190 m. The even deeper Southern Caspian, with deepest point over 1000 m deep is separated from the Middle Caspian by the Apsheron Swell. The depths over this underwater rise do not exceed 180 m.


Figure 1. Depths of the Caspian Sea and vertical distribution of the water masses along a meridian transect (Baidin & Kosarev, 1986). 1 – North Caspian water mass; 2 – Surface Caspian water mass; 3 – Deep middle Caspian water mass; 4 – Deep South Caspian water mass

The sea spans different climatic zones, some of which are affected by cold arctic air masses, others by dry continental air coming from Kazakhstan, and warm tropical air masses coming from the Mediterranean Sea and Iran. This causes great differences in the distribution of surface water temperature (Fig. 2). This difference is especially prominent in winter (from 0-0.5°C near the ice edge in the Northern Caspian to 10-11°C in the Southern Caspian). In summer, the monthly average temperature at the surface is 24-26°C in the Northern and Middle Caspian, 25-26°C in the south, and 27-28 °C in the southeast. The water temperature is maximal in August. Formation of the thermocline begins in the open sea in late May–June. The thermocline is most pronounced in August. Usually it is located within the 20 - to 30th m depth layer in the Middle and Southern Caspian. In autumn, the thermocline degrades with water-cooling and disappears by the end of November.

The most abrupt salinity changes in the Northern Caspian, from 0.1‰ close to Volga and Ural River mouths to 10-11‰, occur near the Middle Caspian boundary. In the Middle and Southern Caspian Sea, salinity variations are not too large – from 12,6 to 13‰. Salinity slightly increases with depth and is 0.1-0.2‰ higher at the bottom than at the surface (Fig. 3) (Terziev et al., 1992).


Figure 2. Seasonal temperature fields (°C) in the surface layer (0 m) of the Caspian Sea. In February (a), April (b), August (c), November (d)


Figure 3. Seasonal salinity fields (‰) in the surface layer (0 m) of the Caspian Sea in February (a), April (b), August (c), November (d)


4. Dispersal of Mnemiopsis leidyi across Caspian waters

The first certified sightings of few adult individuals defi nitely identified as Mnemiopsisleidyi took place in the Middle Caspian Sea in November 1999, by scientists of the Caspian Institute for fisheries (Ivanov et al., 2000; Shiganova et al., 2001b).

In a survey in July 2000, it was found that M. leidyi was already widely distributed in the South and Middle Caspian, with its abundance and biomass increasing southwards. Mnemiopsis abundance was 100 ± 28 ind. m-2 (5 ± 1 ind. m-3) in the Southern Caspian and 24 ± 22 ind. m-2 (1.2 ± 1.6 ind. m-3) in the Middle Caspian, with the mean biomass for both areas 60 ± 44 g m-2 (3 ± 2.2 g m-3). Small-sized individuals (less than 5 mm total length) predominated, particularly in the south, where intensive reproduction of M. leidyioccurred. But it was not found in the Northern Caspian.

In the Northern Caspian, M. leidyi was first found only in September 2000; its abun-dance increased in October, but values were not high: 108 ± 65 ind. m-2 (21.6 ± 9 ind. m-3),biomass 140.4 ± 42 g m-2 (28.1 ± 8 g m-3).

In May 2001, M. leidyi was recorded only in the Southern Caspian (Fig. 6A), where its abundance was 1972 ± 683 ind. m-2 (100 ± 34 ind. m-3) and biomass 128 ± 57.5 g m-2

(6.4 ± 2 g m-3) and in the southwestern part of the Middle Caspian, up to 43° N, abundance was 230 ± 144 ind. m-2 (12 ± 20 ind. m-3)and biomass was 20.0 ± 37 g m-2

(1.4 ± 2 g m-3) (Fig. 4). M. leidyi was most abundant in the western and middle areas of the Southern Caspian, with maximum abundance at the Apsheron Swell and in the west-ern slope waters. Mean size was very small: up to 3.6 mm in the Southern Caspian and 4.2 mm in the Middle Caspian. It is well known that Mnemiopsis shrinks in unfavorable conditions; here, salinity, food, or a combination of both may have been strongly subop-timal. In May, a few eggs and larvae were found in the Southern and Middle Caspian, but mass reproduction did not start yet because of scarcity of reproducing adults and prob-ably, low spring temperatures (16°C in the Southern and 15°C in the Middle Caspian)(Fig. 5).

In June 2001, Mnemiopsis leidyi began to reproduce and continued its expansion towards the north: in the Southern and south Middle Caspian (Fig. 6B), its average abundance was 680 ± 16.8 ind. m-2 (34 ± 2 ind. m-3), and biomass 88.3 ± 7.78 g m-2

(4.3 ± 1 g m-3) (Fig. 4). The highest abundance and biomass, found in the Southern Caspian, represented values of 2005 ± 1248 ind. m-2 (100 ± 62 ind. m-3) and 230 ±

197.66 g m-2 (10.2 ± 9 g m-3), respectively. Ovae and larvae were now recorded every-where in the Southern Caspian and their abundance was 1754 ind. m-3 (estimated from zooplankton samples) (Fig. 5). Larvae (<5 mm) comprised 75.7% of the total (Fig. 7) and, as surface temperature reached 24°C, mean M. leidyi length increased to 7.7 mm. In the Middle Caspian, mean length increased to 10.65 mm (Fig. 8). Reproduction was recorded in the western part of the Middle Caspian, where larvae (<5 mm) comprised 60% of the total abundance. Average egg and larval abundance was now 22 ind. m3 in the whole Middle Caspian (Figs 4, 7).


Figure 4. Seasonal abundance (N, ind. m-2) of Mnemiopsis and biomass (B, g m-2)of Mnemiopsis in the Northern, Middle and Southern Caspian in 2001


Figure 5. Seasonal occurrence of eggs and larvae (ind. m-3) and surface water temperature (data from zooplankton samples)


Figure 6. Spatial distribution of Mnemiopsis in May (A), June (B); July (C), August (D), October (E) 2001, January 2002 (F)

In the second half of July 2001, M. leidyi abundance rose to 3838 ± 1220 ind. m-2

(192 ± 61 ind. m-3), biomass climbed to 500 ± 286 g m-2 (25 ± 14 g m-3), intensity of reproduction increased, and ovae and larval abundance reached 1400 ind. m-3. They comprised about 90% of total abundance in the Southern Caspian (Figs 4, 5, 7).


M. leidyi now had spread to the whole Middle Caspian (Fig. 6 C), and some individuals pen-etrated the south part of the Northern Caspian. Average abundance had doubled, reaching 1266 ± 1035 ind. m-2 (63.3 ± 51.7 ind. m-3), and biomass had more than quadrupled, reaching 372.7 ± 326.55 g m-2 (18.6 ± 16.3 g m-3), probably reflecting the appearance of a new generation. Mean individual length reached 12.3 mm in the Southern and 14.1 mm in the Middle Caspian, but in the Northern Caspian individuals were the largest, with a mean size of 18.3 mm (Fig. 8). Reproduction was recorded everywhere in the Southern and the Middle Caspian. M. leidyi was still the most abundant in the western zones of the Southern and Middle Caspian. Only far to the south was it also abundant in southeastern locations (Fig. 6A-F).

By August 2001, M. leidyi had penetrated the Northern Caspian (Fig. 6 D), but only its western part, where salinity is higher than 4.3‰. Average abundance and biomass for the whole Caspian were now at a maximum of 9103 ± 5690 ind. m-2 (506 ± 316 ind. m-

3) and 954 ± 794 g m-2 (53 ± 44 g m-3), respectively. Abundance reached the huge value of 15587.5 ± 4182.5 ind. m-2 (780 ± 208 ind. m-3) in the Southern Caspian, and larvae comprised 88% of all numbers. In the Middle Caspian, abundance was 6405 ± 2390 ind. m-2 (320 ± 120 ind. m-3) (Figs 4, 7). There were also higher numbers of large adults and lower numbers of ovae and larvae in the Northern Caspian, although the share of ovae and larvae remained considerable (Figs 4, 7). Mean size was 11.4 mm in the Southern, 15 mm in the Middle, and 21.5 mm in the Northern Caspian (Fig. 8).

Figure 6 Continued. Spatial distribution of Mnemiopsis in October (E) 2001, and January 2002 (F)


Figure 7. Seasonal variation of size structure of Mnemiopsis (data from jelly samples)


In October 2001 the abundance of M. leidyi was still high in the whole Caspian (Fig. 6 E), comprising 5375 ± 2145 ind. m-2 (300 ± 120 ind. m-3), but biomass declined to 556 ± 315 g m-2 (31 ± 7 g m-3) (Fig. 4), due to an increasing presence of small-sized individuals of a new generation and the elimination of large but old individuals after reproduction. Hence, mean size decreased to 5.8 mm in the Southern, and 5.2 in the Middle Caspian; no observations were made in October 2001, but data, obtained for october 2000, showed high M. leidyi abundance in the north Western Caspian (Fig. 8).

According to results of a survey in winter 2002 M. leidyi abundance was already very high, with 4234 ± 2846 ind. m-2 (85 ± 42 ind. m-3) in January in the Southern Caspian (Fig. 6 F). These values were much in excess of those in spring 2001. Mean size was only 3 mm, maximum size was 10 mm. Consequently, in August 2002 the abundance of Mnemiopsis was huge – 973 ind. m-3 in the Middle Caspian and 1700 ind. m-3 in the South (Data of CaspNIIRKH). These values were more than twice those of 2001 (Fig. 9).

In August 2002, a survey was performed in the Northern Caspian (Fig. 10A), specifically to determine the northern boundary of occurrence of Mnemiopsis here,and to identify the factors limiting its distribution. It was found that M. leidyi spread north from the Middle Caspian with wind-driven currents. Indeed, the area occupied by M. leidyi in the Northern Caspian directly depended on the direction, velocity and dura-tion of such currents (Fig. 10 A, B). In August 2001, M. leidyi could spread further to the north and its area of distribution, abundance and biomass were higher in the Northern Caspian than in August 2002 (Fig. 9). M. leidyi was found to be able to live only in the northwestern Caspian on condition that salinity is at least 4.3‰, and that there is a high zooplankton concentration (Fig. 10 C, D). In the northeastern Caspian Mnemiopsis wasnot found (see also Kim et al., this volume), in spite of a favorable salinity. Probably, the jellies were inhibited by the high concentration of suspended particles in the local water column. Supposedly, detritus attaches to the combs and tentacles, and thereby causes ctenophore death. In support of this idea, we noticed numerous tiny particles attached to the nematocysts of hydromedusae in this zone and we found only dead and decomposing Mnemiopsis in the eastern part of the Northern Caspian.

5. Morphological and ecological study of M. leidyi in the Caspian Sea

5.1. M. LEIDYI SIZE

The mean length of Caspian Mnemiopsis with lobes, estimated for the whole Caspian in July was 14 .9 ± 3.1 mm, mean wet weight 0.97 ± 0.32 mg while the maximal size recorded was 65 mm with lobes, maximal wet weight 7.2 mg This is consider-ably below the range recorded in the Black Sea in summer. In July mean length was 60.6 ± 39 mm, mean weight 15.1 ± 14.2 and maximum length 137 mm and weight 35 mg. The largest individual found measured 180 mm in early August in the southern Black Sea (Shiganova et al., 2001a).

Mnemiopsis size is at minimum in winter, when it retreats to the Southern Caspian. In spring, with warming and increasing zooplankton concentration, somatic growth of those individuals that survived the winter starts in the south (Fig. 8). Later, the increasing


Figure 8. Seasonal variation of Mnemiopsis mean length (mm) - (1) and wet weight (mg) - (2), upper panel – surface water temperature,°C


population spreads northwards and grows; as a result, mean size increases. Maximum mean size and wet weight was measured in July in the South, and in the Middle and Northern Caspian in August (Figs 7, 8). Mean size increases in a northern direction, as individuals swimming northwards grow while underway (Fig. 8). In August, South Caspian Mnemiopsis decrease in individual size and weight as reproduction begins, larvae and small juveniles appear, and post-reproductive adults are eliminated. In the Middle and Northern Caspian, size and wet weight begin to decrease later, by the end of August.

An equation for biomass calculation was derived, with measurements of length and weight made across the whole Caspian, including the Iranian part (Shiganova & Roohi, unpublished):

W = 0.0018 L2.09, R2 = 0.81, n = 333

where W - wet weight, L - total length with lobes, n - number of measurements.

Figure 8. Continued.


The relative content of dry matter of Mnemiopsis varied from 0.61 to 0.97%, with a mean value of 0.78% in individuals of 2.46 - 4.65 cm length at a salinity of 5.7 % and a temperature of 13.5°C. Wet weight of sampled ctenophores varied from 1.6 to 5.2 g at a salinity of 5.7 ‰ The mean dry weight comprised 0.86% of the wet weight at a salinity of 7.6 ‰ and a temperature of 24°C.

5.2. MORPHOLOGY

Unlike in the Black Sea, no papillae are found on the body of Caspian Mnemiopsis and the animals are also more transparent, due to their smaller size.

In Northern Caspian Mnemiopsis, differences in the morphology of the oral part of the sphaerosoma were found. The metalabial canal is elongate downwards, and as a result the metalabial and labial canals form a loop (Fig. 11). Probably, this is an effect of the unfavorable environmental conditions of the Northern Caspian, although some individu-als from other areas of the Caspian showed the same structure.

Figure 9. Interannual variations of Mnemiopsis abundance in August (Data for 2000 in the Northern Caspian were taken in September)


Figure 10 A, B. Pattern of Mnemiopsis distribution in the Northern Caspian and factors that determine this pattern: A - distribution in August 2002 (ind. m-3);B - distribution in August 2001 (ind. m-3)


Figure 10 C, D. Pattern of Mnemiopsis distribution in the Northern Caspian and factors that determine this pattern: C - Salinity distribution in August 2002; D - zooplankton distribution (mg m-3) in August 2002 (numbers show values of biomass at each station)


Figure 10 E, F. Continued. E - distribution of bacterioplankton (106 cells l-1);F - distribution of total phytoplankton (µg m-3)


Figure 10 G, L. Some chemical variables in the Northern Caspian in August 2002 (from Shiganova et al., 2003b)


Figure 10 M, R. Some chemical variables in the Northern Caspian in August 2002 (from Shiganova et al., 2003b)


Figure 11. Reproduction rate of Mnemiopsis in the Caspian. A - freshly collected ctenophores; B - fed ctenophores

5.3. RESPIRATION RATE

The relationship between oxygen consumption and dry weight can be expressed by the equation

Y = 0.0528 x 0.703, R2 = 0.74


where Y is oxygen consumption in ml O2ind.-1 h-1, and X is dry weight in grams. At 20°C,

oxygen consumption equals 0.097 ml O2ind.-1 h-1.

5.4. REPRODUCTION RATE

Experimental studies of egg production were conducted in forty-seven replications with different sized ctenophores at a temperature of 24°C and a salinity of 12.6‰. These experiments show that Mnemiopsis begins to produce eggs when it reaches a length of about 16 mm, although eggs were occasionally obtained from specimens 12 mm in length and weighing only 0.5 g. The modal size of reproduction in Caspian Sea Mnemiopsis was 20-30 mm. Average fecundity in the Caspian Sea experiments was 1174 eggs. day-1, with a maximum of 2824 eggs. day-1 for specimens 30-39 mm in length and weighing about 2.0-2.7 g. Fecundity of fed ctenophores was higher than that of freshly collected ones (Fig. 12 A, B). Mean fecundity of Mnemiopsis relatively to its wet weight in the Caspian was less than what we found for the Black Sea (Shiganova, unpublished).

The size of hatched eggs was the same as for the Black Sea (Shiganova, unpublished) and for American coastal waters. But the size of different developmental stages in the Caspian Sea was smaller and the size of reproductive maturity for Caspian Mnemiopsiswas also smaller than in the Black Sea. It was found to be about 16 mm, although speci-mens continued to grow and ultimately reached 64.5 mm.

Figure 12. Morphological characters of Mnemiopsis in the Northern Caspian


6. Effects of the Mnemiopsis invasion on the Caspian ecosystem

6.1. EFFECTS ON BACTERIOPLANKTON

Mean abundance of bacteria was 4066 ± 1223 106 cell l-1, biomass 1.38 ± 0.36 mg l-1, var-ies from 2200 to 5280 106 cell l-1 and from 0.8 to 1.84 mg l-1, respectively in the Northern Caspian in August 2002. The highest values were observed in the southwest of the Northern Caspian in those locations that also had the highest Mnemiopsis concentrations. Bacterial abundance here reached 5190-5250 106 cells l-1, or a biomass of 1.4-1.84 mg l-1. In other areas (both in the west and east), abundance varied from 2200 to 3310 106 cell l-1, and biomass from 0.8 to 1.3 mg l-1. Some increase was recorded only in the South-East, where abundance was 4.05 106 cells l-1, and biomass 1.5 mg l-1. A positive correlation was found between the abundances of bacteria and of Mnemiopsis (r = 0.51) (Fig. 10).

6.2. EFFECTS ON MESOZOOPLANKTON

Zooplankton abundance and biomass started decreasing as early as 2000, compared with pre-Mnemiopsis years. In the Northern Caspian, its abundance dropped by a factor 5.3 times, and biomass declined by some six times in October, as compared with July 2000. Most of this change occurred in the Copepoda. In the Middle and South Caspian, the annual values of zooplankton biomass dropped by factors four (Middle Caspian) and nine (Southern Caspian) below those of 1998.

In 2001, the effect on the zooplankton became much more incisive, and it was paral-leled by a huge increase in M. leidyi population size (Fig. 13).

In the Northern Caspian, river discharge and temperature determine the development of the zooplankton. In winter, it is reduced to low stock values but with warming, brack-ish-water species of Rotifera and Cladocera in addition to some marine species increase the standing stock greatly, to reach values that are ten and more times higher than in other regions of the Caspian.

In the west of the Northern Caspian in June 2001, copepods were the most abundant group (21,025 ind. m-3; 122.5 mg m-3), represented by nine species. Halicyclops sarsiwas the dominant species, together with Calanipeda aquae-dulcis and Acartia tonsa.Cladocera were represented by 10 species and their abundance was 3,588 ind. m-3 for a biomass of 53.51 mg m-3. The Rotifera are characteristic for the Northern Caspian, where they are represented by 15 common species and reach values as high as 24,319 ind. m-3

and 76.62 mg m-3 in June. Meroplanktonic species are represented by larval Bivalvia and amount to 4,651 ind. m-3 and 23.25 mg m-3.

In July 2001 there was still no Mnemiopsis in the Northern Caspian; only in late July, a few individuals were found in the western part and zooplankton stock reached very high values, due to 19 species. Their abundance was 144,148 ind. m-3, and biomass reached 769.78 mg m-3. The main increment in abundance and biomass was by larval Bivalvia, and amounted to 100,700 ind. m-3 and 504.7 mg m-3 respectively. Another important contribution was by the Copepoda (four species) and a lesser one by the Rotifera (fi ve species), in all 34,743 ind. m-3 and 4,011 ind. m-3, respectively. In terms of species rich-ness, most species (10) were contributed by the onychopod Cladocera. In addition to


holo- and meroplanktonic species, two demersal species were present. Acartia tonsa,its Copepodites and nauplii predominated among the Copepoda, comprising 36% of the total. Calanipeda aquae-dulcis and Halicyclops sarsi made up only 14.9 and 1.7% respectively, although they had been extremely common in previous years. Among the onychopod Cladocera, Polyphemus exiguus predominated, comprising 73% of the total.Synchaeta stylata predominated among the Rotifera, comprising 62% of the total.

In August, with the spreading M. leidyi in the western part of the Northern Caspian, the zooplankton stock greatly decreased: biomass dropped to 32.4 mg m-3, abundance to 7938.4 ind. m-3, and the number of species decreased to 15, with only one species of Cladocera remaining, and three species of Copepoda, among which A. tonsa was the most

Figure 13. Seasonal changes of abundance (ind. m-3), biomass (mg m-3) and species composition of zooplankton in the Northern (Western) – A, B, the Middle – C, D, and Southern Caspian – E, F


abundant. Rotifera now had the highest input in terms of number of species, and were represented by six species. Most developed far to the north, where salinity was lower and Mnemiopsis did not occur, but their quantitative contribution was low, Keratella tropicaand Brachionus quadridentatus being the most common among them. Larvae of Bivalvia almost completely disappeared. They were relatively most abundant in July (Fig. 13). Copepoda were represented mainly by A. tonsa, which were responsible for 75% of total zooplankton abundance. The abundance of the Cladocera was extremely low.

In the Middle and Southern Caspian, numerical values of zooplankton were lower than in 1991-1993 already by May: biomass declined by a factor 9.7 and abundance by a factor 4.3. The main food species for kilka fish had always been Calanoid copepods, first and foremost Eurytemora grimmi and Heterocope caspia, but in May 2001 they were reduced to low values and total Calanoid abundance was only 400 ind. m-3, and biomass 1.345 mg m-3. In 1991-1993, both values had still been in the thousands of individuals and biomass tens of mg m-3. Eurytemora grimmi and Heterocope caspiaas well as Calanipeda aquae-dulcis were last recorded in low numbers in May; since June they have not been seen at all, neither in Middle nor in Southern Caspian samples. But in June and July, seasonal development of other Copepoda and Cladocera species continued; Copepoda were comprised of five species and Cladocera of seven species. Among Copepoda the most abundant was Acartia tonsa, which made up 1,044 ind. m-3.In low numbers there was also Gymnocalanus grimaldii, Calanipeda aquae-dulcis,and Halicyclops sarsi. Nauplii of Calanoida were also rather abundant, most of them belonging to A. tonsa. In July, Bivalvia larvae greatly dropped. In August, stocks of all zooplankton species declined, in parallel with the now huge development of M. leidyi.Among Copepoda, only A. tonsa was found in the Middle Caspian, in addition to few individuals of Gymnocalanus grimaldii and Halicyclops sarsi. Cladocera, Rotifera and larval Bivalvia were still found, but at very low values. Among Cladocera Pleopis poly-phemoides predominated. Among Rotifera, Synchaeta stylata and S. neapolitana were the most abundant. The number of species decreased from 28 in July to 17 in August.

In the South Caspian, the situation with the seasonal changes of the zooplankton stocks was even more dramatic. Maximum values were recorded in June (Fig. 13). A decline started in July, when the Copepoda were already represented almost exclusively by A. tonsa (Fig. 13), only few individuals of Gymnocalanus grimaldii, Calanipedaaquae-dulcis and Halicyclops sarsi remained. Larvae of Bivalvia followed in values after A. tonsa – 1,016 ind. m-3 and 3.53 g m-3. Representatives of the Cladocera were comprised of 406 ind. m-3, Rotifera of 443 ind. m-3, and the number of species was 22. In August, the Copepoda were represented only by A. tonsa, while the Cladocera com-pletely disappeared, and only a few larvae of Bivalvia were found, as well as some Rotifera, whose number of species dropped to six.

The seasonal development of the zooplankton was such that an increase in zooplank-ton biomass and abundance during summer resulted from the development of warm water holoplanktonic species of Cladocera and of meroplanktonic larvae of Bivalvia and of Copepoda. The peak of development used to fall in June in the Southern and in July for the other regions of the Caspian (Fig. 13). But with the development of Mnemiopsis,which peaked in August, the standing stock of zooplankton also collapsed in August. First of all the Cladocera were affected: they dropped to zero in the South, decreased


five times in the Middle, and 700 times in the northwestern Caspian (Fig. 13). Copepoda became represented almost completely by the non-indigenous Acartia tonsa.

The abundance, biomass and species diversity of zooplankton and meroplankton were decreasing month after month as M. leidyi increased in all regions of the Caspian Sea (Figs 13, 4). Thus, if we compare data in July and August, the abundance of zoo-plankton decreased 17 times in the Northern Caspian (although this decrease was mainly due to a decrease in the larvae of benthic organisms, which comprised 74% in July). In the Middle Caspian, zooplankton decreased by factor two and in the South by a factor three (Fig. 13).

The zooplankton community simplified from month to month. Its index of diver-sity, estimated after Margalef (1974) in the North decreased from 8.8 in June to 1.2 in October (Fig. 14). In the Middle Caspian, it went from 9 to 1.24, and in the South from 5 to 0.85. If we compare index diversity data in August 2001 with data for August 1998, the decrease in the Middle Caspian amounted to six times, while in the Southern Caspian it decreased some nine times (Fig. 14 B, C).

The grazing rate of Mnemiopsis was estimated for all regions (Fig. 15) on the base of the metabolic demand method. This means that we did not include needs for reproduc-tion and growth. It was found that in spite of a continuation of zooplankton development, the stock of zooplankton was much lower than the M. leidyi population demands in all regions of the sea.

The spatial distribution of the zooplankton too changed from month to month (Fig. 16). During May, June, and July zooplankton was most abundant in the western parts of all regions, as had always been characteristic of the Caspian Sea (Polyaninova et al., 2000). But in August, the zooplankton of the western parts collapsed due to high grazing rate of an increasing Mnemiopsis population, mainly because the high prey concentration stimulated an intensive development of Mnemiopsis there (Fig. 16 A, B).

6.3. EFFECTS ON PHYTOPLANKTON

In 2001, the abundance and biomass of the phytoplankton greatly increased between June and August, a result of the decrease in zooplankton grazing. Thus total phytoplankton biomass in June was 354.5 ± 224.5 mg m-3 and increased in August to 510 ± 258 mg m–3. The biomass of the phytoplankton increased in those areas where Mnemiopsis was the most abundant and where the greatest drop in zooplankton had occurred. These were the western parts of the Middle and Southern Caspian. So, in June mean phytoplankton biomass was 324.82 ± 109 mg m-3 in the east of the Middle Caspian, and particularly high values were recorded in the upwelling along the eastern shore of the northeastern Middle Caspian. In the western Middle Caspian, mean biomass of phytoplankton was 226.2 ± 112 mg m-3; in the Southern Caspian, biomass was lower (173.2 ± 134.7 mg m-3).In August, the mean biomass of phytoplankton was 337.8 ± 120.5 mg m–3 in the east of the Middle Caspian but two times higher in the west (568.5 ± 227.5 mg m-3).The greatest increase occurred in the western zone of the South Caspian, where mean value was 630.7 ± 227 mg m-3 (Fig. 17 A, B). Thus, biomass remained at an unchanged level in the eastern Middle Caspian, where Mnemiopsis and zooplankton stocks were both poor (Figs 6, 15), while in the western part phytoplankton biomass doubled, and in


Figure 14. Seasonal changes of biodiversity of zooplankton in 2001 and 1998 (Middle Caspian)


Figure 15. Seasonal changes of Mnemiopsis % daily grazing rate (1), and zooplankton biomass (2), mg m-3


the Southern Caspian biomass of phytoplankton tripled. In the north, high values of biomass were recorded at locations where Mnemiopsis was very abundant, viz. 691 ± 334 mg m-3

in August.The rise in phytoplankton biomass was paralleled by an increase in chlorophyll.

Measurements of chlorophyll “a” in the Northern Caspian showed that values in August 2002 were twice those of August 1999 in areas of intensive bloom of Mnemiopsis. Data of chlorophyll obtained by the SeaWiFS scanner (Kopelevich et al., 2002) indicated that in the Middle Caspian chlorophyll doubled in August-September 2001, while in the Southern Caspian it quintupled compared to the summer months of 1999 (Fig. 18). If we compare data of chlorophyll in June and August 2001, we note that values doubled in the

Figure 16. Zooplankton spatial distribution (ind. m-3) – A – in June, B - in August


Middle Caspian and tripled in the Southern Caspian; these increases are almost identical to those of the phytoplankton (Fig. 18).

Figure 17. Phytoplankton spatial distribution (mg m-3) – A – in June, B - in August

6.4. EFFECTS ON FISH

The main food competitors of M. leidyi are planktivorous fish. The most important among them are small pelagic sardines, represented by three species of kilka: common kilka Clupeonella delicatula caspia, anchovy kilka Clupeonella engrauliformis and big-eye kilka, C.grimmi, beside several species of shad (Ivanov, 2000).

The first species to suffer was anchovy kilka, which is the main commercial species for all Caspian countries. An effect on this species was recorded as well for adult indi-viduals as for juveniles living in the upper water layers. The biological parameters of all species of kilka, especially anchovy kilka-weight, length and fatness sharply decreased (Table 1) (Sokolsky et al., 2001).

In 2001, the biomass of kilka dropped by a factor three in Russia, Iran, and Azerbaijan compared with 2000. In 2002, the decline was even more considerable (Fig. 19).

As the collapse of the kilka stocks proceeded, their share in the diet of stellate, Russian, and beluga sturgeons sharply fell. Before M. leidyi arrived, the share of kilka had represented more than 10% of the diet of stellate and Russian sturgeon, reaching 30-40% in some years. But in 2000, kilka in stomachs was found only in the Northern Caspian, and in 2001 no kilka at all was found in sturgeon guts. Beluga also was an important consumer of kilka. Its share in the diet was from 6 to 100% in 1998-1999, depending on the area, but in 2001 it went down to 0.3-0.7%. In general, the index of fullness of beluga guts decreased from 2.2 to 0.1‰.

In the Northern Caspian, some commercial freshwater species of fish are also plankton feeders (Ivanov, 2000). Here too, and as early as 2000, the share of mollusk larvae in diet of the Caspian roach (vobla) started decreasing.


Figure 18. Interannual changes of chlorophyll concentration in the Caspian Sea (from Kopelevich et al., 2002)

Population dynam

ics and effects on the Caspian E

cosystem

103

Table 1. Mean length (L, cm), wet weight (W, g) and coefficient of fatness (K, %) for anchovy kilka in 1997-2001 (from Sokolsky et al., 2001)

Age 1997 1998 1999 2000 2001

L* W K L W K L W K L W K L W K

1 7,4 3,2 0,79 7,6 3,2 0,73 7,5 3,3 0,78 6,9 2,3 0,7 5,3 1 0,67

2 8,4 4,7 0,79 8,6 5 0,78 8,7 5,2 0,79 7,5 3,5 0,83 6,3 1,7 0,68

3 9,3 6,4 0,79 9,3 6,4 0,79 9,5 6,5 0,76 8,5 4,5 0,73 7,9 3,3 0,67

4 10,1 8,1 0,78 10,3 8 0,73 10,5 8 0,69 9,3 5,8 0,72 8,2 3,8 0,69

5 10,6 9,1 0,76 11 9,5 0,71 11,2 9,9 0,7 9,7 6,4 0,7 8,4 4,1 0,69

6 11 9,9 0,74 9,6

Mean 9,47 6,9 0,78 9,36 6,4 0,75 9,48 6,6 0,74 8,4 4,5 0,74 7,6 2,8 0,63

*L - length, W - wet weight, K – coefficient of fatness


Figure 19. Distribution of biomass of kilka for Caspian countries (after data of kilka surveys, and data of lab kilka stocks study, by KaspNIRKH), A - anchovy kilka; B - common kilka; C - big-eye kilka


6.5. EFFECTS ON CASPIAN SEAL, PHOCA CASPICA

The top trophic level of the Caspian Sea is a seal. Individuals of seal migrate southward for feeding in spring (April-May). Part of the population begins its migration in the Northern Caspian, consuming en route common kilka and silversides, which are abun-dantly arriving in the Northern Caspian in March-April. Another part of the population migrates to the south, to migrate back north in September. In 2001, seal occurred only at an average number of 0.7 ind. per station in the North Caspian in September. This situation reflected a double lack of food: a collapse of the kilka stocks and a decrease in individual weight of any surviving kilka. The seal therefore simply did not find enough food to build the fat reserves needed for it to migrate back. Mean weight of seals was 41 kg, 10% lower than in 2000. As a result of decreased kilka stocks, the share of repro-ductive females in the seal population became greatly reduced. Total barrenness in 2001 amounted to 79.8% of all females, and the percent of pregnant females was only 10.1% (Fig. 20) ((Zakharova &Khuraskin, 2002). The barren females had a lower weight, length and Fulton coefficient of fatness than pregnant seals.

Figure 20. Interannual changes in Caspian Seal reproduction

7. Discussion

Mnemiopsis leidyi was first recorded in the Caspian Sea in 1999, both in the Southern and in the Middle Caspian but some Iranian fishermen reported on the presence of strange new jellies as early as 1997. Not more than four years later, M. leidyi had spread to all parts of the Caspian where salinity was over 4‰.


In 2001 M. leidyi abundance and biomass jumped up enormously, its abundance by some 120 times, and its biomass by16 times in summer (Fig. 4). In 2002, the Mnemiopsispopulation again doubled.

The M. leidyi population study in the four years since its appearance in the Caspian Sea has shown that its major area of distribution is the Southern Caspian, mainly the Iranian area, where it spends winter, and where its population size strongly contracts in December-January, as temperatures drop to 8-10°C, while surviving individuals shrink back to a small size. In spring, M. leidyi begins to grow and reproduce here, soon spread-ing to the north. The main factors that determine the increase of the M. leidyi populationare temperature and food (zooplankton) (Fig. 6). It appears in the Middle Caspian in July and in the Northern Caspian in late July-early August. Largest-sized M. leidyi appear in July-August, and body size generally increases northwards (Fig. 8).

The highest population size was recorded in the western parts of all areas due to higher temperature and zooplankton concentration there (Fig. 6, 16). The highest abundance, biomass and intensity of reproduction have been recorded in August-September, regard-less of area. In October, these values begin to decrease but reproduction continues. It is probable that, as a result of winter cooling, Mnemiopsis completely vacates the Northern Caspian by late November. Next it disappears from the Middle Caspian, and only a small population survives winter in the South.

M. leidyi has now reached critical biomass levels in the important commercial areas of the Caspian. Its level of abundance at the time of its maximal seasonal development (August-September) in 2001 was twice the maximum values in the Black Sea in 1989 measured by Vinogradov et al.(1989). But even after that it increased twice in the Middle and Southern Caspian in 2002. Taking into account the specific features of the Caspian Sea (a closed basin, a long period of production, a high summer temperature every year) this extraordinary level of abundance is expected to be maintained in the near future. The only reason we presently see that could cause a decrease is low food — thus mainly zooplankton — availability.

The various impacts of M. leidyi on the biota of the pelagial of the Caspian Sea are summarized hereunder.

7.1. DIRECTLY IMPACTED BIOTA

Direct effects of Mnemiopsis on the hydrochemistry of the habitat were recorded in the Northern Caspian (Shiganova et al., 2003b). A significantly positive correlation was present between Mnemiopsis abundance and ammonium concentration (r = 0.83), of which maximal concentrations of 0.95 µM-0.8 µM were observed precisely at the sites with maximal Mnemiopsis abundance (Fig. 10). This may be explained by the fact that the main component of Mnemiopsis excretion is ammonium. As a result, the regeneration of nitrogen in areas of Mnemiopsis concentrations was faster than elsewhere. As well, the ratio between organic and inorganic nitrogen in these areas was higher. High ammo-nium concentrations provoked a recycling of nutrients and stimulate phytoplankton development. They also create an enhanced level of primary production (Fig. 10).


7.1.1. Pelagic groups

We noted an increase in the heterotrophic microplankton, mainly of bacteria: Mnemiopsiscontinuously evacuates mucus from the surface of its body, which leads to an additional input of organic compounds to the water. On this substrate, microheterotrophic micro-plankton thrives, first of all, bacteria. Thus Mnemiopsis stimulates the bacterial loop through the polysaccharides in the mucus it releases. Active regeneration of inorganic nutrients (N, PO

4, Si) resulted in enhanced bacterial activity (Fig. 10). The nutrients

released were of course also utilized by the phytoplankton, increasing total plankton biomass.

The decreased abundance, biomass and species diversity of the holozooplankton, also involved the pelagic eggs and larvae of all species of pelagic fish (Figs 13, 14). But M. leidyi first and foremost consumes zooplankton, including meroplankton. Field and experimental data allowed us to estimate its predation impact for 2001. We found that the grazing rate of M. leidyi during intensive development population was higher than the seasonal zooplankton production, such that by the end of summer the zooplankton stock became extremely poor (Fig. 15).

A phytoplankton bloom naturally followed the relaxation of the grazing pressure by Copepoda and Cladocera in late summer, when M. leidyi at its peak and had depleted the zooplankton stock (west part of the Middle and Southern Caspian) (Figs 6, 16, 17). This increase in phytoplankton was, not surprisingly, reflected in a rise in chlorophyll “a”.

7.1.2. Benthic groups

A decrease occurred in the abundance, biomass and species diversity of the meroplankton (=benthic species with pelagic larvae), and of the demersal plankton (=benthic species which migrate to the pelagic zone for feeding). A particularly great effect on the benthos was recorded in the shallow Northern Caspian, where Mnemiopsis inhabits the total water column. Mnemiopsis aggregations were observed near the bottom in high density at locations where salinity is higher near the bottom.

A phytoplankton bloom followed the relaxation of the grazing pressure by Copepoda and Cladocera in late summer, when M. leidyi population size is largest and zooplankton stock is lowest (western parts of the Middle and Southern Caspian) (Fig. 6, 16,17). Due to the increasing phytoplankton, a rise in chlorophyll “a” followed.

7.2. INDIRECTLY IMPACTED BIOTA (FOOD COMPETITORS)

These include small pelagic planktivorous fish such as Clupeonella delicatula caspia,Clupeonella engrauliformis and C.grimmi, which showed a decrease in stocks, a decrease in individual length, weight, and fat content, as well as an altered diet composi-tion and ration.

At the top trophic levels, including the piscivorous fish, sturgeons, and seal, a decreased prey availability was noted. There were less small pelagic fish, and thus there was a decrease in the share of kilka in their rations. A qualitative change in diet composi-


tion occurred, indicating worsened biological conditions, and impaired behavior, migra-tions, and reproduction were noted.

7.3. IMPACT ON FISHERIES

A dramatic drop in the biomass of kilka occurred: biomass was halved in 2001, and another strong decrease occurred in 2002 (Fig. 19). By 2002, M. leidyi had reached criti-cal biomass levels in important commercial areas of the Caspian Sea, jeopardizing the fisheries industries through its impact on the food chain in general and on pelagic fi sh in particular.

7.4. FOOD-WEB EFFECTS

Summarizing our analysis of the alterations of the Caspian ecosystem, we find that many controls, from top predators (Seal, fish predators) to planktivorous fish, to zooplankton, to phytoplankton and from microplankton to detritus, which existed in the previous Caspian ecosystem, were deeply modified by M. leidyi (Fig. 21). Numerous effects can be noted. On the one hand, cascading effects occur at high trophic levels: a drop in zooplankton stock (direct predation effect, top-down), a drop in planktivorous fi sh (direct preying by Mnemiopsis on the eggs and larvae of fish; rather a top-down effect), a decrease in the number of predatory fish and seal (response to a decrease in available prey, a bottom-up effect). On the other hand effect also occur at lower trophic levels: a drop in zooplankton stock allows a phytoplankton increase by a relaxed zooplankton grazing (top-down) and by input of more nutrients by M. leidyi excretion and release of mucus (bottom-up); and heterotrophic microplankton increases due to input of mucus (bottom-up) (Shiganova et al., in press). Certainly this scheme is simplified: we have to include anthropogenic effects such as overfishing and man-made eutrophication in addi-tion to climatic changes, but it is evident that the effects that appeared in the Caspian were similar to those in the Black and Azov Seas in the 1980s-1990s (Shiganova et al., 2003). Thus, this “lower“gelatinous carnivore, very well adapted to a rapid expansion, was capable of deeply modifying a whole ecosystems and its functioning.

Conscious of this, and bearing in mind the devastating impact of M. leidyi on the fisheries in the Black and Azov Seas in the 1990s, we began a number of initiatives in 2001 with a view to take stock of the situation, review and assess remedial measures and take concrete actions. After deliberation, we proposed the introduction of a potential predator of M. leidyi as the only truly viable option. As shown by the example of the Black Sea, the best — and so far only — candidate for this is another ctenophore species, Beroe cf ovata. After the accidental introduction of Beroe cf ovata to the Black Sea, theabundance of M. leidyi here immediately dropped to levels so low that no further damage was inflicted. In fact, the ecosystem almost immediately began to recover. Details of the recovery process can be found in Shiganova et al. (2000, 2001C, 2003) and Kideys et al. (2003). It is anticipated that the results of a Beroe cf ovata introduction in the Caspian will be similar; summer 2004 is now the target date for the implementation of this plan.

Population dynam

ics and effects on the Caspian E

cosystem

109Figure 21. Food Web of the Caspian under jelly impact


References

Baidin, C. C. & A. N. Kosarev (eds), 1974. Caspian Sea. Moscow, “Nauka”, 262 pp.

Dumont, H. J., 1995. Ecocide in the Caspian Sea. Nature 377: 673-674.

Esmaeili, S. A., S. Khodabandeh, B. Abtahi, J. Sifabadi & H. Arshad, 2000. First Report on occurrence of

a comb jelly in the Caspian Sea. Journal of Science and Technology of the Environment, 3: 63-69.

Ivanov, V. P., 2001. Biologicheskie resursy Kaspiiskogo morya. (Biological resources of the Caspian Sea).

Astrakhan, CaspNIIRKH, 100 pp. (in Russian).

Ivanov, P. I., A. M. Kamakim, V. B. Ushivtzev, T. Shiganova, O. Zhukova, N. Aladin, S. I. Wilson, G. R. Harbison

& H. J. Dumont, 2000. Invasion of Caspian Sea by the comb jellyfish M. leidyi leidyi (Ctenophora).

Biological Invasions 2: 255-258.

Kideys, A. E., 1994. Recent dramatic changes in the Black Sea ecosystem: The reason for the sharp decrease

in Turkish anchovy fisheries. Journal of Marine Systems 5: 171-81.

Kideys, A. E., 2002. Fall and rise of the Black Sea ecosystem. Science 297(5586): 1482-1484.

Kopelevich, O. V., V. I. Burenkov, C. V. Ershova et al., 2002. Biological characteristics the seas of Russia after

data of Satellite scanner SeaWiFs. GIS Moscow.

Kremer, P., 1976. Excretion and Body Composition of the Ctenophore Mnemiopsis leidyi (A. Agassiz):

Comparisons and Consequences. Tenth European Symposium on Marine Biology. Ostend, Belgium.

V.2.P.351-362

Niermann, U., F. Bingel, A. Gorban, A. D. Gordina, A. C. Gugu, A. E. Kideys, A. Konsulov, G. Radu, A. A.

Subbotin & V. E. Zaika, 1994. Distribution of anchovy eggs and larvae (Engraulis engrasicolus Cuv.) in

the Black Sea in 1991-1992. ICES Journal of marine Sciences 51: 395-406.

Margalef, R., 1974. Ecologia. Barcelona, Omega, 951 pp.

Mayer, A. G., 1912. Ctenophores of the Atlantic coast of North America. Publications of the Carnegie Institute,

Washington, 162: 1-58.

Polyaninova, A. A., A. G. Ardabieva, T. A. Tatarintzeva et al., 2000. The hydrobiological characteristic of

the commercial fish fattening conditions in the Caspian Sea. In: Fisheries Researches in the Caspian.

Astrakhan, 2001:110-124. (in Russian).

Salmanov, M. A., 1999. Ecology and biological production of the Caspian Sea. Baku, Y. I. Sorokin (ed), 397 pp.

Shiganova, T. A, 1998. Invasion of the Black Sea by the ctenophore Mnemiopsis leidyi and recent changes in

pelagic community structure. Fisheries and Oceanography 7-GLOBEC Special Issue. S. Coombs (ed),

pp. 305-310.



Shiganova, T. A, J. V. Bulgakova, P. Y. Sorokin & Y. F. Lukashev, 2000. Investigation of a new invader, Beroe

ovata in the Black Sea. Biology Bulletin 27: 247-255.




431-445.

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushivtsev, A. B. Dulimov & E. I. Musaeva, 2001b.


Oceanology 41: 542–549.

Shiganova, T. A., J. V. Bulgakova, S. P. Volovik, Z.A. Mirzoyan & S. I. Dudkin, 2001c, A new invader, Beroe

ovata Mayer 1912 and its effect on the ecosystems of the Black and Azov Seas. Hydrobiologia 451:


187-197.

Shiganova, T. A, E. I. Musaeva, Y. V. Bulgakova et. al., 2003. Ctenophore invaders Mnemiopsis leidyi (A.

Agassiz) and Beroe ovata Mayer 1912, and their effect on the pelagic ecosystem of the northeastern Black

Sea. Biological Bulletin 2: 225-235.

Shiganova, T. A., V. V. Sapognikov, E. I. Musaeva, M. M. Domanov, Y. V. Bulgakova, et al., 2003. Factors

that determine pattern of distribution and abundance Mnemiopsis leidyi in the Northern Caspian.

Oceanology 43.

Shiganova, T. A., B. Ozturk & A. Dede, 1994. Distribution of the ichthyo-, jelly - and zooplankton in the Sea

of Marmara. FAO Fisheries report 495: 141-145.

Studenikina, E. I., S. P. Volovik, I. A. Miryozan & G. I. Luts, 1991. The ctenophore Mnemiopsis leidyi in

the Sea of Azov. Oceanology 31: 722-725.

Sokolsky, A. F., T. A. Shiganova & L. A. Zytov, 2001. The biological pollution of the Caspian Sea by the comb

jelly Mnemiopsis and the first results of its impact on the pelagic system. In: Fisheries Researches in

the Caspian. Astrakhan, pp.105-109 (in Russian).

Terziev, F. S. et al. (eds), 1992. Morya USSR. Hydrometeorology and Hydrochemistry of the Seas. T.YI.

The Caspian Sea, Issue 1. St.Peterburg, Gidrometeoizdat.

Vinogradov, M. E., E. A Shushkina., E. I; Musaeva & P. Y. Sorokin, 1989. Ctenophore Mnemiopsis leidyi

(A. Agassiz) (Ctenophora: Lobata) – a new settler in the Black Sea. Oceanology 29: 293-298.

Vinogradov, M. E., V. V. Sapozhnikov & E. A. Shushkina, 1992. The Black Sea ecosystem. Nauka, Moscow:

112 pp. (in Russian).

Volovik, S. P. (ed), 2000. Ctenophore Mnemiopsis leidyi (A. Agassiz) in Azov and Black Seas: Biology and

Consequences of its Intrusion. In S. P. Volovik (ed), Rostov-on-Don, 498 pp.

Zakharova, N. A. & L. S. Khuraskin, 2002. Some problems in biology of Caspian Seal due to anthropogenic

invasion of Mnemiopsis sp. Abstract. Astrakhan. CaspNIRKH conference.

Chapter 4

Distribution and biology of Mnemiopsis leidyi in the Northern Aegean Sea, and comparison with the indigenous Bolinopsis vitrea

TAMARA A. SHIGANOVA1, EPAMINONDAS D. CHRISTOU2,JULIA V. BULGAKOVA1, IOANNA SIOKOU-FRANGOU2,SOULTANA ZERVOUDAKI2 & APOSTOLOS SIAPATIS2

1P.P. Shirshov Institute of oceanology Russian Academy of Sciences36, Nakhimovskiy pr., 7851 Moscow, Russia2National Centre for Marine Research Ag. Kosmas Hellinikon, 16604 Athens, Greece

Keywords: Mnemiopsis leidyi, Bolinopsis vitrea, population abundance, species invasions, metabolism, fecundity, reproduction.

The distribution of the ctenophore Mnemiopsis leidyi in the Aegean Sea, influenced by the outflow of Black Sea water through the Dardanelles strait, has been studied since 1990. Swarms were found in the northern Aegean Sea, mainly near coastal areas, but at a lower abundance (max 150 ind. m-2) than in the Black Sea. It has been hypothesized that M. leidyi was introduced to the Aegean Sea by Black Sea water, but its presence in Saronikos Gulf and Elefsis Bay, located in the central Aegean Sea, could equally well be attributed to introduction with ballast water. No impact of M. leidyi on the mesozoo-plankton communities was detected in the northern Aegean Sea, probably due to its low abundance. During July 2001 the distribution and biology of M. leidyi and of the indig-enous Bolinopsis vitrea were studied in the northeastern Aegean Sea. The abundance of both species was extremely low. The M. leidyi of the Aegean Sea were smaller and probably had lower fecundity than those of the Black Sea, but they presented higher metabolic and clearance rates. The metabolic and clearance rates of Bolinopsis vitreawere lower than those of M. leidyi of the same length. These results suggest a regulation of the ctenophore populations in the oligotrophic waters of the Aegean Sea.

1. Introduction

A predatory ctenophore of the genus Mnemiopsis, assigned to the polymorphic species M. leidyi (A. Agassiz) (Seravin, 1994) was accidentally introduced to the Black Sea in

113

H. Dumont et al. (eds.),113–135.

© 2004 Kluwer Academic Publishers. Printed in the Netherlands.Aquatic Invasions in the Black, Caspian, and Mediterranean Seas,


the early 1980s, presumably with ballast water of ships that came from the northwestern Atlantic coastal region (Vinogradov et al., 1989). From the Black Sea, where it rapidly expanded, it spread north to the Sea of Azov. Also, the Black Sea current carried it through the Bosporus to the Sea of Marmara (Studenikina et al., 1991; Shiganova, 1993, Shiganova et al., 2001a) where it now occurs around the year (Shiganova, 1993). A steep decline in ichthyo - and mesozooplankton abundance and change in species composition followed in its wake in the Black and Azov Seas. The catches of zooplanktivorous fi sh sharply dropped (Vinogradov et al., 1989; 1992; Volovik et al., 1993; Shiganova, 1997; 1998; Kovalev et al., 1998, Konsulov & Kamburska, 1998, Shiganova & Bulgakova, 2000). In 1999, M. leidyi reached the Caspian, where it is currently expanding at an even more rapid rate than in the Black Sea (Shiganova et al., 2001b and this volume).

In the Aegean Sea, M. leidyi was first recorded in the central Saronikos Gulf during spring-summer 1990. After 1991, M. leidyi swarms were observed in several coastal areas of the northern Aegean and few specimens were collected in offshore waters (Shiganova et al., 2001). It is believed that the flow of Black Sea water mass to the northern Aegean Sea contributes to the dispersal of M. leidyi in the area.

There are no studies on M. leidyi or on any other ctenophore in the Aegean Sea. This paper is the first attempt to study the distribution, biology and physiology of M. leidyiin the northern Aegean Sea and analyses the possibility of an effect on the zooplankton and ichthyoplankton, the main food organisms of M. leidyi. Simultaneously, the indig-enous Mediterranean species Bolinopsis vitrea, another representative of the ctenophore order Lobata, was found and studied. This genus is a close relative to M. leidyi and has a similar size. Though both species occur typically in neritic waters, they rarely overlap. Only in the Florida – Bahamian waters have they ever been found together (Kremer et al., 1986). Representatives of warm-water Bolinopsis species (B. vitrea) from North American waters generally occur in cleaner, more open waters, which are presumably less productive and show a weak seasonal variability in temperature and salinity (Kremer et al., 1986). M. leidyi inhabits mainly estuarial basins. According to the last available taxonomic revision, only B. vitrea inhabits the Mediterranean Sea (Fedele, 1940).

2. Study area

The Northern Aegean Sea is characterized by large horizontal discontinuities, such as the frontal region where Black Sea waters (BSW) enter the Aegean Sea, exiting from the Dardanelles strait as a surface current. As the Dardanelles outflow forms a very shallow plume (of thickness only about 20 m during summer), its location is strongly infl uenced by the prevailing wind conditions. During summer the front location is mostly attributed to the North winds (the Etesians) prevailing during this period in the Aegean, which force the waters exiting the Dardanelles to a southwestward direction. In the absence of those winds, the Dardanelles plume follows a northwestward direction, which carries it through the straits between the islands of Lemnos and Imvros (Zervakis et al., 2002)

Distribution, biology and comparison with Bolinopsis vitrea 115


According to previous observations in the northern Aegean Sea, M. leidyi occurs in abundance in some small bays of Limnos Island (Fig. 1). Therefore, before the cruise, an attempt was made to find M. leidyi by diving in several bays of Limnos, but no speci-mens were found except in the enclosed Moudros Bay (Fig. 1, station L5). Sampling of ctenophore mesozooplankton and ichthyoplankton was performed during a cruise on board of the R/V AEGAEO in the northern Aegean Sea during July 17-21, 2001. For the collection of live ctenophores, 13 tows were done in the surface waters of Moudros Bay (station L5, Fig. 1). In addition, specimens of Bolinopsis vitrea were collected in hand-held plastic jars during diving in the eastern coast of Limnos, since their collection by nets was unsuccessful although scattered ctenophores had been spotted by on board watching.

Due to the sensitivity of the position of the Dardanelles plume (BSW) to the atmo-spheric forcing (Zervakis et al. submitted), we used near real-time information to assess the state of the hydrology and hence to select the sampling stations. The ship’s thermo-salinograph and CTD were used for a preliminary mapping of the hydrology (Figs 2, 3).

Based on the position of the front, we selected six stations (C1-C6) in the offshore waters between Limnos island and the Dardanelles for plankton (ctenophores, mesozoo-plankton, ichthyoplankton) sampling; among them four stations (C1-C4) were positioned on a transact crossing the front (Fig. 3). Further, four unsuccessful ctenophore hauls were performed along the northern and eastern coast of Limnos (stations L1-L4). Hauls were performed using a WP-3 net (with 500 µm mesh size) in the 0-20 m layer (or in the 0-5 m layer in the shallow Moudros bay), equipped with a HYDROBIOS fl ow-meter.

Zooplankton samples were collected by vertical hauls of a WP-2 net (with 200 mmmesh size) in the 0-20 m layer. Simultaneously measurements of temperature and salinity were made by a CTD probe “Sea Bird Electronics”. Zooplankton biomass was estimated according to Omori & Ikeda (1984).

Ichthyoplankton hauls were made using a paired 60-cm-diameter Bongo net (300 µm). Hauls were taken obliquely from the depth of 20 m to the surface and at constant ship speed (2.5 Knots), wire angle and retrieval rate. In the laboratory, only samples from the Bongo 300 µm mesh size net were analyzed.

Experiments on metabolism, feeding and reproduction rates were conducted on board. Freshly collected specimens of M. leidyi and Bolinopsis vitrea were acclimated during one hour before the beginning of experiments.

Respiration and excretion rates were estimated on freshly collected animals and mea-surements were repeated after keeping them starved. Each ctenophore was put in a 0.65 l container with filtered water (through a mesh of size 40 mm) for four to five hours at ambient temperature (25-26°C) and salinity (32-33.3); measurements were performed at eight replicates. Respiration rate (Dissolved Oxygen (DO) measurements) was measured immediately after sampling (Rilley, 1975), using the Winkler method (Carit & Carpenter, 1960). Ammonium was measured on board with a Perkin Elmer UV/VIS (Lambda 2S) spectrophotometer, using standard method (Koroleff, 1970).

Feeding rate experiments of M. leidyi were conducted in four aquaria with 10 liters of filtered sea water (over a 40 µm mesh), to which copepods were added (Acartia clausi,

116P


Figure 1. Map over the northeastern Aegean Sea with the sampling stations


Paracalanus parvus, and Clausocalanus sp., mean size 0.6 mm) at concentrations of 2.5 ind. l-1 (two aquaria) and 6.25 ind. l-1 (two aquaria) similar to those found in the field.

Experiments on Bolinopsis vitrea (length 38-104 mm) were conducted at prey con-centrations of 6.25 ind. l-1 (two aquaria) and 12.5 ind. l-1 (three aquaria). The concentra-tion was chosen according to range of the ambient zooplankton abundance. During the fi rst five hours of the experiment, the gut contents were examined under a binocular microscope at hourly intervals. After 24 hours, the water was filtered through a 40 mmmesh size and unconsumed copepods were enumerated, live and dead ones separately. Clearance rates were estimated according to the Omori & Ikeda method (1984).

Figure 2. Surface temperature of the study area, July 2001

Figure 3. Surface salinity of the study area, July 2001


Reproduction rate was estimated for four M. leidyi specimens and for five Bolinopsisspecimens after the feeding experiments. Ctenophores were put in 0.65 l bottles for 12 hours (during night); start temperature in the bottles was 25°C and final 21°C. Next, the water was filtered and the numbers of eggs were counted. Live eggs were placed in “culture cells” for development and hatching. The time of embryonic development was estimated and postembryonic development was observed.

After each experiment, total length and the displacement volume were measured for all ctenophores and their dry weight was determined according to Omori & Ikeda (1984).

4. Results

4.1. ENVIRONMENTAL CONDITIONS: HYDROLOGY

According to Fig. 2, the low salinity BSW (28-32) is moving westward and south-west-ward in the northern Aegean Sea, forming a saline front where it meets the high-salinity (39) water mass coming from the southern Aegean. A thermal front with a similar hori-zontal pattern (west-south-westward) has been also created (Fig. 3) by the warmer BSW and the colder southern Aegean Sea water mass.

4.2. MESOZOOPLANKTON

Total zooplankton abundance in 0-20 m layer varied from 710 ind. m-3 (C4) to 5216 ind. m-3 (C6) to and it was found to decrease from north to south across the front (Table 1; Fig. 4). Biomass distribution did not follow the same pattern, although the high-est value was detected at station C1 (27 mg m-3) and the lowest at station C4 (18 mg m-3).Differences among stations were more important for abundance than for biomass values. This could be attributed to the composition of zooplankton, since the northern stations are characterised by the extreme abundance of onychopod and ctenopod cladocerans when compared to the southernmost station where copepods dominated. Among the cladocerans, the ctenopod Penilia avirostris strongly dominated in the 0-20 m layer at stations C1 and C6 (72% of total zooplankton), whereas its relative abundance was significantly lower at station C4 (13%). At that latter station, copepods represented 42% of total zooplankton and among them Paracalanus parvus, Acartia clausi, Oithona plu-mifera and Oncaea spp. dominated.

4.3. ICHTHYOPLANKTON

The maximum ichthyoplankton abundance was observed at station C1 (1039 eggs and 3039 larvae per 10 m2 respectively) and the minimum at station C4 (1116.2 eggs and 15 larvae per 10 m2 respectively) (Table 2; Fig. 5). Larvae of the small pelagic families Engraulidae and Clupeidae and larvae of the family Gobiidae dominated the ichthyo-plankton, making up ~85% of the total catch. Among them, larvae of Engraulis encrasi-colus represented 65.97% of the total number of collected larvae. They were found at all stations, with the maximum observed at station C1 and the minimum at station C4. Other


taxa were found at much lower percentages. These included Sardinella aurita (15.22%), Gobiidae (4.22%) and Ceratoscopilus maderenis (2.54%). Eggs of E. encrasicolus rep-resented 65.41% of total egg abundance and they were abundant at all stations with the maximum value observed at station C1 and the minimum at station C4.

4.4. GELATINOUS PLANKTON

Three species of ctenophores were found in our samples: 16 specimens of M. leidyi,26 specimens of Bolinopsis vitrea and one specimen of Lampea sp. Individuals of M. leidyi were collected by net hauls in Moudros Bay. Their abundance was low, varying from 0.005 to 0.05 ind. m-2. No M. leidyi specimens were found along the front in the off-shore waters between Limnos Island and the Dardanelles strait. The length of the speci-mens varied from 13 to 34 mm (23.75 ± 7.01 mm mean size). The relationship between the wet weight (displacement volume) and body length of 12 specimens is described by the equation W = 0.0005 L 2.47 (Fig. 6a). The dry weight varied from 0.03 to 0.05 g and was 2.57% of the wet weight (Fig. 6b).

Table 1. Abundance (ind. m-3) of dominant zooplankton species in the 0-20m layer.

Stations

C1 C2 C3 C4 C6

Cladocerans

P. avirostris 3694 2835 886 90 3757

E. tergestina 329 1071 580 106 188

Evadne spinifera 345 106 188 31 337

Copepods

P. parvus 227 94 306 39 173

Centropages typicus 0 8 306 8 0

Acartia clausi 27 43 180 31 16

Oithona plumifera 43 75 173 59 102

Oncaea sp. 24 51 102 39 55

Calocalanus spp. 0 43 31 35 16

T. stylifera 35 31 24 0 31

Others 20 31 102 86 47

Total 5114 4902 3561 710 5216


Figure 4. Fluctuation of mesozooplankton biomass and abundance (0-20 m). 1 to 6 corresponds to stations C1-C6.


Table 2. Abundance (number per 10 m², 0-20 m) of identified larval taxa, collected in the study area

Station

Family Taxon C1 C2 C3 C4 C5 C6

Blennidae Blennidae 3,0 14,4

Bothidae Arnoglossus sp. 8,3 45,6 2,6 3,0 4,8

Carangidae Trachurus mediterraneus 3,0 19,2

Cepolidae Cepola macrophthalma 76,0

Clupeidae Sardinella aurita 282,4 58,3 15,2 223,9 38,3

Engraulidae Engraulis encrasicolus 1005,9 550,0 121,6 746,3 43,1

Gobiidae Gobius sp. 158,8 50,0 76,0 5,3 11,9 28,7

Gonostomatidae Cyclothone braueri 8,3

Labridae Coris julis 45,6 21,1

Symphodus sp. 17,7 15,2

Mugillidae Mugillidae 17,7

Myctophidae Ceratoscopelus maderensis 17,7 8,3 15,2 13,2 3,0 4,8

Hygophum sp. 16,7 2,6

Pomacentridae Chromis chromis 70,6 1

Scombridae Auxis rochei 20,9

Scomber japonicus 17,7 50,0 15,2

Scorpaenidae Scorpaena porcus 9,0

Serranidae Anthias anthias 4,8

Serranus cabrilla 52,9 2,6

Serranus hepatus 8,3 60,8 2,6 23,9

Unknown- Destroyed 52,9 15,2 4,8

Total 1694,1 758,3 501,7 50,2 1035,8 186,7


Figure 5. Total anchovy eggs and larvael abundance (0-20 m). 1 to 6 corresponds to stations C1-C6.


Figure 6. A - Relationship between M. leidyi displacement volume (ml) and total length (mm), B - Relationship between M. leidyi dry weight (mg) and displacement volume (ml)

Individuals of Bolinopsis vitrea were collected at station L4 (Fig. 1). They were much larger than M. leidyi, with a length varying from 19 to 104 mm (58.15 ± 19.28 mm mean size). The relationship between their wet weight (displacement volume) and length is expressed by the equation W = 0.0096 L1.7492. Dry weight was 3.62% of wet weight (Fig. 7 A, B).


Figure 7. A - Relationship between B. vitrea displacement volume (ml) and total length (mm), B - Relationship between B. vitrea dry weight (mg) and displacement volume (ml)

4.5. FEEDING EXPERIMENTS

M. leidyi ingestion rate was 0.25-0.67 copepods per ctenophore h-1 in aquaria with a concentration of 2.5 ind. l-1 and 1.37-1.58 copepods per ctenophore h-1 in aquaria with a concentration of 6.25 ind. l-1. The duration of digestion was about six hours, but during this period M. leidyi continued feeding. Average clearance rate was 1.51 ± 0.29 l. ind-1 h-1

in aquaria with prey concentration 6.25 prey per liter and 1.05 ± 0.33 l. ind-1 h-1 in aquaria with 2.5 prey per liter (Fig. 8), or 25.2 and 36.54 liters cleared ctenophore-1 d-1, respec-tively (Table 6). The estimated daily ration was 0.39 ± 0.26% WW or 1.15 ± 0.77% DW.


Bolinopsis vitrea ingested 2-3 copepods ind-1 h-1. In general, clearance rate increased with ctenophore size average clearance rate was 0.43 ± 0.04 l. ind-1. h-1 in aquaria with a prey concentration of 6.25 prey per liter and 0.21 ± 0.051 in aquaria with prey concentra-tion 12.5 prey per liter (Fig. 8), or 0.6 l. g-1 DW h-1. Daily ration was 0.03 ± 0.02% WW or 0.07 ± 0.04% DW.

Figure 8. Clearance rate of M. leidyi and Bolinopsis vitrea (l ind-1 h-1) in relation to their length (mm). 1 - Mnemiopsis, food concentration 2.5 ind. l-1, 2 - Mnemiopsis, food concentration 6.25 ind. l-1, 3 - Bolinopsis, food concentration 6.25 ind. l-1,4 - Bolinopsis, food concentration 12.5 ind. l-1

4.6. REPRODUCTION RATE

In our experiments, the smallest specimen of M. leidyi (17 mm) did not reproduce at all. Daily fecundity of specimen with the length 27 mm was very low, 24 eggs per day. Specimens with a length of 32 and 34 mm produced 448 and 440 eggs per day, respec-tively. Thus, fecundity seems to increase with increasing body length (Fig. 9). The size of eggs was 0.3-0.42 mm whereas the size of embryos was 0.18-0.2 mm.

All spawned eggs were put in 5 l aquaria with filtered water at 25°C for development. After 7 hours, most eggs were at the stage of a multicellular blastula and few eggs (1%) were with embryos inside the eggs. After 24 hours, 82% of eggs were hatched, 9% were with embryos and 1% were in the blastula stage; after 25 hours, 93% were hatched, 5% with embryos and 2% at the morula stage After 29 hours, only one egg (0.1%) was not hatched, 908 eggs (99.6%) were hatched, three were dead. Thus, mortality amounted to only 0.3%.

Bolinopsis vitrea fecundity ranged from 12 to 96 eggs ind-1 d-1. Eggs (with a diameter of 0.3-0.5 mm) showed a slightly larger size than those of M. leidyi. The first appearance of cilia was recorded in the embryo at 2 mm length; larvae reached the cydippid stage at a length of about 3 mm

4.7. METABOLIC RATE

During the experiment, the oxygen concentration in the containers declined to 0.5-6.3% from the initial level for M. leidyi, and to 2.6-12.8% for Bolinopsis vitrea.


Figure 9. Fecundity of M. leidyi in relation to the length of individuals (mm)

The average respiration rate of M. leidyi individuals (17-34 mm, 25.3 ± 6.63 mm) was 38.5 ± 10.8 µg at g-1 DW h-1 or 1.6 ± 1.0 µg at ind-1 h-1. Average respiration rate for Bolinopsis vitrea specimens (sized 49-73 mm, 60.57 ± 8.81 mm) was 16.2 ± 9.72 µg at g-1 DW h-1 or 6.0 ± 2.0 µg at ind-1 h-1.

The excretion rate of M. leidyi was 3.09 ± 1.68 µg at g-1 DW h-1, while it amounted to 1.897 ± 0.88 µg at g-1 DW h-1 in Bolinopsis vitrea.

5. Discussion

The occurrence of M. leidyi in the northern Aegean Sea has been attributed to a transfer from the Black Sea by the surface current through the Dardanelles (Shiganova et al., 2001a). In this view, it was the continuous inflow of Black Sea water to the northern Aegean Sea and the dominant local circulation pattern that resulted in the dispersal of M. leidyi individuals to this area.

M. leidyi’s presence in Saronikos Gulf (Central Aegean, Table 3), in contrast, should be attributed to a possible introduction with ballast waters (e.g. released in the zone of the harbour of Piraeus).

The occurrence of M. leidyi in the Aegean Sea is summarized in Table 3. During 1991-98 its abundance in offshore waters was low. However, dense swarms were observed during summer in several small bays, especially around Limnos Island (northeastern Aegean, close to Dardanelles strait). Probably, these swarms were temporarily trapped here due to the wind-driven circulation, combined with the general circulation pattern in the area. After 1998, the occurrence of M. leidyi in the northern Aegean was rare.

During our survey, M. leidyi was not seen again in the coastal areas of Limnos Island, with the exception of the single semi-enclosed Moudros Bay. The observed absence in


coastal areas around Limnos, as well as in the frontal area east of Limnos, could be con-nected with the appearance of a new invader, Beroe cf ovata, which rapidly became the main predator of M. leidyi in the Black Sea. Upon the first bloom of Beroe cf ovata in the Black Sea in 1999, a steep decline in M. leidyi abundance followed (Shiganova et al., 2000). In the Black Sea, the seasonal development of B. cf ovata starts in the middle or in late August and lasts until late November (Shiganova et al., 2001c). During winter, spring and early summer of 1999-2001, a very low abundance of M. leidyi occurred in the Black Sea whereas the highest abundance of M. leidyi was detected in August just before the appearance of B. cf ovata (Shiganova et al., 2000). Based on the above-men-tioned changes in the Black Sea ecosystem, M. leidyi abundance should be expected to be low in the northern Aegean Sea during our sampling period (July), if M. leidyi is indeed transferred here from the Black Sea. The absence of M. leidyi in our samples from both the frontal area and from Limnos coastal area could reflect that expectation. Its presence in the enclosed Moudros Bay could therefore suggest an entrapped population from

Table 3. Occurrence of Mnemiopsis leidyi in the Aegean Sea from 1990 to 2001

(Shiganova et al. 2001a and unpublished data)

Area Year Season Mnemiopsis

Abundance

(ind. m-3)

Mesozooplankton

Abundance

(ind. m-3)

Northeastern Aegean

(offshore waters)

1998 June 0.3-0.5 2220-2880

Northeastern Aegean

(offshore waters close to

Dardanelles)

1998 September 0.5 3680-10940

Northeastern Aegean

(enclosed bay in SW Lesvos Island)

1995, 1996 May, December 0.3-0.1 1000

Northeastern Aegean

(nearshore around Limnos island)

1996-2000 July Dense swarms

(10-20)

No data

Central-Northern-Northeastern

Aegean

(coastal areas)

1991-1996 Summer Swarms No data

Central-western Aegean

(Saronikos Gulf)

1990 Spring, Winter 1-2 450-1120


(Saronikos Gulf)

1991-1996 Spring 0.04 300-5000


(shallow embayment in Saronikos

Gulf)

1998 January Up to 8 2450


previous years, which found favourable conditions here for survival and reproduction. But even in this area, its abundance (max 0.05 ind. m-2) was very low, especially when compared to the abundance found during previous years in the northern Aegean Sea (1.5 to 3 ind. m-2, Shiganova et al., 2001a).

During the present study, the mean length of M. leidyi was 23.75 mm, much smaller than that observed in the Black Sea population in early July (mean 60.6 mm). Similarly, the maximum length of specimens collected in the present study (34 mm) as well as in Saronikos Gulf during previous years (65 mm), was much smaller than that of specimens in the Black Sea, which reached 137 mm in the July cruise, with one individual even 180 mm long (Shiganova et al., 2001b). Among the factors that could account for the smaller size are the lower zooplankton abundance in the Aegean is salinity, which is distinctly higher than in the Black Sea.

Average dry weight of M. leidyi was higher in the Aegean Sea, (estimated from M. leidyi individuals caught at salinity 33‰) than in the Black Sea, but lower than in the Narragansett Bay, where salinity was higher (Table 4). This is connected with higher salt contents in dried matter of ctenophores in the Aegean Sea and in Narragansett Bay. The level of metabolism — respiration (oxygen consumption) and nitrogen excretion and their atomic ratio were slightly (Table 5) higher in M. leidyi in the Aegean Sea than in the Black Sea and Narragansett Bay. Probably, a higher level of metabolism (respiration and excretion) may explain the smaller size of the M. leidyi of the Aegean Sea. In our experiments, smaller individuals had a higher oxygen consumption, with the smallest individual having the highest value of all. If we exclude it, the oxygen consumption for all other individuals was on average at 21.43 µg-at O

2per gram DW per hour. The atomic

ratio for M. leidyi from the Aegean Sea (12.46) was in the range (10-16), similar to that of the epipelagic ctenophores studied by Kremer et al. (1986).

Table 4. Biometric conversions for Mnemiopsis leidyi in different areas

Area Salinity wet weight, g

live volume, ml

dry weight, g Source

Narragansett Bay 31 WW = 0.009L1.872 DW = 0.034WW Kremer & Nixon (1976)

Chesapeake Bay 6-12 DW = 0.0095WW

- 0.0014

Nemazie et al. (1993)

Black Sea 18 WW = 2.36L 2.35 Vinogradov et al. (1989)

Black Sea 18 WW = 0.79 L 2.51 Pavlova & Minkina (1993)

Black Sea 18 WW = 0.0061L1.81,

R = 0.95

DW = 0.02 WW Shiganova (2000d)

Black Sea 18 DW = 0.022WW Finenko & Romanova, 2000

Aegean Sea 33 WW = 0.0005L2.4721,

R2 = 0.89

DW = 0.0258V,

R2 = 0.90

Present study

Distribution, biology and com

parison with B

olinopsis vitrea 129

Table 5. Metabolic rates of Mnemiopsis leidyi : excretion in µg-at NH4g DW-1 h-1 and respiration in µg-at O

2g DW-1 h-1

Area Temperature Salinity Length, mm Wet weight, g Oxygen

µg-at O2/g DW/h

Ammonium

µg-at NH4g-1 DW-1 h-1

Atomic ratio

O2: NH

4

Narragansett Bay (Kremer,1977) 24.5 31 0.4 - 38 20.37 1.48 13,76

Black Sea (Shiganova, unpublished) 26 18 56-96 9-32 28.7 1.73 16.59

Aegean Sea (present study) 25 33 17-34 0.5-3.0 38.5±10.8 3.09±1.68 12.46

Table 6. Clearance rates (liters cleared ctenophore-1 d-1) by Mnemiopsis approximately 50 mm in length (~14 ml volume and 14 g WW).Clearance rates were calculated from data in the sources. (mean ctenophore volume = 41 ml)

Prey type Area Container size Mnemiopsis

Total length, mm

Mnemiopsis

wet weight, g

Salinity Temperature

(oC)

Clearance

Rates

Source

Acartia copepods 4 l 22-24 32.2 Quaglietta (1987)

Acartia copepods Narragansett Bay 20 l 50 3.6-17.6 25-32 20-25 16.8 Kremer (1979)

Acartia copepods Chesapeake Bay 1 m3 50 14 5-16 25 46.0 Purcell (Purcell et al., 2001)

Acartia copepods Florida 68 m3 50 14 14-45 27-31 52.8 Walter (1976)

Acartia copepods East coast of Florida Field 50

(30-60)

14 14 27-31 21.6 Larson (1987)

Acartia copepods Black Sea 10l 56-96 9-32 17 26-27 42.5 Shiganova (unpublished)

Acartia copepods Aegean Sea 10l 17-34 0.5-3.0 32 24-25 25.2-36.5


Table 7. Metabolic rates of Bolinopsis vitrea: excretion in µg at NH4

ind-1 h-1 and respiration in ml O2

ind-1h-1

Area Temperature Salinity DW, g Oxygen

ml O2 ind-1h-1

Ammonium

µg-at NH4ind-1 h-1

Kremer,

et al., 1986

Bahamas 25 36 0.127L2.17 0.0243DW0.64 0.17DW0.76

Our study Aegean Sea 25 33 0.1L2.02 0.0394DW-0.7035 0.5197DW0.4462

M. leidyi clearance rate was also comparable with clearance rates measured in other areas. Its fecundity in the Aegean Sea (400-448 eggs per day) was much lower than that in the Black Sea (average 2000-3000) (Zaika & Revkov, 1994; Shiganova, unpublished), a fact that could reflect low ambient food concentration. It is indeed characteristic for ctenophores to reduce fecundity in conditions of low prey availability (Shiganova et al., in press).

Bolinopsis vitrea is indigenous to the Mediterranean but it is not particularly abundant here (Fedele, 1940), although other species of Bolinopsis can sometimes reach huge den-sities in other areas. Bolinopsis infundibulum, for example, occurs abundantly in arctic and subarctic waters, like in the White and Barentz Seas (Kamshilov, 1960; Seravin, 1998), and in fjords of northern Norway (Falkenhaug, 1996). Bolinopsis mikado (Moser), the commonest species of Japanese waters, sometimes occurs in such numbers during late summer that fishermen are compelled to give up using their nets, as the mesh gets choked with ctenophores (Uye & Kasuya, 2000)

Bolinopsis vitrea and M. leidyi have a similar size range and general body shape, but B.vitrea lobes are relatively shorter and they originate about halfway between the mouth and the infundibulum (Mayer, 1912). The estimated relationship in the present study between total length with lobes and wet weight for both species showed that Bolinopsisis heavier than M. leidyi of equivalent length. Similarly, dry weight is higher for Bolinopsis than for M. leidyi. A similar result was obtained with Mnemiopsis mccradyiand Bolinopsis vitrea in Florida-Bahama waters (Kremer et al., 1989).

Our experiments indicate that Bolinopsis vitrea has a lower metabolic and ingestion rate than M. leidyi of comparable length. This could suggest that Bolinopsis is better adapted to oligotrophic Mediterranean waters (Kremer, 1986a) although Bolinopsisblooms have not been recorded in the Aegean Sea or in the eastern Mediterranean. The reproduction rate of Bolinopsis vitrea was very weak (12-96 eggs d-1), probably due to the low ambient prey availability.

5.1. MESOZOOPLANKTON

In the study area, zooplankton abundance increased sixfold across the haline front (C1-C4), with the highest value in the less saline waters (station C1). Differences among


stations were less pronounced concerning biomass, which increased only 1.3-fold at the sites influenced by the Black Sea. Biomass and abundance values exceeded most of the standing stock data recorded for the Mediterranean Sea (Estrada et al., 1985, Mazzochi et al., 1997), except in some regions under upwelling (Estrada et al., 1985, Gaudy, 1985) or in frontal areas (e.g. the Almeria-Oran front: Youssara & Gaudy, 2001). The north-eastern Aegean is characterised by higher zooplankton abundance than the northwestern and southern Aegean (Siokou et al., 1999). The values observed during this study are similar to those found during previous studies in warm seasons in the area either with ctenophores present (see Tables 1, 3), or absent (Siokou et al., 1990, 1999).

The mesozooplankton, mainly in the less saline waters, was dominated by the cladocerans Penilia avirostris, Evadne tergestina and E. spinifera and the copepods Paracalanus parvus, Acartia clausi, Clausocalanus spp, Oithona plumifera and Oncaeaspp. These species were also abundant in the area before the appearance of M. leidyi in the northern Aegean Sea (Siokou et al., 1990) as well as in September 1998 (Zervoudaki et al., in prep.), when M. leidyi was already present (Table 3).

The invasion of M. leidyi to the northern Aegean did not elicit any effect on behalf of the zooplankton communities (Shiganova et al., 2001). Nor do our results suggest a ctenophore impact on mesozooplankton abundance, biomass and community compo-sition. If we compare zooplankton abundance before the M. leidyi invasion, this was much higher in most areas of the Black Sea than in the Aegean Sea (Siokou et al., in prep.), which was precisely what provoked the huge M. leidyi outbreak in the Black Sea. As a result, after the great increase of M. leidyi, the zooplankton abundance and species composition in the Black Sea collapsed (Vinogradov et al., 1992; Shiganova et al., 1998). Thus, low abundance of zooplankton in most areas of the Aegean Sea could act as a limiting factor for M. leidyi development. Because of this low abundance, M. leidyi should not have a detectable effect on the zooplankton of the Aegean Sea. According to our estimations, a population as small as that present cannot graze more than 0.08% of copepod abundance daily, which is negligible.

5.2. ICHTHYOPLANKTON

Among the potential predators of the ichthyoplankton the gelatinous zooplankton, which may feed selectively on fish eggs and larvae, is prominent (Moller, 1980, 1984; Alvarino, 1985; Purcell, 1985; Purcell, 1990; Fancett & Jenkins, 1989). M. leidyi is considered a “keystone predator”, and has the potential to be a major ichthyoplankton feeder (Monteleone & Duguay, 1988). In the Black Sea, M. leidyi competes with anchovy for zooplankton food, but it also preys on anchovy eggs and larvae (Sergeeva et al., 1990; Shiganova & Bulgakova, 2000). Predation by M. leidyi on anchovy eggs and larvae in American estuaries (Cowan & Houde, 1993; Purcell et al., 1994) and on anchovy eggs and larvae in the Black Sea (Niermann et al., 1994, Shiganova, 1997) are a major source of ichthyoplankton mortality. The sharp decline in fish catches of all the countries around the Black Sea since 1989 (Kideys, 1994) coincided with a mass development of M. leidyi(Niermann et al., 1994; Shiganova, 1997). In the North-East Black and Azov Sea areas (both belonging to the former USSR), anchovy catches almost disappeared since the early 1990s (Shiganova & Bulgakova, 2000).


The abundance of anchovy eggs and larvae in the study area was very high, with values close to those mentioned by Somarakis (1999) and Cargitsou et al. (2001) for the Thracian Sea (North Aegean). It seems therefore that there is no measurable impact of M. leidyi and Bolinopsis vitrea on the abundance of anchovy ichthyoplankton in the northern Aegean Sea.

Thus, our experimental data show that conditions of the Aegean Sea can be well toler-ated by M. leidyi. It can live, feed at a high intensity, and reproduce here. Its eggs develop well, and the percent survival and development of eggs are extremely high (99.7%), but it has a smaller size than in the Black Sea, close to the size of individuals recorded in the Sea of Azov and in the Caspian Sea. Probably this is connected with a suboptimal salinity in the latter places, while in the case of the Aegean Sea, conversely, local salinity may be too high.

Experimental and field observations bring us to the conclusion that the distribution of both B. vitrea and M. leidyi is regulated to a major degree by prey availability and that the abundance of both species is correlated with the biological productivity of its habitat. In the mostly oligotrophic waters of the Aegean Sea, particularly open waters with low zooplankton density, the development of these carnivorous species is severely limited, and hence, their impact on the biota is virtually nil.

6. Acknowledgement

The authors appreciated the kind help of L. N. Seravin and R. Harbison in identifi cation of the representative of the genus Bolinopsis. The paper includes results of a bilateral scientific project between the Shirshov Institute of Oceanology and NCMR. In addition, Russian investigations were supported by RFBI 00-05-82847.

References

Alvarino, A., 1985. Predation in the plankton realm: mainly with reference to fish larvae. Investigaciones

Marinas Centro Interdisciplinario de Ciencas Marinas 2: 1-122.

Carritt, D.E. & J. H. Carpenter, 1960. Comparison and evaluation of currently employed modifications of the

Winkler method for determining dissolved oxygen in seawater. Journal of Marine Research 24: 286-318.

Cowan, J. H. & E. D. Houde, 1993. The relative predation potentials of Scyphomedusae, ctenophores, and

planktivorous fish on ichthyoplankton in Chesapeake Bay. Marine Ecology Progress Series 95: 55-65

Estrada, M, F. Vives & M. Alcaraz, 1984. Life and the productivity of the open sea. In R. Margalef (ed),

Western Mediterranean. Pergamon Press, pp. 148-197

Falkenhaug T., 1996. Distribution and seasonal patterns of ctenophores in Malangen, northern Norway. Marine

Ecology Progress Series140: 59-70

Fancett, M. S. & G. P. Jenkins, 1988. Predatory impact of Scyphomedusae on ichthyoplankton and other zoo-

plankton in Port Phillip Bay. Journal of experimental Marine Biology and Ecology 116: 63-77.

Finenko G. A. & Z.A Romanova 2000. Population dynamics and energetics of ctenophore M. leidyi in the

Sevastopol Bay. Oceanology 40: 677-685. Translated from Oceanologiya, 40: 720-728.

Gaudy R., 1985. Features and peculiarities of zooplanlton communities from the Western Mediterranean. In


M. Moraitou-Apostolopoulou & V Kiortsis (eds), Mediterranean marine ecosystems, pp. 279-301

Kamshilov, M. M., 1960. Feeding of ctenophore Beroe cucumis Fabr. Doklady Academia Nauk S.S.S.R. 130:

1138-1140 (In Russian).

Kıdeys, A. E., 1994. Recent dramatic changes in the Black Sea ecosystem: The reason for the sharp decrease

in Turkish anchovy fisheries. Journal of marine Systems 5: 171-181.

Konsulov, A. S. & L. T. Kamburska, 1998. Ecological determination of the new Ctenophora – Beroe ovata inva-

sion in the Black Sea. Oceanology. Proceedings of the Institute of Oceanology of Varna 2: 195-198.

Koroleff, F., 1970. Revised version of “Direct determination of ammonia in natural waters as indophenol

blue”. Int. Con. Explor. Sea C. M. 1969/ C:9 ICES information on techniques and methods for sea water

analysis. Interlab. Rep., No 3, 19-22.

Kovalev, A. V., S. Besiktepe, J. Zagorodnyaya & A. Kideys, 1998. Mediterraneanization of the Black Sea

zooplankton is continuing. In L. Ivanov & T. Oguz (eds), Ecosystem Modeling as a Management Tool for

the Black Sea. Kluwer Academic Publishers,

Kremer, P., 1979. Predation by the ctenophore M. leidyi in Narragansett Bay, Rhode Island. Estuaries 2: 97-105.

Kremer, P., 1977 Respiration and Excretion of the ctenophore M. leidyi. Marine Biology 44: 43-50

Kremer, P., 1979. Predation by the ctenophore M. leidyi in Narragansett Bay, Rhode Island. Estuaries 2: 97-105.

Kremer, P. & S. Nixon, 1976. Distribution and abundance of the ctnophore M. leidyi in Narragansett Bay.

Estuarine and Coastal Marine Sciences 4: 627-639.

Kremer, P., M. F. Canino & R. W. Gilmer, 1986 a. Metabolism of epipelagic ctenophores. Marine Biology 90:

403-412.

Kremer, P., M. R. Reeve & M. A. Syms, 1986b. The nutritional ecology of the ctenophore Bolinopsis vitrea: com-

parisons with Mnemiopsis mccradyi from the same region. Journal of Plankton Research 8: 1197-1208

Larson, R. J., 1987. Feeding and functional morphology of the lobate ctenophore M. leidyi mccradyi. Estuarine

and Coastal Shelf Science 27: 495-502.

Mayer A. G, 1912. Ctenophores of the Atlantic coast of North America. Publications of the Carnegie Institute

162: 1-58

Mazzocchi, M.G., Christou E.D., Fragopoulu N. & Siokou-Frangou I., 1997. Mesozooplankton distribution

from Sicily to Cyprus (Eeastern Mediterranean): I. General aspects. Oceanologica Acta 20: 521-535.

Moller, H., 1980. Scyphomedusae as predators and food competitors of larval fish. Meeresforschung 28: 90-100.

Moller, H., 1984. Reduction of a larval herring population by jelllyfish predator. Science 224: 621-622.

Monteleone, D. M. & L. E. Duguay, 1988. Laboratory studies of predation by the ctenophore M. leidyi on the

early stages in the life history of the bay anchovy, Anchoa mitchilli. Journal of Plankton Research 10:

359-372.

Nemazie, D. A., J. E. Purcell & P. M Glibert, 1993. Ammonium excretion by gelatinous zooplankton and their

contribution to the ammonium requirements of microplankton in Chesapeake Bay. Marine Biology 116:

451-458.

Niermann, U., F. Bingel, A. Gorban, A. D. Gordina, A. C. Gugu, A. E. Kideys, A. Konsulov, G. Radu,

A. A. Subbotin & V. E. Zaika, 1994. Distribution of anchovy eggs and larvae (Engraulis engrasicolus

Cuv.) in the Black Sea in 1991-1992. ICES Journal of marine Sciences 51: 395-406.

Omori M. & T. Ikeda, 1984. Methods in marine zooplankton ecology. New York; John Wiley & Sons, 232 pp.

Purcell, J. E., 1985. Predation on fish eggs and larvae by pelagic cnidarians and ctenophores. Bulletin of Marine

Science 37:739-755

Purcell, J. E. & J. J. Grover, 1990. Predation and food limitation as causes of mortality in larval herring at

a spawning ground in British Columbia. Marine Ecology Progress Series 59:55-61.

Purcell, J. E., D. A. Nemazie, S. E. Dorsey, E. D. Houde & J. C. Gamble, 1994b. Predation mortality of bay


anchovy (Anchoa mitchilli) eggs and larvae due to Scyphomedusae and ctenophores in Chesapeake Bay.

Marine Ecology Progress Series 114: 47-58

Purcell J. E., T. A. Shiganova, M. B. Decker & E. D. Houde, 2001. The ctenophore M. leidyi in native and

exotic habitats: U. S. estuaries versus the Black Sea basin. Hydrobiologia 451: 145-176

Quaglietta, C. E., 1987. Predation by M. leidyi on hard clam larvae and other natural zooplankton in Great

South Bay, N.Y. M. Sci. Thesis, Marine Sciences Research Center, State University of New York, Stony

Brook, N.Y., 66 p.

Riley, J. P., 1975. Determination of dissolved gases. In J. P. Riley (ed), Chemical Oceanography, 2d edition,

vol 3, p.253.

Seravin, L. N., 1994. Systematic revision of the genus M. leidyi (Ctenophora, Lobata). Zoologicheskii Zhurnal

73: 9-18 (in Russian).

Seravin, L. N., 1998. Ctenophore (methodic recommendations) Sankt-Peterburg, Omsk. ed A. A. Dobrovolsky:

85 pp. (in Russian).

Sergeeva, N. G., V. E. Zaika & T & V. Mikhailova, 1990. Nutrition of ctenophore M. leidyi mccradyi

(Ctenophora, Lobata) in the Black Sea. Zoologicheskii Zhurnal, Ecologia Morya 35: 18-22 (in Russian).

Shiganova, T. A., 1993. Ctenophore M. leidyi and ichthyoplankton in the Sea of Marmara in October of 1992.


Shiganova, T. A., 1997. M. leidyi abundance in the Black Sea and its impact on the pelagic community. In

E. Ozsoy & A. Mikaelyan (eds),”Sensitivity of North Sea, Baltic Sea and Black Sea to antropogenic and

climatic changes”. Kluwer Academic Publishers, Dordrecht: 117-130.

Shiganova, T. A., 1998. Invasion of the Black Sea by the ctenophore M. leidyi and recent changes in pelagic

community structure. Fisheries Oceanography – GLOBEC Special Issue 7. ed S. Coombs, pp. 305-310

Shiganova, T.A., 2000. A review of study of ctenophore Mnemiopsis leidyi in the Black Sea. In S. P. Volovik

(ed), Ctenophore M. leidyi (A. Agassiz) in the Azov and Black Seas: its biology and consequences of its

intrusion, pp. 33-76



Shiganova, T. A, J. V. Bulgakova, P., Y. Sorokin & Y. F. Lukashev, 2000. Investigation of new invader Beroe

ovata in the Black Sea. Biology Bulletin 27: 247-255.


E. D. Christou, A. Y. Skirta & H. J. Dumont, 2001. Population development of the invader ctenophore

Mnemiopsis leidyi in the Black Sea and other seas of the Mediterranean basin. Marine Biology139: 431-445.

Shiganova, T. A., A. Kamakin, D. P. Zhukova, V. B. Ushivtzhev, A. B. Dulimov & E. I. Musaeva, 2001b.

New invader in the Caspian Sea - ctenophore Mnemiopsis and its initial effect on the pelagic ecosystem.


Shiganova, T. A., Y. V. Bulgakova, S. P. Volovik, Z. A. Mirzoyan & S. I. Dudkin, 2001c. The new invader Beroe

ovata Esch and its effect on the ecosystem in the northeastern Black Sea. Hydrobiologia 451: 187-197

Shiganova, T.A., Y. V. Bulgakova, E. I. Musaeva, Z. A. Mirzoyan & M. L. Martynyuk, 2003. Ctenophore invad-

ers MNEMIOPSIS LEIDYI (A.AGASSIZ) and BEROE OVATA MAYER 1912 and their effect on pelagic

ecosystem of northeastern Black Sea. Biological Bulletin N3.

Siokou-Frangou, I., M. A. Pancucci-Papadopoulou & P. Kouyoufas, 1990. Etude de la repartition du zoo-

plancton dans les Mers Egee et Ionienne. Rapports de la Commission Internationale pour la Mer

Méditerranéene 32: 221

Siokou-Frangou, I, S. Zervoudaki & E. D. Christou, 1999. Mesozooplankton composition and biomass in the

Aegean Sea. MATER Wp 4 Final Report


Siokou-Frangou, I., T. Shiganova, E. Christou, A. Gubanova, L. Kamburska, A. Konsulov, E. Musaeva,

V. Skryabin & V. L. Khoroshilov. Mesozooplankton communities in the Aegean and Blac Seas: a com-

parative study. (In press).

Studenikina, E. I., S. P. Volovik, I. A. Miryozan & G. I. Luts, 1991. The ctenophore M. leidyi in the Sea of

Azov. Oceanology 3: 722-725.

Uye S. & T. Kasuya. 2000 Functional roles of the lobate ctenophore Bolinopsis Mikado in the marine coastal

ecosystem of the Japan. International Conference on Jellyfish blooms. Gulf Shores, Alabama: 65.

Vinogradov, M. E., E. A. Shushkina, E. I. Musaeva & P. Y. Sorokin, 1989. Ctenophore M. leidyi (A. Agassiz)

(Ctenophora: Lobata) - new settler in the Black Sea. Oceanology 29: 293-298.

Vinogradov, M. E., V. V Sapozhnikov & E. A. Shushkina 1992. The Black Sea ecosystem. Moscow. Russia.

Nauka, 112 p. (in Russian).

Volovik, S. P., I. A. Mirzoyan & G. S. Volovik, 1993. M. leidyi: biology, population dynamics, impact to the

ecosystem and fisheries. ICES (Biol. Oceanogr. Committee) 69: 1-11.

Youssara F. & R. Gaudy, 2001. Variations of zooplankton in the frontal area of the Alboran sea (Mediterranean

Sea) in winter 1997. Oceanologica Acta 24: 361-376

Walter, M. A., 1976. Quantitative observations on the nutritional ecology of ctenophores with special reference

to M. leidyi mccradyi. M. Sci. Thesis, University of Miami.

Zaika V. E. & N. K. Revkov, 1994. Gonads anatomy and reproduction of ctenophore Mnemiopsis sp. In the

Black Sea. Zoologicheskii Zhurnal 73: 5-9.

Zervakis, V. & D. Georgopoulos, 2002. Hydrology and circulation in the Northern Aegean Sea throughout 1997

and 1998. Mediterranean Marine Science 3: 5-19

Chapter 5

Effects of Beroe cf ovata on gelatinous and other zooplankton along the Bulgarian Black Sea Coast

LYUDMILLA KAMBURSKAInstitute of Oceanology, BAS, P.O. Box 152, Varna, 9000, Bulgaria

Keywords: Mnemiopsis, Beroe, Black Sea, Bulgarian coast, predator-prey relationship

This paper focuses on the summer dynamics of two jelly-plankton species, Mnemiopsisleidyi and Aurelia aurita, and on the crustacean mesozooplankton after the invasion of the Black Sea by the ctenophore Beroe cf ovata. We found signifi cant fluctuations in temporal and spatial distribution of both components. During the period 1998-2001, the maximum abundance of B. cf ovata was 13 ind. m-3. Mnemiopsis was in a range between 2-112 ind. m-3, but did not occur at all in 1999. Aurelia was generally present in low numbers, between 1-5 ind. m-3. In September 2000, and August 2001, Beroe was not found in the area, which prompted a relatively high Mnemiopsis abundance, but lower than in the period preceding the Beroe invasion (1994-1996). The average number and biomass of mesozooplankton in the coastal region varied widely, from 1420 ind. m-3 to 19,990 ind. m-3, and from 33 mg m-3 to 227 mg m-3. Offshore, both variables fl uctuated between 1535–5680 ind. m-3, and between 40 - 132 mg m-3. The lowest mesozooplank-ton data inshore were recorded in 1998 and 2000. Maximum mesozooplankton stock (44850 ind. m-3) was recorded in summer 1999. As regards mesozooplankton taxonomic composition, the highest species number off Cape Galata (23 species) was recorded in 1999, with the occurrence of copepod species such as Centropages kroyeri, Pontella mediterranea and Anomalocera patersoni. The lowest species number occurred in sum-mer 1998. Despite a relatively low average zooplankton abundance and biomass in sum-mer 2000 and 2001, the number of copepod species in the zooplankton was as high as in 1999. A PCA analysis indicated that temperature and both ctenophores contribute to the discrimination between years. With respect to Mnemiopsis density, the years 1998, 2000, 2001 are classified as “normal” and 1999 as “poor”. In spite of great inter-annual variability, Mnemiopsis remains a key factor, with the highest load and contribution to mesozooplankton fluctuations, especially in summer. Our results characterize the post-invasion period, 1998-2001, as transitional, with zooplankton performance still adjusting to the ctenophore prey-predator couple.

137




1. Introduction

The Black Sea is widely considered to be one of the most environmentally degraded enclosed seas (Mee, 1992; Zaitzev, 1992). Some of the key factors of “highest concern” in contributing to Black Sea deterioration are overexploitation of its living resources, eutrophication, and the introduction of non-indigenous gelatinous species (Stanners & Boudreau, 1995; Zaitzev & Mamaev, 1997). The hazardous effects (environmental and socio-economic) by such aliens on Black Sea health suggest that ignoring problems caused by ballast water introductions is analogous to playing ecological roulette (Moncheva & Kamburska, 2002). An already classical example of undesirable effects on the ecosystem is the invasion of the ctenophore Mnemiopsis leidyi to the Black and Azov Seas in the early 1980s (Vinogradov et al., 1989). Introduced by ballast waters from the Northern Atlantic coast, M. leidyi became an “ecological engineer” species (Carpenter & Cottingham, 1997), whose impact on the Black Sea in the early 1990s was superimposed on the effects of eutrophication, overfishing, environmental deterioration, and possibly climatic signals (Kideys, 1994; Moncheva et al., 2000; Niermann et al., 1999; Prodanov et al., 2001; Zaitzev & Mamaev, 1997). Obviously, this species, with all the characteristics of a successful alien, has all “the right stuff” to produce harmful blooms (Kremer, 2001). Recently, Mnemiopsis has conquered the Caspian Sea and detrimental effects on mesozooplankton communities have followed promptly (Kideys & Moghim, 2003; Shiganova et al., 2001b).

Black Sea ecosystem evolution has been subdivided in different phases, depending on the critical anthropogenic impact (e.g. eutrophication, biological invasions, overfi shing). Based on the “gelatinous species concept”, the following classification has been proposed: 1) a pristine period, during which Rhizostoma pulmo prevailed (1960-70s); 2) a period of Aurelia aurita expansion (1970-80s); 3) a period recognised as the “Mnemiopsis era” (late 1980s-90s) (Oguz et al., 2000); 4) the period after 1997, when a ctenophore new for the Black Sea ecosystem, Beroe cf ovata, was first reported (Konsulov & Kamburska, 1998a). Morphological (Harbison, personal communication) and molecular (Bayha et al., this volume) evidence indicates that Black Sea Beroe ovata belongs to a species that is different from Mediterranean Beroe ovata sensu Chun. Most likely, this newcomer, B. ovata sensu Mayer, 1912 (Seravin et al., 2002), was again imported from the estuaries of the Northern Atlantic with ballast water. Tolerant to lower salinity than the Mediterranean species, this ctenophore is known as an extremely specialized and specific predator of M. leidyi (Nelson, 1925; Swanberg, 1970). We here refer to it as Beroe cf ovata (for a further justification, based on a molecular analysis, see Bayha et al., this volume).

Recently, signs of a relative recovery of Black Sea zooplankton diversity and dynamics have been reported, which can be interpreted as the result of the predation of Beroe on Mnemiopsis (Finenko et al., 2000; Kideys, 2002; Shiganova et al., 2001), but should not ignore the possible role of large-scale weather patterns on the pelagic Black Sea ecosystem too (Moncheva et al., 2000; Niermann et al., 1999). The uncertainties linked to the “successfully” interacting M. leidyi - B. cf ovata couple raise many questions for future Black Sea ecosystem scenarios (GESAMP, 1997; Kamburska et al., 2002). A return and flourishing of the medusa Aurelia aurita, a competitor of M. leidyi, is to

Effects of Beroe cf ovata on gelatinous and other zooplankton 139

be expected based on the competitive release of the latter (Fraser, 1962). A coexistence of the three gelatinous species in the gelatinous branch of the pelagic food web may become established as well (Swanberg, 1970) and further complicate the ecology of the jelly-plankton in Black Sea (Kideys, 1994).

In the present paper, we consider the initial post-invasion impact of Beroe cf ovataon Mnemiopsis leidyi, on the native medusa Aurelia aurita, and on the crustacean meso-zooplankton. In order to do this, the population dynamics of A. aurita, M. leidyi and B. cf ovata were studied in conjunction with summer mesozooplankton dynamics off the Bulgarian Black Sea coast from 1998 to 2001.

2. Approach

2.1. STUDY AREA

Our investigations were carried out during cruises of the IO-BAS with N/V “Adm. Br. Ormanov” and R/V “Akademik” in the western Black Sea off Cape Galata (transect Galata) in September 1998, 1999, 2000 and August, 2001. The region is adjacent to the highly eutrophied area-Varna Bay-Varna Lake. The data were collected at 8 stations, 4 of them inshore (< 40 m depth) and 4 offshore (> 40 m). The station grid and depths are given in Fig. 1, and in Tables 1, 2.

2.2. METHODS

Zooplankton samples were collected with a vertical plankton Juday-type net (36 cm diameter and 150 µm mesh size). At the stations offshore, only data for the layer above the thermocline (the upper 20-35 m) were used (Table 2). The gelatinous zooplankton was sorted and measured on board. Samples were fixed to 4% formalin. Individual standard weights were used for calculation the biomass (Petipa, 1959).

The following factors were considered:1) A. aurita, M. leidyi and B. cf ovata: numerical abundance, size structure, ratios of occurrence, distribution in time and space2) Mesozooplankton: individual number, biomass, species number3) Long-term dynamics of dominant mesozooplankton groups, of M. leidyi, and of temperature4) A Principal Components Analysis (PCA) was applied to score and narrow down the selected variables (log10-transformed data) to work out the role of gelatinous species on zooplankton dynamics


Table 1. Cruise stations on the transect Galata

Year, Date Number of stations Research Vessel

inshore offshore

1998, 23-26 September 4 4 N/V “Adm.Br.Ormanov”

1999, 20-23 September 4 3 N/V “Adm.Br.Ormanov”

2000, 10-13 September 4 4 R/V “Akademik”

2001, 19-23 August 4 2 R/V “Akademik”

Table 2. Thermocline depth at stations along the Galata transect in summer 1998-2001

No station

(depth, m), area

Sept 1998

thermocline depth

[m]

Sept 1999

thermocline depth

[m]

Sept 2000

thermocline depth

[m]

Aug 2001

thermocline depth

[m]

300 (20 m) coastal — — — —

301 (22 m) coastal — — — —

302 (25 m) coastal — — — —

303 (38 m) coastal 25 30 35 35

304 (77 m) offshore 35 28 25 22

305 (97 m) offshore 35 24 20 20

306 (360 m) offshore 32 20

308 (1650 m) offshore 35 20 18


Figure 1. Map of stations off Cape Galata in the summers of 1998 to 2001

3. Results

3.1. GELATINOUS PLANKTON VARIABILITY

We found signifi cant fluctuations in jelly distribution in time and space. Across the period of investigation, Beroe was found only in September 1998 (at 2 coastal stations), and in 1999 (at 2 coastal and 2 offshore station). In total, 20 individuals were caught. Their maximum abundance was 13 per cubic meter. Mnemiopsis was found in a range between 2-112 ind. m-3 and did not occur during 1999. Aurelia was generally present in low num-bers, ranging from 1-5 ind. m-3.

In September 1998, Beroe was found at two inshore stations, while Mnemiopsis was present at all stations. The ctenophore Beroe ovata (with 13 ind. m-3) dominated over Mnemiopsis (with only 7 ind. m-3) at station 300 inshore (Fig. 2), where the predator/ prey ratio was 2:1 in favour of Beroe. At station 301, both ctenophores co-existed, and their ratio was in favour of Mnemiopsis (15:1). M. leidyi was recorded inshore at an average of 42 ind. m-3, with a peak of 112 ind. m-3 at station 303 (depth 40 m, Fig. 4, 2). Mnemiopsis was represented inshore by individuals of less than 30 mm in size (post-larvae and juveniles) (Fig. 3). Their average number rose to 37 ± 11 ind. m-3 offshore, where Beroe was totally absent (Fig. 4). The age structure of Mnemiopsis consisted of 85% of post-larvae and juveniles, which is evidence for an active reproduction phase (Fig. 3). Aurelia was rare, widespread, and did not exceed 2 ind. m-3.

300

301 302 303 304 305 306 308

27.60 27.80 28.00 28.20 28.40 28.60 28.80 29.00 29.20 29.40 29.60

42.00

42.20

42.40

42.60

42.80

43.00

43.20

43.40

43.60

43.80

301 302 303 305 306 308

c.Galata VARNA


In September 1999, the distribution of the jelly species was different from the previous pattern. Although the density of B. cf ovata (1-2 ind. m-3) accompanied by A. aurita (1-4 ind. m-3) was low, both species completely predominated all over the area (Fig. 2, 4). M. leidyi was totally absent from the transect. At the deepest stations, B. cf ovataindividuals were over 7 cm in length.

Figure 2. : Interannual fluctuations at stations along the Galata transect in the summers of the period 1998-2001 (c - coastal area; o - offshore area)

In September 2000, Beroe was absent from all stations surveyed. In contrast, but due to a very high number of larvae (more than 90% of the total), Mnemiopsis average abundance inshore was relatively high (about 68 ± 28 ind. m-3, Fig. 4). The numbers offshore were 11 times lower than those inshore and the share of intermediate stages was higher offshore (Fig. 3). The medusa Aurelia occurred only offshore, at an average abundance of about 1 ind. m-3 (Figs 2, 4).

Similar to the summer situation of 2000, Beroe still was not found in the area in August 2001. The M. leidyi population inshore was composed of 90% of juveniles and it had a mean abundance comparable to that of the previous year (57 ± 27 ind. m-3).On the contrary, it increased about nine times offshore (Figs 2, 4). The maximum number of individuals (96 ind. m-3) was recorded at station 303, as in 1998. The share of juveniles in the age structure was 88-90% in both areas (Fig. 3). Aurelia occurred mainly offshore (Fig. 2), now exceeding its maximum density for the whole investigated period (5 ind. m-3) (Figs 2, 4).

0

2

4

6

8

10

12

14

c98 c98 o98 o98 c99 c99 o99 o99 c00 c00 o00 o00 c01 c01 o01

0

10

20

30

40

50

60

70

80

90

100

110

120

A.aurita B.ovata M.leidyi

B.o

vata

, A.a

urit

a [i

nd.m-3

]M

.leidyi [ind.m-3]

region, year


Figure 3. Mnemiopsis leidyi: Size-structure and total abundance of the population at stations along the Galata transect in the summers of the period 1998-2001(c - coastal area; o - offshore area)

Figure 4. Gelatinous zooplankton: Species composition off Cape Galata(c - coastal area; o - offshore area)

0%

20%

40%

60%

80%

100%

c98 o98 c99 o99 c00 o00 c01 o01

0

20

40

60

80

100

120

< 10mm 10 ÷ 30 mm > 30 mm

[ind.m-3]

0

2

4

6

8

10

12

c1998 o1998 c1999 o1999 c2000 o2000 c2001 o2001region, year

0

10

20

30

40

50

60

70

80

90

100

A.aurita B.ovata M.leidyi

B.o

vata

, A.a

urita

[in

d.m-3

]M

.leidyi [ind.m -3]


3.2. MESOZOOPLANKTON VARIABILITY

The mesozooplankton too exhibited significant inter-annual fluctuations by regions and stations. Generally, its average abundance and biomass were higher at stations inshore. Seen over the whole period of investigation, the lowest mesozooplankton values inshore were recorded in 1998 and 2000. The biomass for both years varied between 22 mg m-3

and 55 mg m-3 and between 28 mg m-3 and 56 mg m-3 respectively (Fig. 5). Zooplankton abundance as well was low, and ranged from 1,620 ind. m-3 to 3,600 ind. m-3 and from 905 ind. m-3 to 2,065 ind. m-3.

Maximum mesozooplankton stock was recorded in summer 1999. During the inves-tigated period, the highest abundance (44,850 ind. m-3) was registered at inshore station 301, while the biomass was 420 mg m-3 (Fig. 5). After critically low values at all stations along the Galata transect in summer 2000, an increasing trend in individual numbers and biomass inshore were apparent in 2001. A maximum of 510 mg m-3 for the period 1998-2001 was recorded at station 300, whereas the mesozooplankton distribution offshore was similar to that in 1998 and in 2000 (Fig. 5).

Figure 5. Interannual fluctuations at stations along the Galata transect in summer of the years 1998-2001 (c - coastal area; o - offshore area)

In the coastal region, the average individual number and biomass varied between wide ranges: from 1,420 ind. m-3 to 19,990 ind. m-3, and from 33 mg m-3 to 227 mg m-3.Offshore, both values fluctuated between 1,535-5,680 ind. m-3, and between 40-132 mg m-3, respectively (Fig. 6). A pronounced increase (by about a factor 8) of zooplankton abundance and biomass was found inshore in 1999, compared to 1998 and 2000. But exceptionally, in summer 2000, mesozooplankton values at one station offshore were in the same range as in the coastal area (Fig. 6), possible related to the very low numerical

0

5000

10000

15000

20000

25000

30000

35000

40000

45000

c98 c98 o98 o98 c99 c99 o99 o99 c00 c00 o00 o00 c01 c01 o01

0

50

100

150

200

250

300

350

400

450

500

abundance [ind.m-3] biomass [mg.m-3]

[ind

.m-3

] [mg.m

-3]

region, year


abundance of Mnemiopsis (Fig. 4). The interannual fluctuations revealed relatively high individual number and biomass inshore in 2001 as well, but this was due to the maximum at one coastal station only. The mesozooplankton distribution offshore (only 1,530 ind. m-3

and 40 mg m-3 on average) might represent a response to an unusually high density of N.scintillans (about 10,000 ind. m-3).

Regarding the taxonomic composition of the mesozooplankton, the highest species richness off Cape Galata (23 species), recorded in 1999, was due to the occurrence of the copepod species Centropages kroyeri, Pontella mediterranea and Anomalocera pat-ersoni. The lowest species number was found in summer 1998 (Table 3). Despite a rela-tively low average abundance and biomass in summer 2000 and 2001 in both areas, the number of copepod species in the zooplankton was now as high as in 1999. The number of cladoceran species, in contrast, remained reduced.

Figure 6. Interannual fluctuations in coastal and offshore areas along the Galata transect in the summers of 1998-2001

The interannual variability in average temperature in the upper 20 meters showed a steadily increasing trend after 1998 (Fig. 7). The maximum value of 24.7 C was recorded in September 2000 and in August 2001, while a minimum of 19.3 C was registered in 1998. The average temperature from 1998 to 1999 increased with 0.4ºC. The temperature in September 2000 was higher, with an abnormal increase of about 2.5ºC (Fig. 7).

0

5000

10000

15000

20000

25000

30000

35000

1998 1999 2000 2001

coastal area offshore area

aver

age

abun

danc

e [i

nd.m

-3]

0

50

100

150

200

250

300

350

400

1998 1999 2000 2001

coastal area offshore area

aver

age

biom

ass

[mg.

m-3

]


Table 3. Species number of major taxonomic mesozooplankton groups in coastal and offshore areas off

Cape Galata in summer 1998-2001

year, area 1998 1999 2000 2001

groups coastal offshore coastal offshore coastal offshore coastal offshore

Copepods 3 4 5 9 8 9 8 8

Cladocera 3 3 4 5 2 2 2 1

Meroplankton 4 4 6 5 5 5 6 5

Others 4 4 5 4 4 6 6 6

Total 14 15 20 23 19 22 22 20

Figure 7. Interannual fluctuation of temperature in the upper 20 meters along the Galata transect in the summers of the period 1998-2001

3.3. STATISTICAL ANALYSIS

The above-discussed variables were scored and narrowed down by PC analysis, which helped us to identify the most relevant combination of factors. The matrix was based on a data array of the following variables: Temperature (T), mesozooplankton abundance (Zoo A), biomass (Zoo B), and numerical abundance of B. cf ovata, A. aurita, and M. leidyi.

1919.5

2020.5

2121.5

2222.5

2323.5

2424.5

25

300 301 302 303 304 305 306 308

Sep 1998 Sep 1999 Sep 2000 Aug 2001

Tem

pera

ture

[ o

C]

station


PCA analysis extracted two components, (PC 1) and (PC 2), to which most ecological significance could be attached. They explained 66.9% of the total variance (Fig. 8). PC1 (a loading of 37.3% in the total variance) correlates positively with mesozooplankton abundance and biomass. PC2 (29.6%) corresponds to a decrease in B. cf ovata abundance and an increase of M. leidyi and temperature, and can be characterized as the ctenophorecomponent.

The PCA plot of the determinant scores shows a clear discrimination along PC2 between Group1 (1999), and Group 2 (1998, 2000, 2001). Group 1 with no M. leidyi,highest B. ovata abundance, contrasts with Group 2 (Fig. 8). Group 2 (1998, 2000, 2001) corresponds to the ctenophore component (high M. leidyi, low B. cf ovata) and an increase in temperature, although the scatter of 1998 is high, due to a relatively low tem-perature and the occurrence of Beroe at the coastal stations. This group can be split in two subgroups, G2a and G2b, with discrimination apparent along the PC1 axis (zooplankton component). G2b is with higher Zoo A, Zoo B, while G2a manifests the opposite trend. Both (G2b, G1) are projected at coordinates corresponding to the highest level of the zooplankton component. The PCA projection of yearly means corresponds to the lowest zooplankton parameters 1998 and 2000, contrasting with 1999 and 2001, which have a high zooplankton component (Fig. 8).

The PC’s scores were plotted to illustrate the distribution of determinants into G2a and G2b. Considering that PC1 discriminates both subgroups, the results reveal that plotted scores into G2a (low zooplankton) refer to 1998 and 80% of the coastal stations in 2000, 2001 (Fig. 9). On the contrary, the G2b (high zooplankton) covers mainly the offshore area in 2000 and 2001.

Figure 8. PCA plot of the scores of selected variables

av 1998

av 1999

av 2000av 2001

-3

-2.5

-2

-1.5

-1

-0.5

0

0.5

1

1.5

2

-3 -2.5 -2 -1.5 -1 -0.5 0 0.5 1 1.5 2

1998 1999 2000 2001 PC

2: T

, M

.leid

yi, -

B.o

vata

PC1: Zoo A, Zoo B

G1

G2b

G2a

G2


Figure 9. Plot of PC’s scores by regions (c - coastal area; o - offshore)

3.4. LONG-TERM DYNAMICS

The long-term summer dynamics of the dominant mesozooplankton groups - copepods and Cladocera [ind. m-3], and M. leidyi [ind. m-3] - and temperature at 3 miles station at the transect Galata revealed large interannual fluctuations (Fig. 10). During the 1990s, the average temperature at the monitoring station increased with almost 2ºC compared to that of the 1980s. Before the invasion of M. leidyi, during the 1980s, the average abundance of both zooplankton groups was lower than in the previous years (1967-1980). Our results revealed a higher abundance of M. leidyi in the mid-1990s, directly causing the decrease in those mesozooplankton groups, and well before the introduction of Beroe.

4. Discussion

The problem considered in the present paper is the initial post-invasion effect of Beroe cf ovata on gelatinous M. leidyi, A. aurita and on mesozooplankton summer dynamics. The recent arrival of Beroe cf ovata, which is a specific predator of Mnemiopsis, raises many questions about future Black Sea ecology and thus is of interest to the scientifi c community.

Because of the strong year-to-year fluctuations of the gelatinous plankton, individual years may be identified as “poor”, “normal” or “rich” (Buecher, 2001). As apparent from the data on Mnemiopsis density, the investigated interval 1998-2001 is divided in the

-3

-2.5

-2

-1.5

-1

-0.5

0

0.5

1

1.5

2

c98

c98

c98

c98

o98

o98

o98

o98

c99

c99

c99

c99

o99

o99

o99

c00

c00

c00

c00

o00

o00

o00

o00

c01

c01

c01

c01

o01

o01

PC1: Zoo A, Zoo B

PC2: T, M.leidyi, -B.ovata


“normal” years 1998, 2000, 2001, because of M. leidyi abundances at a level much lower than the blooming concentrations typical for the late 1980s (Vinogradov & Tumantseva, 1993), while1999 is a “poor” year (the species was absent). This is well supported by the results of PCA analysis, which clearly discriminates between the “poor” 1999 (G1) and the “normal” 1998, 2000, 2001 (G2).

Across the study period, the highest abundance of Mnemiopsis was recorded in 1998. Although its average distribution in 1998, 2000 and 2001 was similar and close to that in summer 1993-1996, when Mnemiopsis has begun increasing again in the Black Sea basin (Konsulov & Kamburska, 1998; Shiganova, 1997), the “normal” 1998 year stands out among the period 1998-2001. Indeed, the lowest zooplankton average abundance and biomass as well as species numbers were recorded in 1998 (Fig. 6, Table 3). Taking into account that Beroe was first detected in the Black Sea in 1997, and a maximum was registered the next year in October-November (Kamburska et al., 2002), it is well possible that the predation pressure on Mnemiopsis was not so efficient in the initial period of Beroe, especially during August-September.

The dominance of B. cf ovata coincided with an increase of mesozooplankton abundance and biomass in the “poor” year 1999 (Fig. 6). A pronounced maximum of mesozooplankton (about 8 times higher) was demonstrated inshore, compared to the previous year. A similar trend was reported for the North-eastern Black Sea, where in September 1999 M. leidyi was recorded at an unusual low density (Shiganova et al., 2001a), although a high abundance would have been expected as a result of a warm winter,

2.5

3.0

3.5

4.0

4.5

5.0

1967 1970 1973 1976 1980 1983 1986 1991 1996 2000

0

0.5

1

1.5

2

2.5

Copepods+Cladocera M.leidyi T [oC]

log M.leidyi [ind.m

-3], T

log

Cop

epod

s+C

lado

cera

[in

d.m

-3]

year

R2=0.458

Figure 10. Long-term summer dynamics of selected variates at 3 miles station in front of Galata


similar to that of 1998 (Purcell et al., 2001). The highest number of mesozooplankton species was also observed in that period (Table 3) with the occurrence of the copepod species Centropages kroyeri, Pontella mediterranea and Anomalocera patersoni, which were rare or absent in the past (Konsulov & Kamburska, 1998). Since copepods are most sensitive to environmental degradation (Cameron & Von Westernhagen, 1996), most likely their diversity manifests a sign of recovery after 1999 possibly a response to reduced Mnemiopsis pressure and the impact of other environmental factors. Moncheva et al. (2000) claimed the period 1997-1999 to be one of a decreasing trend in eutrophication (especially by phosphates and silicates) at higher sea temperatures.

The high temperatures of 1999-2001 (Fig. 7) were favourable to Mnemiopsis, and bloom events were expected. As apparent from the data of August-September 2000-2001, its demographic structure was constituted by more than 90% of juveniles, an indicator of intense reproduction. In spite of this peak and its “physiological advantage” to emerge directly from gametes (Malashev & Archipov, 1992), Mnemiopsis density remained relatively low in the absence of Beroe. This may be a long-lasting effect of the Beroepressure during 1998-99 after the poor 1999 (Mnemiopsis absent). Mnemiopsis prefers copepods and Cladocera as a more energy-rich food (Reeve et al., 1989). Despite the high share of juveniles, whose diet is mainly copepods, a high copepod diversity was recorded (Table 3). It was reported that in Sevastopol Bay, Beroe consumed 2-53% of the M. leidyi biomass in September - October (Finenko et al., 2001). The low M. leidyi in summer 2000, 2001, despite of the absence of its predator, a favourable temperature and food availability, therefore suggest that the control of Beroe on Mnemiopsis in autumn was effi cient.

Aurelia is expected to expand by the coexistence of both ctenophores, but as evident from the results, the medusa continued to occur irregularly at a maximum average abundance of only 5 ind. m-3 in August 2001 (Fig. 4). The distribution of Aurelia is highly patchy and due to its antagonism with Mnemiopsis, with which it competes for food, a spatial segregation between both could be expected (Mutlu, 1999). The significance of the medusa Aurelia is not supported by PCA, but its future expansion remains possible as long the coexistence of both ctenophores lasts. Recently Weisse & Gomoio, 2000, reported that medium-sized Aurelia feed on small Mnemiopsis, providing preliminary evidence that mutual trophic relationships exist among these gelatinous zooplankters and thus the significance of an internal loop among jellies should not be ignored.

Great inter-annual mesozooplankton variability occurred after the invasion of Beroe.The PCA analysis suggests that the exotic couple M. leidyi - B. ovata and its prey - preda-tor interaction especially in summer could explain the shift in mesozooplankton during the last 4 years (Fig. 8). The discrepancy between the years was primarily in respect to Mnemiopsis occurrence. In respect to the ctenophore component extracted by the analysis, (PC2) which correlates to high temperature, M. leidyi, decreasing of B. ovataabundance, a clear discrimination between “poor” 1999 and “normal” 1998, 2000, 2001 was demonstrated.

Faced with predation, Mnemiopsis was reduced during the last two “normal” years and mesozooplankton increased to above the level of the “normal” year 1998 (Fig. 6, Table 3). PCA results suggest an instability of this tendency, by splitting 2000 and 2001 along PC1 (zooplankton component) in two subgroups. G2a corresponds to low


zooplankton and is constituted by 88% of the coastal stations in 2000 and 2001 together with 1998. In (G2b), conversely, along with a high zooplankton component, we fi nd the offshore stations (Fig. 9). The reasons for this could be: 1) there is less Mnemiopsispresent offshore than inshore; 2) the mesozooplankton community inshore is more vulnerable to Mnemiopsis grazing in summer due to a time-lag in Beroe occurrence and reproduction phase in the coastal area (Finenko et al., 2000; Kamburska et al., 2002; Vinogradov et al., 2001); 3) the highest temperatures could contribute to a decrease in zooplankton. As suggested by Gordina et al., 2002, the unusually warm summer of 1998 might be a primary cause of the considerable increase in zooplankton mortality in Sevastopol Bay.

A negative impact of Mnemiopsis on its prey, even with the ctenophore present at low abundances only, should not be excluded, even as predation limits its own numbers. It remains a key factor, with the highest load and contribution to mesozooplankton growth. Still the long-term dynamics of Mnemiopsis density and major zooplankton groups in front of cape Galata provide evidence for a relative recovery of the plankton. During the initial invasion by Beroe in 1998-2001, Mnemiopsis decreased, compared to the period 1994-1996 (Fig. 10). In parallel, copepod and cladoceran abundance during 1998-2001 were higher than in 1995-1997. The same trend was reported from the Ukrainian coast (Finenko et al., 2003). Therefore, it seems likely that, indeed, the coexistence of the two alien ctenophores and their dynamics gave an opportunity to the zooplankton fauna for recovery in a “Mnemiopsis era”.

Since the appearance of Beroe in the Black Sea, the widespread expectation is that it will control the Mnemiopsis stock, reduce the duration of its negative impact and thereby contribute to a recovery of the Black Sea ecosystem. Are indeed recent mesozooplankton alterations the result of biological control by Beroe? It appears that not all improve-ments reflect a post-invasion effect of Beroe. Since the mid-1990s, signs of recovery of the Black Sea ecosystem, as well as its zooplankton community structure (dynamic mode, diversity) have been reported, despite inter-annual fluctuations of Mnemiopsis(Kamburska et al., 2002; Kideys et al., 2000; Kideys, 2002; Moncheva et al., 2000; Prodanov et al., 2001). The 1990s, furthermore, seem to represent a peculiar environ-mental window of Black Sea ecosystem evolution, controlled by both physical and biotic interactions, a decrease of anthropogenic eutrophication, and some unusual large-scale weather patterns (Moncheva et al., 2000).

The results given above, supported by the PC analysis identify the summer period 1998-2001 as transitional, with zooplankton performance under adjustment to the prey-predator ctenophore couple. It is still difficult to call the recent changes a steady trend of recovery, even if some signs of improvement compared to the previous years are evident. The degree to which the trophic relationship Mnemiopsis - Beroe may shape the future Black Sea ecosystem is a scenario that remains uncertain. Besides, it is worth to note that a high M. leidyi concentration was observed in November 2002 off the Bulgarian coast demonstrating behavioral plasticity of this ctenophore to the occurrence of Beroe. Further investigations, coupling biological and physical interactions are needed, as the mechanisms triggering Mnemiopsis “poor”, “normal” or “rich” years are still unclear, and question the role of Beroe as the sole underlying mechanism of zooplankton recovery.


5. Conclusions

Our study revealed a high inter-annual variability of the mesozooplankton and of Mnemiopsis after the arrival of Beroe ovata. The period 1998-2001 can be considered as transitional, with the zooplankton still vulnerable to Mnemiopsis predation pressure and under adjustment to the new prey-predator couple Beroe-Mnemiopsis. Mnemiopsisdecreased relatively compared to the period before Beroe (1994-1996), which could be attributed to control by B. cf ovata after 1998. Despite this inter-annual variability, the recent features of mesozooplankton performance, viz. species number, numerical abundance and biomass, show signs of recovery. These are widely believed to reflect a reduced top-down control by Mnemiopsis. Still, Mnemiopsis remains a key control on zooplankton growth, especially in summer, as illustrated by our PCA analysis.

6. Acknowledgements

The author thanks Dr T. Shiganova and Prof. H. J. Dumont for their support and encour-agement. The study is based on data produced as apart of the Projects: CESUM-BS Contract ICA1-CT-2000-70031 and NATO-SfP-971818 ODBMS Black Sea.

References

Buecher, E., 2001. Erratic fluctuations in abundance of medusoid and ctenophore populations in two systems,

Ligurian Sea and Benguela ecosystem: some examples. CIESM Workshop Series “Gelatinous zooplankton

outburst: theory and practice”, Naples, Italy, 29 August-1st September n.14, 63-66.

Cameron, P., J. Berg & H. von Westernhagen, 1996. Biological effects monitoring of the North Sea emplying

fish embryological data. Journal of Environmental Monitoring and Assessment 40: 107-124.

Carpenter, S. R. & K. L. Cottingham, 1997. Resilience and restoration of lakes. Conservation Ecology 1, 2.

GESAMP, 1997. Opportunistic settlers and the problem of the ctenophore Mnemiopsis leidyi invasion in the

Black Sea. Reports and studies 58, pp.50.

Gordina, A. D., E. V. Pavlova, E. I. Ovsyany, J. G. Wilson, R. B. Kemp & A. S. Romanov, 2002. Long-term

changes in Sevastopol Bay (the Black Sea) with particular reference to Ichthyoplankton and zooplankton.

Estuarine, Coastal and Shelf Sciences 52: 1-13.

Finenko, G. A., B. E. Anninsky, Z. A. Romanova, G. I. Abolmasova & A. E. Kideys, 2001. Chemical

composition, respiration and feeding rates of the new alien ctenophore, Beroe ovata in the Black Sea.


Finenko, G. E., Z. A. Romanova & G. I. Abolmasova, 2000. The ctenophore Beroe ovata is a new invader to

the Black Sea. Ecologiya Morya 50: 19-22 (in Russian).

Finenko, G. A., Z. A. Romanova, G. I. Abolmasova, B. E. Anninsky, L. S. Svetlichny, E. S. Hubareva, L. Bat

& A. E. Kideys, 2003. Ingestion, growth and reproduction rates of the alien Beroe ovata and its impact on

plankton community in Sevastopol Bay (the Black Sea). Journal of Plankton Research (in press).

Fraser, H. F., 1962. The role of Ctenophores and salps in zooplankton production and standing crop. Rapports

et Proces verbaux des Reunions du Conseil permanent International pour l’ Exploration de la Mer 153:

121-123.


Kamburska, L., S. Moncheva, A. Konsulov, A. Krastev & K. Prodanov, 2002. The invasion of Beroe ovata in

the Black Sea-why a warning for ecosystem concern? Oceanology, IO-BAS, v. 4 (in press).

Kideys, E. A., 1994. Recent dramatic changes in the Black Sea ecosystem: the reason for the sharp decline

in turkish Anchovy fisheries. Journal of Marine Systems 5:171-181.

Kideys, E. A., A. V. Kovalev, G. Shulman, A. Gordina & F. Bingel, 2000. A review of zooplankton investiga-

tions of the Black Sea over the last decade. Journal of Marine Systems 24: 355-375.

Kideys, A. E. & M. Moghim, 2003. Distribution of the alien ctenophore Mnemiopsis leidyi in the Caspian Sea

in August 2001. Marine Biology 142: 163-171.

Kideys, E. A., 2002. Fall and rise of the Black Sea ecosystem. Science 297: 1482-1483.

Konsulov, A. & L. Kamburska, 1998. Black Sea zooplankton structural dynamic and variability off the

Bulgarian Black Sea coast during 1991-1995. NATO ASI Series, 2. Environment-vol.2/27, “Ecosystem

Modeling as a Management Tool for the Black Sea, Symposium on Scientific Results”, L. Ivanov &

T. Oguz (eds), v.1, (Kluwer Academic Publishers), 281-293.

Konsulov, A. & L. Kamburska, 1998a. Ecological determination of the new Ctenophora-Beroe ovata invasion

in the Black Sea, Oceanology, IO-BAS 2: 195-198

Kremer, P., 2001. Opportunistic lifestyle of the gelatinous and abundant: what dives a species “the right stuff”?

CIESM Workshop Series “Gelatinous zooplankton outburst: theory and practice”, Naples, Italy, 29August-

1st September, n.14, 87-92.

Malashev, V. I. & A. G. Archipov, 1992. The Ctenophore Mnemiopsis leidyi in the West Part of the Black Sea.

Hydrobiologichkyi Zhurnal IBSS 28: 34-39.

Mee, L., 1992. The Black Sea in crisis: A need for concerted international action. Ambio 21:278-286.

Moncheva, S., Doncheva, V. & L. Kamburska, 2000. On the long-term response of harmful algal blooms to the

evolution of eutrophication off the Bulgarian Black Sea coast: are the recent changes a sign of recovery

of the ecosystem-the uncertainties. In: Proceedings of IX International conference on “Harmful Algal

Blooms”, Hobart, Tasmania; G. M.Hallegraff et al., (eds), (UNESCO-IOC, Paris, 2001), pp. 177-182.

Moncheva, S. & L. Kamburska, 2002. Plankton stowaways in the Black Sea-Impacts on biodiversity and

ecosystem health. CIESM, 2002. Alien marine organisms introduced by ships in the Mediterranean and

Black Seas. CIESM Workshop Monographs 20: 47-53.

Mutlu, E., 1999. Distribution and abundance of ctenophores and their zooplankton food in the Black Sea. 2.

Mnemiopsis leidyi. Marine Biology 135: 603-613.

Nelson, T. C., 1925. On the occurrence and food habits of ctenophores in the New Jersey inland coastal waters.

Biological Bulletin 48: 92-111.

Niermann, U., A. E. Kideys, A. V. Kovalev, V. Melnikov & V. Belokopytov, 1999. Fluctuations of pelagic

species of the open Black Sea during 1980-1995 and possible teleconnections. In: Environmental

Degradation of the Black Sea: Challenges and Remedies, NATO ASI Series, 2. Environmental Security,

v. 56, Besiktepe, S., Unluata, U. & A. Bologa, eds (Kluwer Academic Publishers), pp. 147-175.

Oguz, T., H. W. Ducklow, J. E. Purcell & P. Malanotte-Rizzoli, 2001. Simulation of recent changes in the Black

Sea pelagic food web structure due to top-down control by gelatinous carnivores. Journal of Geophysical

Research 106: 4543-4564.

Petipa, T. S., 1959. On average weight of main forms of zooplankton. Studies of Sebastopol Biological Station

5, pp. 13.

Prodanov, K., S. Moncheva, A. Konsulov, L. Kamburska, T. Konsulova & K. Dencheva, 2001. Recent

Ecosystem Trends along the Bulgarian Black Sea Coast. Oceanology 10: 110-128.

Purcell J. E., T. A. Shiganova, M. B. Decker & E. D. Houde, 2001. The ctenophore Mnemiopsis in native and

exotic habitats: U.S. estuaries versus the Black Sea basin. Hydrobiologia 451: 145-176.


Reeve, M., M. Syms & P. Kremer, 1989. Growth dynamics of a Ctenophore (Mnemiopsis) in relation to variable

food supply. I. Carbon biomass, feeding, eggs production, growth and assimilation effi ciency. Journal of

Plankton Research 11: 535-552.

Seravin, L. N., T. A. Shiganova & N. E. Luppova, 2002. Investigation History of Comb Jelly Beroe Ovata

(Ctenophora, Atentaculata, Beroida) and Certain Structural Properties of Its Black Sea Representative,

Zoologichetskyi Zhurnal 81: 1193-1201.

Shiganova, T. A., 1997. Mnemiopsis leidyi abundance in the Black Sea and its impact on the pelagic community.

NATO ASI Series, 2. Environment-vol.2/27, “Ecosystem Modeling as a Management Tool for the Black

Sea, Symposium on Scientific Results”, L. Ivanov & T. Oguz (eds), v. 1, (Kluwer Academic Publishers),

117-129.

Shiganova, T. A., Y. V. Bulgakova, S. P. Volovik, Z. A. Mirzoyan & A. I. Dudkin, 2001. The new invader

Beroe ovata Mayer 1912 and its effect on the ecosystem in the north eastern Black Sea. Hydrobiologia

451: 187-197.



Mnemiopsis leidyi, in the Black Sea and other seas of the Mediterranean basin. Marine Biology 139:

431-445.

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushitsev, A. B. Dulimov & E. I. Musaeva, 2001b.


Oceanology (Russia) 41: 517-524.

Stanners, D. & P. Boudreau, 1995. Europe’s environment: the Dobris assessment. European Environment

Agency Task Force. Newsletter 5, ISBN 92-826-5409-5; ECU: 55.Luxembourg: Office for offi cial

publications of the EC.

Swanberg, N., 1970. The feeding behavior of Beroe ovata. Marine Biology 24: 69-76.

Vinogradov, M. E, E. A. Shushkina, E. I. Musaeva & P. Y. Sorokin, 1989. Ctenophore Mnemiopsis leidyi

(A. Agassiz) (Ctenophora: Lobata)-New settlers in the Black Sea. Oceanology, Institute of Oceanology

29: 293-299, Moskva.

Vinogradov, M. E. & N. Tumantseva, 1993. Intergovermental Oceanographic Commission, no. 3, UNESCO,

(Paris), 80-91.

Vinogradov, M. E, E. A. Shushkina & S. V. Vostokov, 2001. Gelatinous macroplankton (Jellyfi sh Aurelia

aurita, ctenophores Mnemiopsis leidyi and Beroe ovata) in the Black Sea ecosystem (Important aspects

for the Caspian Sea modern ecology). Abstracts, Caspian Environmental Programme (CEP) Mnemiopsis

Advisory Group First Workshop, Baku, December, 2001.

Weisse, T. & M. T. Gomoio, 2000. Biomass and size structure of the scyphomedusa Aurelia aurita in the

northwestern Black Sea during spring and summer. Journal of Plankton Research 22: 223-239.

Zaitzev, Y. & V. Mamaev, 1997. Biological diversity in the Black Sea-A study of change and decline/GEF,

Black Sea Environmental series, vol. 3, pp. 208.

Zaitzev, Y., 1992. Recent changes in the trophic structure of the Black Sea. Fisheries Oceanography 1: 180-189.

Chapter 6

Decreased levels of the invasive ctenophore Mnemiopsis in the Marmara Sea in 2001

MELEK ISINIBILIR, AHMET N. TARKAN & AHMET E. KIDEYS1

Istanbul University, Faculty of Fisheries, Laleli, Istanbul, TURKEY1Institute of Marine Sciences, Middle East Technical University, Erdemli, TURKEY

Keywords: Mnemiopsis leidyi, Beroe cf ovata, Marmara Sea, population dynamics, predation

Mnemiopsis leidyi, an endemic ctenophore of the western Atlantic, was first reported in the Marmara Sea in summer 1992, at an average abundance of 27 ind. m-3. We inves-tigated its abundance and distribution together with that of the mesozooplankton (most species are prey organisms of M. leidyi) at eight stations during August 2001, in order to evaluate recent population developments with regard to the impact of its predator, Beroe cf ovata. The abundance of M. leidyi was found to be quite low (range 0.5-8.8 ind. m-3, average 1.62 ind. m-3) compared to 1992. B. cf ovata was, although at very low abundance (0.1-1.1 ind. m-3), only present at stations where M. leidyi occurred. The zoo-plankton abundance was higher during our investigation than in previous years, which should at least partly be due to a decreased predation impact by M. leidyi.

1. Introduction

The Marmara Sea is an inland sea which, together with the Bosporus and Dardanelles, forms the Turkish Strait Systems. The water column has two different layers; whilst the top 20-30 m has low saline (around 22 ppt) Black Sea waters, saline Mediterranean waters (38 ppt) occupy the lower layers which can be as deep as 1390 m.

Inland seas are more sensitive to impact than open seas. Many dramatic changes took place in recent years in the Marmara Sea, all connected with antropogenic stress. This includes the release of industrial and agricultural wastes into the rivers that drain into the sea, water transfer from the eutrophic Black Sea, an increase in the level of marine pollution, and heavy exploitation of the fish stocks in the last few years. The Marmara Sea ecosystem has also been damaged in the past by opportunistic invasions of temper-ate and subtropical animal and plant species. The introduction of a new species is often

155




harmful for the recipient ecosystem. It is important to know the degree of tolerance of the invader to a new environment, peculiarities of its biology in the new habitat, and the relationship between introduced and indigenous species, its prey and competitors. All these factors determine the abundance and distribution of the invader, and its impact on the ecosystem.

M. leidyi, a voracious zooplanktivorous ctenophore, was accidentally introduced in the early 1980’s to the Black Sea, almost certainly with ballast water from the northwest-ern Atlantic coastal region (Vinogradov et al., 1989). Via the surface currents fl owing from the Black Sea through the Bosporus, Mnemiopsis invaded the Marmara Sea as well. Documented was the appearance of Mnemiopsis at first in 1992 by (Shiganova 1993), when the levels of M. leidiy were already lower in the Black Sea than in 1988 and 1989.Later, several other investigators provided data on the abundance of this ctenophore in the Marmara Sea (Kıdeys and Niermann 1994, Shiganova et al., 1995; Isinibilir and Tarkan, 2001; Yuksek et al., 2002). In early October 1992, the average numbers of M.leidyi were 27 ind. m-3 (Shiganova et al., 1995), but in July, 1993, these numbers were as low as 0.1 ind. m-3 (Kıdeys and Niermann, 1994). In August 2000, higher values of M.leidyi were reported again from the Marmara Sea, (12.9 ind. m-3) (Isinibilir and Tarkan, 2001). However, a new era started with the appearance of a predator of Mnemiopsis,the ctenophore Beroe ovata sensu Mayer, in the Marmara Sea in the late 1990s. This ctenophore feeds almost exclusively on other ctenophores, especially on Mnemiopsis(GESAMP, 1997). B. ovata was supposed to be of American origin, too and it seems to be different from the native species Beroe ovata sensu Chun which is not rare in the Mediterranean. (R. Harbison and K. Bayha, personal communication). Beroe ovata was found in the Marmara Sea as early as summer 1992 (Shiganova et al., 1995), but if it was already the new invader species could not clarifi ed.

A new era started with the appearance in the Marmara Sea in the late 1990s of a predator of Mnemiopsis, the ctenophore Beroe ovata sensu Mayer. This ctenophore feeds almost exclusively on other ctenophores, especially on Mnemiopsis (GESAMP, 1997). B.cf ovata is currently supposed to be of American origin too, and molecular methods have revealed that it is different from the species Beroe ovata sensu Chun, which is not rare in the Mediterranean. (Bayha et al., this volume). Because of this unsettled taxonomic situ-ation, we will henceforth refer to it as Beroe cf ovata. This ctenophore was found in the Marmara Sea as early as summer 1992 (Shiganova et al., 1995); whether it was already present there earlier could not be clarifi ed.

Our purpose is to evaluate the abundance and distribution of Mnemiopsis leidyi after the arrival of Beroe ovata in the Marmara Sea.


The occurrence of Mnemiopsis leidyi and Beroe ovata were investigated in the Marmara Sea between 12 and 18 August 2001 aboard the R/V “YUNUS”. Sampling was con-ducted at 8 stations (Fig. 1). Ctenophores and zooplankton samples were collected by vertical towing of a WP2 plankton net with a diameter of 57 cm and mesh size of 200 micrometers between the sea surface and the halocline, where water of the Black Sea and

The invasive ctenophore Mnemiopsis in the Marmara Sea 2001 157

the Mediterranean Sea mixes (15-30m). The total volume of seawater filtered was calcu-lated as 32.5 m3. Ctenophore samples were identified and their total lengths measured on board. Zooplankton samples were preserved in 4% buffered formalin and qualitative and quantitative analyses were performed in the laboratory under a binocular microscope. Some basic environmental variables of the seawater (e.g. temperature and salinity) were also measured.

Figure 1. Location of 8 stations in the Marmara Sea, sampled between 12 and 18 August 2001

3. Results

Temperature and salinity data are presented in Table 1. The two-layer structure of the Marmara Sea was clear from the salinity and temperature values: whilst the salinity was around 22 ppt at the surface, much more saline Mediterranean water (about 36 ppt) was found at 30 m depth. The temperature also sharply decreased from >22 °C at the surface to around 15 oC at 30 m. Thus, it is clear that both a halocline and a thermocline occur between 20-30.

In total, 51 Mnemiopsis leidyi individuals were counted at the 8 stations with a mean abundance of 1.62 ind. m-3 (Fig. 2). The abundance varied spatially, No individuals were found at station 3, 8, and the offshore station 6, while the maximum of 8.8.ind. m-3


were recorded at station 5, consisting of almost all small individuals collected during the survey. The majority of animals were found between 20 and 30 m. Generally the smallest individuals (10 mm in length) were occupying the calm and near-coastal areas of the Sea. Maximum length of Mnemiopsis leidyi was 130 mm and average length was 30 mm (Fig. 3).

Table 1. Temperature and salinity at eight stations in the Marmara Sea between 12 and 18 August 2001

Stations

1 2 3 4 5 6 7 8

Date 12.08.01 12.08.01 14.08.01 14.08.01 15.08.01 17.08.01 17.08.01 18.08.01

Salin

ity‰

Surface 22.5 24.1 24.1 22.5 22.8 23.2 23.8

10 22.8 24.3 24.2 24.9 24.9 23.5 25.9

20 23.0 24.3 25.7 26.6 34.4 24.9 31.6

30 35.9 36.5 36.5 33.6 36.8 36.5

T(º

C)

Surface 27.0 25.4 25.7 25.4 22.8 24.6 24.1

10 26.5 25.1 25.7 25.2 20.7 24.5 18.7

20 25.4 24.3 21.5 16.3 14.4 22.4 14.6

30 15.2 15.3 15.3 15.4 15.1 15.0

Total depth (m) 33.5 62.5 37.0 38.0 60.0 90.0 23.0 80.0

0123456789

1 0

1 2 3 4 5 6 7 8

Stations

Abu

ndan

ce o

f M.

leid

yi

ind.

m-

3

0

0.2

0.4

0.6

0.8

1

1.2

Abu

ndan

ce o

f B.

ovat

a in

d.m

-3

Abundance of M. leidyi Abundance of Beroe ovata

Figure 2. Abundance of Mnemiopsis leidyi and Beroe ovata in the Marmara Sea in August 2001


Figure 3. Size groups of Mnemiopsis leidyi in the Marmara Sea in August 2001

Only eight large Beroe ovata specimens with an average abundance of 0.3 ind. m-3

were found in August 2001 (Fig. 2). Their total lengths ranged from 125 to 200 m. Beroe ovata was only present at stations where Mnemiopsis leidyi was abundant. Analysis of data collected in August 2001 showed a modest positive correlation between the number of M. leidyi and the number of Beroe ovata (n = 8, r = 0.643, p < 0.05, non-parametric Spearman’s rank correlation analysis).

The total zooplankton abundance varied between 20.000 and 27.000 ind. m-3 at the southern stations (Fig. 4). At the more northern stations 4,5,7,8 the abundance was less, 10.000-15.000 ind. m-3. The most offshore station 6 displayed the lowest abundance, about 1000 ind. m-3.

At station 5, total zooplankton abundance was in the same range as the other northern stations, despite of the local abundance of the Mnemiopsis leidyi (Figs 2, 4). The number of M. leidyi and the number of zooplankton were not correlated in the Marmara Sea dur-ing August 2001 (n = 8, r = 0.239, p < 0.05, non-parametric Spearman’s rank correlation analysis).

The zooplankton of the Marmara Sea was found to consist of five groups. These were the Copepoda, Cladocera, Meroplankton, Noctiluca miliaris and “Others”, consisting of Nauplii, Appendicularia, Chaetognatha and Ichthyoplankton. Compared to all other zooplankton groups, copepods were the dominant taxon (Fig. 5). The maximum abundance of Copepoda (13 440 ind. m-3) was recorded at the station 3, in Erdek Bay, where no Mnemiopsis occurred.

0

24

68

1 0

1 21 4

1 61 8

2 0

1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3

Size groups of M.leidyi (cm)

Abu

ndan

ce o

f M.

leid

yi(i

ndiv

idua

ls)


Figure 4. Abundance of the total mesozooplankton (except Noctiluca miliaris) and Mnemiopsis leidyi in the Marmara Sea during August 2001

Figure 5. Abundance of different groups of zooplankton at eight stations in the Marmara Sea during August 2001

0123456789

1 0

1 2 3 4 5 6 7 8

Stations

Abu

ndan

ce o

f M.

leid

yi

ind.

m-

3

0

5000

10000

15000

20000

25000

30000

Abu

ndan

ce o

f m

esoz

oopl

ankt

on i

nd.m-

3

Abundance of M. leidyi Abundance of mesozooplankton

0

2000

4000

6000

8000

10000

12000

14000

16000

1 2 3 4 5 6 7 8

Stations

Abu

ndan

ce o

f zo

opla

nkto

n in

d.m

-3

Copepoda Cladocera Meroplankton Noctiluca miliaris Others


4. Discussion

Mnemiopsis leidyi is known to tolerate a wide range of salinities (10-70‰) and tempera-tures (1.3-28.8ºC) (Burrell & Van Engel, 1976). Thus, the Marmara Sea has a suitable salinity (22.5-36.8‰) and temperature (27-15°C) for M. leidyi to survive and reproduce. Ctenophores can be important carnivores in planktonic food chains. They are sometimes so numerous that they drastically modify the structure of an otherwise stable community (Fraser, 1970; Bishop, 1967). The outburst of the ctenophore M. leidyi in the Black Sea at the end of the 1980s, changed the structure of the planktonic communities and affected the functioning ecosystem in an essential way (Vinogradov et al., 1989).

Shiganova et al. (1995) assumed that Mnemiopsis leidyi first penetrated to the Marmara Sea from the Black Sea with the upper Bosporus current. Considering the con-tinuous strong flow from the Black Sea towards the Sea of Marmara, the arrival of M.leidyi here must have occurred long before 1992, presumably as soon as the ctenophores became abundant in the Black Sea, in 1987 or 1988. Unfortunately no data existed before 1992 to corroborate this hypothesis.

By October 1992, Mnemiopsis leidyi was present in the Marmara Sea, at an average abundance of 27 ind. m-3 (Shiganova et al., 1995). Shiganova et al., 1995 suggested that M. leidyi occurs all year round in the upper water layer of the Marmara Sea, simi-lar to the situation in the Black Sea. However in the subsequent years the density of M. leidyi decreased considerably. In July 1993, the average density of M. leidyi was only 0.1 ind. m-3 (Kıdeys and Niermann, 1994), in July 1999 the abundance was 0.06 ind. m-3

(only Bosphorus data; Tarkan et al., 2000), in August 2000, the numbers increased to 12.9 ind. m-3 (Isinibilir and Tarkan, 2001) and dropped again to 1.62 ind. m-3 in August 2001 (present study).

These data demonstrate that Mnemiopsis leidyi populations show marked interannual variation in the Marmara Sea, probably resulting from environmental interactions and food availability and spawning season.

In 1992, medium-sized individuals (10-45 mm) of Mnemiopsis leidyi were dominant in the Marmara Sea (Shiganova et al., 1995 ), but later in 2000, small individuals were found the dominant group in the northern part of Marmara Sea (Isinibilir and Tarkan, 2001). These small individuals, occupying the calm and coastal areas of the Sea, may suggest either that spawning of Mnemiopsis leidyi occurs in the coastal regions of the Sea or that the ctenophores here are starving more than those in the offshore regions (it is known that they shrink with starvation).

At least three species of the predatory, large-sized genus Beroe inhabit the Mediterranean Sea: Beroe cucumis Fabricius (in Campbell, 1982), B. ovata Esch and B. forskalii Chun (in Tregouboff and Rose, 1957). Beroe ovata sensu Chun was till end of the 1990’s not distributed the Black Sea. Thinkable is, that for this species the low salinity of the Black Sea was a barrier. The recently introduced Beroe ovata censu Mayer, possibly of western Atlantic origin, seems to be adapted to low salinity.

In 1992 Beroe ovata was recorded in the Marmara Sea (Shiganova et al., 1995), however it was uncertain, which species of Beroe it was. In 1999, two individuals of B.ovata were found near the Bosphorus (Tarkan et al., 2000). During 2000 B. ovata was not found in the Marmara Sea (Isinibilir and Tarkan, 2001). In August 2001 we caught eight


mostly large individuals with an average abundance of 0.3 ind. m-3. But still uncertain is, which species of Beroe was collected, the Mediterranean or the newly introduced one. The occurrence of large individuals in the Marmara Sea during August 2001 may sug-gest that Beroe ovata is transported to the Marmara Sea by currents from the adjacent Black Sea.

Finenko et al. (2001, 2002) and Kideys (2002) demonstrated for the Black Sea area off Sevastopol that Beroe ovata sensu Mayer could control the M. leidyi stock. With the occurrence of B. ovata in the Black Sea end of the 1990’s the previous year-round distribution of M. leidyi became limited to a very short period in summer (Finenko et al., 2003).

It may be that the appearance of its predator, Beroe ovata had an effect on the stock of M. leidyi in the Sea of Marmara in recent years, as it was observed for the Black Sea, but from our limited data we can not make such a statement.Compared to earlier investi-gations the abundance of copepods was high in August 2001. In 1977 the abundance of copepods in the northern Marmara was 257 ind. m-3, in the southern Marmara 360 ind. m-3 (Cebeci and Tarkan, 1990). In August 1992, the zooplankton was drastically reduced to 33 and 35 ind. m-3 in the northern and southern Marmara respectively (Shiganova et. al., 1995). In 2000 the food zooplankton increased in the northern Marmara to 2935 ind. m-3 and in 2001 (present study) to 14751 ind. m-3.

Mnemiopsis is a voracious feeder on zooplankton, especially on copepods. It was often observed in the Black Sea, that in areas with high abundance of M. leidyi the copepod numbers were harshly reduced (Niermann et al, 1999). This was not found in the Marmara Sea during August 2001. There was no significant correlation between the abundance of copepods and Mnemiopsis. Despite of that, by comparing long-term trends in the Black Sea and Marmara Sea, is seems that the fluctuation of mesozooplankton was similar in both seas, low numbers at the beginning of 1990’s and high numbers of zoo-plankton in the end of the 1990’s and beginning of the 2000’s. It could be assumed that there is a relation between the decrease in the amount of zooplankton and the extraordi-nary increase of Mnemiopsis leidyi and vice versa. Unfortunately we do not have weight data of zooplankton which would be a better measure for analysing long-term changes.

Similar to that of the Black Sea the fish catch of the Marmara Sea was the lowest in the late 1980s (Fig. 6), in the period of highest M. leidyi impact in the Black Sea. According to several authors the high density of Mnemiopsis leidyi in the Black Sea during 1989 and subsequent years could be responsible for the decline of the anchovy, because M. leidyifeeds on its eggs and larvae and is a strong competitor for the mesozooplankton food of the juvenile and adult anchovy (Kideys, 2000, Shiganova, 1998).

Due to the lack of data on Mnemiopsis for this time period, we only can assume that beside other impacts (see Niermann in this volume) probably Mnemiopsis, could have affected the anchovy in the Sea of Marmara as well.

Since the outburst of Mnemiopsis during 1989 in the Black Sea (which could probably assumed for the Marmara Sea as well), fish catches were increasing steadily until 1999 (up to almost 55 thousand tonnes). In 2000 the catches decreased to 21 thousand tonnes.

What exactly were the reasons for the recovery of the catches during the 1990’s, the steep increase in 1999 and the drastic decrease in 2000 can not be answered by our investigations.


Figure 6. Catches of fish species in the Marmara Sea (Fisheries Statistics. State Institute of Statistics Prime Ministry Republic of Turkey.1980-1999) and GFCM Capture Production 1970-2000 Fishstat Plus Version 2.30 FAO

According to Kideys (2000), Shiganova (1998), Finenko et al. (2003) the extermina-tion of M. leidyi by B. ovata could be an important factor for the recovery of the anchovy in the Black Sea by end of the 1990’s. To what extents Beroe ovata sensu Mayer played a role by the fast increase of the catches in the Marmara Sea from 1997-1999 can not be answered yet.In conclusion, it is once more clear that for a better understanding of the ecosystem of the Marmara Sea, long-term monitoring data on the important biological components, and particularly on the quality and quantity and of plankton are essential.

According to Kideys (2000), Shiganova (1998), and Finenko et al. (2003), the exter-mination of M. leidyi by Beroe cf ovata was an important factor in the recovery of the anchovy in the Black Sea by end of the 1990’s. However, to what extent this B. ovatasensu Mayer played a role in the fast increase of the catches in the Marmara Sea during 1997-1999 cannot be answered yet.

In conclusion, it is once more clear that for a better understanding of the ecosystem of the Marmara Sea, long-term monitoring data on the important biological components, and particularly on the quality and quantity and of plankton are essential.

0

10000

20000

30000

40000

50000

60000

19

80

19

81

19

82

19

83

19

84

19

85

19

86

19

87

19

88

19

89

19

90

19

91

19

92

19

93

19

94

19

95

19

96

19

97

19

98

19

99

20

00

Years

Ton

nes

Engraulis encrasicolus Sprattus sprattus Sardina pilchardus

Trachurus trachurus Pomatomus saltator Scomber scombrus


5. Acknowledgements

We are grateful to Dr. Ulrich Niermann for his constructive comments.

References

Anonymous, 1980-1999. Fisheries Statistics. State Institute of Statistics Prime Ministry Republic of Turkey.

Anonymous, 1970-2000. GFCM Capture Production, Fishstat Plus Version 2.30, FAO

Bishop, J. W., 1967. Feeding rates of the ctenophore Mnemiopsis leidyi. Chesapeake Sci. 8: 259-264.

Burrell, V. G. and Van Engel, W. A. 1976. Predation by and distribution of a ctenophore, Mnemiopsis leidyi

A. Agassiz, in the York River estuary. Estuarine and Coastal Marine Science, 4: 235-242.

Campbell A. C. 1982. The Hamlyn guide to the flora and fauna of the Mediterranean Sea. Hamlyn Publ.,

London, 320 p.

Cebeci,M. and Tarkan, N. 1990. Marmara Denizinde zooplankton organizmaların da ılımı. I.U. Su Urunleri

Dergisi 4(1) 69.

Finenko G. A., Z. A. Romanova, G. I. Abolmasova, B. E. Anninsky, L. S. Svetlichny, E. S. Hubareva, L. Bat &

A. E. Kideys, 2003. Ingestion, growth and reproduction rates of the alien Beroe ovata and its impact on

plankton community in Sevastopol Bay (the Black Sea). J. Plank. Res. (accepted).

Finenko G. A., B. E. Anninsky, Z. A. Romanova, G. I. Abolmasova & A. E. Kideys 2001. Chemical com-

position, respiration and feeding rates of the new alien ctenophore, Beroe ovata, in the Black Sea.

Hydrobiologia 451:177-186.

Fraser, H. F., 1970. The ecology of the ctenophore Pleurobrachia pileus in Scotish waters. J. Cons. Int. Explor.

Mer. 33: 149-168.

GESAMP (IMO/FAO/UNESCO-IOC/WMO/WHO/IAEA/UN/UNEP Joint Group of Experts on The Scientifi c

Aspects of Marine Environmental Protection), 1997. Opportunistic settlers and the problem of the

Mnemiopsis leidyi invasion in the Black Sea. Rep. Stud. GESAMP 58: 84 pp.

Isinibilir, M. & A. N. Tarkan, 2001. Abundance and distribution of Mnemiopsis leidyi in the northern Marmara

Sea. Rapp. Comm. int. Mer. Médit.36. CIESM, Monte-Carlo. pp.276.

Kideys, A. E. 2002. Fall and rise of the Black Sea ecosystem. Science 297: 1482-1484.

Kideys, A. E. & U. Niermann, 1994. Occurrence of Mnemiopsis along the Turkish coast. ICES Journal of

Marine Science, 51: 423-427.

Niermann, U., A. E. Kideys, A. V. Kovalev, V. Melnikov, V. Belokopytov, 1999. Fluctuation of pelagic

species of the open Black Sea during 1980-1995 and possible teleconnections.- in: Besiktepe S., Ünlüata,

Ü., Bologa, S. (eds), Environmental degradation of the Black Sea: Challenges and Remedies.- Kluwer

Academic Publishers: 147-173.Mayer, A. G., 1912. Ctenophores of the Atlantic coast of North America. Carnegie Institute Washington.

Publication, 162.

Shiganova, T. A. 1993. Ctenophore Mnemiopsis leidyi and ichthyoplankton in the Sea of Marmara in October

of 1992. Oceanology 33: 900-903.

Shiganova, T. A., A. N. Tarkan; A. Dede, & M. Cebeci, 1995. Distribution of the ichthyo-jellyplankton

M. leidyi (Agassiz, 1865) in the Marmara Sea (October 1992). Turkish Journal of Marine Science 1: 3-12,

Istanbul.

Shiganova, T. A., 1998. Invasions of the Black Sea by the ctenophore Mnemiopsis leidyi and recent changes in

pelagic community structure. Fisheries and Oceanography 7:305-310.


Tarkan, A. N., Isinibilir, M., Benli, H. A. 2000. An observation on distribution of the invader Mnemiopsis

leidyi (Agassiz,1865) and the resident Aurelia aurita (Linn.1758) along the Strait of Istanbul. Oztürk

B., Kadıo lu M. and Oztürk H. (eds), The Symposium of The Marmara Sea 2000, TUDAV. Istanbul p.

461-467.

Tarkan, A. N., Isinibilir, M., Ogdul, R. G. 2000. Mesozooplankton composition Sea of northern Marmara.

Oztürk B., Kadıo lu M. and Oztürk H. ed., The Symposium of The Marmara Sea 2000, TUDAV. Istanbul,

p. 493-499. (in Turkish).

Tregouboff, G. & M. Rose, 1957. Manuel de Planctonologie Mediterraneenne. Centre Nat. de la Rech. Sci.

Paris. 1:1-587

Vinogradov, M. Ye., E. A. Shushkina, E. I. Musayeva & F. Yu. Sorokin, 1989. A newly acclimated species in

the Black Sea: The ctenophore M. leidyi (Ctenophora: Lobata). Oceanology 29: 220-224.

Yuksek, A., E. Okus, A. Uysal, N. Yılmaz, 2002. Distribution of Mnemiopsis leidyi in the Sea of Marmara and

Black Sea and influence of environmental parameters (1995-2001). Yılmaz A., Saliho lu ., Mutlu E.,

Second Conference of Oceanography of the eastern Mediterranean and Black Sea. Ankara. 142 pp.

Chapter 7

Preliminary investigation on the molecular systematics of the invasive ctenophore Beroe ovata

KEITH M. BAYHA1,2, G. RICHARD HARBISON3,JOHN H. MCDONALD1 & PATRICK M. GAFFNEY2

1Dept. of Biological Sciences, University of Delaware, Wolf Hall, Newark, DE, 197162College of Marine Studies, University of Delaware, 700 Pilottown Rd., Lewes, DE, 199583Woods Hole Oceanographic Inst., Biology Dept., Woods Hole, MA, 02543

Keywords: Mnemiopsis, Beroe, invasive species, molecular phylogeny, DNA, ITS1 and ITS2.

In the mid-1990’s, a ctenophore species of the genus Beroe appeared in the Black Sea ecosystem and was found to be feeding on the invasive ctenophore Mnemiopsis leidyi.Identification of this species is complicated by the fact that the same species name, Beroe ovata, has historically been used for morphologically different Beroe species in the Mediterranean (B. ovata sensu Chun) and the western Atlantic and Caribbean (B. ovata sensu Mayer). In order to accurately identify this species of Beroe and gain insight into the possible source of the new invader, we have collected preliminary DNA sequence data for Beroe from the Bosporus region of Turkey to compare it to sequence data for B. ovata sensu Mayer from the western Atlantic, B. ovata sensu Chun from the Mediterranean and published data for B. cucumis sensu Mayer from the Atlantic and Pacific. Due to its general utility in species diagnostics, we used data from the nuclear Internal Transcribed Spacer Region 1 (ITS-1). ITS-1 length variation, sequence divergence and molecular phylogenetic analysis all indicated the existence of two well-differentiated groups.

The first group consisted of Beroe from the Bosporus and B. ovata sensu Mayer from the western Atlantic (Woods Hole, Massachusetts and Rehoboth Bay, Delaware), based on the absence of ITS-1 length variation and extremely low sequence divergence (0-0.8%), indicating that the Bosporus Beroe are probably B. ovata sensu Mayer that were transported there from somewhere in the animal’s native range (western Atlantic and Caribbean coasts). Bosporus Beroe ITS-1 sequences were 25 base pairs longer than and had 13.2%-13.8% sequence divergence from Mediterranean Sea B. ovata sensu Chun, which does not support the idea of range expansion from the Mediterranean.

167




Beroe ovata sensu Chun from the Mediterranean and published Beroe cucumis sensuMayer from the Atlantic and Pacific formed a second group, based on low length varia-tion of ITS-1 (209-211 bp) and low sequence divergence (0.5-1.5%), indicating that B. ovata sensu Chun from the Mediterranean is a member of a widespread species that includes B. cucumis sensu Mayer from the western Atlantic and eastern Pacific. Due to the taxonomic uncertainties within the genus Beroe and inconsistencies involving the original species descriptions, we advocate using the name Beroe ovata sensu Mayer for Beroe ovata from the western Atlantic and Black Sea and the name Beroe cucumis sensu Mayer (= Beroe ovata sensu Chun) for those found in the Mediterranean, western Atlantic and eastern Pacific until a thorough systematic revision of the genus Beroe canbe done.

1. Introduction

There have apparently been two major ctenophore invasions of the Black Sea over the past two decades. Before the 1980’s, the only ctenophore species found in the Black Sea was Pleurobrachia rhodopis (= pileus) Chun (Vodyanitskii, 1968). In contrast, there are a large number of species of ctenophores in the Mediterranean (Trégoubouf & Rose, 1959). In the 1980’s, a ctenophore was found in the Black Sea that was identified as Mnemiopsis leidyi Agassiz (Vinogradov et al., 1989) and Mnemiopsis mccradyi Mayer(Zaika & Sergeyeva, 1990). Harbison & Volovik (1994) suggested that there is only one species, M. leidyi, which is found continuously distributed along the Atlantic coast of southern Argentina to northern U.S.A. If this is the case, and molecular investiga-tions support this (KMB, unpublished results), then generic identification is sufficient to establish the correct species of Mnemiopsis found in the Black Sea. By the late 1980’s, M. leidyi populations exploded in the Black Sea, coinciding with major alterations in the pelagic ecosystem (see Kideys, 2002 for a summary).

It is likely that Mnemiopsis leidyi was transported to the Black Sea in the ballast water of empty ships returning from the Atlantic waters of North or South America (see Harbison & Volovik, 1994 and GESAMP, 1997 for summaries). Some authors have suggested specific geographic source regions for specimens of M. leidyi that were transported to the Black Sea (e.g., Vinogradov et al., 1989). However, M. leidyi is natu-rally distributed continuously along the eastern seaboard of the Americas from southern Argentina to the northern United States, as well as throughout the Caribbean (Harbison & Volovik, 1994) and there is presently no published evidence favoring a particular region as the source. In order to try to locate the geographic source of M. leidyi populations in the Black Sea, an ongoing project of this research group has included genetic analysis of this species.

In the mid-1990’s, a ctenophore of the genus Beroe appeared in the Black Sea (Shiganova et al., 2000) and was initially believed to be Beroe ovata from the Mediterranean Sea. The problem as to the correct identification of this species is quite different from that of identifying Mnemiopsis leidyi, since over 50 species of Beroe have been described (GRH, unpublished). Thus, identification to genus is not sufficient to establish identification to species in this case.

Preliminary investigation on the molecular systematics 169

There are two possibilities: this species of Beroe in the Black Sea is a member of the Mediterranean fauna that entered though the Bosporus, or it was brought from some-where else in ships’ ballast water, as apparently was the case with Mnemiopsis leidyi.Our examinations of photographs by T.A. Shiganova in 2000 (KMB) and S.P. Volovik in 2001 (GRH) suggested strongly to us that an American species of Beroe was transported to the Black Sea. This species, indigenous to the Atlantic seaboard of North and South America, is called Beroe ovata by American investigators. It differs morphologically from the species found in the Mediterranean that is called B. ovata by European scien-tists. In order to understand how this odd circumstance arose, a short historical digression is necessary.

In 1880, Chun published a major monograph on the ctenophores of the Gulf of Naples, and this paper became the basic text on Mediterranean ctenophores. One of the species that he described and illustrated he called Beroe ovata Eschscholtz (Chun, 1880, pp. 308-309, plate XIV, figs. 1 and 2). For the sake of clarity, this species will henceforth be referred to as B. ovata sensu Chun. In 1912, Mayer published a major monograph on the ctenophores of the Atlantic Coast of North America, and this paper became the basic guide to American ctenophores. In this work, he described and figured a species that he called Beroe ovata Chamisso and Eysenhardt (Mayer, 1912, pp. 49-52, figs. 66, 68 to 75, plates 14 to 16). This species will henceforth be referred to as B. ovata sensu Mayer. To add further confusion, B. ovata sensu Chun in the Atlantic was called Beroe cucumisFabricius by Mayer (1912), a name that we use in this paper for morphologically similar animals from the Atlantic and Pacific. This has, of course, created a number of problems, since investigators on each side of the Atlantic have been commonly using the same name for two different species, and different names for the same species. Based on col-lections made in numerous locations by one of us (GRH), B. ovata sensu Mayer seemed, until recently, to be restricted to the eastern seaboard of North and South America, much like Mnemiopsis leidyi. In contrast to M. leidyi, it has been more frequently found in oligotrophic waters (Harbison et al. 1978, Swanberg 1974). An excellent photograph of B. ovata sensu Mayer can be found in Swanberg (1974).

There are a number of morphological characters that serve to separate the two species, but the most striking difference is in the gross morphology. Beroe cucumis sensu Mayer, which is morphologically similar to Beroe ovata sensu Chun, is oval to almost circular in cross-section, while B. ovata sensu Mayer is so flattened that it appears almost planar (see Mayer, 1912, fig. 69), with a wide flaring mouth (see Mayer, 1912, fig. 68). One of the us (Harbison, 2001) pointed out these differences, and provided an illustrated PowerPoint presentation entitled “Guide to American ctenophores in the Mediterranean” to all of the participants at a CIESM workshop entitled “Gelatinous zooplankton outbreaks: theory and practice”, held in Napoli, Italy from 29 August to 1 September, 2001. Similar conclu-sions were apparently later published by Seravin et al. (2002), based on their published abstract, although we have not yet had access to their paper. Since so many species of Beroe have been described, it might be argued that morphological evidence alone is not sufficient to establish the specific identity of the Black Sea Beroe. Therefore, in this paper we have done a genetic analysis of specimens from the Black Sea, comparing them to specimens from the Mediterranean and the Americas.


Podar et al. (2001) found genetic differences between four species of Beroe: B. ovatasensu Mayer, B. cucumis sensu Mayer, B. forskalii Lesson and B. gracilis Künne. In order to establish the identity of the Black Sea Beroe, we have collected preliminary DNA sequence data from animals in the western Atlantic Ocean, as well as the Mediterranean and Black Seas. We have analyzed sequence data from the nuclear ribosomal Internal Transcribed Spacer Region 1 (ITS-1). Because of its relatively conservative evolution within species, this region is often useful for species delineation (Anderson & Adlard, 1994; Dawson & Jacobs, 2000, Schroth et al., 2002). Podar et al. (2001) have published ITS-1 sequences for a wide range of ctenophore species, including those of B. ovatasensu Mayer (Atlantic) and B. cucumis sensu Mayer (Atlantic and Pacific). The goal of this work has been to compare sequence data from specimens of Beroe from the western Atlantic, Mediterranean and Black Seas with published Beroe sequence data to determine 1) whether or not invasive Black Sea Beroe are, in fact, more similar to B. ovata sensu Mayer from the western Atlantic than B. ovata sensu Chun from the Mediterranean and 2) whether or not Mediterranean B. ovata sensu Chun are genetically similar to B. cucu-mis sensu Mayer from the Atlantic and Pacific Oceans.


Beroe samples were individually collected from shore with hand-held containers. Specimens of Beroe from the Bosporus region were provided by Dr. Ahmet Kideys (Middle East Technical University) and Guler Kideys. Specimens of Beroe ovata sensu Chun were provided by the lab of Dr. Christian Sardet (Observatoire Océanologique de Villefranche-sur-Mer, France). All animals were either frozen on dry ice and stored at - 80 C or preserved in 70-100% ethanol.

DNA was isolated from Beroe comb row tissue using a standard CTAB extraction protocol (Ausubel et al., 1989) that was modified to allow for a second round of concen-trated CTAB. The Internal Transcribed Spacer Region 1 (ITS-1) was amplified by PCR using Taq polymerase and the primers ITS1A (5’GGTTTCTGTAGGTGAACCTGC3’) and N74 (CCGTTACTGGGGGAATCCT) (Gaffney, unpublished). PCR amplifi cation was confirmed by electrophoresis of products on a 2% agarose gel. The products were treated with EXOSAP-it (USB Corporation) to prevent interference by unused primers and dNTPs in subsequent sequencing reactions. Clean PCR products were then cycle sequenced directly with Applied Biosystems (ABI) Big Dye Cycle Sequencing Kit (1/4 dilution) using the above PCR primers. Cycle Sequenced amplicons were then ethanol precipitated, resuspended and run on an ABI 310 or 377 sequencer.

Obtained sequences were aligned against published Beroe ovata sensu Mayer and Beroe cucumis sensu Mayer sequences (Podar et al., 2001), in order to trim off 18S and 5.8S sequence flanking the ITS-1 region, using the program Sequence Navigator (Applied Biosystems, Inc.). All sequences were then aligned by ClustalW (Thompson et al., 1994), using the program Megalign (DNAStar, Inc.). All sequences used in this study can be found in Table 1. Phylogenetic anlysis by Neighbor joining (NJ) was done using PAUP V. 4.0b10 (Swofford, 2000).


3. Results

The length of Beroe ITS-1 sequences varied from 209-236 base pairs. 26 aligned sites were variable, while the segment contained five insertion/deletions. Beroe cucumis sensuMayer sequences published by Podar et al. (2001) are short (209 base pairs) and differ in length from their published Beroe ovata sensu Mayer sequence (236 base pairs) due to four insertion/deletions, which are 4-10 base pairs in length. Sequence divergences between these species range from 12.6-13.8%. Mediterranean Sea B. ovata sensu Chun(209 base pairs) sequences were similar in length to published B. cucumis sensu Mayer (209-211 base pairs), while sequences of Bosporus Beroe (236 base pairs) and B. ovatasensu Mayer from Rehoboth Bay (236 base pairs) were identical in length to published B. ovata sensu Mayer sequences (236 base pairs). Based on sequence divergence, Mediterranean Sea B. ovata sensu Chun was more similar to published B. cucumis sensuMayer (0.5-1.5%) than to published B. ovata sensu Mayer (13.2-13.8%), while Bosporus Beroe and Rehoboth Bay B. ovata sensu Mayer sequences were more similar to published B. ovata sensu Mayer (0-0.8%) than to published B. cucumis sensu Mayer (12.7-13.8%). Mediterranean B. ovata sensu Chun sequences were slightly more similar to B. cucumis from Santa Barbara (0.5%) than Woods Hole (1.0%), but the Santa Barbara B. cucumis sequence contained a 2 base pair insertion that was absent in the other two. Sequences of B. ovata sensu Mayer from the western Atlantic and from Bosporus Beroe were identical in length and differed only by the presence of ambiguous sites in the Rehoboth Bay and Woods Hole sequences, indicating intragenomic variation.

Molecular phylogenetic analysis by Neighbor-Joining indicated two strongly support-ed clades in the data set, with bootstrap values near 100 (Fig. 1). One clade consisted of Beroe ovata sensu Mayer from the Americas and Beroe from the Bosporus. Differences within this clade were minor, with only two ambiguous nucleotide positions variable among the samples. The second clade consisted of Beroe cucumis sensu Mayer from the Atlantic and Pacific and B. ovata sensu Chun from the Mediterranean. Again, differences within this clade were minor, with three variable nucleotide positions.

4. Discussion

The ITS-1 data from this study provide clear and concrete diagnostic molecular char-acters to delineate Beroe ovata sensu Mayer from Beroe cucumis sensu Mayer and B. ovata sensu Chun. Length variation, sequence divergence levels and molecular phylogenetic analysis all indicate two groups in the sample data (Table 1, Fig. 1) that differ greatly from one another but contain individual sequences that are nearly identical. The placement of Beroe from the Bosporus in a clade with B. ovata sensu Mayer from the Americas is supported by the absence of length variation and extremely low sequence divergence levels (0-0.8%). This indicates strongly that the Bosporus Beroe are B. ovata sensu Mayer, and were transported there from somewhere else. Given the experience with Mnemiopsis leidyi, it is likely that this Beroe species introduced from the coasts of the western Atlantic or Caribbean, where morphologically and genetically similar animals are found. At any rate, they could not have come from the Mediterranean Sea,


as initially thought, since Beroe ovata sensu Mayer has never been found there. Given the large number of species of Beroe that have been described, and the general taxonomic confusion within the genus, molecular data are vital to confirming previous conclusions based solely on morphology.

The placement of Beroe ovata sensu Chun from the Mediterranean in a clade with Beroe cucumis sensu Mayer from the Atlantic and Pacific is supported by a small degree of length heterogeneity (209-211 base pairs) and very low sequence divergence (0.5-1.5%). This strengthens the idea that these animals belong to the same cosmopoli-tan species and that American and European scientists have been historically using two different names to refer to one cosmopolitan animal. Relationships within the clade are rather uncertain, as they are based on such small differences. While it may appear that B. ovata sensu Chun (=B. cucumis sensu Mayer) is phylogenetically more closely related to B. cucumis sensu Mayer from Woods Hole than to that from Santa Barbara (Fig. 1), this difference is based on a single base pair difference. Another site delineating speci-mens in this clade was ignored for the molecular phylogenetic analysis, since it occupied a nucleotide position that was ambiguous in one of the western Atlantic Beroe ovata sensu Mayer (see Fig. 1 legend). If this site is included in the analysis, the topology of the Beroe cucumis sensu Mayer group changes, further indicating that topology within this clade is not reliable. Regardless, the lack of significant length heterogeneity and sequence

Table 1. List of species and ITS-1 sequences used in this study

Species Source Region Sequence

(Accession #) Length (bp)

Beroe ovata Podar et al., 2001 Woods Hole, MA (USA) (AF293694) 236

Beroe This study Bosporus, Turkey 236




Beroe ovata This study Rehoboth Bay, DE (USA) 236

Beroe ovata This study Villefranche sur Mer, France 209

Beroe cucumis Podar et al., 2001 Woods Hole, MA (USA) (AF293694) 209

Beroe cucumis Podar et al., 2001 Santa Barbara, CA (USA) (AF293699) 211

Haeckelia rubra Podar et al., 2001 Woods Hole, MA (USA) (AF293673) 233


divergence between animals from geographically distant water bodies is surprising. Recent molecular studies of cosmopolitan species have often found varying degrees of genetic structure within these species, including the existence of previously unknown cryptic species. An example of this is the moon jelly Aurelia aurita, previously consid-ered to be a single cosmopolitan species. Analyses of nuclear (ITS-1) and mitochondrial (cytochrome c oxidase subunit I, 16S) sequence data have revealed the presence of at

Figure 1. Neighbor-joining (NJ) tree based on p-distance of 10 Beroe ITS-1 sequences. Ambiguous data and gaps were treated as missing data. All other substitutions were equally weighted. Branch lengths indicate evolutionary distance between samples. The tree was rooted using Haeckelia rubra, a member of the genus most genetically similar to Beroe based on 18S phylogeny (Podar et al., 2001). Numbers in bold indicate bootstrap values based on 1000 subreplicates. Bootstrap values less than 50% were collapsed. Abbreviations: Beroe -SB, Santa Barbara, California (USA); Beroe cucumis -WH, Woods Hole, Massachusetts (USA); Beroe ovata -VI, Villefranche sur Mer (France); Beroe -BO, Bosporus, Turkey; Beroe ovata -RB, Rehoboth Bay, Delaware (USA); Beroe ovata -WH, Woods Hole, Massachusetts (USA)


least seven cryptic species within Aurelia aurita (Dawson & Jacobs, 2001; Schroth et al., 2002). In the case of B. cucumis sensu Mayer (= B. ovata sensu Chun), molecular data support the existence of one widespread species instead of several isolated ones.

While it may seem tempting to simply lump all Beroe ovata sensu Mayer animals into the species Beroe ovata and all Beroe cucumis sensu Mayer (= B. ovata sensu Chun) into the species Beroe cucumis, taxonomic uncertainties within the genus Beroe precludeus from doing so. The original description of Beroe cucumis (Fabricius, 1780) included a bright red stomadaeum that is not present in B. cucumis sensu Mayer, indicating that Mayer’s application of the trivial name “cucumis” may not be appropriate. Likewise, the species called Beroe ovata may be a junior synonym, since Linnaeus (1758) first named a species Medusa beroe for an animal described by Browne (1756) from Jamaica, whereBeroe ovata sensu Mayer is abundant. In any case, until a rigorous systematic revision is undertaken for the genus, incorporating all of the relevant literature, it seems prudent to use the name B. ovata sensu Mayer for B. ovata found in the western Atlantic, Caribbean and Black Sea and the name B. cucumis sensu Mayer (=B. ovata sensu Chun) for B. ovata(sensu Chun) from the Mediterranean as well as B. cucumis from the eastern Pacific and western Atlantic. Also, one of us (GRH) has collected B. cucumis sensu Mayer from the eastern Atlantic, along the Spanish coast, Canary Islands and Madeira.

It is also important to keep in mind that this preliminary data set, while rather con-vincing to us, is based on a small set of samples. A more complete study, including more animals from a wider range of regions, is needed. Such a study would strengthen the con-clusions found here. Also, if any geographical differentiation is found in ITS sequence data in the native range of Beroe ovata sensu Mayer, this may allow us to pinpoint the specific source region of the Black Sea B. ovata. In order for this to be done, specimens from numerous sites within the native range would need to be studied. In any case, given the large number of described Beroe species, the need for a careful revision of the genus and the paucity of concrete morphological characters, it is clear that the future use of molecular data will be invaluable for clarifying taxonomic relationships in this genus.

References

Ausubel, F. M., R. Brent, R. F. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith & K. Struhl (eds), 1989.

Current Protocols in Molecular Biology. Wiley & Sons, New York.

Browne, P., 1756. The Civil and Natural History of Jamaica. Printed by the Author, London.

Chamisso, A de & C. G. Eysenhardt, 1821. De Animalibus quibusdam e Classe Vermium Linneana, in

Circumnavigatione terrae, auspicante Comite N. Romanzoff, duce Ottone de Kotzebue, annis 1815-1818.

Nova Acta Physico-Medica Academiae Caesareae Leopoldino-Carolinae Naturae Curiosorum. 10: 545-

574, pls. 24-33.

Chun, C., 1880. Die Ctenophoren des Golfes von Neapel und der angrenzenden Meeresabschnitte. Fauna und

Flora des Golfes von Neapel, herausgegeben von der zoologischen Station in Neapel. I. Monographie

XVIII, 313 pages with 18 plates and 22 text-figures. Leipzig.

Dawson, M. N. & D. K. Jacobs, 2001. Molecular evidence for cryptic species of Aurelia aurita (Cnidaria,

Scyphozoa). Biological Bulletin 200: 92-96.

Eschscholtz, F. 1829. System der Acalephen. Erste Ordnung. Rippenquallen. Ctenophorae, pp. 20-39, pls. 1-3.


190 pp., 16 pls. F. Dümmler, Berlin.

Fabricius, O., 1780. Fauna Groenlandica. 450 pp. Hafniae et Lipsiae, J.G. Rothe.

GESAMP (IMO/FAO/UNESCO-IOC/WMO/WHO/IAEA/UN/UNEP Joint Group of Experts on the Scientifi c

Aspects of Marine Environmental Protection), 1997. Opportunistic settlers and the problem of the cteno-

phore Mnemiopsis leidyi invasion in the Black Sea. Reports and Studies of GESAMP 58: 84 pp.

Harbison, G. R., 2001. Guide to American ctenophores in the Mediterranean. PowerPoint presentation at

CIESM (International Commission for the Scientific Exploration of the Mediterranean Sea) Meeting on

“Irregular massive plankton events in the Mediterranean Sea,” F. Boero, Chairman. Napoli, 29 August to

1 September 2001.

Harbison, G.R., L.P. Madin & N.R. Swanberg, 1978. On the natural history and distribution of oceanic cteno-

phores. Deep-Sea Research 25: 233-256.

Harbison, G.R. & S. P. Volovik, 1994. The ctenophore, Mnemiopsis leidyi, in the Black Sea: a holoplanktonic

organism transported in the ballast of ships. In: Non-Indigenous Estuarine & Marine Organisms (NEMO)

and Introduced Marine Species. Proceedings of the Conference and Workshop, NOAA Tech. Rep., U.S.

Dept. Commerce. U.S. Govt. Printing Office, Washington, D.C.

Künne, C. 1939. Die Beroe (Ctenophora) der südlichen Nordsee, Beroe gracilis n.sp. Zoologischer Anzeiger

127: 172-174.

Lesson, R. P. 1836. Mémoire sur la famille des Béroïdes (Beroideae Less.). Annales des Sciences Naturelles

5: 235-266.

Linnaeus, C. 1758. Systema Naturae per Regna Tria Naturae, secundum Classes, Ordines, Genera, Species,

cum Characteribus, Differentiis, Synonymis, Locis. Tomus I. Editio Decima, Reformata. Holmiae,

Laurentii Salvii.

Podar, M., S. H. D. Haddock, M. L. Sogin & G. R. Harbison. 2001. A molecular phylogenetic framework for

the phylum Ctenophora using 18S rRNA genes. Molecular Phylogenetics and Evolution 21: 218-230.

Schroth, W., G. Jarms, B. Streit & B. Schierwater, 2002. Speciation and phylogeography in the cosmopolitan

moon jelly Aurelia sp. BMC Evolutionary Biology 2:1.

Seravin L. N., T.A. Shiganova and N.E. Luppova. 2002. History of studying the ctenophore Beroe ovata

(Ctenophora, Atentaculata, Beroida) and some structural features of its representative from the Black Sea

Zoologicheskyi Zhurnal 81: 1193-1200. (in Russian).

Shiganova, T. A, Y. V. Bulgakova, P. Y. Sorokin & Y. F. Lukasheva, 2000. Invasion of new settler Beroe ovata

in the Black Sea. Biology Bulletin. 2:247-255 (in Russian)

Swanberg, N. 1974. The feeding behavior of Beroe ovata. Marine Biology 24: 68-74.

Swofford, D. L., 2002. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.0.

Sinauer Associates, Sunderland, Massachusetts.

Thompson, J. D., D. G. Higgins & T. J. Gibson, 1994. CLUSTAL W: improving the sensitivity of progressive

multiple sequence alignment through sequence weighting, position specific gap penalties and weight

matrix code. Nucleic Acids Research 22: 4673-4680.

Trégouboff, G. & M. Rose, 1957. Manuel de Planktonologie Méditerranéenne. 2 Volumes. Centre National de

la Recherche Scientifique, Paris.

Vinogradov, M. E., E. A. Shushkina, E. I. Musayeva & P. Y. Sorokin, 1989. A newly acclimated species in

the Black Sea: the ctenophore Mnemiopsis leidyi (Ctenophora: Lobata). Oceanology 29: 220-224.

Vodyanitskii, V.A. (ed), 1968. Definition of the Fauna of the Black and Azov Seas. Vol. 1. Free-living Invertebrates.

Academy of Science of the USSR, Institute of the Biology of the Southern Seas, Kiev. (In Russian)

Zaika, V. E. & N. G. Sergeyeva, 1990. Morphology and development of Mnemiopsis mccradyi (Ctenophora,

Lobata) in the Black Sea. Hydrobiological Journal 26: 1-6.

Chapter 8

Introduction of Beroe cf ovata to the Caspian Sea needed to control Mnemiopsis leidyi

STANISLAV P. VOLOVIK & IRINA G. KORPAKOVAState Unitary Enterprize Research Institute of Fishery Problems (GUP AzNIIRKH)Rostov-on-Don, Beregovaya st. 21/2, Russian Federation

Keywords: Biological invaders, Sea of Azov, Caspian Sea, Biological Control, Mnemiopsis,Beroe.

When Beroe cf ovata appeared in the Sea of Azov, it rapidly decimated Mnemiopsis here, and a partial restoration of the pelagic food chain followed. Experiments were conducted with Beroe, to test for its salinity tolerance and temperature range, using Sea of Azov water, and Caspian water, which has a distinct ionic composition. Beroe is capable of surviving in both, and is limited only by the salinities of the extreme northern Caspian, 7.5‰ apparently being the limiting concentration. We argue that the stenophagous Beroecan be safely introduced to the Caspian, in order to save the fisheries and other compo-nents of the pelagic food chain there.

1. Introduction

The Caspian Sea, by virtue of its geographical position, isolation from the World Ocean, salt composition and salt content, and by the composition of its biota, represents a unique ecosystem. One of the major distinctive features of its biota is local diversifi ca-tion, measured by the high number of endemic species of the Caspian ecosystem relative to the other seas of Russia (Zenkevitch, 1963; Kosarev & Yablonskaya, 1994). The high biological efficiency of the basin is due to the fact that high-energy ecological niches are occupied by 1-2 or several rather closely related species. But this factor also creates an extraordinary vulnerability of the ecosystem. Ecological incidents occur, the succession (natural or anthropogenic) of which, even if affecting only one niche, has far-reaching consequences, defined by the length of the food chain and intensity of the attacking fac-tor. For this reason, the intrusion of new exotic species, capable of a high reproductive biological potential in Caspian conditions, may lead to real eco-catastrophes.

177




2. Mnemiopsis appears

Such a catastrophic event was the appearance of the ctenophore Mnemiopsis leidyi(A. Agassiz) in 1999 (Ivanov et al., 2000; CEP, 2001). As of 2000, it became a mass organism, causing large negative effects in the pelagic zone of the basin. According to the data of KaspNIIRKH, by the end of 2000 the rates of growth of Caspian sprat were 40-60% lower than usual, and the size and mass parameters of its age-groups, as well as total stock, were more than halved. At the beginning of 2000, a collapse of sprat and seals occurred, and the first half-year catches of sprat, herring, grey mullet, and seals were factors ten to hundred times lower than expected in the absence of Mnemiopsis (data of the Caspian scientifi c-fisheries council, Elista, August 23-24, 2001).

The experience gained on the biology and effects of Mnemiopsis in the Azov-Black Sea basin (Volovik, 2000) now becomes very useful. It allows to predict:1) The consequences of the intrusion of Mnemiopsis in the Caspian Sea will become

worse than in 2000-2001, since the existing food chain of the pelagic zone, based on zooplankton and sprat as first order predators, will be completely destroyed

2) The stocks of sprat and other fish, consumers of zooplankton and sprat, will sharply (probably, by an order of magnitude and more) decrease, and the behavior of fish in the traditional period of the formation of accumulations for fishery will change;

3) The catches of fish will decrease sharply, both because of stock reduction, and by a change in fish behavior. Thus, the efficiency of traditional fishing gear will drop or even cease to be applicable

4) It is easy to imagine the scope of economic losses and social problems that Caspian countries will face, should a practically complete degradation of the fisheries occur.

3. The Sea of Azov experience

A similar scenario materialized during the invasion of Mnemiopsis in the Azov Sea. One year after its intrusion, it provoked the degradation of anchovy and tyulka sprat fisheries. The catch of these fishes dropped to 12-15 103 t., i.e. decreased almost by 145 103 t. as had been the case during the preceding 25-year period. Five years after the intrusion of Mnemiopsis in the Black Sea, commercial catch losses of pelagic fi sh exceeded 600 103 t. y-1. The damage of these catch losses were estimated at 240-340 mil-lion US dollars (FAO Fish. Rep, 1994), while the Azov annual losses was estimated at 40-45 million US dollars (Volovik, 2000). Unfortunately, the Black Sea countries sub-scribed to a strategy “of doing nothing” about the ctenophore. Only in Russia did the State fishery committee, through the services of AzNIIRKH, organize a regular moni-toring of the Azov-Black Sea basin. Meanwhile, at the beginning of the 1990s, recipes for remedial measures against the ctenophore-Mnemiopsis and the damage caused by it were developed. It was recommended to utilize another ctenophore, Beroe ovata, which feeds only on other ctenophores (Mnemiopsis, Bolinopsis, Pleurobachia). Also some fi sh (e.g. of the genus Peprilus), whose ration consists of 70-100% of gelatinous organisms (Harbison & Volovik, 1993) were suggested. These recommendations were subsequently endorsed by the UN experts of GESAMP (1997).

Caspian Sea will control the local population of Mnemiopsis leidyi 179

In 1997, the Black Sea was spontaneously invaded by yet another ctenophore, Beroe cf ovata (Konsulov & Kamburska, 1998), and in 1999-2001 an explosive development in the north-eastern and some other districts of the Black Sea occurred. From the first year of its development, the zooplankton and the complex of pelagic fishes of the Black and Azov Seas reacted by a clear recovery (Shiganova et.al., 2000; Mirzoyan et al., 2001). A meeting organized within the framework of the Caspian Ecological Program (Baku, April, 2001), in which leading scientists dealing with ctenophore studies in different seas of the World ocean took part, recognized that under the prevailing circumstances Beroe ovata was the best choice for biocontrol (read: depressing) of the population of Mnemiopsis in the Caspian Sea (CEP, 2001).

4. Experimental work on Beroe in the Sea of Azov

In 2000-2001, AzNIIRKH, with financial support of State fishery committee of Russian Federation, carried out a series of studies of Beroe biology in the Azov and Black Seas. These included an assessment of its effect on the development of the local Mnemiopsispopulation, and a series of experiments on the tolerance of Beroe to environmental fac-tors (salinity, temperature, food, gases, etc.), with an aim at evaluating its acclimatization and production potential. The results confirm that Beroe cf ovata can live and reproduce in the southern, central and even in the southern part of the northern Caspian Sea, feeding only on the ctenophore Mnemiopsis. The reproductive potential of Beroe is close to that of Mnemiopsis, and its tolerance to environmental factors is similar to the correspond-ing parameters of Mnemiopsis, i.e. Beroe will dwell practically in the same places as Mnemiopsis. In other words, this species may be a “magic wand”, which largely (but not completely) will settle the ecological, economic and social problems that arose with the introduction of Mnemiopsis to the Caspian Sea.

5. Need for an introduction of Beroe cf ovata to the Caspian Sea

The possibility and benefits of an introduction of Beroe cf ovata to the Caspian Sea with the purpose of suppression of the development of Mnemiopsis are as follows:1. Reaction to salinity. In 1999-2001 we conducted a series of experiments on Beroe’s

reaction to water of a salinity equal to that of the Black, Azov and Caspian Seas. Partially, the results for 1999 are given in a publication by T. Shiganova and co-authors (2000). In the Black Sea, where the salinity is modally 10-14‰ (Zaitzev, 1998), and in a range from 18‰ near Turkey down to 10‰ near Odessa, both salt content and ionic composition, which are practically identical to that of the World Ocean (Zenkevitch, 1963), are favorable for this ctenophore. Both after a sudden transfer from Black Sea water with salinity 18‰ to water of 10.5‰, and after a con-tinuous decrease of salinity to the specified level, Beroe (small, medium and large specimens) behaved uniformly, preserving a typical motive and alimentary activity, and reproducing. This confirms the Azov Sea situation, where Beroe reproduced in the Kuban district at a salinity of 12-11‰. Therefore, a salinity of up to 10.5‰ may


be considered as favorable for Beroe. At a further drop of salinity of water, in aquar-ium conditions to 4.5‰, Beroe showed signs of a depression, especially intensifi ed at salinities below 7.5‰. The value of 7.5‰ can be recognized as the lower level of tolerance in water with a salt composition close to that of the World Ocean.

Experiments in water with a salt composition similar to that of the Caspian Sea (artificially prepared) have shown that Beroe reacts satisfactorily to Caspian water, preserving a typical mobility, feeding behavior and reproduction, and the produced eggs engaged in embryogenesis (Table 1, Fig. 1). At a sudden transfer of Beroe from Black Sea water (18‰) to Caspian water (12‰) the animals at first were depressed (about 3 hours) (settling on the bottom of the aquarium, changing colour, but with the cilia actively moving), then recovered and did not behave differently from specimens in a control sample (Table 1). The fact that all functions of vital activity in Caspian water were restored within 3-3.5 hours is confirmed by the regeneration of the light absorption spectrum by the pigment spots, up to a level of background parameters (Fig. 2). The minimum salinity of Caspian water at various temperatures, at which the animal felt comfortable was 6.5-7.5‰ Therefore, as far as saline conditions go, Beroe can inhabit the southern, central and the southern part of the northern district of the Caspian Sea (Figs 3, 4).

Figure 1. Progressive dilution (I-IV) of Black Sea with Caspian Sea water to acclimate Beroe ovata to Caspian Sea water (initial salinity 18‰)

Caspian Sea w

ill control the local population of Mnem

iopsis leidyi 181

Table 1. Adaptation of Beroe cf ovata to Caspian Sea water

Duration

of observation

(hour)

Variations of salinity in experiments*

I II III IV

Beroe size groups (cm)

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

0** Beroe placed in aquarium of definite salinity.

0.5 Individuals changed color and sank to the bottom,

cilia beating active.

Individuals immediately went to the bottom,

changed color, all of them were alive,

cilia beating active.

2 Moving in the water column, cilia beating active. Began to move, went up the water column.

3 Behavior not changed. Individuals of different size Mnemiopsis were added.

Beroe reacted with typical feeding behavior.

All individuals were alive and swam in water

column, color recovered.

5 Feeding behavior did not

change: if contact with

prey, swallowed it.

Did not feed but rather active moved. Individuals of first group actively swallowed prey.

Individuals of groups 2 and 3

were more active.

Individuals of 4 group

were more active.

Individuals of size group 2 and 3 began to feed.

8 Food digested, individuals

of groups 2 and 3 continued

feeding.

Most Beroe individuals in all size groups had

Mnemiopsis in gastrovascular cavity.

182P


Table 1. Continued

Duration

of observation

(hour)

Variations of salinity in experiments*

I II III IV

Beroe size groups (cm)

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

1. 5.5-6.0

2. 3.5-4.0

3. 2.0-2.5

4. 1.0-1.5

11 Individuals of groups 2 and

3 were more active.

Individuals of all sizes were

active, most individuals of

Beroe had Mnemiopsis in

gastrovascular cavity.

Most Beroe had

Mnemiopsis in

gastrovascular cavity.

Large individual Beroe of group 1 digests food,

small ones attacked large individual Mnemiopsis.

18 Movements and feeding behavior did not change. Activel feeding, all individuals of Mnemiopsis

ingested.

20 All animals now in Caspian water.

24 All alive. Locomotion and alimentary behavior without changes.

* changes in salinity are given in Fig. 1

** Dilution of the Black Sea water with Caspian water


Figure 2. Absorption spectrum by pigments of Beroe ovata in Caspian Sea water

2. Feeding behavior and duration of assimilation depended on Beroe size, but did not depend on whether these phenomena occurred in Black or Caspian Sea water (Table 1, Figs 5, 6).

3. Beroe reacted similarly to temperature in Black Sea and in Caspian water. With rising temperature, activity and vital functions increased (Figs 5, 6). The highest param-eters occurred at a water temperature of 20°C and more, and the processes were approximately identical. However, even at lower water temperatures Beroe can both feed, and propagate in the conditions of the Black and Caspian Sea (see Figs 7, 8). Thus, Beroe can dwell in the surface layer of the water column of the whole Caspian Sea, except its extreme northern and north-eastern districts (Figs 9, 10).

4. Beroe had a similar oxygen consumption rate (Figs 11, 12) in Black and Caspian Sea waters at different temperatures. This means that, under the prevailing oxygen con-tents, the full upper strata of Caspian waters (Fig. 13) will be accessible to Beroe.


Figure 3. Average salinity of upper level of the water column in the Caspian Sea (from Zenkevitch, 1963)

Figure 4. Average salinity in the northern region of the Caspian Sea (from Zenkevitch, 1963)


Figure 5. Food assimilation (hours) by Beroe ovata of different size in Black Sea water at different temperatures

Figure 6. Food assimilation (hours) by Beroe ovata during acclimation to Caspian Sea water at 26°C (I-IV: parallel series of experiments)

0

5

10

15

20

25

Ass

imila

tion

perio

d, h

.

12,5 20 22 23 26

Temperature of water, C

4,0-5,0 cm 2,0-3,0 cm

0

0,5

1

1,5

2

2,5

3

3,5

4

Ass

imila

tion

perio

d, h

.

5,0-6,0 3,0-4,0 2,0-3,0 1,0-2,0

Beroe length, cm

I II III IV Black Sea


Figure 7. Adaptation of Beroe ovata to lower temperature conditions in Black Sea water. Sizes of Beroe are up to 1 cm. Specimens stay near the bottom, beating cilia, structure of the body is normal (n=20).

Figure 8. Adaptation of Beroe ovata to lower temperatures Caspian Sea water


Figure 9. Average temperature (0C) of the upper level of the water column in the Caspian Sea (from Zenkevitch, 1963)

Figure 10. Temperature of water column (transect in meridional direction) in February (a) and August (b) (from Kosarev & Yablonskaya, 1994)


Figure 11. Velocity of oxygen consumption by Beroe ovata in function of its biomass in Black Sea and Caspian Sea water (temperature 18°C)

Figure 12. Velocity of oxygen consumption by Beroe ovata in function of its biomass in Black Sea and Caspian Sea water (temperature 28°C)


Figure 13. Dissolved oxygen content (mg/l) (transect in meridional direction) in February (a) and August (b) (from Kosarev & Yablonskaya, 1994)

5. It was not possible for us to estimate the fecundity of Beroe in Caspian waters. But in the Black Sea, fecundity of Beroe varies with size and experimental conditions, from 0.7 to 10.7 103 eggs per day. Within 2-3 days, specimens produced 3.7-18.3 103

eggs when sufficiently fed (Tables 2, 3). There is no reason why Beroe should not display a similar fecundity level in Caspian waters. It is necessary to stress that these fertility parameters are close to those found for Mnemiopsis too (Pianka, 1974; Shiganova, 2000). This confirms the widely held hypothesis of a similarly high pro-duction potential in both ctenophore species.


Table 2. Fecundity of Beroe cf ovata in different experimental conditions (t = 23°C)

Conditions of experiment Body size of Beroe (cm)Total number of eggs per

specimen

darkness + hunger 7.6x4.6 10,680

darkness + food (1 M.l* 3_4 cm) 7.6x4.4 10,773

6 h. in darkness + food (larva of M.l.) 6.0x5.5 1,444

12 h. in darkness + food (larva of M.l.) 6.0x5.5 722

24 h. in darkness + food (larva of M.l.) 6.5x5.5 2,527

24 h. in light + food (larva of M.l.) 6.1x5.3 1,800

24 h. in light + food (M.l. 4_3,3 cm) 5.8x4.8 1,560

feed – freezing M.l. 3.4x2.9 7,025

T=90C 6.7x4.8 48

* Mnemiopsis leidyi

Table 3. Fecundity of Beroe cf ovata (number of eggs per specimen per day) (t = 23°C)

NN day 1 day 2 day 3 Conditions of experiment

1 7,680 10,777 - Darkness

2 2,520 10,650 4,350

3 9,120 1,800 light + feeding (M.l. 4_3,3 cm)

4 2,040 1,680 light + feeding (larva M.l.)

6. Literature data (Kamshilov, 1961; Swanberg, 1974; Shiganova et al., 2000) as well as newly-obtained data confirm that Beroe is capable of consuming only other ctenophores. That implies that no damage will be caused to other representatives of the Caspian plankton, including eggs and larvae of fishes. Only Mnemiopsis will be eaten away. It is necessary to mention that Beroe can mechanically swallow other organisms, but this phenomenon, in our observations, happened rarely, and inciden-tally swallowed organisms were regurgitated without signs of damage.


6. Conclusion

A comparative evaluation of the distribution and biology of Beroe and of its effects on Mnemiopsis in the Black Sea with data from its possible habitat in the Caspian Sea, leads to the conclusion that Beroe can successfully inhabit the upper strata of the water column of most of the Caspian Sea. During the co-habitation of Mnemiopsis and Beroein the Azov-Black Sea basin, the latter reduced the number of Mnemiopsis briefly after its invasion and improved (but did not restore completely) the biological processes in the pelagic zone of the basin. A similar situation may be expected in the Caspian Sea, should Beroe ovata be introduced there.

The studies carried out in the Azov-Black Sea basin allowed us to formulate necessary measures to largely neutralize the effect of Mnemiopsis on the ecosystem of both Seas, even though these questions may demand further scientific elaboration. We conclude that introducing Beroe ovata to the Caspian Sea will mitigate the problems created by Mnemiopsis while not causing any damage or aggravation to the ecological situation in the Sea.

References

CEP, 2001. Caspian Environmental Program, Mnemiopsis workshop (Baku, 24-26 April 2001) final report;

CEP Wb site: http://www.http://www Caspian environment. org/biodiversity/meeting. Htm

GESAMP, 1997. Report for the Meeting UNEP/IMO/FAO/UNESCO. Second Meeting of the GESAMP

Working Group on Opportunistic Settlers and the Problem of the Ctenophore Mnemiopsis leidyi in the

Black Sea. Draft 2. Geneva. 20-24.03.95, 1995. - Published 1997. - 65 p.

Harbison, G. R. & S. P. Volovik, 1994. Methods for the Control of the Ctenophore Mnemiopsis leidyi in

the Black and Azov Seas. FAO Fisheries Report No 495. Rome, p. 32-44.

Harbison, G. R. & S. P. Volovik, 1994. S.P. The ctenophore Mnemiopsis leidyi in the Black Sea. In:

Nonindigenous Estuarine and Marine Organisms (MRMO), p. 25-26.

Ivanov, V. P., A. M. Kammakin, V. B. Ushivtzev, T. Shiganova, O. Zhukova, N. Aladin, S. I. Wilson, G. R.

Harbison & H. J. Dumont, 2000. Invasion of the Caspian Sea by the comb jellyfi sh Mnemiopsis leidyi


Kamshilov, N. M., 1961. A biology ctenophore of the Murman littoral. Publications of the Murmansk marine

biological institute. Edition. 3 (7).

Konsulov A. & L. Kamburska, 1998. Ecological determination of the new Ctenophore - Beroe ovata invasion

in the Black Sea. Studies of the Institute of Oceanology BAN, Varna, p. 195-197.

Kosarev, A. N. & E. A. Yablonskaya, 1994. The Caspian Sea. SPB Publishers, The Haque, 259 pp.

Mirzoyan, I. A., Volovik S.P. & M. Martinyuk, 2001. Features of development of the population of Beroe ovata

in the Azov-Black Sea basin and consequences of its intrusion. The Caspian floating university, in press.

Pianka, H. D., 1974. Ctenophora. In A. C. Giese & J. S. Pearse (eds), Reproduction of Marine Invertebrates,

Academic Press, New York, Vol 1: 201-265.

Shiganova, T. A., 2000. Some conclusions on studies of intruder Mnemiopsis leidyi (A. Agassiz) in the Black

Sea. In S. P. Volovik (ed), “Ctenophore Mnemiopsis leidyi (A. Agassiz) in the Azov and Black Seas:

biology and consequences of the intrusion. AzNIIRKH, Rostov-on - Don, pp. 33-75.

Shiganova, T. A., Y. V. Bulgakova, S. P. Volovik, Z. A. Mirzoyan & S. I. Dudkin, 1999. New intruder Beroe


ovata and its affect on the ecosystem of the Azov-Black Sea basin in August, - September 1999, p. 432-449.

Volovik, S. P. (editor), 2000. The Ctenophore Mnemiopsis leidyi (A. Agassiz) in the Azov and Black Seas:

biology and consequences of the intrusion. AzNIIRKH, Rostov-on - Don, 500 pp.

Swanberg, N., 1974. The feeding behavior of Beroe ovata. Marine Biology 24: 69-76.

Zenkevitch L. A., 1963. Biology of Seas of the USSR. Nauka, 739 pp.

Chapter 9

Feeding, respiration and growth of ctenophore Beroe cf ovata in the low salinity conditions of the Caspian Sea

AHMET E. KIDEYS1, GALINA A. FINENKO2,BORIS E. ANNINSKY2, TAMARA A. SHIGANOVA3,ABDOLGHASEM ROOHI4, MOJGAN ROWSHAN TABARI4,M. YOUSEFFAN4 & MOHAMMAD T. ROSTAMIYA4

1Institute of Marine Sciences, Erdemli, Turkey ([email protected])2Institute of Biology of Southern Seas, Sevastopol, Ukraine ([email protected])3P. P.Shirshov Institute of Oceanology RAS, Moscow, Russia ([email protected])4Mazandaran Fisheries Research Center, Sari, Iran ([email protected])

Keywords: Beroe cf ovata, Mnemiopsis leidyi, predation, acclimation, salinity, energy budget, Caspian Sea.

The ctenophore Beroe cf ovata, which spontaneously entered the Black Sea in the 1990s and suppressed the previous ctenophoran invader Mnemiopsis leidyi by its predatory impact, is currently considered for intentional introduction to the Caspian Sea as well. In order to assess its impact on Mnemiopsis in the Caspian, Beroe was transported during 2002 from the Black Sea and the Bosporus to the Khazerabad laboratory (Mazandaran), on the Caspian coast of Iran, where experiments on its survival in Caspian water, and on various physiological characteristics (feeding, respiration, reproduction and growth) of both ctenophore species were performed. Beroe cf ovata was found to adjust to Caspian salinity conditions without problems.

Beroe also readily fed on Mnemiopsis, but rejected all zooplankton food. The feeding rates measured are such that it can be predicted that Beroe will suppress Mnemiopsisin the Caspian at the same rate as it did in the Black Sea. The mean daily ration of Beroe was found to be 26-43% of its body weight. The daily specific growth rate of Beroe cf ovata makes up 0.1 (10%) of its body weight in conditions of food ad libitum. Under favourable food conditions, the population of Beroe was able to double its biomass in 10 days. An energy budget for Beroe cf ovata is provided.

193




1. Introduction

The ctenophore Mnemiopsis, native to the eastern coasts of America, caused great eco-nomic damage to the Black Sea in late 1980s. Inevitably, this ctenophore was transported to the Caspian Sea via the Volga-Don Canal in the mid-1990s (Ivanov et al., 2000). Its impact on this new environment almost immediately became significant. By October 2000, the abundance and biomass of Caspian zooplankton decreased 5-6 fold (Shiganova et al., 2001), and by late summer 2001, the important pelagic fishery of Iran had started declining (Kideys et al., 2001a; b). To deal with the problem, an international group of scientists under the umbrella of the Caspian Environmental program suggested several immediate actions. Among these were laboratory experiments with Caspian Mnemiopsisto evaluate its impact on the Caspian ecosystem quantitatively and laboratory studies on the predation of Beroe on Mnemiopsis, to find out whether Beroe could be used to control Caspian Mnemiopsis.

In order to document the effectiveness of a Beroe introduction against Mnemiopsisin the Caspian, specimens were transported from the Black Sea and the Bosporus to the Khazerabad laboratory (Mazandaran) on the Caspian coast of Iran, where experiments on its survival in Caspian waters, and on various physiological characteristics (feeding, respiration, reproduction and growth) of both ctenophore species were performed.

2. Acclimation of Beroe to low salinity

Beroe, generally made up of small individuals (10-40 mm), was transported to the Caspian coast of Iran in two batches: the first batch consisted of thirty Beroe, collected at Sinop, Turkey (southern Black Sea; salinity about 18‰) and transported to the labora-tory in Khazerabad (Mazandaran, Iran) in a 10 liter jar. The second batch consisted of about 60 Beroe, collected from the Bosporus (salinity around 22‰), transported by air to the same destination.

Seven specimens of the first batch were kept individually at 26°C in conditions of their original salinity of 18‰ in 5 liter containers for a day. The next day they were moved to the container with a salinity of about 16‰ and finally to a container filled with Caspian water (12-13‰).

A total of 42 individuals sampled from the Bosporus (salinity approx. 22‰) were similarly acclimated by lowering the salinity gradually over a period of four days. During acclimation, animals fed actively on Mnemiopsis and did not show any behav-ioral changes.

3. Feeding, respiration and growth rates of Beroe fed Caspian Mnemiopsis

A series of feeding experiments was undertaken to measure not only the feeding rate of Beroe on Mnemiopsis but also its digestion time, digestion rate, and prey size preference. Additional experiments were performed in order to clarify whether Beroe would also eat other zooplankton.

Feeding, respiration and growth of the Ctenophore Beroe cf ovata 195

Under conditions of free choice, in which four different size groups of M. leidyi, each in equal numbers were offered to B. cf ovata simultaneously, Beroe selected prey of a mean size. Small-sized Mnemiopsis comprised only an insignificant part of the daily ration. In the absence of choice (the same groups offered separately but at the same bio-mass level), Beroe consumed all sizes of Mnemiopsis at the same rate. This is important, as most Mnemiopsis in the Caspian Sea are small in size.

The relationship between the specific daily ration (SDR, g g-1 day-1) and Beroe wetweight at two food concentrations (I - 1.6; II - 1.0 g l-1) can be described by the two power functions (Fig. 1):

I - SDR= 3.184 W-0.841 r2 =0.852II - SDR = 0.842 W-0.904 r2 = 0.701

Figure 1. Effect of body weight on specific ration in Beroe cf ovata at 1.66 g/l (I; Log SDR = Log 3.184 - 0.841 Log W, r2 = 0.852) and 1.00 g/l (II; Log SDR = Log 0.842 - 0.904 Log W, r2 = 0.701) food concentration

The difference between the specific daily rations at the food concentrations tested showed that food conditions are significant to Beroe feeding. In long-term experiments, the mean daily ration of Beroe was found to be 26-43% of its own body weight.

Digestion time of B. ovata feeding on M. leidyi at 21 ± 1°C varied from 30 to 450 minutes in the studied weight range of both ctenophores (13-38 mm in Beroe and 3-27 mm in Mnemiopsis). The interval between two subsequent engulfings usually ranged from 95 to 720 minutes. Every size of Beroe consumed both small and large M. leidyi; but the ratio between prey and predator weight in these experiments had no significant effect on digestion time (Fig. 2). Beroe did not feed on Artemia salina or Acartia tonsa, even when offered in abundance.

I

II

0.10 1.00 10.00Body wet weight (g)

0.01

0.10

1.00

10.00

100.00

Spec

ific

dai

ly ra

tion

(g g

-1 d

ay-1

)


Figure 2. Effect of prey/predator weight ratio (P) on digestion time (D) in Beroe cf ovata in Caspian water at 21°C (I; Log D = Log 249.4 + 0.3 Log P, r2 = 0.55) and 26°C (II; Log D = Log 117.8 + 0.17 Log P, r2 = 0.18)

The relationship between oxygen consumption rate (Q, ml O2ind-1 h-1) and wet weight

of B. ovata (g) at 21-23°C is expressed by the equation (Fig. 3): Q = 0.0052 W1.02 r2 = 0.87.

The value of 1.02 indicates that the weight – specific respiration rate was independent of weight over the measured weight range of 0.23-3.87 grams.

Analysis of Beroe respiration rate in Caspian Sea water (Q= 0.0052 W1.02) has shown that this rate is lower than that in the Black Sea (Q = 0.341DW1.04, r2 = 0.98; n = 17;at 21 ± 1°C); where Q is respiration rate (ml O

2 g-1 h-1), W is wet weight and DW is dry

weight (g) (Finenko et al., 2001).In a long-term experiment (12-14 days), average weight for three Beroe of similar

initial weight (3.17 g or 30 mm length) increased during the experiment, and growth was well expressed by the following exponential function (Fig. 4): W = 2.615 e0.101 t r2 = 0.964, (W: wet weight, and t: time, in days).

The daily specific growth rate of Beroe cf ovata according to this equation makes up 0.1 (10%) of its body weight. This high value was obtained in conditions of food adlibitum and demonstrates its high growth potential. Exponential growth supposes the same specific growth rate in animals of a different size (it does not depend on cteno-phore weight); so, the population of Beroe in favorable food conditions could double its biomass in 10 days.

The energy budget of B. cf ovata was calculated and is presented in Table 1.

2 4 6 8 2 4 6 8 2 4 6 8 2 4 6 80.00 0.01 0.10 1.00 10.00

Prey/predator weight ratio

2

4

6

8

2

4

6

8

10

100

1000

Dig

estio

n tim

e, m

in

I

II


Figure 3. Relationship between respiration rate (ml O2

ind-1h-1) and wet weight (g) in Beroe cf ovata in Caspian Sea water (Log Q = Log 0.0052 + 1.02 Log W, r2 = 0.87).

Figure 4. Growth of Beroe cf ovata in Caspian Sea water (Ln W = Ln 2.615 + 0.101, r2 = 0.964).

We were able to reproduce Beroe in the laboratory. During our experiments 128 eggs of Beroe were obtained and seven of these were hatched into larvae.

But although we were able to obtain eggs and on occasion also larvae, continued larval development experiments were not successful in the laboratory. However, it is still pos-sible that successful development may take place in field conditions, and more work in this field remains highly desirable.

0.1 1.0 10.0Wet weight (g)

0.001

0.010

0.100

Res

pira

tion

rate

(ml O

2/in

d/h)

0 4 8 12t, days

2

3

4

5

6

789

1

10

W, w

eigh

t, g


Table 1. Daily energy budget (cal. ind-1 day-1) of Beroe cf ovata in a long-term experiment

Initial

weight, g

C R G A a K1

K2

3.17 18.06 4.73 11.27 16 0.88 0.62 0.7

3.17 10.73 2.89 4.1 6.99 0.65 0.38 0.59

3.17 17.11 3.57 7.7 11.27 0.65 0.45 0.68

Average 0.72 ± 0.13 0.48 ± 0.12 0.66 ± 0.06

C: daily ration, R: respiration rate, G: growth, A: assimilated food in cal. ind-1 day-1; a: assimilation efficiency, and

K1 and K2 are coefficients. The energy content of M. leidyi is 6.8, that of B. cf ovata is 17 cal. g-1 wet weight.

4. Conclusions

We conclude that (1) Beroe is able to adjust to and survive in Caspian water, (2) in a Caspian Sea water environment, Beroe is ingesting Mnemiopsis to a degree suffi cient to decrease its abundance as sharply as in the Black Sea, (3) reproducing Beroe in Caspian water in limited preliminary laboratory trials was not successful, but should be repeated.

Note added in proof

Experiments on reproduction of Beroe cf ovata in the Caspian Sea water were successful in 2002-2003 in several institutes, where they were performed by authors. Beroe could reproduce, larvae could hatch, larvae could feed on Mnemiopsis larvae and grew.

References

Finenko, G. A., B. E. Anninsky, Z. A. Romanova, G. I. Abolmasova & A. E. Kideys, 2001. Chemical com-

position, respiration and feeding rates of the new alien ctenophore, Beroe ovata, in the Black Sea.


Ivanov, P. I, A. M. Kamakim, V. B. Ushivtzev, T. Shiganova, O. Zhukova, N. Aladin, S. I. Wilson, G. R.

Harbison & H. J. Dumont, 2000. Invasion of Caspian Sea by the comb jellyfi sh Mnemiopsis leidyi


Kideys, A. E., S. Ghasemi, D. Ghninejad, A. Roohi & S. Bagheri, 2001a. Strategy for combatting Mnemiopsis

in the Caspian waters of Iran. A report prepared for the Caspian Environment Programme, Baku,

Azerbaijan, Final Report, July 2001.


Kideys, A. E., F. M. Jafarov, Z. Kuliyev & T. Zarbalieva, 2001b. Monitoring Mnemiopsis in the Caspian

waters of Azerbaijan. A report prepared for the Caspian Environment Programme, Baku, Azerbaijan, Final

Report, August 2001.

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushivtzev, A. B. Dulimov & E. I. Musaeva, 2001.

An invader in the Caspian Sea: ctenophore Mnemiopsis and its initial effect on pelagic ecosystem.

Oceanology 41: 1-9.

Chapter 10

A brief résumé of the status of the Mnemiopsis population in the Turkmen sector of the Caspian Sea according to observations during the first half of 2002

FIRDOUZ M. SHAKIROVAAshgabad, Turkmenistan

A critical situation has arisen in the Caspian ecosystem, in particular in its pelagic zone as a result of an invasion by Mnemiopsis leidyi in 1998-1999. The situation resembles that in the Azov-Black Seas, but with an even more rapid effect.

Based on experience in biological and ecological research as well as in research on the Mnemiopsis invasion in the Azov-Black Sea basin, a prognosis can be made on the Caspian Sea situation, which is supposed to entail considerable economic and social consequences (Volovik, 2000; Volovik & Karpakova, 2001; Kideys et al., 2001).

Mnemiopsis biomass of 1 kg ± 10% per m2 (raw weight without net catch rate) was proposed as an alarm figure, in compliance with data on this comb-jelly in the Black Sea in 1988. In April 2001, this figure was suggested as a reference point at an interna-tional workshop, organized by CEP at Baku, with the participation of leading specialists on comb-jelly studies in different parts of the world. Appropriate measures should be requested of the governments of the littoral states as soon as the Caspian Sea reached this critical level. According to results on Mnemiopsis dynamics, a biomass of 470 g/m2

was registered in summer 2000 and was supposed to increase substantially in 2001, so that the ecosystem was expected not to be able to manage it.

In December 2001, regional experts presented the status of Mnemiopsis population in the sea at a Workshop of the CEP Regional Advisory Group and made a statement on considerable impact of the comb-jelly on the Caspian ecosystem.

Viewed against this background, the research on status, biomass and number of Mnemiopsis in the Turkmenistan sector of the Caspian Sea revealed the following situa-tion in the first half of 2002:- February 3-4, 2002 - Mnemiopsis was not found in Krasnovodsk bay. The catch was

carried out with an ichthyoplankton net (50 cm diameter), close-meshed gauze of 500 µm, at a depth of 5 m and with a water temperature of 7°C.

- April 13-14 – the comb-jelly was found in the Bekdash region (at Karabogaz bay). The catch was carried out at a depth of 6.5 m, with a water temperature of 10.8°C.

201




- Observations in the first half of June 2002 revealed the presence of the comb-jelly from Turkmenbashi to Gasankuli. The catch was carried out in the open sea and in bays (Krasnovodsk and Turkmen bays).

- The largest groups of specimens were registered in Krasnovodsk bay, at a depth of 5 m, where their number varied from 30 to 70 species m-2, and their biomass from 6.14 to 31.95 g m-2.

- In Turkmen bay (Cheleken region) at a depth of 1.5-2.0 m, the number was around 40 ind. m-2, and biomass varied from 67.17 to 326.7 g m-2, while at Cheleken itself, numbers reached 30 ind. m2, and biomass varied from 5.19 to 6.16 g m-2. This con-siderable variation in biomass resulted from the fact that young specimens (3-5 mm, occasionally 7-8 mm long) occurred in Turkmenbashi, Cheleken, Okarem and Gasankuli. Mature specimens, with size 23-25 mm, have been caught only in Turkmen bay and at Cheleken.

- In Okarem region, at a depth of 5-8 m, the number of specimens varied from 20 to 60 m-2, and biomass varied from 5.66 to 37.79 g m-2.

- In Gasankuli, at a depth of 3-4 m the number of jellies reached 60 m-2, with biomass of 33.06 g m-2.

We conclude that an important fraction of young individuals occurred in the region, which shows the potential for increase of Mnemiopsis in the area. According to fi sher-men, numerous mature species were found in the preceding winter season (December-February) in Turkmen bay, in Cheleken and Gasankuli regions, at depths of 1.0-1.5 m. The size of these specimens reached 3-4 cm. They were actively swimming, and were found in fish and crayfish nets.

References

Kideys A. E., F. M. Jafarov, Z. Kuliyev & T. Zarbalieva 2001b. Monitoring Mnemiopsis in the Caspian waters

of Azerbaijan. A report prepared for the Caspian Environment Programme, Baku, Azerbaijan, Final

Report, August 2001

Volovik, S. P. (ed). 2000. Ctenophore Mnemiopsis leidyi (A. Agassiz) in Azov and Black Seas: Biology and

Consequences of its Intrusion. In S. P. Volovik (ed), Rostov-on-Don: 498 pp.

Volovik, S. P. & E. Karpakova, 2001. The Ctenophores Mnemiopsis leidyi and Beroe ovata in the Sea of Azov

(Azov Sea research Institute for Fisheries, Rostov-on-Don, Russian Federation) NATO ARW.Baku.

Chapter 11

Dynamics of Mnemiopsis distribution in the Azerbaijan sector of the Caspian Sea in 2001-2002

ZULFUGAR M. KULIYEVAzerNIRKH, Azerbaijan Republic, Baku, 16 Damirchizadeh street.fi [email protected]

In 1997-1999, Mnemiopsis was first found in the Caspian Sea. Jelly-like organisms (Caspian endemics and invasive species) are not normally numerous and they do not impact on the total biomass of commercially exploited species. But in 2000, the Mnemiopsis biomass considerably increased, especially in the South and Middle Caspian regions where mesoplankton biomass collapsed (Shiganova et al., 2000; Sokolskiy et al., 2001).

Taking into consideration the potential impact on fish reserves by the Mnemiopsisinvasion, AzerNIRKH, in April 2001 developed a research program on distribution, num-ber and biomass of Mnemiopsis in the Azerbaijan sector of the Caspian Sea.

The programme provided a survey of the comb-jelly at depths of 0-25 m at five sta-tions – Yalama, Siyazan, Primorsk, Neftechala and Lenkoran in the Middle and South Caspian, where constant observation stations are located. In addition, it was planned to sample other sections. In spring 2001 and spring 2002, observations were carried out at three stations– Nabran (Yalama-6), Primorsk and Liman (Narimanabad-1) at depths up to 5 m.

The equipment and methods used during researches were coordinated with CEP experts, and abiotic factors such as temperature, salinity, transparency and oxygen concentration in water at all sections and depths were determined from July 2001 till the present.

Different size and age groups of Mnemiopsis were registered. The highest biomass was registered at Sumgayit (Jorat) station at a depth of 10 m (up to 271.0 g m-3), at the Shikhov settlement, at a depth of 3 meters (up to 247.8 g m-3), at the Liman settlement (137.0 g m-3) and in Siyazan at a depth of 5 meters (151,9 g m-3). Over 12 thousand comb-jellies have been processed across this period of time.

Analysis of Mnemiopsis distribution in summer (July-August) revealed that small-sized specimens, up to 15 mm long, predominated along the coast (from 70.7 to 98.8%), and made up 89.1% of the population on average.

203




It should be mentioned, that size varied between the sections. The biggest comb-jellies were isolated specimens, 61-65 mm long. Small specimens (young and juveniles) formed a majority and made up 70% of the total. In Lenkoran, small specimens predominated at a depth of 10 m (91.3% of the total).

In autumn, the research was extended and carried out at 10 sections. The analysis of size characteristics now showed that the number of groups of young individuals had increased, but their individual size had become reduced. The majority was up to 10 mm long, and their number varied from 71.1 to 100%, 86.3% on average. The minimum number of Mnemiopsis was found in northern areas (Yalama and Khachmaz), and the population increased in abundance southward.

High numbers of young indicate that there is still a high rate of reproduction, which was found to extend from July to October. The sampling carried out in November at seven sections revealed a considerable reduction of the population, which dropped to 5% of the previous figures. In some sections (Borisov shoal, the Kura estuary) the comb-jelly was not found at all, or only in small numbers. Over 60% of the total number was now found in Liman.

Sampling in December - January revealed no comb-jellies in the Middle Caspian and a minimum number in the coastal zone of the Apsheron Peninsula (only in one of three samples: 2 specimens, 0-5 mm). A considerable reduction of the population (less than 10 individuals per sample) was also discovered in the South Caspian (Liman) region. Moreover, no big individuals were found.

A new increase was registered at the end of February and in the beginning of March, when small comb-jellies were found at three sampling points. An increase in numbers and biomass was observed in spring, with biomass reducing from the South to the North. In the South Caspian (Liman) region, the biomass reached 70 g m-3, in Primorsk it was 34 g m-3, but in Yalama it was only 14 gm-3.

All our data on distribution, number and sizes of the comb-jelly in the coastal zone of Azerbaijan have been registered in an electronic database.

References

Shiganova, T. A., A. M. Kamakin, O. P. Zhukova, V. B. Ushivtsev, A. B. Dulimov & E. I. Musaeva, 2000.

An Invader of the Caspian Sea-Comb Jelly Mnemiopsis sp. and the First Consequences of Its Infl uence

upon the Pelagic Ecosystem. Meeting of Caspian Environmental program. Baku.

Sokolsky A. F., T. A. Shiganova & L. A. Zytov, 2001. The biological pollution of the Caspian Sea by the comb

jelly Mnemiopsis and the first results of its impact on the pelagic system. In: Fisheries Researches in

the Caspian. Astrakhan:105-109. (in Russian).

Chapter 12

Investigation on the distribution and biomass of Mnemiopsisin the Kazakhstan sector of the Caspian Sea in May 2002

YULIA A. KIM, L. V. KWAN & G. DEMESINOVAKazNIIRKHThe Republic of KazakhstanAtyrau, 5 Seyfullin str.

The necessity of a constant observation of the Mnemiopsis population in the Caspian Sea has been stated repeatedly at the meetings of the Caspian states.

In the Kazakhstan sector, a considerable number of Mnemiopsis has been registered in the Middle Caspian only, but no advanced research has been carried out in deep-sea regions, due to technical reasons. In summer 2001 and in early May 2002 the sampling was organized mainly at a depth of 10 meters in the North Caspian. It was carried out with a Juday net of the Caspian type, with an opening diameter of 50 cm.

No jelly-like species were found during these surveys in the northeastern part of the sea in 2001(depth - less than 4 m, salinity - from 4 to 7‰). In deeper areas, with depth up to 10 m and salinity 8‰, jelly-like organisms were reduced to a shapeless mass. It is hard to separate individuals within this whole mass. As it has been already stated, there is much suspended matter in these areas, making the water very turbid. Furthermore, salinity is low here.

The research of 2002 did not reveal jelly-like organisms in these same water areas. Probably, this fact is connected with a cold spring and low water temperature. No infor-mation about comb- jellies has been received from other regions of Kazakhstan sector either.

Some conclusions on Mnemiopsis distribution may eventually be drawn on the basis of the results of the All-Russian expedition. Another study is planned. It will be carried out in July 2002, with the participation of all Caspian states.

205

H. Dumont et al. (eds.),, 205.


PART 2

Ponto-Caspian species invading Europe; information network

Henk A. M. Ketelaars Range extensions of Ponto-Caspian . . . . . . . . . 209aquatic invertebrates in Continental Europe

Erkki Leppäkoski Living in a sea of exotics . . . . . . . . . . . . . . . . . . 237– the Baltic case

Vadim E. Panov Internet-based information resources . . . . . . . . 257of aquatic alien species relevant to the Ponto-Caspian Region

Chapter 13

Range extensions of Ponto-Caspian aquatic invertebrates in continental Europe

HENK A. M. KETELAARSWater Storage Company Brabantse Biesbosch. PO Box 61 NL-4250 DB WerkendamE-mail: [email protected]

Keywords: Ponto-Caspian, Rhine, Baltic, exotic species, range extension, Main-Danube Canal.

The dispersal of Ponto-Caspian aquatic invertebrates outside their historic geographical range during the past 200 years was mainly caused by the construction of canals between previously separated biogeographic regions and to unintentional transport via ballast water of vessels. In addition, intentional introductions outside their native range facili-tated further spread of Ponto-Caspian species. Since the beginning of 1990 their spread has been accelerated by the opening of the Main-Danube Canal in southern Germany.

Four main migration corridors can be distinguished: a northern corridor connecting the Rivers Don and Volga with the Baltic Sea, a north central corridor, connecting the River Dnieper with the Baltic Sea region and the River Rhine basin, a south western corridor, connecting the River Danube with the Rhine and neighbouring basins, and a southern corridor through the Mediterranean.

1. Introduction

The Ponto-Caspian region, i.e. the Black and Azov seas and the Caspian Lake including estuaries and lower reaches of rivers draining into these water bodies, has a very high level of endemism. The Caspian Lake itself contains about 400 metazoan species that are endemic to the lake or are partly shared with the Black-Azov and Aral Seas, whereas the Black and Azov Seas have 19 endemic species (Mordukhai-Boltovskoi, 1979; Dumont, 2000, Grigorovich et al., 2003). The euryhalinity of the Ponto-Caspian biota (Dumont, 1998) makes them ideally pre-adapted to invade (and survive in) new environments, as pointed out for the Ponto-Caspian Onychopoda by Dumont (2000).

The construction of canals between previously separated biogeographic regions, led to a range extension of many Ponto-Caspian species. Since the 17th century numerous canals have been constructed in Europe (Table 1; Fig. 2), through which species actively

209




Table 1. Some major canals linking large rivers in Europe

Canal Connected basins Year opened SynonymLength

(km)

1 Volga-Don Canal Don, Volga 1951 60

2 Volga-Baltic

Waterway

Volga, Neva 1810 600

3 Ahinski Kanal* Dnieper (Prypyats),

Neman

1784 Oginski Kanal;

Königskanal

50

4 Kanal Dnyaprowska-

Buhski

Vistula (Bug),

Prypyats (Dnieper)

1784 Pripet-Bug Kanal 75

5 Kanal Augustowski Vistula (Biebrza), Neman 1839** 101

6 Kanal Bydgoski Vistula, Oder (Notec) 1774 Bromberger Kanal 27

7 Finow Kanal Oder, Elbe (Havel) 1746 32

8 Oder-Havel Kanal Oder, Elbe (Havel) 1914 Hohenzollernkanal 83

9 Elbe-Havel Kanal (inside Elbe basin) 1942** 56

10 Mittellandkanal Elbe, Weser, Ems 1933 321

11 Rhein-Herne Kanal/

Dortmund-Ems Kanal

Ems, Rhine 1914/1899 45/269

12 Ludwig Main Donau

Kanal

Danube, Rhine (Main) 1845 Ludwigskanal 173

13 Main-Donau Kanal Danube, Rhine (Main) 1992 171

14 Canal du Rhône au

Rhin

Rhine, Rhône 1834 320

15 Canal de la Marne

au Rhin

Rhine, Seine (Marne) 1853 316

Note: Numbers refer to Figure 2. Spelling of the canal names is according to The Times Comprehensive Atlas

of the World Millenium Edition, Times Books, London (1999), except no. 1 and 2. Opening years are

mainly after Jazdzewski (1980).

*: not in use anymore (Bij de Vaate et al., 2002);

**: canal not fully completed; year indicates when construction was stopped.

Range extensions in C

ontinental Europe

211Figure 1. Migration corridors of Ponto-Caspian aquatic invertebrates outside the Ponto-Caspian basin (extended and modified from Bij de Vaate et al. (2002)).


migrated, or were aided by shipping traffi c (Jazdzewski, 1980), either inside in ballast or bilge water or outside on the ship’s hull.

As early as 1614 the first connection between the basins of the rivers Oder and Elbe, the Finow Canal, was finished, but destroyed soon afterwards in the Thirty Years War. In 1746 the second Finow Canal was completed. Since 1914 the basins are, however, also connected with the much broader Oder-Havel Canal. The Ahinski Canal between the tributaries of the rivers Vistula and Dnieper, finished in 1784, was one of the early con-nections between the Ponto-Caspian basin and the Baltic region. Supposedly Dreissena polymorpha used this corridor for its spread outside the Ponto-Caspian basin (Bij de Vaate et al., 2002), probably with the large wood transports from the Dnieper basin to the Baltic Sea (Rudolph, 1997). Nowadays this corridor does not exist anymore (Bij de Vaate et al., 2002).

The Volga-Baltic Waterway was started in the beginning of the 18th century and com-pleted in the 1930’s. It consists of the River Volga, the River Sheksna, the White Lake Canal, the River Vytegra, the Onega Canal, the River Svir, the Ladoga Canals, and the River Neva to Sankt Peterburg.

The connection of the Baltic Sea region with the Rhine drainage area was established when the Mittellandkanal was completed in 1933, connecting the Rhine-Herne Canal and Dortmund-Ems Canal with the Elbe-Havel Canal. Although the connection still does not permit continuous navigation, this will soon be the case when the Magdeburg Waterways Bridge connects the Elbe-Havel Canal directly with the Mittellandkanal.

An important corridor for the Ponto-Caspian fauna to reach Western Europe is undoubtedly the Main-Danube Canal, directly connecting the Rhine basin with that of the Danube.

The first attempt to connect both basins dates back to 793 A.D., but Emperor Charlemagne failed to complete the Fossa Carolina, a canal between the headwaters of both basins. King Ludwig I of Bavaria did succeed to build a waterway between Bamberg (Main) and Kelheim (Danube) from 1837 to 1845 (Bryson, 1992). The Ludwig Canal functioned for almost a century, but due to the small locks and competition by new railways it was not a profitable project. In 1921 a company was formed to build a broader and deeper canal in the same area. After 70 years of building the Main-Danube Canal was officially openend in 1992. The canal has 16 locks, numerous hydroelectric power sta-tions and pumps an estimated 150 million cubic metres of water from the Danube basin into the Rhine basin per year (Tittizer, 1996a, 1997). Southward dispersal from the Rhine basin is possible through many canals between the Rhine basin and the Meuse, Scheldt and Rhône basins and further south with canals to the Seine and Loire basins (Fig. 2).

In Eastern Europe, especially in the 1960s and 1970s, the Ponto-Caspian region has been the favourite source for the transfer and “acclimatization” of nonindigenous species to water bodies, in particular new impoundments on large rivers, in order to “enrich” the fauna and as a direct food source for fish (Jazdzewski, 1980; Mordukhai-Boltovskoi, 1979). These “inoculations” sparked further spread of the Ponto-Caspian fauna outside their original range, as was already pointed out by Zhuravel in 1965, who explicitly called these new environments the nuclei (“otchagi”) of further dispersal (Dumont, 2000).

In this contribution the migration pathways of Ponto-Caspian species that dispersed outside their original distribution range are discussed.


ontinental Europe

213Figure 2. Canals between large rivers in Europe and reservoirs on large rivers in eastern Europe (see Table 1 for names of thenumbered canals).


2. Migration pathways

In addition to the intentional introductions four main migration pathways can be identifi ed (extended and modified from Bij de Vaate et al., 2002; Cristescu et al., 2001; MacIsaac et al., 2002) (Fig. 1): i) the northern corridor, combining the route from the Black and Azov Seas via the Don River and Volga-Don Canal to the Volga with the route straight from the Caspian Lake via the River Volga to Lake Beloye and from there via the Volga-Baltic Waterway to the Baltic Sea; ii) the north central corridor, connecting the Black and Azov Seas via the River Dnieper, the River Prypyats, Dnyaprowska-Buhski (=Bug-Prypyats) Canal and River Vistula to the Baltic Sea and further westward through canals connecting the Vistula, Oder, Elbe, Weser and Ems basins with the Rhine basin; iii) the south central corridor connecting the Danube River with the Rhine basin and adjacent basins through the Main-Danube Canal; iv) the southern corridor consisting of transport in ballast water directly from ports on the Black and Azov Seas.

Many reviews have dealt with Ponto-Caspian species that extended their range, outside the Ponto-Caspian region to Europe (Bij de Vaate et al., 2002; Jazdzewski, 1980; Kinzelbach, 1995; Leppäkoski, 1984; Leppäkoski & Olenin, 2000; Tittizer, 1996b; Van der Velde et al., 2002). In the present paper, this information is summarized and supplemented with new information on further spread. In addition, the paper deals with Ponto-Caspian species that have extended their historic geographical ranges, within the vast Ponto-Caspian drainage area. For an extensive review of the endemic Pontic species that are now found in the Caspian Lake (e.g. Dreissena bugensis, Hypanis colorata) one is referred to Grigorovich et al. (2003). Introductions of invertebrate species outside their native ranges into and within the Ponto-Caspian region are described by Grigorovich et al. (2002).

Table 2 lists the Ponto-Caspian aquatic invertebrates which have been recorded out-side their native region, especially in the Baltic region, the Rhine basin, North-Eastern Europe (especially Poland), rivers, canals and reservoirs on major rivers in the Russian Federation, Ukraine, Moldavia and the upper River Danube. The migration route has also been indicated. Intentional introductions are also considered to be a route, even if the species was a chance component of the introduction. Of some species the native region has not been established unequivocally. Because these species often occur in published lists of Ponto-Caspian invaders they have not been omitted, but are put between brackets. For some species it is not certain if they really spread beyond their historic range. Several invertebrates inhabit the lower courses of rivers that drain into the Black and Azov seas and the Caspian Lake. Canal construction in the lower reaches of the rivers gives the opportunity to spread, but it is doubtful if this really can be classified as range extension. E.g. during the 1960s and 1970s a complex network of canals was constructed in south-ern Ukraine (Grigorovich et al., 2002), permitting invertebrates like Corophium mucro-natum, C. maeoticum, Gmelina pusilla and G. costata to move up the canals. If they reached other basins, however, one can denominate them as having extended their range.

Some well known Ponto-Caspian invaders like Dreissena polymorpha, Cordylophora caspia and Corophium curvispinum (syn. Chelicorophium curvispinum) are discussed only briefly. The reader is referred to the above-mentioned reviews for a full description of their range extensions.


ontinental Europe

215Table 2. Occurrence of Ponto-Caspian invertebrates outside their native region with migration corridors

Occurrence Route References

Species name UD RR B NE Rh Other A N1 N2 NC SC S Other

Turbellaria Dendrocoelum romanodanubiale X X X 1,2

Oligochoerus limnophilus X X X ? 3

Cnidaria (Blackfordia virginica)* Loire estuary X? 4,5

Cordylophora caspia X X X X X World wide X X X 6

Polypodium hydriforme

Maeotias marginata X X Loire estuary X X 4,7,8

Moerisia maeotica World wide X 6

Bryozoa Victorella pavida World wide X 6

Annelida Archaeobdella esmonti X X

Caspiobdella fadejewi X X X? X 10,11

Cystobranchus fasciatus** X X 9,12

Hypania invalida X X X Meuse X X 12,13,14,15

Hypaniola kowalewskyi X X

Manayunkia caspica X X


(Paranais frici)* X X X X X ± Worldwide n.r. 16,17,18

(Potamothrix heuscheri)* X X X X X ± Worldwide n.r. 16,17,18

216P


Table 2. Continued



(Potamothrix vejdovskyi)* X X X X X ± Worldwide n.r. 16,17,18,19

Psammoryctides deserticola X X

Acarina Caspihalacarus hyrcanus X X X 1

Mollusca Dreissena bugensis X X

Dreissena polymorpha X X X X X X X 21

Hypanis colorata X X X X 12,18,20

(Lithoglyphus naticoides)* X X X X X X 10,18,22

(Theodoxus danubialis)* ? ? 23

Theodoxus pallasi X X X X? X 6,12,24

(Valvata naticina)* ? ? 23

Crustacea Cercopagis pengoi X X X X 25,26,27

Cladocera Cornigerius bicornis X X X 12,27

Cornigerius maeoticus X X 12,17

Podonevadne trigona ovum X X X 12,17

Copepoda (Calanipedia aquaedulcis)* X X 17,18,28

Heterocope caspia X X 17,18

Limnocletodes behningi X Asia X 9,12


ontinental Europe

217Table 2. Continued



Paraleptastacus spinicaudata

triseta**

X X

Schizopera borutzkyi** X X 9

Schizopera neglecta Mediteranean Sea X 12,29

Amphipoda Amathillina cristata X X 20,30

Corophium chelicorne X X

Corophium curvispinum X X X X X Meuse, GB X X 12,30,31

Corophium maeoticum** X X 9

Corophium mucronatum** X X 9

Corophium nobile X X

Corophium robustum X X 9,20

Corophium sowinskyi** X X 32

Dikerogammarus bispinosus

Dikerogammarus haemobaphes X X X X X X X X 10,12,34,35

Dikerogammarus villosus X X X Rhône, Meuse X 6,36,37,38,39

Echinogammarus ischnus X X X X X X 9,30,40,41

Echinogammarus trichiatus X X X X? X 10,42,43

218P


Table 2. Continued



Echinogammarus warpachowskyi X X X X X 9,30,44

Gmelina costata** X X 9

Gmelina kuznetzowi** X X 20

Gmelina pusilla** X X 9

Iphigenella andrussowi X X

Iphigenella shablensis** X X 9

Niphargus hrabei

Obesogammarus crassus X X X X X 20,30,44

Obesogammarus obesus 12,46

Pontogammarus aralensis X X

Pontogammarus maeoticus X X

Pontogammarus robustoides X X X X X X X? 10,30,44

Pontogammarus sarsi X X? X?

Pontogammarus subnudus** X X? X? 20

Stenogammarus carausui** X X? X? 20

Stenogammarus macrurus X X? X?

(Stygobromus ambulans)* X X ? 32,47


ontinental Europe

219Table 2. Continued



Isopoda Jaera istri X X X X X 1,6,12,48,49

Mysidacea Hemimysis anomala X X X X X Meuse, Scheldt X X *** 50,51,52

Limnomysis benedeni X X X X X Meuse X X 50,53,54,55

Katamysis warpachowskyi X X X 9,56

Paramysis baeri X X 12,20

Paramysis intermedia X X

Paramysis kessleri X X

Paramysis lacustris X X X 12,57

Paramysis ullskyi X X 6,12

Cumacea Caspiocuma campylaspoides X X

Pseudocuma cercaroides X X

Pterocuma pectinata X X

Pterocuma rostrata** X X 9

Pterocuma sowinskyi X X

Schizorhynchus eudorelloides X X

Stenocuma tenuicauda X X

220P


Table 2. Continued



Decapoda Astacus leptodactylus X X X X X 48,58,59

(Astacus astacus colchius)* X Aegean Sea? X X? 9,12,60

Note: Occurrence: UD: upper Danube; RR: reservoirs in the Ponto-Caspian basin, including rivers and canals; B: Baltic Sea; NE: north-eastern Europe (esp. Poland); Rh:

Rhine basin.

Route: A: intentional introductions, inclusive chance components; N1: northern corridor from the Caspian Lake; N2: northern corridor from the Black and Azov seas; NC:

north central corridor; SC: south central corridor; S: southern corridor.?: unkown or uncertain; n.r.: not relevant. *:non-resolved Ponto-Caspian endemic; **: not certain it

concerns range extension; ***: probably migrated from the Rhine basin towards the Danube. References: 1, Haybach & Hackbarth (2001); 2, Schöll& Behring (1998); 3, Ax

& Dörjes (1966); 4, Goulletquer et al. (200); Mills & Rees (1995); Mordukhai-Boltovskoi (1964); 7, Mills & Rees (2000); 8, Vainola & Oulasvirta (1999); 9, Grigorovich

et al. (2002); 10, Bij de Vaate et al. (2002); 11, Geissen & Schöll (1998); 12, Mordukhai-Boltovskoi (1979); 13, Klink & Bij de Vaate (1996); 14, Kothé (1967); 15, Vanden

Bossche et al. (2001); 16, Brinkhurst & Jamieson (1971); Panov et al. (1999); 19, Slynko et al. (2002); 19, Van Haaren (2002); 20, Pligin & Yemel’yanova (1989); 21,

Kinzelbach (1992); 22, Gittenberger et al. (1998); 23, Tittizer (1996b); 24, Gasiunas (1966); 25, Cristescu et al. (2001); 26, Ojaveer & Lumberg (1995); 27, Rivier (1998);

28, Aladin et al. (2001); 29, Bacescu (1966); 30, Jazdzewski (1980); Van den Brink et al. (1989); 32, Straškraba (1962); 33, Müller & Schramm (2001); 34, Schleuter et al.

(1994); 35, Jazdzewski & Konopacka (2000); 36, Grabow et al. (1998); 37, Liefveld et al. (2001); 38, Bij de Vaate & Klink (1995); 39, Devin et al. (2001); 40, Schöll (1990);

41, Van den Brink et al. (1993); 42, Weinzierl et al. (1997); 43, Prodaza et al. (2001); 44, Olenin & Leppaköski (1999); 45, Nesemann (1993); 46, Weinzierl et al. (1996);

47, Nesemann et al. (1995); 48, Schleuter & Schleuter (1995); 49, Schöll & Hardt (2001); 50, Ketelaars et al. (1999); 51, Salemaa & Hiethalathi (1993); 52, Schleuter et

al. (1998); 53, Weish & Türkay (1975); 54, Kelleher et al. (1999); 55, Geissen (1997); 56, Wittmann (2002); 57, Leppaköski (1984); 58, Holthuis & Heerebout (1986); 59,

Jazdzewski & Konopacka (2002); 60, Karaman (1962).

Range extensions in Continental Europe 221

2.1. TURBELLARIA, HYDROZOA AND BRYOZOA

Dendrocoelum romanodanubiale was first observed in the Rhine basin in 1997 (Schöll & Behring, 1998), after it has been recorded in the Upper Danube in 1994, indicating that the south central corridor was used for its range extension (Bij de Vaate et al., 2002). In 2000, it was first found outside the Rhine basin in western Europe in the Mittelland Canal, obviously expanding its range further east (Haybach & Hackbarth, 2001).

Oligochoerus limnophilus is one of the two freshwater species of the otherwise marine order of the Acoela (Turbellaria) (Young, 2001). O. limnophilus belongs to the endemic Caspian genus Oligochoerus (Mordukhai-Boltovskoi, 1979). The species was described by Ax & Dörjes in 1966 (Ax & Dörjes, 1966) after it had been found in many rivers in western Europe since 1953 (Elbe, Lahn, Main, Mosel, Danube) and in irrigation canals in the Rhône delta. In addition it has been found in several freshwater lakes in the Netherlands (Dörjes & Young, 1975). It is uncertain if the westward range extension of O. limnophilus is postglacial or happened in recent times, comparable with the range extension of Dreissena polymorpha and Corophium curvispinum (Ax & Dörjes, 1966).

The hydrozoan Polypodium hydriforme, from which the larval life stage lives in fish eggs (Honegger, 1978), probably migrated through the sea with the sturgeon host (Mordukhai Boltovskoi, 1964). The hydrozoans Moerisia maeotica and Cordylophora caspia and the bryozoan Victorella pavida, all euryhaline species, certainly migrated through the sea (southern corridor). C. caspia can easily be transported over large distances in its menont stage, because in this stage it is temperature and drought resistant and survives in sea water (Vervoort, 1946). V. pavida has similar overwintering bodies (hibernacula) (Mundy, 1980). C. caspia most probably also used the numerous canals and rivers in Europe to spread to the drainage area of rivers discharging in the North and Baltic seas in the past 150 years (Bij de Vaate et al., 2002; Holstein, 1995) and now has a worldwide distribution, as do M. maeotica and V. pavida (Bacescu, 1966; Mordukhai-Boltovskoi, 1979).

Maeotias marginata (syn. Maeotias inexspectata, see Mills & Rees (2000)) and Blackfordia virginica are both believed to be native to the Black Sea and now are resident in a variety of estuarine habitats worldwide (Mills & Sommer, 1995). Both have been found in Europe in the Loire estuary and M. marginata has already been found in the Netherlands in 1762 and most recently (1999) in the Baltic Sea (Mills & Rees, 2000; Vainola & Oulasvirta, 1999). Obviously they spread via the southern corridor. The native region of B. virginica, however, is unresolved since it is considered to be of North American Atlantic origin by Grigorovich et al. (2002).

2.2. ANNELIDA

The polychaetes Hypaniola kowalewskii (syn: Lysippides kowalewskii; syn. Amphicteiskowalewskii) and Hypania invalida were, together with the mollusc Hypanis colorata,transferred to Tsimlyansk and Manych reservoirs in the Don basin and Zaporizhzhia reservoir (syn. Zaporozhye; previously called Dnieper reservoir) on the Dnieper, as well as to Lake Balkhash (Kazakhstan), where they all settled (Mordukhai-Boltovskoi, 1979). Hypania invalida extended its range westward through the south central corridor, where


it was first found in the upper Danube in 1967 (Kothé, 1968). It now occurs in the whole Rhine basin (Bij de Vaate et al., 2002) and has been found far upstream in the Belgian part of the Meuse in 2000 (Van den Bossche et al., 2001). Eastward, H. invalida has recently been found in the Moskva River, together with Dreissena polymorpha, Astacusleptodactylus and Dikerogammarus haemobaphes (Lvova et al., 1996). According to Mordukhai-Boltovskoi (1964) Hypaniola kowalewskii is not likely to be easily dispersed, because it does not enter the open Black Sea and never inhabits the ship fouling. Both polychaetes, however, spread through the Dnieper reservoirs, probably introduced on dragnets and trawls used for introductions. H. kowalewskii was found in Kremenchuk reservoir in 1987 (Pligin & Yemel’yanova, 1989).

Archaeobdella esmonti, Cystobranchus fasciatus, Manayunkia caspica and Psammoryctides deserticola all are found at a few places outside their native range because hydrotechnical constructions on rivers in the Ponto-Caspian region created a new habitat for these species (Grigorovich et al., 2002).

Mordukhai-Boltovskoi (1964) mentions the finding of a new species of the endemic Ponto-Caspian genus Hypaniola: H. grayi off the Atlantic coasts of Northern America. This species is now called Hobsonia ß orida, obviously not of Ponto-Caspian origin.

In several lists of Ponto-Caspian invaders the oligochaetes Paranais frici, Potamothrixvejdovskyi and P. heuscheri are mentioned as of Ponto-Caspian origin. Although both Potamothrix species are found in the Caspian Lake and all three species occur in the Black Sea area (Brinkhurst, 1978; van Haaren, 2002) their Ponto-Caspian origin can not be con-firmed (Brinkhurst & Jamieson, 1971; Grigorovich et al., 2002; Mordukhai-Boltovskoi, 1964, 1979; Timm, 1999). Brinkhurst & Jamieson (1971) mention P. vejdovskyi from the Danube River, Europe and the Great Lakes in North America; P. heuscheri from Europe, Lake Tiberias (Israel) and Congo, Paranais frici from Africa, Europe and North America.

The leech Caspiobdella fadejewi (syn. Piscicola fadejewi), which is a fish parasite, and the water mite Caspihalacarus hyrcanus, have only recently been found outside their historical range. According to Bij de Vaate et al. (2002) C. fadejewi most certainly and C. hyrcanus probably used the south central corridor for range extension. The former could, however, also have been unintentionally introduced as a result of living fish trade. Data on the occurrence of the latter are scarce because due to its size (ca 500 µm) it will often not be caught and it can easily be overlooked during sorting of samples (Bij de Vaate et al., 2002).

2.3. MOLLUSCA

The pontic endemic Dreissena bugensis (Willmann & Pieper, 1978) extended its range northward along the Dnieper since the 1940’s, up to the Dnieper-Prypyats confl uence near Kyiv (syn. Kiev) (Pligin & Yemel’yanova, 1989). It was found in the Caspian Lake in 1994 (Grigorovich et al., 2003) and was first found in North America (Lake Ontario) in 1989 (Mackie, 1999). D. bugensis, however, so far has not reached the Baltic and Rhine basin.

In addition to the above mentioned oligochaetes the gastropod Lithoglyphus nati-coides is often mentioned as a Ponto-Caspian endemic. Mordukhai-Boltovskoi (1979) explicitly states that L. naticoides is a true freshwater species and is not a part of the


Caspian complex of species. Jazdzewski & Konopacka (2002), however, denote it as a freshwater as well as brackish water snail. According to Gittenberger et al. (1998) it originates from the western Black Sea area, from where it was dispersed via the Ludwig Main Danube Canal in the 19th century to the Rhine basin. The interconnecting water-ways in the northern and north central corridor were probably used to reach northeastern Europe, where it has recently become rare and even disappeared from some of its former locations (Jazdzewski & Konopacka, 2002).

Theodoxus danubialis and Valvata naticina are mentioned, without any comment, by Tittizer (1996b) as being non-indigenous species in western Germany from Ponto-Caspian origin. His reference to Jungbluth (1996) does not give a clue, because Jungbluth does not mention them in his list. The distribution according to Willmann & Pieper (1978) does not suggest a Ponto-Caspian origin. Both species are also not mentioned by Mordukhai-Boltovskoi (1979).

Theodoxus pallasi was never found upstream of the Volga delta until around 1960 when it was discovered in the Volgograd reservoir and in the Baltic region (Lithuania), where it most probably has come via the sea (Mordukhai-Boltovskoi, 1964, 1979). In more recent lists of non-indigenous species in the Baltic (Leppäkoski & Olenin, 2002; Olenin & Leppäkoski, 2002; Panov et al., 1999), however, it is not mentioned anymore.

Hypanis colorata (syn. Monodacna colorata) was succesfully transferred to Tsimlyansk, Manych and Veselovsky reservoir in the Don basin and Zaporizhzhia and Dniprodzerzhynsk reservoir on the Dnieper (Pligin & Yemel’yanova, 1989; Mordukhai-Boltovskoi, 1979). H. colorata was also succesfully introduced into the Kuybyshev res-ervoir on the Volga, where 1.6 million specimens were released in the period 1965-1970. It was found in the Saratov reservoir in 1967 (Slynko et al., 2002).

2.4. ONYCHOPODA

The cladoceran onychopods Cercopagis pengoi, Podonevadne trigona, Cornigeriusbicornis and C. maeoticus, all tolerant of freshwater (Rivier, 1998), were first found in reservoirs along lower reaches of some major Ponto-Caspian rivers in the 1960’s (Mordukhai-Boltovskoi, 1979; Rivier, 1998). The Pontic C. maeoticus, found in the Volgograd reservoir, apparently penetrated through the Volga-Don Canal. The alteration of the hydrological regime in these rivers facilitated the colonization of the onychopods, which can not actively move upstream. Interestingly, the reverse has also happened: the onychopod Bythotrephes longimanus was not able to colonize the downstream parts of the Volga despite downstream drift, until the construction of reservoirs created suitable (lacustrine) conditions (Therriault et al., 2002). In 1992 Cercopagis pengoi was fi rst found outside the Ponto-Caspian drainage area in the Gulf of Riga in the Baltic Sea (Ojaveer & Lumberg, 1995), from where it spread eastward to the Gulf of Finland and the Neva estuary (1995) and later on north and westward to the Vistula lagoon (1999) (Leppäkoski & Olenin, 2000; Panov et al., 1999). In 1998 C. pengoi was first recorded across the Atlantic Ocean in Lake Ontario, where fishermen were very annoyed with fishing lines all covered with these onychopods (MacIsaac et al., 1999). It has been clearly demonstrated with genetic analyses that the invasion corridor used by C. pengoi to reach North America was the northern corridor from the Black Sea to the Baltic Sea


and from there with ballast water to North America (Cristescu et al., 2001). Because of its western range extension in the Baltic Sea, its capability to survive ballast water transport and its occurrence in the lower reaches of the Danube River (Rivier, 1998) it will only be a matter of time (and coincidence) before C. pengoi invades suitable habitats in western Europe.

2.5. COPEPODA

The harpactoid copepods Limnocletodes behningi and Schizopera neglecta, usually con-sidered to belong to the Caspian complex (Bacescu, 1966; Mordukhai-Boltovskoi, 1979), were found outside the Ponto-Caspian basin; the former in Issyk-Köl Lake (Kyrgyzstan) and in China and the latter in the Mediterranean Sea, Lake Tiberias and Asia (Bacescu, 1966; Mordukhai-Boltovskoi, 1979; Pesce, 2002). Of the two calanoid copepods in the list, Heterocope caspia certainly belongs to the Caspian complex of species (Mordukhai-Boltovskoi, 1979), but although Panov et al. (1999) mention Calanipeda aquaedulcis as being a Caspian species, Aladin et al. (2001) call it a mediterranean-atlantic copepod. Both calanoids extended their range to the reservoirs of Don, Dnieper and Volga rivers (Panov et al., 1999; Slynko et al., 2002).

2.6. AMPHIPODA

Since the 1940’s Ponto-Caspian amphipods and mysids have been the favourite organisms for an immediate supplementary live food supply for fish and for acclimatization attempts in many impoundments on the large rivers in the former Sovjet Union to increase fi sh production in those new reservoirs (Borodich & Havlena, 1973; Gasiunas, 1966, 1968; Jazdzewski, 1980 with very interesting details about quantities and distances; Mordukhai-Boltovskoi, 1964, 1979; Pligin & Yemel’yanova, 1989). Along with the target species for the introductions other species were introduced unintentionally. The amphipod Amathillina cristata in the Seym River, tributary of the Desna, which flows into the Dnieper, came along with the target mysid Paramysis lacustris as did Pontogammaruscrassus and Dikerogammarus villosus in the upper Dnieper and Limnomysis benedeni in Kaniv and Kyiv reservoirs, all with the same target organism Paramysis lacustris (Pligin & Yemel’yanova, 1989).

Following intentional introductions, mainly in Lithuania (Kaunas reservoir, lakes and lagoons) several amphipods penetrated the basin of the Baltic Sea: Echinogammarusischnus, Echinogammarus warpachowskyi, Obesogammarus crassus and Pontogammarusrobustoides (Jazdzewski, 1980). From there E. ischnus dispersed along canals and rivers into the Rhine basin (Van den Brink et al., 1993). P. robustoides also spread westward to the Vistula River (Jazdzewski & Konopacka, 2000) and further to the Mittelland Canal (Martens, et al., 1999), which is linked with the Rhine basin. Undocumented records in Bij de Vaate et al. (2002: 1169, fig. 5) suggest that P. robustoides is also moving upstream the Danube. Amphipods that have not been introduced outside the Ponto-Caspian basin either (so far) stayed there or used the western corridor to invade the Rhine basin. The former include a.o. Amathillina cristata, Corophium robustum, Gmelina kuznetzowi,Pontogammarus aralensis, P. maeoticus, P. sarsi, P. subnudus, Stenogammarus carausui


and S. macrurus (Table 2). The latter are represented by Dikerogammarus villosus andD. haemobaphes (Bij de Vaate & Klink, 1995; Schleuter et al., 1994) who will probably be joined by Obesogammarus obesus in the near future, because this amphipod has been found in the upper Danube, close to the Main-Danube Canal, in 1995 (Weinzierl et al., 1996). D. haemobaphes was recently found in the Vistula, Bug and Notec Rivers (Jazdzewski & Konopacka, 2000) and in the Moskva River (Lvova, 1996), indicating an active spread in central Europe during the last decade. This is also the case for D. villosus. After having reached the Rhine basin in 1995 (Bij de Vaate & Klink, 1995), where it rapidly spread, D. villosus reached northern Germany in 1998 (Grabow et al., 1998) and reached the River Oder in 2001, where it already was the most dominant gammarid (Müller et al., 2001), clearly going further east to “conquer” the whole Baltic region. From the Rhine basin it moved south to the Meuse basin through the Meuse-Waal Canal (the Netherlands), where it was first found in late 1996 in the Dutch part of the Meuse (Liefveld et al., 2001) and in 1998 in the Belgian part of the River Meuse (Vanden Bossche, 2002).

The highly invasive D. villosus is also spreading in south-western direction from the middle Rhine, where it was found in the Rhine tributary River Moselle in 1999 and in the Rhine-Rhône Canal and the River Rhône in 2000 (Devin et al., 2001).

Some authors consider Dikerogammarus bispinosus as a subspecies of D. villosus.Allozyme analyses, however, revealed unambiguously that D. bispinosus is a separate species (Müller & Schramm, 2001). In addition, Jazdzewski & Konopacka (1988) could easily distinguish the two species based on their morphology. Although it naturally occurs upstream in Ponto-Caspian rivers (Jazdzewski & Konopacka, 1988; Straškraba, 1962) it has recently been found in the German part of the Danube, indicating further upstream migration (Müller & Schramm, 2001).

Corophium robustum was introduced to the Kakhovka reservoir in 1956-1957 (Grigorovich et al., 2002) and is listed by Pligin & Yemel’yanova (1989) as having dispersed to other areas of the Dnieper basin. Jazdzewski & Konopacka (1988) found C. robustum sometimes together with other Ponto-Caspian corophiids (C. maeoticum,C. sowinskyi, C. chelicorne) far upstream the River Dniester.

Whether Corophium sowinskyi is really extending its range is unclear. Straškraba (1962) found it, together with C. curvispinum, in Lake Balaton in 1956 and only C. sowinskyi in the Danube on the Hungarian-Slovakian border in 1947. Because of the difficulty in distinguishing it from C. curvispinum it may easily have been overlooked (Jazdzewski, 1980).

Niphargus hrabei is a Ponto-Caspian species (Pinkster, 1978) that was recently found in the Bavarian part of the Danube (Nesemann et al., 1995). Stygobromus ambulans(syn. Synurella ambulans) is supposed to be an original element of the Pontic fauna and inhabits all rivers discharging into the Black Sea (Nesemann et al., 1995). Its present distribution area reaches from the Elbe River to the Po River, albeit in disjunct populations (Nesemann et al., 1995). Both above mentioned species inhabit swampy banks of rivers, muddy shores of lakes, temporary pools, all of which have low oxygen concentrations (Nesemann et al., 1995).


2.7. ISOPODA AND MYSIDACEA

The isopod Jaera istri without doubt used the south central corridor to reach the Rhine basin (Schleuter & Schleuter, 1995) and is presently moving towards the Baltic region, like Dikerogammarus villosus and Dendrocoelum romanodanubiale (Haybach & Hackbarth, 2001; Schöll & Hardt, 2000).

In the former Sovjet Union mysids were the most popular species for introductions into other water bodies, accounting for more than ¾ of the whole acclimatization stock of invertebrates (Mordukhai-Boltovskoi, 1979). They were introduced in reservoirs on the rivers Volga, Dniester, Dnieper, Zeravshan (Uzbekistan), Syrdar’ya (Kazakhstan), Ural and Daugava (Latvia), rivers in the Dnieper basin and in the lakes Aral, Balkash and Ysyk Köl and the Dubossary reservoir (Moldavia) (Borodich & Havlena, 1973; Komarova, 1971; Mordukhai-Boltovskoi, 1979; Zhuravel, 1959). Many of the attempts, however, failed (Pligin & Yemel’yanova, 1989).

The mysids Paramysis lacustris (syn. Paramysis kowalevskyi), P. intermedia, P. ull-skyi, Limnomysis benedeni, Hemimysis anomala and to a lesser extent P. baeri all accli-matized in the new localities (Borodich & Havlena, 1973; Pligin & Yemel’yanova, 1989; Zhuravel, 1959, 1960). All four formed dense populations in Lake Balkash (Mordukhai-Boltovskoi, 1979).

The mysids Paramysis lacustris, Limnomysis benedeni and Hemimysis anomala were several times introduced into the Kaunas reservoir on the River Nemunas (Lithuania) after its construction in 1959 from the Zaporizhzhia reservoir and a reservoir on the Crimean peninsula in the beginning of the 1960’s (Arbaciauskas, 2002; Gasiunas, 1968). After these successful introductions mysids (and amphipods) were transferred to the Curonian Lagoon on the Baltic Sea and to many other waterbodies in Lithuania from up to 1989 (Arbaciauskas, 2002). The occurrence of these three mysids in the Baltic Sea since 1962 (Leppäkoski & Olenin, 2000) is without doubt the result of the intentional introductions in the region.

L. benedeni slowly migrated upstream the Danube during the last 50 years (Weish & Türkay, 1975) and was found in the River Main in 1997 (Geissen, 1997) and in the Main-Danube Canal, lower River Rhine and the Rhine delta in 1998 (Reinhold & Tittizer, 1998; Kelleher et al., 1999). In addition to moving downstream the River Rhine it also moved upstream the Rhine (from the confluence with the River Main), where it was found near Strasbourg in 1998 (Wittmann & Ariani, 2000). L. benedeni also dispersed to the Meuse basin, where it was first found in 1998 in shallow creeks surrounding the Biesbosch reservoirs (Ketelaars et al., 1999). The range extension of L. benedeni along the Danube and Rhine may have been facilitated by navigation. Wittmann (1995) and Reinhold & Tittizer (1998) collected L. benedeni in ballast water or on the outer hull of ships. L. benedeni is often associated with stands of littoral vegetation or shallow waters with diverse types of hard substrate, but can also occur at a depth of 6 m (Kelleher et al., 1999). In the Biesbosch reservoirs (the Netherlands) L. benedeni, however, exchanged the littoral zone in a few years time for the deep (25 m) water zone (unpublished results), thus underpinning the euryoecious character of many Ponto-Caspian invaders.

H. anomala was first found in the Rhine basin in June 1997 (Faasse, 1998). Several swarms were observed in the littoral zone of the brackish Lake Noorder-IJ, close to but


isolated from the North Sea Canal and the harbour of Amsterdam (the Netherlands). Later on in 1997 H. anomala was found in stomachs of young percids caught in the lower Rhine in the Netherlands (Nijmegen) (Kelleher et al., 2000), in one of a series of freshwater reservoirs in the south western part of the Netherlands (Biesbosch, Meuse basin) (Ketelaars et al., 1999) and in the middle Rhine near Koblenz (Germany) and the River Neckar (Schleuter et al., 1998). In 1998 it was found again in Lake Noorder-IJ (Faasse, 1998) and the Biesbosch reservoirs, where extremely high densities were observed (Ketelaars et al., 1999). In addition, it was found in 1998 in Andijk reservoir in the northern part of the Netherlands (Ketelaars et al., 1999) and further upstream in the River Rhine drainage area in the River Main (Schleuter & Schleuter, 1998). Despite intensive sampling in the Danube during the last decades, the first record of H. anomaladates from August 1997 (upper Danube, near the Main-Danube Canal) (Wittmann et al., 1999). Only in 1998 it was found further downstream in the Danube near Vienna (Wittmann et al., 1999). This species thus seems to colonize the Danube from the head-waters towards the lower reaches.

Also in 1998, H. anomala was found for the first time outside the Rhine basin in north-ern Germany in the Salzgitter Canal, a canal branching off the Mittelland Canal, which connects the Rhine basin with the River Elbe and rivers draining into the Baltic Sea.

In 1999 H. anomala was found in a 13 m deep brackish lake close to the Scheldt estuary near the port of Antwerp (Verslycke et al., 2000), in the freshwater reservoir Broechem connected to the Albert Canal (Meuse basin), also close to the port of Antwerp (Belgium) (unpublished result) and in 2000 far upstream in the River Meuse in the Belgian Ardennes (Vanden Bossche, 2002). In 1999 Haesloop (2001) found several thou-sand specimens of H. anomala in an old floodplain of the River Weser near Bremerhaven and in the harbour of Bremerhaven on the German North Sea coast. Another record in this area is that of Rehage & Terlutter (2002), who found H. anomala in the Mittelland Canal only a few kilometers before the confluence with the Dortmund-Ems Canal.

The presently known distribution of H. anomala in the Rhine basin does not provide definite clues as to which corridor was used to invade Western Europe. Based on this dis-tribution and on the dates of the first records the following possibilities exist i) transport in ballast water from the Baltic Sea to ports in Belgium and the Netherlands; ii) dispersal from the Baltic via rivers and canals in northeastern Germany and Poland to the Rhine basin; iii) south central corridor.

In Western Europe H. anomala was found for the first time in a lake near the large port of Amsterdam, which indicates transport by ballast water from, possibly, the Baltic Sea. The findings of H. anomala near the ports of Antwerp and Bremerhaven also indicate that ballast water transport could be the case. Transport with ballast water is well pos-sible, because H. anomala is not sensitive to harsh environmental conditions (Ketelaars et al., 1999). The Baltic Sea is not necessarily the donor region for the Rhine populations, however; the Black Sea is also possible.

Possibility two cannot be ruled out, because two records exist of H. anomala in the Mittelland Canal.

The temporal sequence of records in the German Rhine and Danube, as described above, does not indicate that the south central corridor was used. Instead, it rather indicates an upstream colonization pattern for the River Rhine and a downstream


colonization pattern for the River Danube (as also suggested by Schleuter et al., 1998): H. anomala was found later in the River Rhine and in the well studied section of the Danube than in the coastal area of the Netherlands. In addition, it was found later in the more downstream section of the Danube than upstream and it has never been found in the Danube before, except for the Danube section near the Black Sea coast (Bacescu, 1954, Wittmann et al., 1999). Established large populations in northwestern Europe, like those in the Biesbosch reservoirs, could have served as the source of the upstream migration. The mass occurrence in the Biesbosch reservoirs from 1998 onwards is presumed to be the result of an invasion at least several years before 1998 (Ketelaars et al., 1999), which had gone unnoticed because of the hidden life style of H. anomala during the day and the use of inappropiate sampling methods for mysids (Ketelaars et al., 1999; Salemaa & Hietalathi, 1993). Also, the presence of several thousand specimens of H. anomala near Bremerhaven shows that H. anomala has been there for a longer time. If H. anomalawould have used the south central corridor then it should have been noticed earlier in the Danube and upper Rhine. Obviously this is not the case, because the upper Danube has been sampled intensively. The scarce data on the geographical distribution make it impossible to know the real route. Molecular techniques, like electrophoretic allozyme analysis and DNA-fingerprinting can perhaps help to solve this puzzle.

Katamysis warpachowskyi was first detected in the middle and upper section of the Danube in 2001, which means that it has extended its known distribution range by 1700 km (Wittmann, 2002). Intense sampling in the Danube for the last fifty years never yielded any positive result, and therefore the sudden recent range extension was prob-ably caused by navigation (Wittmann, 2002).

2.8. CUMACEA AND DECAPODA

The cumaceans Pterocuma pectinata and Schizorhynchus eudoreloides were successfully introduced to Kakhovka reservoir on the Dnieper in late 1950’s, although their abundance remained low (Pligin & Yemel’yanova, 1989). P. pectinata and Pseudocuma cercaroidesboth settled in Dniprodzerzhynsk and Kremenchuk and the latter also in Kaniv reservoir on the Dnieper (Pligin & Yemel’yanova, 1989).

Because of its economic importance as a culinary delicacy, the crayfi sh Astacus lep-todactylus was transplanted for nearly two centuries to ponds and lakes all over Europe (Jazdzewski & Konopacka, 2002; Nesemann et al., 1995), from where it spread to other waters. Also, the protection status of the indigenous crayfish of Western Europe, A. astacus,was a reason to introduce A. leptodactylus (Holthuis & Heerbout, 1986). Due to pol-lution, the crayfish plague (Aphanomyces astaci) and competition with the American crayfi sh, Orconectus limosus, A. leptodactylus has become an increasingly rare species in Poland (Jazdzewski & Konopacka, 2002).

Astacus astacus colchius is mentioned by Morduchai-Boltovskoi (1979), citing Karaman (1962) as having spread from the Ponto-Caspian region to the Aegean Sea on the Balkan peninsula. This record seems doubtful, because Karaman (1962) does not mention this finding. In addition, Grigorovich et al. (2002) do not consider it as Ponto-Caspian but mention the native habitat as Transcaucasian.


3. Discussion

Many Ponto-Caspian fishes and invertebrates inhabit the estuaries of the rivers draining into the seas and are even most abundant in the lower reaches of the rivers. Some spe-cies even reach the middle reaches (e.g. Cordylophora caspia, Polypodium hydriforme,Jaera sp., Paramysis ullskyi, Dikerogammarus villosus and Obesogammarus obesus), or the headwaters (e.g. Dreissena polymorpha, Corophium curvispinum, Echinogammarus ischnus and Dikerogammarus haemobaphes) (Mordukhai Boltovskoi, 1964). Obviously these species migrated upstream successfully because they are able to resist or avoid the downstream currents, e.g. by burying into the sand (psammophil gammarids and mysids) or migrated along shallow banks, where the current velocity is low (Mordukhai Boltovskoi, 1964). The species in Table 2 were able to extend their range beyond their native region because of anthropogenic factors such as canal construction, navigation, river impoundment, intentional introductions or transport with ballast water.

Altogether 62 species of Ponto-Caspian origin are now found outside their historic geographical range, not counting species of doubtful origin (10 species) and species for which it is uncertain if they really extended their range (12 species) (see Table 2). Among the 62 species are some species, however, that extended their native range only marginally, notably some cumaceans, mysids and amphipods of the genera Gmelina,Corophium and Pontogammarus. Fifty-six species out of the 62 extended their range in the Ponto-Caspian region itself, mostly because of intentional introductions; a subset of 7 species exclusively dispersed upstream the River Danube. Up till now the Rhine basin has been invaded by 17, north-eastern Europe by 15 and the Baltic Sea by 14 Ponto-Caspian species.

Clearly, the intentional introductions to “enrich” the fauna and to increase fish produc-tion by supplying a new food source in the impoundments on the large rivers in the for-mer Sovjet Union since the 1940’s have played an important role in the range extension of species of the Ponto-Caspian complex. 38 species established themselves in the new environments. Especially the introductions outside the Ponto-Caspian basin in Lithuania and Latvia led to further range extensions of Obesogammarus crassus, Pontogammarusrobustoides, Echinogammarus ischnus, E. warpachowskyi, Paramysis lacustris andprobably Hemimysis anomala.

The south central corridor (with the pivotal Main-Danube Canal) is the most frequent-ly used corridor to leave the Ponto-Caspian basin; not less than 14 species used this cor-ridor to the Rhine basin. Some of these species (Limnomysis benedeni, Hypania invalida,Dikerogammarus haemobaphes) also spread through the northern corridor and reached north-eastern Europe or the upper part of the Volga basin. From the Rhine basin several species clearly are extending their range to the Baltic region: Jaera istri, D. villosus and Dendrocoelum romanodanubiale. In the Rhine basin L. benedeni and Dikerogammarus villosus spread southward and the latter has already reached the adjacent Rhône basin. More to the north, the Meuse basin has recently been invaded by Hypania invalida,D. villosus and Hemimysis anomala. Whether the latter was introduced with ballast water or extended its range from the Rhine basin via waterways, is unclear.

Some species that are moving upstream the Danube will most likely reach the Rhine basin through the Main-Danube Canal in a short time: Obesogammarus obesus, Katamysis


warpachowskyi, Dikerogammarus bispinosus and perhaps also Pontogammarus robustoides, which could, however, also reach the Rhine basin from the Baltic, because it is extending its range westward from there.

In conclusion, many species of Ponto-Caspian origin have extended their native range in - and outside the Ponto-Caspian basin and are still in the process of further range extensions. This has clearly been human-mediated. The colonization and introduction success is also linked to the euryhaline and euryoecious character of these species, permitting them to survive and propagate in a broad variety of waters. Jazdzewski & Konopacka (2002) hypothesized that industrial and agricultural pollution in the last decades increased the ionic content of large European rivers like the Dnieper, Vistula, Oder or Danube, which allowed oligohaline species to invade new basins. This hypothesis was also put forward for the River Rhine by Den Hartog et al. (1989). However, it is evident that many of the invaders also thrive in purely fresh waters (e.g. Ketelaars et al., 1999). Other biological factors that contribute to the colonization success are the often omnivorous feeding mode, relatively short life span and generation time and high fecundity of the invaders (e.g. Bij de Vaate et al., 2002).

Range extensions of Ponto-Caspian species have probably been facilitated by the alteration of waters through pollution, eutrophication and other forms of human impacts. In addition to these processes, water quality improvement can also play a role, as Van der Velde et al. (2002) put forward for the River Rhine.

The ongoing “conquest” of Western Europe and the Baltic Sea, both with many international ports, by euryoecious and euryhaline Ponto-Caspian species is increasing the amount of species that are potential invaders for the principal recipient area in North America, the Great Lakes region. If no adequate actions are taken to prevent new introductions, they will lead to increasing homogeneity of the fauna of the Northern Hemisphere and aggravate environmental and economic problems (Leppäkoski et al., 2002). Van der Velde et al. (2002) predict that in the near future these introductions “will cause a shift from battles between invaders and indigenous species towards battles among invaders of various origins” as these authors have shown for the River Rhine.

4. Acknowledgements

Jan-Willem Blijenburg and Daan Spitzers are gratefully acknowledged for preparing the maps and Jurgen Volz for critical remarks on the manuscript.

References

Aladin, N. V., I. S. Plotnikov & A. A. Filippov, 2001. Opportunistic settlers in the Aral Sea. First international

meeting. The invasion of the Caspian Sea by the comb jelly Mnemiopsis. Problems, perpectives, need for

action. Baku, 24-26 April 2001.

Arbaciauskas, K., 2002. Ponto-Caspian amphipods and mysids in the inland waters of Lithuania: history of

introduction, current distribution and relations with native malacostracans. In E. Leppaköski, S. Gollasch

& S. Olenin (eds), Invasive aquatic species of Europe. Distribution, impacts and management. Kluwer


Academic Publishers, Dordrecht: 104-115.

Ax, P. & J. Dörjes, 1966. Oligochoerus limnophilus nov. spec., ein Kaspisches Faunenelement als erster

Süßwasservertreter der Turbellaria Acoela in Flüssen Mitteleuropas. Internationale Revue der gesamten

Hydrobiologie 51: 15-44.

Bacescu, M., 1954. Crustacea. Mysidacea. Fauna Republicii Popular Romane 3:1-126.

Bacescu, M., 1966. Die kaspische Reliktfauna im ponto-asowschen Becken und in anderen Gewässern. Kieler

Meeresforschungen 22: 176-188.

Bij de Vaate, A. & A. G. Klink, 1995. Dikerogammarus villosus Sowinski (Crustacea: Gammaridae) a new

immigrant in the Dutch part of the lower Rhine. Lauterbornia 20: 51-54.

Bij de Vaate, A., K. Jazdzewski, H. A. M. Ketelaars, S. Gollasch & G. Van der Velde, 2002. Geographical

patterns in range extension of Ponto-Caspian macroinvertebrate species in Europe. Canadian Journal of

Fisheries and Aquatic Sciences. 59: 1159-1174.

Borodich, N. D. & F. K. Havlena, 1973. The biology of mysids acclimatized in the reservoirs of the Volga

River. Hydrobiologia 42: 527-539.

Brinkhurst, R. O. 1978. Oligochaeta. In: J. Illies (ed). Limnofauna Europea. Gustav Fischer Verlag, Stuttgart:

139-144.

Brinkhurst, R. O. & B. G. Jamieson, 1971. Aquatic Oligochaeta of the world. Oliver & Boyd, Edinburgh.

Bryson, B., 1992. Main-Danube Canal. Linking Europe’s waterways. National Geographic 182:3-31.

Cristescu, M. E. A., P. D. N. Hebert, J. D. S. Witt, H. J. MacIsaac & I. A. Grigorovich, 2001. An invasion

history for Cercopagis pengoi based on mitochondrial gene sequences. Limnology and Oceanography

46: 224-229.

Den Hartog, C., F. W. B. van den Brink & G. van der Velde, 1989. Brackish-water invaders in the River Rhine.

A bioindication for increased salinity level over the years. Naturwissenschaften 76:80-81.

Devin, S., J. N. Beisel, V. Bachmann & J. C. Moreteau, 2001. Dikerogammarus villosus (Amphipoda:

Gammaridae): another invasive species newly established in the Moselle river and French hydrosystems.

Annales Limnologie 37:21-27.

Dörjes, J. & J. O. Young, 1975. A note on the occurrence of Oligichoerus limnophilus Ax & Dörjes (Turbellaria,

Acoela) in freshwater habitats in the Netherlands. Zoölogische Bijdragen 17: 63-64.

Dumont, H. J., 1998. The Caspian Lake: History, biota, structure, and function. Limnology and Oceanography

43: 44-52.

Dumont, H. J., 2000. Endemism in the Ponto-Caspian fauna, with special emphasis on the Onychopoda

(Crustacea). Advances in Ecological Research 31: 181-196.

Eggers, T. O., A. Martens & K. Grabow, 1999. Hemimysis anomala im Stichkanal Salzgitter (Crustacea:

Mysidacea). Lauterbornia 35: 43-47.

Faasse, M. A., 1998. The Pontocaspian mysid, Hemimysis anomala Sars, 1907, new to the fauna of the

Netherlands. Bulletin Zoölogisch Museum Universiteit van Amsterdam 16: 73-76.

Gasiunas, I. I., 1966. Acclimatization of invertebrates of Pontocaspian origin as food for fishes in Lithuania

(Basin of the Baltic Sea). In: A. E. Yanushevich (ed), Acclimatization of animals in USSR. Jerusalem

(Translation):159-160.

Gasiunas, I., 1968. Acclimatization of the mysid Hemimysis anomala Sars in the reservoir of the Kaunas

Hydropower Station. Works of Academy of Science of Lithuanian SSR, Series B 3: 71-73.

Geissen, H.-P., 1997. Nachweis von Limnomysis benedeni Czerniavski (Crustacea: Mysidacea) im Mittelrhein.

Lauterbornia 31: 125-127.

Geissen, H.-P. & F. Schöll, 1998. Erste Nachweise des Fischegels Caspiobdella fadejewi (Epshtein 1961)

(Hirudinea: Piscicolidae) im Rhein. Lauterbornia 33: 11-12.


Gittenberger, E., A. W. Jansen, W. J. Kuiper, T. Meijer, G. van der Velde & J. N. de Vries, 1998. De Nederlandse

zoetwatermollusken. De Nederlandse Fauna 2. Nationaal Natuurhistorisch Museum Naturalis, KNNV,

European Invertebrate Survey, Leiden.

Goulletquer, P., G. Bachelet, P. G. Sauriau & P. Noel, 2002. Open Atlantic coast of Europe – a century of

introduced species into French waters. In: E. Leppaköski, S. Gollasch & S. Olenin (eds). Invasive aquatic

species of Europe. Distribution, impacts and management. Kluwer Academic Publishers, Dordrecht:

276-290.

Grabow, K., T. O. Eggers & A. Martens, 1998. Dikerogammarus villosus Sovinsky (Crustacea: Amphipoda) in

norddeutschen Kanälen und Flüssen. Lauterbornia 33: 103-107.

Grigorovich, I. A., H. J. MacIsaac, N. V. Shadrin & E.L. Mills, 2002. Patterns and mechanisms of aquatic

invertebrate introductions in the Ponto-Caspian region. Canadian Journal of Fisheries and Aquatic

Sciences. 59: 1189-1208.

Grigorovich, I. A., T. W. Therriault & H. J. MacIsaac, 2003. History of aquatic invasions in the Caspian Sea.

Biological Invasions 5: 103-115.

Haybach, A. & W. Hackbarth, 2001. Dendrocoelum romandanubiale (Codreanu) und Jaera istri Veuille im

Mittellandkanal. Lauterbornia 41: 61-61.

Haesloop, U., 2001. Einige bemerkenswerte Makroevertebraten-Funde aus Gewässern des Großraumes

Bremen. Lauterbornia 41:55-59.

Holstein, T., 1995. Cnidaria: Hydrozoa. In: J. Schwoerbel & P. Zwick (eds). Süßwasserfauna von Mitteleuropa

1 (2), Gustav Fischer Verlag, Stuttgart: 1-110.

Holthuis, L. B. & G. R. Heerebout, 1986. De Nederlandse Decapoda (garnalen, kreeften en krabben).

Wetenschappelijke Mededelingen KNNV 179. KNNV, Hoogwoud.

Honegger, T., 1978. Hydrozoa. In: J. Illies (ed). Limnofauna Europea. Gustav Fischer Verlag, Stuttgart: 3-4.

Jazdzewski, K., 1980. Range extensions of some gammaridean species in European inland waters caused by

human activity. Crustaceana Supplement 6: 85-107.

Jazdzewski, K. & A. Konopacka, 1988. Notes on the gammaridean Amphipoda of the Dniester river basin and

eastern Carpathians. Crustaceana 13: 72-89.

Jazdzewski, K. & A. Konopacka, 2000. Immigration history and present distribution of alien crustaceans in

Polish waters. Crustacean Issues 12: 55-64.

Jazdzewski, K. & A. Konopacka, 2002. Invasive Ponto-Caspian species in waters of the Vistula and Oder basins

and the southern Baltic Sea. In: E. Leppaköski, S. Gollasch & S. Olenin (eds). Invasive aquatic species of

Europe. Distribution, impacts and management. Kluwer Academic Publishers, Dordrecht: 384-398.

Jungbluth, J. H., 1996. Einwanderer in der Molluskenfauna von Deutschland I. Der chorologische Befund. In:

H. Gebhardt, R. Kinzelbach & S. Schmidt-Fischer (eds), Gebietsfremde Tierarten: Auswirkungen auf ein-

heimische Arten, Lebensgemeinschaften und Biotope - Situationsanalyse. Ecomed, Landsberg: 105-125.

Karaman, M. S., 1962. Ein Beitrag zur Systematik der Astacidae (Decapoda). Crustaceana 3:173-191.

Kelleher, B., G. v. d. Velde, K. J. Wittmann, M. A. Faasse & A. Bij de Vaate, 1999. Current status of the

freshwater Mysidae in the Netherlands with records of Limnomysis benedeni Czerniavsky, 1882,

a Pontocaspa in species in Dutch Rhine branches. Bulletin Zoölogisch Museum Universiteit van

Amsterdam 16: 89-93.

Ketelaars, H. A. M., F. E. Lambregts-van de Clundert, C. J. Carpentier, A. J. Wagenvoort & W. Hoogenboezem,

1999. Ecological effects of the mass occurence of the Ponto-Caspa in invader, Hemimysis anomala

G.O. Sars, 1907 (Crustacea: Mysidacea), in a freshwater storage reservoir in the Netherlands, with notes

on its autecology and new records. Hydrobiologia 394: 233-248.

Kinzelbach, R., 1992. The main features of the phylogeny and dispersal of the Zebra Mussel Dreissena


polymorpha. In: D. Neumann & H. A., Jenner (eds), The Zebra Mussel Dreissena polymorpha. Limnologie

aktuell 4. Gustav Fischer Verlag, Stuttgart:5-17.

Kinzelbach, R., 1995. Neozoans in European waters – Exemplifying the worldwide process of invasion and

species mixing. Experientia 51:526-538.

Klink, A. & A. Bij de Vaate, 1996. Hypania invalida (Grube 1860) (Polychaeta: Ampharetidae) in the Lower

Rhine - new to the Dutch fauna. Lauterbornia 25: 57-60.

Komarova, T. I., 1991. Mysidacea. Fauna Ukrainy 26 (7). Akademia Nauk Ukrainy, Kiev, 104 pp. (In Russian).

Kothé, P., 1968. Hypania invalida (Polychaeta sedentaria) and Jaera istri (Isopoda) erstmals in der deutschen

Donau. Archiv für Hydrobiologie Supplement 34:88-114.

Leppäkoski, E., 1984. Introduced species in the Baltic Sea and its coastal ecosystems. Ophelia 123-135.

Leppäkoski, E. & S. Olenin, 2000. Non-native species and rates of spread: lessons from the brackish Baltic

Sea. Biological Invasions 2:151-163.

Leppäkoski, E. S. Gollasch & S. Olenin, 2002. Alien species in European waters. In E. Leppaköski, S. Gollasch

& S. Olenin (eds), Invasive aquatic species of Europe. Distribution, impacts and management. Kluwer

Academic Publishers, Dordrecht: 1-6.

Liefveld, W. M., K. van Looy & K. H. Prins, 2001. Biologische monitoring zoete rijkswateren: water-

systeemrapportage Maas 1996. RIZA rapport 2000.056. RIZA, Lelystad.

Lvova, A. A., A. V. Paliy & N. Yu. Sokolova, 1996. Ponto-Caspian immigrants in the Moscow River within

Moscow city. Zoological Journal 75: 1273-1275 (In Russian).

MacIsaac, H. J., I. A. Grigorovich, J. A. Hoyle, N. D. Yan & V. E. Panov, 1999. Invasion of Lake Ontario by

the Ponto-Caspa in predatory cladoceran Cercopagis pengoi. Canadian Journal of Fisheries and Aquatic

Sciences 56: 1-5.

MacIsaac, H. J., I. A. Grigorovich & A. Ricciardi, 2002. Reassessment of species invasions concepts: the Great

Lakes basin as a model. Biological Invasions 3: 405-416.

Mackie, G.L., 1999. Ballast water introductions of Mollusca. In R. Claudie & J. H. Leach (eds), Nonindigenous

freshwater organisms. Vectors, biology, and impacts. Lewis Publishers, Boca Raton: 219-254.

Martens, A., T. O. Eggers & K. Grabow, 1999. Erste Funde von Pontogammarus robustoides (Sars) im

Mittellandkanal (Crustacea: Amphipoda). Lauterbornia 35: 39-42.

Mills, C. E. & F. Sommer, 1995. Invertebrate introductions in marine habitats: two species of hydromedusae

(Cnidaria) native to the Black Sea, Maeotias inexspectata and Blackfordia virginica, invade San Francisco

Bay. Marine Biology 122: 279-288.

Mills, C. E. & J. T. Rees, 2000. New observations and corrections concerning the trio of invasive hydromedusae

Maeoticas marginata (=M. inexspectata), Blackfordia virginica, and Moerisia sp. in the San Francisco

Estuary. Scientia Marina 64 Supplement 1: 151-155.

Mordukhai-Boltovskoi, F. D., 1964. Caspian fauna beyond the Caspian Sea. Internationale Revue der gesamten

Hydrobiologie 49:139-176.

Mordukhai-Boltovskoi, F. D., 1979. Composition and distribution of Caspian fauna in the light of modern data.

Internationale Revue der gesamten Hydrobiologie 64:1-38.

Müller, J. & S. Schramm, 2001. A third Dikerogammarus invader is located in front of Vienna. Lauterbornia

41:49-52.

Müller, O., M. L. Zettler & P. Gruszka, 2001. Verbreitung und Status von Dikerogammarus villosus (Sovinski

1894) (Crustacea: Amphipoda) in der mittleren und unteren Strom-Oder und den angrenzenden

Wasserstraßen. Lauterbornia 41: 105-112.

Mundy, S. P., 1980. A key to the British and European freshwater bryozoans. Freshwater Biological Association.

Scientific Publications 41.


Nesemann, H., 1993. Zur Verbreitung von Niphargus (Phaenogammarus) Dudich 1941 und Synurella

Wrzesniowski 1877 in der ungarischen Tiefebene (Crustacea, Amphipoda). Lauterbornia 13: 61-71.

Nesemann, H., M. Pöckl & K. J. Wittmann, 1995. Distribution of epigean Malacostraca in the middle and upper

Danube (Hungary, Austria, Germany). Miscellanea Zoologica Hungarica 10: 49-68.

Ojaveer, H. & A. Lumberg, 1995. On the role of Cercopagis (Cercopagis) pengoi (Ostroumov) in Pärnu Bay

and the NE Part of the Gulf of Riga ecosystem. Proceedings of the Estonian Academy of Sciences Ecology

5: 20-25.

Olenin, S. & E. Leppäkoski, 1999. Non-native animals in the Baltic Sea: alteration of benthic habitats in coastal

inlets and lagoons. Hydrobiologia 393: 233-243.

Olenin, S & E. Leppäkoski (eds), 2002. Baltic Sea alien species database. Baltic marine Biologists working

group on non-indigenous estuarine and marine organisms. Web site: http://www.ku.lt/nemo/alien_

species_directory.htm (19.11.2002).

Panov, V. E., P. I. Krylov & I. V. Telesh, 1999. The St. Petersburg harbour profile. In S. Gollasch &

E. Leppäkoski (eds). Initial risk assessment of alien species in nordic coastal waters. Nord 1999(8):

225-244. Nordic Council of Ministers, Copenhagen.

Pesce, G.L., 2002. Copepods web portal. University of l’Aguila. http://www.copepods.interfree.it/diosac3.htm

(04.01.2003).

Pinkster, S., 1978. Amphipoda. In: J. Illies (ed). Limnofauna Europea. Gustav Fischer Verlag, Stuttgart: 244-253.

Pligin, Y. V. & L. V. Yemel’yanova, 1989. Acclimatization of Caspian invertebrates in Dnieper reservoirs.

Hydrobiological Journal 25: 1-9.

Podraza, P., Th. Ehlert & P. Roos, 2001. Erstnachweis von Echinogammarus trichiatus (Crustacea: Amphipoda)

im Rhein. Lauterbornia 129-133.

Rehage, H.-O. & H. Terlutter, 2002. Hemimysis anomala Sars (Crustacea: Mysidacea) im Mittellandkanal bei

Recke-Obersteinbeck (Nordrhein-Westfalen). Lauterbornia 44: 47-48.

Reinhold, M. & T. Tittizer, 1998. Liymnomysis benedeni Czerniavsky 1882 (Crustacea: Mysidacea), ein

weiteres pontokaspisches Neozoon im Main-Donau-Kanal. Lauterbornia 33: 37-40.

Rivier, I. K., 1998. The predatory Cladocera (Onychopoda: Podonidae, Polyphemidae, Cercopagidae) and

Leptodorida of the world. Guides to the identification of microinvertebrates of the continental waters of

the world 13. Backhuys Publishers, Leiden.

Rudolph, K., 1997, Zum Vorkommen des Flohkrebses Pontogammarus robustoides im Peenemündungsgebiet.

Natur und Museum 127:306-312.

Salemaa, H. & V. Hietalahti, 1993. Hemimysis anomala G.O. Sars (Crustacea: Mysidacea) - Immigration of

a Pontocaspian mysid into the Baltic Sea. Annales Zoologica Fennici 30: 271-276.

Schleuter, A. & M. Schleuter, 1995. Jaera istri (Veuille) (Janiridae, Isopoda) erreicht über den Main-Donau-

Kanal den Main. Lauterbornia 33: 125-127.

Schleuter, A. & M. Schleuter, 1998. Dendrocoelum romanodanubiale (Turbellaria, Tricladida) und Hemimysis

anomala (Crustacea: Mysidacea) zwei weitere Neozoen im Main. Lauterbornia 33: 125-127.

Schleuter, A., H.-P. Geissen & K. J. Wittmann, 1998. Hemimysis anomala G. O. Sars 1907 (Crustacea:

Mysidacea), eine euryhaline pontokaspische Schwebgarnele in Rhein und Neckar. Erstnachweis für

Deutschland. Lauterbornia 32: 67-71.

Schleuter, A., M. Schleuter, S. Potel & M. Banning, 1994. Dikerogammarus haemobaphes (Eichwald, 1841)

(Gammaridae) aus der Donau erreicht über den Main-Donau-Kanal den Main. Lauterbornia 19: 155-159.

Schöll, F., 1990. Erstnachweis von Chaetogammarus ischnus Stebbing im Rhein. Lauterbornia 5: 71-74.

Schöll, F. & E. Behring, 1998. Erstnachweis von Dendrocoelum romanodanubiale (Codreanu 1949)

(Turbellaria, Tricladida) im Rhein. Lauterbornia 33: 9-10.


Schöll, F. & D. Hardt, 2000. Jaera istri (Veuille) (Janiridae, Isopoda) erreicht die Elbe. Lauterbornia 38: 99.

Slynko, Y. V., L. G. Korneva, I.K. Rivier, V. G. Papchenkov, G. H. Scherbina, M. I. Orlova & Th. W. Therriault,

2002. The Caspian-Volga-Baltic invasion corridor. In E. Leppaköski, S. Gollasch & S. Olenin (eds),

Invasive aquatic species of Europe. Distribution, impacts and management. Kluwer Academic Publishers,

Dordrecht: 399-411.

Straškraba, M., 1962. Amphipoden der Tschechoslovakei nach den Sammlungen von Prof. Hrabe. I. Acta

Societalis Zoologicae Bohemoslovenica 26:117-145.

Therriault, T. W., I. A. Grigorovich, M. E. Cristescu, H. A. M. Ketelaars, M. Viljanen, D. D. Heath & H. J.

MacIsaac, 2002. Taxonomic resolution of the genus Bythotrephes Leydig using molecular markers and

re-evaluation of its global distribution. Diversity and Distributions 8: 67-84.

Timm, T., 1999. A guide to the Estonian Annelida. Naturalist’s Handbook. Tartu, Tallinn.

Tittizer, T., 1996a. Main-Danube canal now a short cut for fauna. Danube Watch 2: 7-8.

Tittizer, T., 1996b. Vorkommen und Ausbreitung aquatischer Neozoen (Makrozoobenthos) in den

Bundeswasserstraßen. In: H. Gebhardt, R. Kinzelbach, and S. Schmidt-Fischer (eds), Gebietsfremde

Tierarten: Auswirkungen auf einheimische Arten, Lebensgemeinschaften und Biotope - Situationsanalyse.

Ecomed Verlag, Landsberg: 49-86.

Tittizer, T., 1997. Ausbreitung aquatischer Neozoen (Makrozoobenthos) in den europäischen Wasserstrassen,

erläutert am Beispiel des Main-Donau-Kanals. Güteentwicklung der Donau, Rückblick und Perspectiven.

Schriftenreihe des Bundesamtes für Wasserwirtschaft (Wien), 4:113-114.

Vainola, R. & P. Oulasvirta. 1999. An invading hydromedusa from Moonsund Sea area, Estonia. Helsingin

Sanomat 25.9.1999: D3.

Van den Bossche, J.-P., 2002. First records and fast spread of five new (1995-2000) alien species in the River

Meuse in Belgium: Hypania invalida, Corbicula ß uminea, Hemimysis anomala, Dikerogammarus villosus

and Crangonyx pseudogracilis. Bulletin van het Koninklijk Belgisch Instituut voor Natuurwetenschappen.

Biologie 72 Supplement: 73-78.

Van den Bossche, J.-P., F. Cherot, E. Delooz, F. Grisez & G. Josens, 2001. First record of the Pontocaspian

invader Hypania invalida (Grube, 1860) (Polychaeta: Ampharetidae) in the River Meuse (Belgium).

Belgian Journal of Zoology 131: 183-185.

Van den Brink, F. W. B., G. van der Velde & A. Bij de Vaate, 1989. A note on the immigration of Corophium

curvispinum Sars, 1895 (Crustacea: Amphipoda) into the Netherlands via the River Rhine. Bulletin

Zoölogisch Museum Universiteit van Amsterdam 11: 211-213.

Van den Brink, F. W. B., B. G. P. Paffen, F. M. J. Oosterbroek & G. van der Velde, 1993. Immigration of

Echinogammarus (Stebbing, 1899) (Crustacea: Amphipoda) into the Netherlands via the lower Rhine.

Bulletin Zoölogisch Museum Universiteit van Amsterdam 13: 167-170.

Van der Velde, G., I. Nagelkerken, S. Rajapogal & A. bij de Vaate. 2002. Invasions by alien species in inland

freshwater bodies in western Europe: the Rhine delta. In: E. Leppaköski, S. Gollasch & S. Olenin (eds).

Invasive aquatic species of Europe. Distribution, impacts and management. Kluwer Academic Publishers,

Dordrecht: 360-372

Van Haaren, T., 2002. Eight species of aquatic Oligochaeta new for the Netherlands (Annelida). Nederlandse

Faunistische Mededelingen 16:39-55.

Verslycke, T., C. Janssen, K. Lock & J. Mees, 2000. First occurrence of the Ponto-Caspa in invader Hemimysis

anomala (Sars, 1907) in Belgium (Crustacea: Mysidacea). Belgian Journal of Zoology 130: 157-158.

Vervoort, W., 1946. Hydrozoa. Hydropolypen. Fauna van Nederland XIV. A.W. Sijthof, Leiden.

Weinzierl, A., S. Potel & M. Banning, 1996. Obesogammarus obesus (Sars 1894) in der oberen Donau

(Amphipoda, Gammaridae). Lauterbornia 26: 87-89.


Weinzierl, A., G. Seitz & R. Thannemann, 1997. Echinogammarus trichiatus (Amphipoda) und Atyaephyra

desmaresti (Decapoda) in der bayerischen Donau. Lauterbornia 31: 31-32.

Weish, P. & M. Türkay, 1975. Limnomysis benedeni in Österreich mit Betrachtungen zur Besiedlungs-

geschichte (Crustacea: Mysidacea). Archiv für Hydrobiologie Supplement 44: 480-491.

Willmann, R. & H. Pieper, 1978. Lamellibranchiata. In: J. Illies (ed). Limnofauna Europea. Gustav Fischer

Verlag, Stuttgart: 135-137.

Wittmann, K. J., 1995. Zur Einwanderung potamophiler Malacostraca in die obere Donau: Limnomysis

benedeni (Mysidacea), Corophium curvispinum (Amphipoda) und Atyaephyra desmaresti (Decapoda).

Lauterbornia 20: 77-85.

Wittmann, K. J., 2002. Weiteres Vordringen pontokaspischer Mysidacea (Crustacea) in die mittlere und obere

Donau: Erstnachweis van Katamysis warpachowskyi für Ungarn, die Slowakei und Östereich, mit Notizen

zur Biologie und zum ökologischen Gefährdungspotential. Lauterbornia 44:49-63.

Wittmann, K J. & A. P. Ariani, 2000. Limnomysis benedeni: mysidacé Ponto-Caspien nouveau pour les eaux

douces de France (Crustacea, Mysidacea). Vie et Milieu 50: 117-122.

Wittmann, K. J., J. Theiss & M. Banning, 1999. Die Drift von Mysidacea und Decapoda und ihre Bedeutung

für die Ausbreitung von Neozoen im Main-Donau-System. Lauterbornia 35: 53-66.

Young, J. O., 2001. Keys to the freshwater microturbellarians of Britain and Ireland with notes on their ecology.

Freshwater Biological Association. Scientific Publications 59.

Zhuravel, P. A., 1959. Some data on the biology and ecology of mysids, introduced into the reservoirs and other

waterbodies of the Ukraine for enrichment of fish food. Zoological Zhurnal 38: 987-990. (In Russian).

Zhuravel, P. A., 1960. The mysid Hemimysis anomala Sars (Crustacea, Malacostraca) in the Dnieper reservoir

and its importance as fish food. Zoological Zhurnal 39: 1571-1573. (In Russian).

Chapter 14

Living in a sea of exotics – the Baltic case

ERKKI LEPPÄKOSKIEnvironmental and Marine Biology, Åbo Akademi UniversityFIN-20500 Turku/Åbo, Finlandeleppako@abo.Þ

Keywords: Baltic Sea, Invasive species, Nonindigenous species, Ponto-Caspian area, Cercopagis pengoi, Marenzelleria viridis.

The brackish Baltic Sea is known to function as a bridgehead for the spread of non-indigenous species (NIS) between the Eastern and Western Hemispheres and, in an ecological sense, between freshwater and the sea. The recent basin-wide invasion of the predatory fishhook water fl ea Cercopagis pengoi and the North American bristle worm Marenzelleria viridis in the Baltic are the latest examples of >100 introductions recorded over the last 200 years. A great majority of them are found in the most diluted coastal lagoons and estuaries only, these hot spot sites being known as centers of xenodiversity. The most important source areas for NIS have been the western European waters, the Atlantic coast of North America and the Ponto-Caspian realm.

A brief review of the present state of invasions and the history of invasion biology in the Baltic Sea is given, together with examples of the role of NIS as habitat engineers. Approximately 70 NIS in the Baltic Sea are more or less naturalized. Less than 20 of them (<30%) can be classified as nuisance species that cause damage to underwater con-structions, fisheries, shores and embankments or to target species for hunting. Seven of them have caused or are prone to cause significant impact on human interests: the Ponto-Caspian species Cordylophora caspia (Hydrozoa), Cercopagis pengoi (Cladocera), and Dreissena polymorpha (Bivalvia), the North American barnacle Balanus improvisus and the American mink Mustela vison, the Japanese swimbladder nematode Anquillicolacrassus and the cryptogenic shipworm mollusk Teredo navalis.

1. Introduction

The Baltic Sea is an ecological island, isolated from other brackish seas by both land and fully marine seas. It has been inoculated by nonindigenous species (NIS) for at least eight centuries. Because of the low salinity and low winter temperatures, the Baltic Sea is

237




often thought to be well protected against species invasions. However, it is important to keep in mind that most of the major ports, even along fully oceanic coasts, are situated at river mouths. Ballast water may be taken in from the brackish part of a port area, to later be discharged somewhere in the brackish Baltic Sea; thus, the risk of successful species introductions appears to be relatively high.

The Baltic is known to function as a bridgehead for spread of NIS between the Eastern and Western Hemispheres and, in ecological sense, between fresh water and the sea. NIS inevitably affect biodiversity by adding new species and functions to the ecosystem or by competing with and replacing native species and altering ecosystem functioning. In the northern Baltic, several NIS have been introduced during the last decade but the eco-logical impacts of them are still poorly known. Economic impacts are due to e.g. fouling communities causing preventive measures in ships and power plants, harmful blooms affecting tourism and aquaculture and impacts on commercial fish stocks. In the Baltic Sea ca. 20 NIS can be classified as nuisance organisms; 7 of them have caused signifi cant damage (Leppäkoski 2002). The economic impacts of these species have rarely been quantified (see below).

There is a great number of factors that have facilitated the potential of alien aquatic organisms to get introduced, establish reproducing populations and spread within the Baltic Sea:• Brackish water. In the brackish Baltic, highly euryhaline species of both marine and

fresh-water origin are potential invaders. Consequently, there is a substantial pool of both intra- and intercontinental NIS already established in adjacent water bodies (see Leppäkoski et al. 2002a for regional overviews for the Baltic and other brackish seas of Europe).

• Gradients. The Baltic Sea is characterized by a complicated, three-dimensional (i.e. physical, chemical, and biological) network of environmental gradients. These gradients, both horizontal and vertical, provide NIS of different origin a repertoire of hospitable conditions. Inoculation events have taken place along the whole salin-ity gradient from >20 to <2 psu of the Baltic Sea, from Kattegat in the west to the diluted, innermost parts of the Baltic.

• Habitats. The habitat surfaces in the Baltic region range from hard bottoms covered by algal vegetation to muddy and sandy sediments at very shallow depths. The salinityrange of these brackish habitats covers the oligo- and mesohaline conditions prevail-ing in the Baltic.

• Vacant niches. Even if the concept of vacant vs. occupied niches can be debated, it is obvious that there were several Eltonian niches available for human-mediated invad-ers in aquatic communities of the Baltic Sea, e.g., those of large semiaquatic rodents (the muskrat Ondatra zibethicus), large migratory decapods (the Chinese mitten crab Eriocheir sinensis), and hard-bottom filter-feeders in the most oligohaline lagoons (the zebra mussel Dreissena polymorpha).

• Absence of predators and competitors. The Baltic Sea with its low number of native species and relatively simple food webs is vulnerable to functional changes if the species composition is altered and offers excellent opportunities for detailed studies in invasion biology. Along the gradients, the number of animal species of marine origin decreases from the Kattegat (>850 species) to the Baltic proper (about 80), the

Living in a sea of exotics – the Baltic Case 239

Bothnian Sea (50), and the innermost Bothnian Bay (<10). Of about 180 species of macroalgae found in the Kattegat, only about a dozen species occur in the Bothnian Bay. The number of fish species is reduced from ca. 70 in the southwestern Baltic to about 20 in the Bothnian Sea and 6-10 in the Bothnian Bay (see Voipio 1981; Leppäkoski & Bonsdorff 1989; Elmgren & Hill 1997 for reviews). The absence of predators and competitors among the impoverished biota of the inner parts of the Baltic can be one of the major decisive factors in the success of introductions of NIS.

• Invasion corridors. In addition to the contact with the Atlantic through the Danish Straits, the major rivers of Europe provide cross-continent invasion corridors for NIS to spread to the Baltic Sea, e.g., the Black Sea/Caspian Sea-Volga-Baltic and Lake Ladoga shipping routes and contacts with large European lakes (Ladoga, Onega, Peipsi) in the north, and Vistula and Oder river systems in the south. The sea and its drainage area are connected to the Ponto-Caspian brackish seas (Black, Azov and Caspian Seas) by rivers and canals since the 18th century, providing access from the Mediterranean and the Ponto-Caspian basin to Central, Western and Northern Europe (Kinzelbach 1995; Bij de Vaate et al. 2002; Jazdzewski & Konopacka 2002). Some 250 rivers discharge fresh water into the Baltic from the drainage area that is four times greater than its sea surface itself. Consequently, every single NIS established within the drainage basin can be transported to the sea or its most diluted coastal areas.

• Intense trade contacts with the Americas, established in the 15th century, connected European coasts with source areas of similar climate regions. Natural barriers, such as the fully saline oceans, preventing coast-bound and freshwater species to spread, were broken down by ship traffic across the oceans. Increasing shipping activities (both intra-Baltic and international) resulted in the development of busy ports in the Baltic Sea countries connecting them to ports all around the world. Recently, shipping (i.e. ballast water, sediments in ballast tanks and hull fouling) is the most important vector for species invasions. Restricted use of tributyltin (TBT) as antifoulant with an ultimate ban to take effect in 2006 will further increase the worldwide trade of marine invaders. In addition to the existing ports, future development of new ports in the northeastern Baltic will further increase the probability of introductions. A 4-fold increase in ships’ traffic in the Gulf of Finland only is expected from 1990 to 2010.

• Intentional introductions into European lakes for stocking purposes of mainly North American fish species have contributed to the Baltic Sea fauna. Introductions have been continuous since the first part of the 19th century. During the 1920s and 1930s a large number of alien fish species were moved into European fresh waters for general fishery management purposes. The third period of intensive introduction was during the 1960s and 1970s (Lehtonen 2002); some few of the imported fish species have been able to establish reproducing populations in the brackish Baltic (Alien Species Directory – Baltic Sea Alien Species Database 2002). Within a former USSR program of transplantations of crustaceans, beginning about 1950, more than 40 Ponto-Caspian amphipod and mysid species from the “Caspian complex” were used for acclimatization purposes in order to improve foraging conditions for fish. Many of them have expanded their ranges from the southeast European source pool into central and western Europe, including the coastal lagoons of the Baltic (Arbaciauskas 2002, Jazdzdewski & Konopacka 2002; Ojaveer et al. 2002 and references therein).


2. Recent invasion status of the Baltic Sea

The Baltic Sea is a sea of invaders: being a former post-glacial lake, it has been subjected to spontaneous invasion of fauna and flora in the last 10,000 years (Leppäkoski et al. 2002b). The first non-native stocks of catchable fish were most probably transplanted into the lakes soon after the end of the last glaciation period by the early tribes colonizing the northwestern Europe. These introductions and their spread into the Baltic coastal waters remain cryptic, however. The first human-mediated introduction of North American species to northern Europe is supposed to be the soft-shell clam (Mya arenaria),carried across the Atlantic by the Vikings (Petersen et al. 1992). Among the earliest known introductions into the Baltic Sea are the Ponto-Caspian zebra mussel (Dreissena polymorpha) that spread into the SE Baltic coastal lagoons in the early 1800s (Olenin et al. 1999), and the North American barnacle (Balanus improvisus), first recorded in the southeastern Baltic in 1844 (Luther 1950).

In the beginning of the year 2002, >100 NIS have been recorded in the Baltic, approxi-mately 70 of which have been able to establish reproducing populations (Table 1; for full list of species, visit Alien Species Directory – Baltic Sea Alien Species Database 2002). A great majority of them are found in the most diluted coastal lagoons and estuaries only, these hot spot sites being known as centers of xenodiversity (Leppäkoski & Olenin 2000b). Five new species have been recorded during the last 10 years in the Gulf of Finland alone.

The most important source areas for NIS have been the western European waters, the Atlantic coast of North America and the Ponto-Caspian realm. In addition, at least fi ve species are listed as cryptogenic (e.g., the dinofl agellate Prorocentrum minimum and the ship worm Teredo navalis). The invasion rate for the Baltic Sea region was one new NIS every year e.g. over the period 1995-1999 (Alien Species Directory – Baltic Sea Alien Species Database 2002).

Few estimates are available for the proportion of NIS in relation to the total num-ber of species in the Baltic. On the German Baltic Sea coast, about 450 bottom-living species have been recorded; of these, 15 species or 3% are NIS (Nehring 1999, 2000). In a benthos study in the eastern Bothnian Sea, 22 species were recorded, among them four NIS (18%). In the Curonian Lagoon (SE Baltic), 16 of the about 95 benthic animal species recorded (17%) are nonindigenous; in the inner oligohaline part of the lagoon the ratio would be 16 to 55 (29%; Olenin 1987; Olenin & Leppäkoski 1999).

The Baltic has been and still is subject to secondary introductions from both the North Sea area and adjacent inland waters. Approximately two-thirds of benthic invertebrates introduced into the Baltic Sea have a pelagic larval stage enabling their within-basin spread by currents or with ballast water. There are very few primary introductions known from the Baltic Sea, e.g., the fishhook water fl ea Cercopagis pengoi and some Pacifi c salmonids (Oncorhynchus spp.). The salmonids generally failed to establish breeding populations with the exception of the rainbow trout O. mykiss, an escapee from fish farms that occasionally breeds in several rivers.


3. The Baltic Sea as a donor area of nonindigenous species

The Baltic Sea acts also as a donor or transit area for NIS for, e.g., the North American Great Lakes. The predatory cladocerans Bythotrephes longimanus and B. cederstroemiwere most likely transferred to the Great Lakes in ballast water taken in the port of Leningrad (St. Petersburg) or elsewhere in the Baltic (Berg et al. 1998; MacIsaac et al. 2000). Likewise, Cercopagis pengoi was introduced into the Great Lakes in 1998, i.e. six years after being first found in the Baltic Sea (MacIsaac et al. 1999), almost certainly carried in ballast tanks from the eastern Baltic (Cristescu et al. 2001). In fact, C. pengoiwas among the Ponto-Caspian species predicted to invade the Great Lakes-St. Lawrence River system based on shipping traffic from key donor areas in Europe to Great Lakes’ ports (MacIsaac 1999). The large pool of resting eggs produced during summer months enables C. pengoi to be carried in ballast and achieve rapid population growth when released in receiving areas (Krylov & Panov 1998). The diatom Thalassiosira baltica(first found in Lake Ontario in 1988) likely originated from the Baltic Sea, though other sources were also possible (Edlund et al. 2000).

Table 1. Number of nonindigenous species recorded in the Baltic Sea (Kattegat included) 1800-2001.

W = in the most parts or in the whole Baltic; R = within one of the Baltic sub-regions (visit Alien Species

Directory – Baltic Sea Alien Species Database 2002 for further data)

Ecological

or taxonomic

group

Number

of species

recorded

Established

species

W(R)*

Ecological

or taxonomic

group

Number of

species

recorded

Established

species

W(R)*

Phytoplankton 8 0? (8) Mollusca 12 2 (7)

Phytobenthos 9 0 (9) Bryozoa 1 0 (1)

Invertebrates Tunicata 1 0 (1)

Cnidaria 6 2? (1) Vertebrates

Platyhelminthes 2 0 (2?) Pisces 30 0 (8?)

Nematoda 1 0 (1) Aves 1 1 (0)

Annelida 7 1 (6) Mammalia 2 2 (0)

Crustacea 21 4 (13)

TOTAL 101 12? (57?)


4. Scales and rates

4.1. SPATIAL SCALES

The spatial scales on which species introductions into the Baltic have taken place vary from >20,000 km for species native to East Asia or New Zealand, to >6,000 km for numerous species originating in North America, and 1-100 km only for species spread actively or with man’s aid from one river system to another via canals.

Rates for secondary spread within the Baltic of invaders from the sites of their fi rst establishment have been possible to estimate for a few species only. Based on published fi rst findings, the minimum rate of spread within the Baltic Sea was estimated for the barnacle Balanus improvisus from Königsberg (now Kaliningrad) in 1844 to southwest-ern Finland (1868) at 30 km a-1. The North American polychaete Marenzelleria viridisspread from the southern Baltic coastal inlets up to the Bothnian Bay within 10 years: from the Baltic coast of Germany (1985) to Lithuania (1989) 170 km a-1, further to the south coast of Finland (1990) 480 km a-1, and to the northern Bothnian Sea (1996) 90 km a-1. The mud snail Potamopyrgus antipodarum, native to New Zealand, spread from German Baltic to Gotland (Sweden) (1920) 20 km a-1, to the Åland Islands (1926) 50 km a-1, and finally to the Bothnian Bay (1945) 30 km a-1. Cercopagis pengoi, the pred-atory cladoceran native to the Black Sea area, spread from its bridgeheads in the Gulf of Finland and Gulf of Riga up to the Northern Quark and down to the Gulf of Gdansk in less than 10 years (Leppäkoski & Olenin 2000a; Telesh & Ojaveer 2002).

The vertical distribution of most NIS in the non-tidal Baltic is restricted to shallow waters above the primary halocline at about 50-70 m depth (Fig. 1), below which depth the salinity is several psu higher and oxygen content is lower than in the surface layer. Several species that live on shallow bottoms or in the intertidal zone in their native range occur at deeper depths upon introduction in the brackish Baltic Sea. This brackish water submergence (Remane & Schlieper 1972) has been explained as a result of salinity stratification, or the absence of predators and competitors in the Baltic, or both. Brackish water submergence among introduced species illustrates their flexibility in a novel envi-ronment. NIS that colonize deeper bottoms in the Baltic than in their native range include the barnacle Balanus improvisus, found at 44-53 m and the bivalve Mya arenaria at 45 m depth, and the spionid polychaetes Boccardia redeki at 29 m (Leppäkoski & Olenin 2000a and references therein) and Marenzelleria viridis which was recorded at 300 m depth in the Åland Sea in June, 2002 (Andersin & Lumiaro 2002). In fact, M. viridis(mainly known as an intertidal or estuarine species in its area of origin) is the first NIS detected in the Baltic to permanently colonize soft bottoms even below the halocline.

4.2. SCALES OF IMPACTS

The scales of impact, both spatial and functional, vary from none known to basin-wide. At the species level, known or likely impacts of NIS on native biodiversity and ecosys-tem functioning can be classified as follows: competition for food and/or space; habitat change; food-prey for native species; predation on native species; herbivory; hybridiza-tion with native populations; parasitism; toxicity (excretion of phytotoxins); community


dominance (quantitative changes in community structure); benthic-pelagic interaction (introducing new linkages between the benthic and pelagic subsystems); bioaccumula-tion (storage of toxic substances). Examples of all these functions have been documented among the NIS established in the Baltic Sea (Alien Species Directory – Baltic Sea Alien Species Database 2002; Olenin et al. 2002).

Ecosystem impacts can be detected at different scales as well. Some planktonic NIS (e.g. Acartia tonsa and Cercopagis pengoi in the Baltic) or shallow-water benthic and nektobenthic species (e.g. introduced mysids and gammarid amphipods) influence one subsystem (the pelagial or shallow sublittoral) only whereas several or all subsystems will be influenced by benthic species with planktonic larvae (M. viridis, B. improvisus)A classification system was developed for the Alien Species Directory – Baltic Sea Alien Species Database (2nd edition, 2002) to describe the role of NIS in the food webs of the sea. Following ecofunctional groups were specified: phytoplankton (auto-, hetero- and mixotrophs); zooplankton (phytophagous, predacious); macrophytes; invertebrate parasites; benthic macrofauna (suspension and deposit feeders, omnivores, nektobenthic organisms, wood borers); fishes (phytophagous, planktivorous, benthophagous, preda-cious); birds; mammals (Olenin et al., 2002).

5. From distributions to structures and functions

A study of scales of awareness reveals how well NIS-related topics have been studied and understood during the first 50 years of research into invasion biology in the Baltic

0

1

2

3

4

5

6

7

<20 21-30 31-40 41-50 51-60 61-70 71-80 81-90 91-100 101-

110

111-

120

121-

124

Depth intervals, m

Nu

mb

er o

f al

ien

sp

ecie

s

0

5

10

15

20

25

30

35

40

45

50

Nu

mb

er o

f n

ativ

e sp

ecie

s

Figure 1. Vertical distribution in the eastern Baltic Sea of native (curve) and nonindigenous (staples) zoobenthic species in 1981-1992 (from Leppäkoski & Olenin 2000a, quoting Olenin 1987).


Sea countries. The first studies focused mainly on the occurrence of species in relation to the salinity gradients prevailing along the S-N axis in the Baltic and its gulfs. Studies on the functional role of NIS were started in the late 1990s. Along with these studies, an ecologisation of invasion biology of the Baltic Sea took place. Experimental studies on the interspecific relationships between NIS and the native fauna are still scarce (see Table 2 for references).

Table 2. History of invasion biology in the Baltic Sea

Year Milestones References

2002 An all-European book published from the BMB

Working Group and other co-operative groups

Leppäkoski et al. 2002a

2002 > 105 NIS known Leppäkoski et al. 2002b

2001 1st intergovernmental response: HELCOM supports

development of the Database on Alien Species

HELCOM documents

2000 ERNAIS1) established; >50 European scientists

included

http://www.zin.ru/projects/invasions/

gaas/ernaismn.htm

2000 1st Nordic Directory of NIS Weidema 2000

1999 1st onboard study of ballast water Olenin et al. 2000

1999 1st Nordic risk assessment Gollasch & Leppäkoski 1999

1998-1999 1st EU Concerted Action on ballast water Rosenthal et al. 1998

1996-2001 5 PhD dissertations Bochert 1996; Zettler 1996; Röhner

1997; Kotta 2000; Daunys 2001

1996-2000 21 publications/5 years Baltic Marine Environment

Bibliography 2002

1997 1st Baltic database; 78 NIS listed Olenin et al. 2002

1997 1st PhD course3)

1996 1st genetic studies on populations and strains Röhner et al. 1996


Table 2. Continued.

Year Milestones References

1995 1st PhD on benthic NIS Fritzsche 1995

1994 BMB WG 302) established

1994 1st Governmental response Jansson 1994

1994 Alien species (ca 40) in Swedish coastal waters

listed

Jansson 1994

1989-1993 2 publications/5 years Baltic Marine Environment

Bibliography 2002

1983 1st presentation at BMB Symposia;

35 NIS mentioned

Leppäkoski 1984

1962-1963 1st intentional introduction of crustaceans into

a coastal lagoon

Gasiunas 1964

1951 15 NIS mentioned Nikolajev 1951

1948 Invasion history of Balanus improvisus discussed Hägg 1948

1946 Mya arenaria regarded as a Neo-European of

American origin

Hessland 1946

1935 ICES recommended to publish a report on NIS ICES 1935

1852 1st plans to introduce oyster and lobster in

the Gulf of Finland

Hamel 1852

> 1804 Dnieper and Neman rivers linked by Oginskij

Canal; Dreissena polymorpha appears in

the Curonian Lagoon

Nikolajev 1963

1) ERNAIS - European Research Network on Aquatic Invasive Species2) BMB WG 30 - Baltic Marine Biologists’ Working Group on Non-Indigenous Estuarine and Marine

Organisms3) PhD course in invasion biology, helt at Åbo Akademi University, Finland, was funded by the Nordic

Academy for Advanced Study (NorFA)


In the Baltic Sea, several NIS play an important role as ecosystem engineers, defi ned as species that “directly or indirectly control the availability of resources to other organ-isms by causing physical state changes in biotic or abiotic materials” (Jones et al., 1997; Karataev et al., 2002). Engineering organisms can cause physical modification of the environment, and influence the maintenance or creation of habitats (Ojaveer et al. 2002). In the Baltic Sea, NIS are known to affect habitat properties and, consequently, several ecosystem processes (e.g., nutrient and contaminant cycling, energy flow), involving multiple trophic levels, are affected, especially for zooplankton and zoobenthos. Effects on diversity have not been well studied for the majority of invasions; although most inva-sions appear to add to local diversity, in some cases diversity declines have occurred at this scale (Table 3; Olenin & Leppäkoski 1999; Ojaveer et al., 2002).

Table 3. Examples of habitat engineering and ecosystem changes caused by Ponto-Caspian invasive species

in the Baltic Sea, inland European freshwater bodies and North American Great Lakes (modified from

Ojaveer et al. 2002).

Species/function 1 2 3 4 5 6 7 8 9 10 11

Cordylophora caspia (Hydrozoa) × × ×

Cercopagis pengoi (Cladocera) ×

Pontogammarus robustoides (Amphipoda) × ×

Echinogammarus ischnus (Amphipoda) × × ×

Corophium curvispinum (Amphipoda) × × × × × × × × ×?

Hemimysis anomala (Mysidacea) × ×

Dreissena polymorpha (Mollusca) × × × × × × × × × × ×

Neogobius melanostomus (Pisces) × × × × ×

1) modifies rocky bottom or sediment substrate

2) provides refuges from predators and currents

3) traps and accumulates POM in interstitial microhabitats

4) increases water clarity (= lowers concentrations of POM and suspended solids)

5) affects macrophyte canopy

6) redirects energy from pelagic to benthic subsystems or vice versa

7) provides additional prey to planktivorous and/or benthivorous fi sh

8) provides food for waterfowl

9) excludes competing species

10) increases soluble (bioavailable) nutrients (N, P)

11) influences cycling of organic and/or metal contaminants

12) ? – undocumented


6. Impacts on uses and resources

An assessment of known or likely impacts on uses of the sea, natural resources and human health includes aquaculture, aquatic transport, fisheries, tourism, water abstrac-tions (e.g. use of cooling water), and water quality (Table 4; Olenin et al. 2002). In economic terms, attempts to evaluate the damages and benefits related to NIS can yield (cf. Turner et al. 1996)• direct use values (outputs measurable as fish yield, recreational values, transport)• indirect use values (functional values, e.g. the value of changes in productivity, pre-

ventive expenditures)• non-use values (value of passing on the sea in an intact way to future generations)

Many of the ecosystem services or damages related to NIS as well as the novel func-tions provided by them (see Olenin & Leppäkoski 1999 for examples) are typically non-market goods. Indirect economic losses or benefits resulting from NIS are therefore not possible to assess. The valuation of costs or benefits for direct uses (fisheries, industrial water use, sea traffic and other assets potentially at risk) is needed to consider the policy options that are of crucial importance for the coastal zone management.

Most of the NIS do not, however, have any influence on economic or societal inter-ests. Approximately 70 NIS in the Baltic Sea are more or less naturalized. Less than 20 of them (i.e. less than 30%) can be classified as nuisance species that cause damage to underwater constructions, fisheries, shores and embankments or to target species for hunting. Seven of them have caused significant damage. These are three Ponto-Caspian species (the hydrozoan Cordylophora caspia, the cladoceran Cercopagis pengoi, and the bivalve Dreissena polymorpha), two North-American species (the barnacle Balanus improvisus and the American mink Mustela vison), the Japanese swim-bladder nematode Anquillicola crassus and the shipworm mollusk Teredo navalis, believed to be of Indo-Pacific origin. Toxic blooms of several species of planktonic algae can cause hygienic problems or risks (Leppäkoski, 2002). For the sake of comparison, 10% of NIS have caused significant economic or ecological damage in the North American Great Lakes (Cairns & Bidwell, 1996).

The economic impacts of NIS in the Baltic Sea have rarely been quantified. The foul-ing of nets makes C. pengoi a nuisance species that may cause substantial economic loss in fisheries. The estimated loss in one fishery enterprise in the eastern Gulf of Finland, in average during 1996–1998, was at minimum USD 50,000, caused by the drastic decline in fish catches in the coastal zone due to fouling of fishing equipment by C. pengoi(Panov et al. 1999). During the exceptionally warm summer 1999, C. pengoi became a serious problem in the eastern Gulf of Finland, the inner parts of the Archipelago Sea, Finland, the northern Bothnian Sea and Lithuania (Leppäkoski, 2002). The cryptogenic shipworm T. navalis, fully established in the southwestern Baltic region, caused dam-ages to submerged wooden installations estimated at 25-50 Mio euro along the Baltic coast of Germany alone (Hoppe, 2002). The shipworm also causes damage to marine archaeological objects.


Table 4. Nuisance species among the >100 nonindigenous species recorded in the Baltic Sea (the Kattegat

included) by 2002. Data on origin, date of introduction and vectors mainly from Leppäkoski & Olenin 2000;

modified from Leppäkoski 2002 and references therein).

Type of nuisance

SpeciesOrigin

Time of introduction

into the BalticVector

1. Fouling of installations, water supply systems, boats, fishing gear

Coscinodiscus wailesii

Centric diatomIndo-Pacifi c? 1980s

Shipping or

associated

Cordylophora caspia

Brackish-water hydroidPonto-Caspian early 1800s Shipping, canals

Styela clava 1)

Leathery sea squirtNW Pacifi c 1990s Shipping

Ficopomatus enigmaticus 1)

TubewormS Hemisphere 1950s Shipping

Cercopagis pengoi

Fishhook water fl eaPonto-Caspian 1990s Shipping

Balanus improvisus

Bay barnacleN America 1840s Shipping

Dreissena polymorpha

Zebra musselPonto-Caspian early 1800s Shipping, canals

2. Impacts on fisheries, boating and recreational qualities

Sargassum muticum 1)

JapweedSE Asia 1980s Associated

Elodea canadensis 1)

Canadian waterweedN America 1870s Ornamental

C. pengoi

Eriocheir sinensis

Chinese mitten crabSE Asia 1920s Shipping

3. Parasites or pests on fish and shellfi sh

Pseudodactylogyrus spp.

Gill parasitic monogeneansPacifi c 1980s Associated

Anguillicola crassus

Swimbladder nematodeSE Asia 1980s Associated

Crepidula fornicata 1)

Slipper limpetN America 1940s Associated


Table 4. Continued

Type of nuisance

SpeciesOrigin

Time of introduction

into the BalticVector

4. Damage caused to wooden objects (boring)

Teredo navalis

Shipworm molluscSE Asia? 1700s Shipping

5. Impacts on water quality; hygienic (toxic) risks

Alexandrium tamarense

Dinofl agellateUnknown Unknown Shipping

Gyrodinium spp.

Dinofl agellateUnknown 1980s Shipping

Gymnodinium spp.

Dinofl agellateUnknown 1990s Shipping

Branta canadensis 2)

Canada gooseN America 1930s Stocking

Branta leucopsis2)

Barnacle gooseArctic Sea Cryptic 3)

6. Damage caused to agriculture from overgrazing

B. canadensis

B. leucopsis

7. Damage caused to shores (burrowing)

E. sinensis 1)

Ondatra zibethicus

MuskratN America 1920s Stocking

8. Damage caused to target species for hunting

Mustela vison

American minkN America 1920s

Escapee from fur

farms

1) negligible in brackish water2) both goose species are known to foul beaches and cause a risk for bacterial contamination (Salmonella)2) the origin of the barnacle goose remains cryptic; it is believed that escapees from zoological gardens formed

the founder population in both Finland and Sweden


NIS have no economic value of food resources in the Baltic as none of them support commercial fisheries; invertebrates are not harvested for food because of their small size. Some planktonic invaders (e.g., the fishhook water flea C. pengoi) and planktonic larvae of several benthic NIS have a high value as food source for commercially har-vested fish such as the Baltic herring (e.g. Antsulevich & Välipakka 2000). Positive economic impacts include the recreational resources provided for sport fishing by some nonindigenous fish, such as the rainbow trout (escapees from fish farms along the Finnish coast), the round goby (in the Gulf of Gdansk) and hunting (the muskrat and the Canada goose).

7. International cooperation

International cooperation in the field of invasion biology of the Baltic Sea started in 1994, when the Working Group on Estuarine and Marine Nonindigenous Organisms was established by the Baltic Marine Biologists (BMB), a non-governmental scientific organi-zation. The first meeting of this Group was held at the University of Klaipeda, Lithuania in 1995. Its systematic work on comprehensive inventories resulted in the first Internet-based inventory, issued in 1997, where 78 nonindigenous species (both established and occasional) were listed. In 2002, the database was updated and made interactive, and an international book on alien aquatic species in Europe was published, the initiative to which arose from the BMB activities (Table 2).

In 2000, a European network on aquatic invasive species (ERNAIS) was established in order to facilitate more close cooperation and information exchange between invasion biologists from different regions in Europe. Key objectives of this initiative include the development of international databases on aquatic alien species and assessment of their ecosystem impacts. ERNAIS is hosted by the Regional Biological Invasions Center at the Zoological Institute of the Russian Academy of Sciences in St. Petersburg (http://www.zin.ru/projects/invasions/gaas/ernaismn.htm).

The first risk assessment study for the Baltic Sea area was published in 1999 (Gollasch & Leppäkoski, 1999). It included risk profiles for five northwest European ports along the full salinity gradient from the fresh-water port of St. Petersburg to Bergen on the Atlantic coast of Norway. The first shipping study in the Baltic Sea was undertaken to quantify the survival of organisms in ballast tanks during ship voyages (Olenin et al., 2000). The EU Concerted Action Testing Monitoring Systems for Risk Assessment of Harmful Introductions by Ships to European Waters 1998-1999 brought together scientists work-ing on ballast water in Europe. Both land-based and ocean-going workshops were con-ducted. Besides the partners from EU member states and the IMO as an intergovernmen-tal organization, at least 21 countries participated at one or more of the Concerted Action activities. The project was co-ordinated by the Department of Fishery Biology, Institute of Marine Science, University of Kiel, Germany (Rosenthal et al., 1998).

A review of the research into invasion biology in the Baltic Sea countries reveals a timeline from first records of single new species toward more advanced studies in inva-sion biology (Table 2). During the second half of the 1990s, both scientific and com-mon awareness of alien species and the risks associated to them increased markedly.


An increasing number of PhD dissertations and publications clearly demonstrates the birth and initial growth of a new discipline in brackish-water ecology in the region.

In the Baltic Sea countries NIS were added to the environmental policy agenda in the mid-1990s only, although both intentional and unintentional introductions had existed long before their environmental and economic impact was recognized and formulated. The Environment Committee of the Helsinki Commission (HELCOM) requested the Contracting Parties to take action in reducing risks associated with intentional introduc-tions and to consider possibilities of monitoring the distribution of already established species within the Baltic Monitoring Programme.

8. Conclusions

Of the approximately 60 unintentionally introduced species with a known invasion his-tory, 38 are transoceanic (including 19 Atlantic species of American origin) and 18 of Ponto-Caspian origin (Leppäkoski et al., 2002b). A recent review (Ojaveer et al., 2002) revealed substantial gaps in the knowledge of the ecological effects of, e.g., Ponto-Caspian invaders in the region; the same is true for invaders from other donor areas (N America, SE Asia). We lack basic impact studies on important ecosystem processes and trophic levels (e.g., changes in native species richness, phytoplankton and primary productivity, contaminant cycling, fisheries), even for the most abundant and well-rec-ognized NIS. Moreover, only a few studies examine the effects of invasions in aquatic food webs; this knowledge is of high importance for proper management of ballast water and other major vectors.

In terms of species number, xenobiota constitute a small portion of the macrozoo-benthos and zooplankton in the open Baltic and even in its coastal lagoons. However, their functional role in recipient ecosystems is much more important, since most of these species became dominant in the communities and have significantly changed the native environment. The Curonian lagoon has the highest number of introduced Ponto-Caspian species, due to intentional introductions into adjacent fresh waters in the 1960s.

The polychaete Marenzelleria viridis and the cladoceran Cercopagis pengoi have caused measurable and documented changes in the Baltic Sea ecosystem. While the impact of the polychaete could be characterized as basin-wide, that of the cladoceran is apparently confined mostly to sheltered, coastal areas. The major adverse economic impacts of NIS are limited to seven species.

References

Alien Species Directory – Baltic Sea Alien Species Database, 2002. Olenin S & Leppäkoski E (eds). http:

//www.ku.lt/nemo/mainnemo.htm

Andersin, A-B. & R. Lumiaro, 2002. Marenzelleria, new alien polychaete in the Baltic Sea, has spread explo-

sively to the Gulf of Bothnia. http://www2.fi mr.fi /fi /aranda/uutiset/39.html (in Finnish)

Antsulevich, A. E. & P. Välipakka, 2000. Cercopagis pengoi - new important food object of the Baltic herring

in the Gulf of Finland. International Review of Hydrobiology 85: 609-619


Arbaciauskas, K., 2002. Ponto-Caspian amphipods and mysids in the inland waters of Lithuania: history of

introduction, current distribution and relations with native malacostracans. In E. Leppäkoski, S. Gollasch

& S. Olenin (eds), Invasive Aquatic Species of Europe. Distribution, Impacts and Management, pp 104-

115. Kluwer Academic Publishers, Dordrecht.

Baltic Marine Environment Bibliography, 2002. The Baltic Marine Environment Protection Commission

(HELCOM - Helsinki Commission). http://otatrip.hut.fi /vtt/baltic/search.html

Berg, D. J., D. W. Garton, H. J. MacIsaac & V. E. Panov, 1998. Bythotrephes cederstroemi in the Great Lakes:

genetic identification of a European source population and erosion of founder effects. SIL 27 Congress,

Dublin, Ireland. p 206 (Abstract)

Bij de Vaate, A., K. Jazdzewski, H. A. M. Ketelaars, S. Gollasch & G. Van der Velde, 2002. Geographical

patterns in range extension of Ponto-Caspian macroinvertebrate species in Europe. Canadian Journal of

Fisheries and Aquatic Science 59: 1159–1174

Bochert, R., 1996. Untersuchungen zur Reproduktionsbiologie von Marenzelleria viridis (Polychaeta,

Spionidae) in einem flachen Küstengewässer der südlichen Ostsee. Ph. D. Thesis, Universität Rostock.

138 pp.

Cairns, J. & J. R. Bidwell, 1996. Discontinuities in technological and natural systems caused by exotic species.

Biodiversity and Conservation 5: 1085-1094.

Cristescu, M., P. D. N. Hebert, J. Witt, H. J. MacIsaac & I. Grigorovich, 2001. An invasion history for

Cercopagis pengoi based on mitochondrial gene sequences. Limnology and Oceanography 46: 224-229.

Daunys, D., 2001. Patterns of the bottom macrofauna variability and its role in the shallow coastal lagoon. Ph.

D. Thesis, University of Klaipeda. 85 pp.

Edlund, M. B., C. M. Taylor, C. M. Schelske & E. F. Stoermer, 2000. Thalassiosira baltica (Grunow) Ostenfeld

(Bacillariophyta), a new exotic species in the Great Lakes. Canadian Journal of Fisheries and Aquatic

Sciences 57: 610-615.

Elmgren, R. & C. Hill, 1997. Ecosystem function at low biodiversity - the Baltic example. In R. F. G. Ormond,

J. D. Gage & M. V. Angel (eds) Marine Biodiversity: Patterns and Processes, pp 319-336. Cambridge

University Press, Cambridge.

Fritzsche, D., 1995. Leistungsanalytische und resistenzökologische Untersuchungen zur Emanzipation

des Polychaeten Marenzelleria viridis (Verrill 1873) gegenüber den Faktoren Salinität und

Sauerstoffpartialdruck. Ph. D. Thesis, Universität Rostock. 106 pp.

Gasiunas, I., 1964. Acclimatisation of forage crustaceans into the Kaunas Waterpower Plant reservoir and pos-

sibility of their migration into other waters of Lithuania. Trudy Akademii Nauk Litovskoi. SSR, Serija B

1(30) (in Russian).

Gollasch, S. & E. Leppäkoski (eds), 1999. Initial Risk Assessment of Alien Species in Nordic Coastal Waters.

Nord 1999:8. Nordic Council of Ministers, Copenhagen. 244 pp.

Hägg, R., 1948. Some notes on quaternary and recent Cirripeda. II. Balanus improvisus. Geologiska

Föreningens Förhandlingar 70: 348-349.

Hamel, 1852. Ueber das Project: Austern, wie auch Hummern, Seekrebse, Krabben und Miesmuscheln im

Finnischen Meerbusen zu ziehen. Bulletin de la Classe Physico-Mathématique de L’Académie Impériale

des Sciences de Saint-Pétersbourg 10 (18,19,20).

Hessland, I., 1946. On the Quaternary Mya period in Europe. Arkiv för Zoologi 37A (8): 1-51.

Hoppe, K. N., 2002. Teredo navalis – the cryptogenic shipworm. In E. Leppäkoski, S. Gollasch & S. Olenin

(eds), Invasive Aquatic Species of Europe. Distribution, Impacts and Management, pp 116-119. Kluwer

Academic Publishers, Dordrecht.

ICES, 1935. Combined Baltic and Transition area Committees. Rapports et Procès-verbaux des Réunions 94:


31-32.

Jansson, K., 1994. Alien species in the marine environment. Swedish Environmental Protection Agency Report

4357, 67 pp.

Jazdzewski, K. & A. Konopacka, 2002. Invasive Ponto-Caspian species in waters of the Vistula and Oder

basins and the southern Baltic Sea. In: E. Leppäkoski, S. Gollasch & S. Olenin (eds), Invasive Aquatic

Species of Europe. Distribution, Impacts and Management, pp 384-398. Kluwer Academic Publishers,

Dordrecht.

Jones, C. G., J. H. Lawton & M. Shachak, 1997. Positive and negative effects of organisms as physical ecosys-

tem engineers. Ecology 78: 1946-1957.

Karataev, A. Y., L. A. Burlakova & D. K. Padilla, 2002. Impacts of zebra mussels on aquatic communities

and their role as ecosystem engineers. In E. Leppäkoski, S. Gollasch & S. Olenin (eds), Invasive Aquatic

Species of Europe. Distribution, Impacts and Management, pp 433-446. Kluwer Academic Publishers,

Dordrecht.

Kinzelbach, R., 1995. Neozoans in European waters - Exemplifying the worldwide process of invasion and

species mixing. Experientia 51: 526-538.

Kotta, J., 2000. Impact of eutrophication and biological invasions on the structure and functions of benthic

macrofauna. Ph. D. Thesis, University of Tartu. 160 pp.

Krylov, P. I. & V. E. Panov, 1998. Resting eggs in the life cycle of Cercopagis pengoi, a recent invader of the

Baltic Sea. Archiv für Hydrobiologie Special Issues in Advanced Limnology 52: 383-392.

Lehtonen, H., 2002. Alien freshwater fishes of Europe. In E. Leppäkoski, S. Gollasch & S. Olenin (eds),

Invasive Aquatic Species of Europe. Distribution, Impacts and Management, pp 153-161. Kluwer

Academic Publishers, Dordrecht.

Leppäkoski, E., 1984. Introduced species in the Baltic Sea and its coastal ecosystems. Ophelia Suppl. 3: 123-135.

Leppäkoski, E., 2002. Harmful non-native species in the Baltic Sea - an ignored problem. In G. Schernewski

& U. Schiewer (eds), Baltic Coastal Ecosystems: Structure, Function and Coastal Zone Management,

pp 253-275. Central and Eastern European Development Studies, Springer-Verlag, Berlin Heidelberg.

Leppäkoski, E. & E. Bonsdorff, 1989. Ecosystem variability and gradients. Examples from the the Baltic Sea as

a background for hazard assessment. In: L. Landner (ed) Chemicals in the aquatic environment, pp 6-58.

Springer-Verlag, Berlin Heidelberg.

Leppäkoski, E. & S. Olenin, 2000a. Non-native species and rates of spread: lessons from the brackish Baltic

Sea. Biological Invasions 2: 151-163.

Leppäkoski, E. & S. Olenin, 2000b. Xenodiversity of the European brackish water seas: the North American

contribution. In J. Pederson (ed), Marine Bioinvasions. Proceedings of the First National Conference,

January 24-27, 1999, pp 107-119. Massachusetts Institute of Technology, Cambridge, MA.

Leppäkoski, E., S. Gollasch & S. Olenin (eds), 2002a. Invasive Aquatic Species of Europe. Distribution,

Impacts and Management. Kluwer Academic Publishers, Dordrecht, The Netherlands, 583 pp.

Leppäkoski, E., S. Gollasch, P. Gruszka, H. Ojaveer, S. Olenin & V. Panov, 2002b. The Baltic - a sea of invad-

ers. Canadian Journal of Fisheries and Aquatic Sciences 59: 1175-1188.

Luther, A., 1950. On Balanus improvisus in the Baltic Sea. Fauna och Flora 45:155-160 (in Swedish).

MacIsaac, H., 1999. Biological invasion in Lake Erie: Past, present and future. In Munawar M & Edsall

T (eds), State of Lake Erie – Past, present and future, pp 305-322. Backhuys Publishers, Leiden, The

Netherlands.

MacIsaac, H. J., I. A. Grigorovich, J. A. Hoyle, N. D. Yan & V. Panov, 1999. Invasion of Lake Ontario by

the Ponto-Caspian predatory cladoceran Cercopagis pengoi. Canadian Journal of Fisheries and Aquatic

Sciences 56: 1-5.


MacIsaac, H. J., H. A. M. Ketelaars, I. A. Grigorovich, C. W. Ramcharan & N. D. Yan, 2000. Modeling

Bythotrephes longimanus invasions in the Great Lakes basin based on its European distribution. Archiv

für Hydrobiologie 149: 1-22.

Nehring, S., 1999. Zur Rolle der Seeschifffahrt bei der Einschleppung fremder Tierarten (Makrozoobenthos) in

deutsche Gewässer. In: Umweltaspekte der Seeschifffahrt. GAUSS Forum, Bremen.

Nehring, S., 2000. Neozoen im Makrozoobenthos der deutschen Ostseeküste. Lauterbornia 39: 117-126.

Nikolajev, I. I., 1951. On new introductions in fauna and flora of the North and the Baltic Seas from distant

areas. Zoologicheskij Zhurnal 30: 556-561 (in Russian).

Nikolajev, I. I., 1963. New introductions in fauna and flora of the North and Baltic Seas. Zoologicheskij

Zhurnal 42: 20-27 (in Russian with English summary).

Ojaveer, H., E. Leppäkoski, S. Olenin & A. Ricciardi, 2002. Ecological impact of Ponto-Caspian invad-

ers in the Baltic Sea, European inland waters and the Great Lakes: an inter-ecosystem comparison. In

E. Leppäkoski, S. Gollasch & S. Olenin (eds), Invasive Aquatic Species of Europe. Distribution, Impacts

and Management, pp 412-425. Kluwer Academic Publishers, Dordrecht.

Olenin, S., 1987. Zoobenthos of the Curonian Lagoon: results of biological monitoring, 1980-1984. In:

Chemistry and Biology of the Seas. Proceedings of the State Oceanographic Institute, pp 175-191.

Hydrometeoizdat, Moscow (in Russian).

Olenin, S. & E. Leppäkoski, 1999. Non-native animals in the Baltic Sea: alteration of benthic habitats in coastal

inlets and lagoons. Hydrobiologia 393: 23-243.

Olenin, S., M. Orlova & D. Minchin D., 1999. Dreissena polymorpha. In S. Gollasch, D. Minchin,

H. Rosenthal & M. Voigt (eds), Exotics Across the Ocean. Case Histories on Introduced Species,

pp 37-42. Logos Verlag, Berlin.

Olenin, S., S. Gollasch, S. Jonusas & I. Rimkute, 2000. En-route investigations of plankton in ballast water

on a ships’ voyage from the Baltic Sea to the open Atlantic coast of Europe. International Review of

Hydrobiology 85: 577-596.

Olenin, S., E. Leppäkoski & D. Daunys, 2002. Internet database on aliens species in the Baltic Sea. In

E. Leppäkoski, S. Gollasch & S. Olenin (eds), Invasive Aquatic Species of Europe. Distribution, Impacts

and Management, pp 525-528. Kluwer Academic Publishers, Dordrecht.

Panov, V. E., P. I. Krylov & I. V. Telesh, 1999. The St. Petersburg harbour profile. In S. Gollasch &

E. Leppäkoski (eds), Initial Risk Assessment of Alien Species in Nordic Coastal Waters, pp 225-244. Nord

8. Nordic Council of Ministers, Copenhagen.

Petersen, K. S., K. L. Rasmussen, J. Heinemeler J & N. Rud, 1992. Clams before Columbus? Nature 359: 679.

Remane, A. & C. Schlieper, 1972. Biology of Brackish Water. Die Binnengewässer 25. E. Schweizerbart,

Stuttgart, 372 pp.

Röhner, M., 1997. Allozymelektrophoretische Analyse der kryptisch-parallelen Immigration zweier

Zwillingsarten der Gattung Marenzelleria (Polychaeta: Spionidae) in Nord - und Ostsee einschließlich

der vergleichenden Betrachtung der autochthonen Art Hediste diversicolor (Polychaeta: Nereidae). Ph. D.

Thesis, Universität Rostock. 125 pp.

Röhner, M., R. Bastrop & K. Jürss, 1996. Colonization of Europe by two American genetic types or species

of the Marenzelleria (Polychaeta: Spionidae). An electrophoretic analysis of allozymes. Marine Biology

127: 277-287.

Rosenthal, H., S. Gollasch, I. Laing, E. Leppäkoski, E. Macdonald, D. Minchin, M. Nauke, S. Olenin, S. Utting,

M. Voigt & I. Wallentinus, 1998. Testing monitoring systems for risk assessment of harmful introduc-

tions by ships to European waters. Proceedings of the Third European Marine Science and Technology

Conference, Lisbon, 23-27 May, 1998. European Commission. pp 921-928.


Telesh, I. V. & H. Ojaveer, 2002. The predatory water flea Cercopagis pengoi in the Baltic Sea: invasion history,

distribution and implications to ecosystem dynamics. In E. Leppäkoski, S. Gollasch & S. Olenin (eds),

Invasive Aquatic Species of Europe. Distribution, Impacts and Management, pp 62-65. Kluwer Academic

Publishers, Dordrecht.

Turner, R. K., S. Subak & W. N. Adger, 1996. Pressures, trends, and impacts in coastal zones: interactions

between socioeconomic and natural systems. Environmental Management 20: 159-173.

Voipio, A. (ed), 1981. The Baltic Sea. Elsevier Oceanography Series 30, 418 pp.

Weidema, I. R. (ed), 2000. Introduced Species in the Nordic Countries. Nordic Council of Ministers,

Copenhagen. Nord 2000:13, 242 pp.

Zettler, M. L., 1996. Ökologische Untersuchungen am Neozoon Marenzelleria viridis (Verrill, 1873)

(Polychaeta: Spionidae) in einem Küstengewässer der südlichen Ostsee. Ph. D. Thesis, Universität

Rostock. 149 pp.

Weidema IR (ed) (2000) Introduced Species in the Nordic Countries. Nordic Council of Ministers, Copenhagen.

Nord 2000:13, 242 pp

Zettler ML (1996) Ökologische Untersuchungen am Neozoon Marenzelleria viridis (Verrill, 1873) (Polychaeta:

Spionidae) in einem Küstengewässer der südlichen Ostsee. Dissertation, Universität Rostock. 149 pp.

Chapter 15

Internet-based information resources on aquatic alien species relevant to the Ponto-Caspian Region

VADIM E. PANOVZoological Institute, Russian Academy of Sciences, 199034 St. Petersburg, Russiae-mail: [email protected]

Keywords: invasive species, Black Sea, Caspian Sea, Baltic Sea, databases, information networks.

Open information systems are considered to be essential elements of dissemination of information on invasive alien species, and are powerful management tools. A review of available online information resources, relevant for the Ponto-Caspian Region, has revealed that they are not sufficient to serve the region. Development of the regional, Ponto-Caspian online information system on aquatic alien species is urgently needed, in view of the accelerating rates of introductions of harmful alien species in the region, severe impacts of these species on the environment, and associated economic losses. Such an information system should be developed using already available information technologies, in order to ensure its effective incorporation in a global invasive species information network.

1. Introduction

The development of open databases and information systems on invasive alien species* is essential for effective international cooperation in data and expertise sharing, and pro-vides support for management and control efforts. The international legal regime requires governments and other relevant organizations to support the creation and maintenance of such information resources (Decision VI/23 2002). These resources may provide comprehensive information for the management of invasive alien species, as well as for scientific and educational purposes.

The following definitions are used: (i) “alien species” refers to a species, subspecies or lower taxon, introduced outside its natural past or present distribution. Introduction includes any part, gametes, seeds, eggs, or propagules of such species that might survive and subsequently reproduce; (ii) “invasive alien species” means an alien species whose introduction and/or spread threaten biological diversity (iii) “introduction” refers to the

257




movement by human agency, indirect or direct, of an alien species outside of its natural range (past or present) (Decision VI/23 2002).

There is an urgent need for open information on aquatic alien species in the Ponto-Caspian area. This region is particularly heavily affected by species invasions: the list of exotic species includes 59 names for the Black Sea, and 39 for the Caspian Sea (Zaitsev & Öztürk 2001). In the early 1980s, the Atlantic ctenophore Mnemiopsis leidyi was introduced with ballast water into the Black Sea, and by the late 1990s it had spread to the Mediterranean and Caspian Seas. The invasion of Mnemiopsis resulted in a drastic decline in the anchovy fishery in the Ponto-Caspian region with huge economic losses, estimated in hundreds of million of US dollars per year. Currently, the unique biodiver-sity of the Caspian Sea is also under serious risk, with numerous species facing extinction (Caspian Environment Programme 2002).

On the other hand, the Ponto-Caspian region is serving as an important donor area of harmful aquatic organisms to other parts of Europe and worldwide. During the last two decades, several invasive species have been introduced to the Baltic Sea with the ballast water of ships, including the Ponto-Caspian cladoceran Cercopagis pengoi which is considered harmful in the Baltic (Leppäkoski et al. 2002a; this volume). The biodiversity of inland running and stagnant waters of Europe and the Great Lakes of North America too is seriously endangered by the introduction of alien species of Ponto-Caspian origin (Ketelaars, this volume). Some of the most harmful of those include the Ponto-Caspian zebra mussel Dreissena polymorpha, a number of amphipod and mysid species, and the fishhook waterfl ea Cercopagis pengoi (Leppäkoski et al. 2002b).

The present paper provides a brief overview of existing internet-based information resources regarding alien species in the Ponto-Caspian region and invasive alien species of Ponto-Caspian origin, and discusses the perspectives of their further use and develop-ment.

2. Regional and international online databases and information systems

2.1. CASPIAN SEA BIODIVERSITY DATABASE

A demonstration version of the Caspian Sea Biodiversity Database (CSBD) has been developed during 2001-2002 in the framework of the UNDP Caspian Environment Programme (CEP), and posted on the CEP web-site since June 2002. The CSBD exists in English and Russian language versions, and currently includes entries on 36 aquatic species, both native (30 species) and alien (6 species) in the Caspian Sea ecosystem (Caspian Sea Biodiversity Database 2002). Alien species in the CSBD are represented by three unintentionally introduced zooplankton organisms: the mediterranean diatom alga Rhizosolenia calcar-avis, the Atlantic copepod Acartia tonsa, the Atlantic cteno-phore Mnemiopsis leidyi, and three intentionally introduced organisms: the Atlantic-Mediterranean clam Abra ovata, and the two fish species, Liza aurata (Atlantic-Mediterranean), and Liza saliens (Mediterranean). The CSBD also includes entries on two native species, considered as invasive outside of the Ponto-Caspian Region, viz. the cladoceran Cercopagis pengoi (fishhook waterflea) and the fi sh Neogobius melanostomus

Internet-based information resources of aquatic alien species 259

(round goby). Entries in the database include information on the species’ taxonomy, their distribution and biology, and bibliographic references. All entries are illustrated by fi g-ures of the organisms involved (Fig. 1). Entries on Cercopagis and Mnemiopsis include Internet-links to entries on these species in the Regional Biological Invasions Center Information System (see section 2.5).

Figure 1. Main page of the Caspian Sea Biodiversity Database with inserted entries of selected invasive species (source: Caspian Sea Biodiversity Database 2002)

2.2. CIESM ATLAS OF EXOTIC SPECIES

The International Commission for the Scientific Exploration of the Mediterranean Sea (CIESM) Atlas of Exotic Species includes detailed descriptions of 125 alien species of


mollusks, 55 species of alien crustaceans, and 91 species of alien fish that have invaded the Mediterranean Sea. The list of alien species includes five species, known as invasive in the Ponto-Caspian region: the Pacific gastropod Rapana venosa, the North Atlantic clam Mya arenaria, the West Atlantic crabs Rhythropanopeus harrisii and Callinectessapidus, the Chinese mitten crab Eriocheir sinensis; and two more species, intentionally introduced in the region: the Japanese oyster Crassostrea gigas, and the Far-East Asian fi sh Mugil soiuy. Individual species pages include illustrations, diagnostic features, bio-logical information, literature references and a distribution map (CIESM 2001).

2.3. BALTIC SEA ALIEN SPECIES DATABASE

An Internet Database on aquatic alien species in the Baltic Sea area was developed as an initiative of the Baltic Marine Biologists´ Working Group on Non-indigenous Estuarine and Marine Organisms in 1997; in 2000, a new concept of the online Database appeared with support received from the Baltic Marine Environment Protection Commission (HELCOM). At present, the database represents an interactive, user-friendly tool, which includes several information-retrieving options.

The database species-directory contains individual species entries. An entry includes the complete taxonomy of a species and available comments, complementing and specifying the database features (year of introduction, ecological impact, etc.). Currently, the directory includes 24 alien species of Ponto-Caspian origin (Fig. 2), and several invasive alien species from other regions, common to the Baltic, Black and Caspian Seas (e.g. the Atlantic barnacle Balanus improvisus and the crab Rhythropanopeus har-risii). The Database Search tool offers a direct way to retrieve information according to a number of major features. It allows the retrieval of data by a single feature (i.e. by “Taxon”) or by combined features (i.e. “Taxon” and “Origin” and “Ecological impact”), including multiple selections of items within any feature.

A list of species, retrieved according to the selected criteria, is linked to relevant individual entries on species and references (Baltic Sea Alien Species Database 2002, Olenin et al. 2002), which include individual entries on such invasive Ponto-Caspian species as the fishhook waterflea Cercopagis pengoi and the round goby Neogobiusmelanostomus. Some species-specific entries are hosted by the Regional Biological Invasions Center Information System (see section 2.5). The entry for the zebra mussel, Dreissena polymorpha,is an example.

2.4. GLOBAL INVASIVE SPECIES DATABASE

The Global Invasive Species Database was developed by the IUCN/SSC Invasive Species Specialist Group (ISSG) as part of the global initiative on invasive species, led by the Global Invasive Species Programme (GISP 1999). It provides global information on invasive alien species to agencies, resource managers, decision-makers, and interested individuals. The database focuses on invasive species that threaten biodiversity and covers all taxonomic groups from micro-organisms to animals and plants. Species information is supplied by expert contributors from around the world and includes the species’ biology, ecology, native and alien range, bibliographic references, contacts, links and images.


Currently it includes entries for the 100 “World’s Worst Invasive Alien Species”, which involve both aquatic invasive species of Ponto-Caspian origin (the fishhook waterfl ea Cercopagis pengoi and zebra mussel Dreissena polymorpha) and harmful aquatic species that invaded the Ponto-Caspian region (the Atlantic ctenophore Mnemiopsis leidyi and the Chinese mitten crab Eriocheir cinensis) (Fig. 3). These information sources are linked to the Baltic Sea Alien Species Database, the Caspian Sea Biodiversity Database and the Regional Biological Invasions Center Information System (see section 2.5) (ISSG Global Invasive Species Database).

Figure 2. Alien Species Directory of the Baltic Sea Alien Species Database with inserted results of the query on Ponto-Caspian species (source: Baltic Sea Alien Species Database 2002)


Figure 3. Main page of the Global Invasive Species Database with inserted entries of selected invasive species of interest (source: ISSG Global Invasive Species Database)

2.5. REGIONAL BIOLOGICAL INVASIONS CENTER INFORMATION SYSTEM

The Regional Biological Invasions Center Information System (RBIC), hosted by the Zoological Institute of the Russian Academy of Sciences in St. Petersburg, is a new prod-uct of the Group on Aquatic Alien Species (GAAS) web-site, which initially was opened in 1999, and at that time already included first versions of entries on two Ponto-Caspian invasive species, Dreissena polymorpha and Cercopagis pengoi (Panov 1999). Beginning with 2001, the GAAS web-site became a part of RBIC. Currently RBIC is serving as the regional clearinghouse on invasive alien species (both aquatic and terrestrial), and as a web portal, providing access to the Internet-based information resources on invasive species research and management in Europe and worldwide (Regional Biological Invasions Center 2001a). The development of the Geographic Information System “INVADER” as an international database on the Internet is one of RBIC’s priorities. Currently, a demon-stration version of GIS “INVADER”, with comprehensive geo-referenced information on the distribution of the Ponto-Caspian invasive cladoceran Cercopagis pengoi in Europe and North America, is available online (Regional Biological Invasions Center 2001b).


An example of a GIS “INVADER” - generated map of distribution of the Atlantic cteno-phore Mnemiopsis leidyi in the Ponto-Caspian Region is provided in Fig. 4.

Figure 4. Example of the GIS “INVADER”-generated map: distribution of Mnemiopsis leidyi in the Ponto-Caspian Region (asterisks indicate sites of 1st records in the ecosystems) (source: RBIC - Regional Biological Invasions Center - 2001b)

On-line geo-referenced distribution maps of selected invasive species, including Mnemiopsis leidyi, Dreissena polymorpha and Cercopagis pengoi, along with detailed descriptions of their taxonomy, invasion histories, biology, and environmental impacts are available at the RBIC Illustrated Database of the Aquatic Invasive Species of Europe, interlinked with the Baltic Sea Alien Species Database, the Global Invasive Species Database and the Caspian Sea Biodiversity Database (Fig. 5) (Regional Biological Invasions Center 2001c). The entry on Mnemiopsis leidyi provides an example of a com-prehensive and user-friendly online information system on the invasive species, linked to other Internet-based sources of information (Shiganova & Panov 2002). The entry on Mnemiopsis in the RBIC Illustrated Database is already serving as an open information system on Mnemiopsis for the Ponto-Caspian Region, and is updated on a regular basis (Fig. 6).


Figure 5. Main page of the Illustrated Database of the Aquatic Invasive Species of Europe (source: Regional Biological Invasions Center 2001c)

The RBIC portal is also supporting the web pages of some international working groups and networks, including the developing European Research Network on Aquatic Invasive Species, the Caspian Environment Program Regional Invasive Species Advisory Group, and the SIL Working Group on Aquatic Invasive Species (Regional Biological Invasions Center 2001d), and serves as a regional information hub for the developing global invasive species information network (for more information on the global network, see the online Report of the Joint Convention on Biological Diversity/Global Invasive Species Programme Informal Meeting on Formats, Protocols and Standards for Improved Exchange of Biodiversity-related Information 2002, and Report of the Workshop on Development of Nordic/Baltic Invasive Species Information Network 2002).


2.6. OTHER REGIONAL AND INTERNATIONAL INFORMATION RESOURCES

Other principal online informational resources on aquatic alien species, relevant to the Ponto-Caspian Region, include three regional and two international information systems: the Directory of Non-native Marine Species in British Waters, the Caulerpa taxifoliaDatabase, the United States Geological Survey Non-indigenous Aquatic Species (USGS NAS) Information Resource, the Food and Agriculture Organization of the United Nations (FAO) Database on Introductions of Aquatic Species (DIAS), and the Global Information System on Fishes (FishBase). Additional information about databases on aquatic alien species can be found in a recent review by S. Gollasch (2002).

The directory of Non-native Marine Species in British Waters includes entries on six species, considered as alien for the Ponto-Caspian Region: the New Zealand mud snail Potamopyrgus antipodarum, the Japanese oyster Crassostrea gigas, the North Atlantic clam Mya arenaria, the West Atlantic crab Rhythropanopeus harrisii and the Chinese

Figure 6. Example of web page from the entry on Mnemiopsis leidyi in the Illustrated Database of the Regional Biological Invasions Center (source: Shiganova & Panov 2002)


mitten crab Eriocheir sinensis. The species-specific entries include data on species taxonomy, dates of introduction, origin, method of introduction, rates of spread, brief description of distribution, effects on the environment and control methods.

The Caulerpa taxifolia Database is located at the Université de Nice-Sophia Antipolis (France), and provides distributional maps, information on environmental impacts and images of this Pacific invasive macroalga, which potentially poses the threat of invading the Ponto-Caspian Region (primarily the Black Sea coastal ecosystems).

The USGS NAS Information Resource is located at the Florida Caribbean Science Center (USA), and has been established as a central repository for accurate and spatially referenced biogeographic accounts of nonindigenous aquatic species. Provided are scien-tific reports, online/realtime queries, spatial data sets, regional contact lists, and general information. It includes comprehensive entries on some Ponto-Caspian species, includ-ing the round goby Neogobius melanostomus and the tubenose goby Proterorhinus mar-moratus, the zebra mussel Dreissena polymorpha and the fishhook waterflea Cercopagis pengoi. It also includes information on invasive species, alien to the Ponto-Caspian Region, such as the New Zealand mud snail Potamopyrgus antipodarum and the Chinese mitten crab Eriocheir sinensis, and provides links to other online sources of information on aquatic invasive species in North America and Europe, including those located at the Regional Biological Invasions Center information system.

The FAO database on introductions of aquatic species currently contains about 3,150 records of introductions of freshwater and marine fishes, and other taxa, and can be accessed through a Search Form. The database includes records of species introduced or transferred from one country to another. Coverage of accidental introductions of organisms (e.g., through ship ballast waters) is not complete and records on this topic have been entered only when important impacts on fisheries or on the environment have been caused (Mnemiopsis introduction to the Black Sea, for instance).

The Global Information System on Fishes (FishBase) is one of the most comprehen-sive online informational resources on freshwater and marine fishes. FishBase was devel-oped at the International Center for Living Aquatic Resources Management (ICLARM) in collaboration with the Food and Agriculture Organization of the United Nations (FAO) and with support from the European Commission. FishBase is a relational database, which contains practically all fish species known to science (more than 25,000 species), and includes information on invasive Ponto-Caspian species and on fish species alien to the Ponto-Caspian Region.

3. Development of an information system on aquatic invasive species for the Ponto-Caspian Region

At present, open information on aquatic invasive species alien to the Ponto-Caspian Region (or introduced from the Ponto-Caspian Region), is located in the online regional and international databases and information systems, briefly described above. These open information sources are already linked, within the World Wide Web, with the Regional Biological Invasions Center serving as a regional web portal, and providing links to these sources (Fig. 7). However, at present available online information is not suffi cient


for management purposes, such as the prevention of introductions, control or eradication of invasive alien species established in the Ponto-Caspian Region. Probably, only in the case of the invasive ctenophore Mnemiopsis, available information in the interlinked Global Invasive Species Database, Caspian Sea Biodiversiy Database and Regional Biological Invasions Center Information System (Fig. 7) is sufficient for the elaboration of adequate control measures in the Ponto-Caspian, as well as for undertaking preven-tive management measures in those regions which are recipients of these harmful species (the Baltic Sea, for instance).

Figure 7. Present links between available regional and international online information resources on aquatic alien species, relevant to the Ponto-Caspian Region (1 - Regional Biological Invasions Center Information System, 2 - Caspian Sea Biodiversity Database, 3 - CIESM Atlas of Exotic Species, 4 - Baltic Sea Alien Species Database, 5 - Directory of Non-native Marine Species in British Waters, 6 - FAO Database on Introductions of Aquatic Species, 7 - Caulerpa taxifolia Database)


The development of the regional online information system on aquatic alien species (all alien species in novel ecosystems should be considered as potentially invasive) as a principal management tool should be considered as one of the regional priorities. Considering the significance of the Ponto-Caspian Region as an important donor area of invasive species for the Baltic Sea region and worldwide, such a regional information system should be a part of the developing global invasive species information network. Integration of the Ponto-Caspian regional information system on aquatic alien (invasive) species in the global network of relevant databases will ensure its effective service as an early warning system for other regions and as a tool for risk assessment of harmful spe-cies introductions from the Ponto-Caspian to the potential recipient regions.

The regional Ponto-Caspian information system on aquatic alien organisms should be build on the basis of the information technologies developed for the adjacent Baltic Sea Region, in order to ensure inter-operability. For this reason, the online Baltic Sea Alien Species Database could be used as a prototype database, and the regional directory of alien species should be linked to the detailed species-specific entries, including those already available at the existing information hubs (Global Invasive Species Database, Regional Biological Invasions Center and other). A timely incorporation of geo-refer-enced data from alien species monitoring in the regional Ponto-Caspian information system should also be ensured, and, for this purpose, GIS applications like one described in section 2.5. should be considered.

References

Baltic Sea Alien Species Database, 2002. Olenin S., E. Leppäkoski & D. Daunys D (eds), Alien Species

Directory. http://www.ku.lt/nemo/mainnemo.htm

Caspian Environment Programme, 2002. Mnemiopsis leidyi in the Caspian Sea. http://caspianenvironment.org/

mnemiopsis

Caspian Sea Biodiversity Database, 2002. V. N. Belyaeva (ed) http://www.caspianenvironment.org/biodb/eng/

main.htm

Caulerpa taxifolia Database http://www.caulerpa.org

CIESM Atlas of Exotic Species in the Mediterranean Sea (2001). http://www.ciesm.org/atlas

Decision VI/23 COP6 of the Convention on Biological Diversity (2002) http://www.biodiv.org/decisions

Directory of Non-native Marine Species in British Waters. Eno NC, Clark RA & Sanderson WG (eds). http:

//www.jncc.gov.uk/marine/dns

FAO Database on Introductions of Aquatic Species (DIAS) (1998). http://www.fao.org/waicent/faoinfo/fi shery/

statist/fi soft/dias/index.htm

GISP, 1999. Global Invasive Species Programme. http://jasper.stanford.edu/gisp

Global Information System on Fishes (FishBase). http://www.fi shbase.org/home.htm

Gollasch, S, 2002. Databases on aquatic alien species: North and Mediterranean Seas and non-European

Initiatives. In: Leppäkoski E, Gollasch S & Olenin S (eds) 2002. Invasive Aquatic Species of Europe.

Distribution, Impacts and Management. Kluwer Academic Publishers, Dordrecht, pp 520-524

ISSG Global Invasive Species Database. http://www.issg.org/database

Leppäkoski, E., S. Gollasch, P.Gruszka, H. Ojaveer, S. Olenin & V. Panov, 2002a. The Baltic—a sea of

invaders. Can. J. Fish. Aquat. Sci. 59: 1175-1188


Leppäkoski, E., S. Gollasch & S. Olenin (eds), 2002b. Invasive Aquatic Species of Europe. Distribution,

Impacts and Management. Kluwer Academic Publishers, Dordrecht, 583 pp

Olenin, S., E. Leppäkoski & D. Daunys, 2002. Internet database on aliens species in the Baltic Sea. In E.

Leppäkoski, S. Gollasch & S. Olenin (eds) 2002. Invasive Aquatic Species of Europe. Distribution,

Impacts and Management. Kluwer Academic Publishers, Dordrecht, pp. 525-528

Panov, V. E., 1999. GAAS: Group on Aquatic Alien Species at the Zoological Institute in St.Petersburg, Russia.

Biological Invasions 1: 99-100

Regional Biological Invasions Center, 2001a. V. Panov, M. Dianov & A. Lobanov (eds) http://www.zin.ru/

projects/invasions

Regional Biological Invasions Center, 2001b. V. Panov, M. Dianov & A. Lobanov A (eds), Interactive

Geographical Information System for Documentation and Mapping of Alien Species Distribution. http:

//www.zin.ru/projects/invasions/gaas/invader/invader.htm

Regional Biological Invasions Center, 2001c. V. Panov, M. Dianov & A. Lobanov (eds) Aquatic Invasive

Species of Europe. http://www.zin.ru/projects/invasions/gaas/aa_idb.htm

Regional Biological Invasions Center, 2001d. V. Panov, M. Dianov & A. Lobanov (eds), International

Networking. http://www.zin.ru/projects/invasions/gaas/aa_netw.htm

Report of the Joint Convention on Biological Diversity/Global Invasive Species Programme Informal Meeting

on Formats, Protocols and Standards for Improved Exchange of Biodiversity-related Information (2002).

http://www.biodiv.org/doc/meetings/cop/cop-06/information/cop-06-inf-18-en.doc

Report of the Workshop on the Development of a Nordic/Baltic Invasive Species Informational Network

(2002). http://www.us-reo.dk/IS_Database.htm

Shiganova, T. A. & V. E. Panov, 2002. Mnemiopsis leidyi A. Agassiz, 1865. Entry to the Illustrated Database,

Regional Biological Invasions Center Information System. http://www.zin.ru/projects/invasions/gaas/

mnelei.htm

United States Geological Survey Nonindigenous Aquatic Species (USGS NAS) Information Resource. http:

//nas.er.usgs.gov

Zaitsev Y. & B. Öztürk (eds), 2001. Exotic species in the Aegean, Marmara, Black, Azov and Caspian Seas.

Published by Turkish Marine Research Foundation, Istanbul, Turkey, 267 pp

PART 3

Other Mediterranean Invaders

Alenka Malej & Alenka Malej Jr. Invasion of the jellyfi sh . . . . . . . . . . . . . .273Pelagia noctiluca in the Northern Adriatic: a non-success story

Thierry Thibaut & Alexandre Meinesz Caulerpa taxifolia: . . . . . . . . . . . . . . . . . 28718 years of infestation in the Mediterranean Sea

Chapter 16

Invasion of the Jellyfi sh Pelagia noctiluca in the Northern Adriatic: a non-success story

ALENKA MALEJ1 & ALENKA MALEJ JR2

1 Marine Biology Station Piran, National Institute of Biology, Slovenia2 Faculty of Maritime Studies and Transportation, University of Ljubljana, Slovenia

Key words: Scyphomedusa, biological invasion, Adriatic Sea, population dynamics, modelling.

Over the last two centuries, massive outbreaks of Pelagia noctiluca were recorded on average at 12 years intervals in certain parts of the Mediterranean Sea. Population peaks of Pelagia noctiluca were sometimes accompanied by an expansion outside of its usual distribution range, and during 1977-1986 this jellyfish also populated the northern Adriatic Sea. After maintaining itself at rather high densities for several consecutive years, the Pelagia noctiluca population of the northern Adriatic collapsed rather abruptly and for no obvious reason.

Environmental conditions before, during and after the invasion of Pelagia noctilucato the northern Adriatic are described. A model using time series analysis (1984-1986) of its population size structure was utilized to simulate the abundance of this jellyfish in the northern Adriatic. Results of this modelling exercise indicate that the most important effect on Pelagia population density was maturation at an early age (thus, at smaller size). The incorporation of demographic parameters such as shrinkage (regression and recovery to sexual maturity) into the model was the second most important factor for simulating its population abundance.

1. Introduction

The term biological invasion refers to the man-facilitated transfer/release of allochtonous species in a new environment where they establish new and permanent populations. There is ample evidence that the introduction and spread of aquatic nuisance species has caused substantial economic and ecological degradation of affected areas. In addition to facilitating the displacement of aquatic species, humans occasionally assist invaders by creating conditions favourable to the persistence of newcomers, for example by

273




increasing salinity by the damming of major rivers, by augmenting food levels as a consequence of anthropogenic eutrophication, and by eliminating potential predators/competitors by overfi shing.

Several species of the taxonomically diverse group of gelatinous zooplankton are con-sidered harmful when abundant even in their native environments due to their negative impact on human activities, particularly on fisheries and tourism (CIESM 2001). The list of successful gelatinous invaders in the marine environment is not extensive compared to some other taxonomic groups (GESAMP 1997), yet some of these invasions have had serious ecological and economic consequences on the recipient milieu (Galil et al., 1990; Purcell et al., 2001; several contributions in the present volume).

Pelagia noctiluca, a holoplanktonic scyphomedusa, shows periodic population peaks with occasional devastating impact in certain parts of the Mediterranean Sea (UNEP 1991). Massive outbreaks, recorded over two centuries in the northwestern Mediterranean, and occurring on average at twelve-year intervals, have been related to climatic factors (Goy et al., 1989). In other Mediterranean areas (the Tunisian coast, Maltese waters, the Aegean and Ionian Sea, the southern Adriatic) increases of Pelagianoctiluca have been less predictable. In addition, during a population outburst from 1976-1986, this jellyfish expanded outside its usual distribution range. It also invaded the northern Adriatic, previously considered an unsuitable environment for this species because of its low winter temperatures (< 10°C) and salinities, believed to be suboptimal for this open water organism (> 35 psu, Catalano et al. 1985). The combined effects of anthropogenic nutrient enrichment in the northern Adriatic and overfishing of pelagic fish were suspected of promoting the increase of this jellyfish population in the northern Adriatic sub basin (Purcell et al. 1999). The distribution shift of Pelagia noctiluca in the northern Adriatic might thus be seen as an invasion of a non-indigenous species, facili-tated by human activities.

2. Some general features of the Adriatic Sea and of the usual Pelagia noctilucadistribution

The Adriatic Sea is an 800 km long, enclosed sea with its major axis extending in a NW-SE direction. It consists of three sub-basins, characterized by a decreasing depth from the south towards the north (Fig. 1). The circulation and water mass distribution are strongly influenced by morphological features of the bottom (the Jabuka and southern Adriatic depressions, the Palgruža sill, a steep slope that separates the central and north-ern basins and a more gentle slope towards the northernmost part of the Adriatic).

Exchange with the Ionian Sea in the south, considerable freshwater inflow in the north and meteorological forcing are major factors that control circulation. A recent overview of Adriatic circulation is given in Cushman et al. (2001). The surface waters of all three basins show a clear seasonal temperature cycle with peak values in late summer and maximum mixed layer depths during winter. The northern basin exhibits characteris-tics of a shallow sea (large T and S variations, seasonally strong vertical stratifi cation). The middle Adriatic is a transition basin with some open-sea characteristics (persistence of a pool of deep water during spring-summer), while the southern basin shows open

Invasion of the jellyfi sh Pelagia noctiluca in the Northern Adriatic 275

sea-water mass characteristics below 150 m (Artegiani et al. 1997a). In a subsurface layer of the southern Adriatic, and to a lesser extent of the middle Adriatic, the characteristic of the modified Levantine Intermediate Waters (MLIW) can be traced.

The computed climatological freshwater and heat balance indicate that the Adriatic Sea behaves like a dilution basin and that negative surface heat flux has to be compensat-ed for by the inflow of heat through the Otranto Straits. The general baroclinic circulation is characterised by a wide northward fl ow field during winter (E-SAd current), and a nar-rower northward coastal current that is particularly developed in autumn along the east-ern Adriatic coast. Intense southward currents along the western side of the Adriatic are disconnected in the three sub basins (northern, middle and southern Adriatic) in spring and summer and three cyclonic gyres (northern Adriatic gyre, middle Adriatic gyre and southern Adriatic gyre) are evident and intensify in autumn (Artegiani et al. 1997b).

Figure 1. The Adriatic Sea, its sub-basins and its bathymetry. Sampling stations in the northern Adriatic, where the densities of were followed from 1983 to 1987 are also shown (inset).


With regard to plankton characteristics, three main regions may be distinguished: the open waters of the southern and central basins with low phytoplankton and zooplank-ton biomass, the open waters of the northern Adriatic basin characterised by moderate biomasses and with a clear east-west gradient, and the restricted coastal zone with high plankton biomass and recurring red tides, especially conspicuous on the western side (Fonda Umani et al. 1992).

Swarms of scyphomedusae like Aurelia aurita, and to lesser extent Cotylorhiza tuberculata, Chrysaora hysoscella and Rhisostoma pulmo have been quite common in the northern Adriatic (Issel 1922, UNEP, 1984, Purcell et al. 1999, Malej 2001) but Pelagia noctiluca swarms were never mentioned before 1977. Babi (1913) considered Pelagia noctiluca to be quite common in the southern Adriatic; the species was described by Mayer (1910) as periodically common in the Mediterranean Sea. In the northern Adriatic, a few records of ephyrae that could be attributed to Pelagia were published at the end of the 19th and beginning of the 20th century (Claus 1883, Stiasny 1911, Neppi 1922, all cited in Avian & Rottini Sandrini, 1994). In other studies of the zooplankton in the northern Adriatic, Pelagia has never been recorded. Therefore, we may assume that before 1976 Pelagia was limited to the southern Adriatic basin and probably, at times, to the middle Adriatic.

3. Introduction and establishment of Pelagia noctiluca in the northern Adriatic

Introduction of Pelagia noctiluca into the northern Adriatic likely occurred during the period extending from autumn 1976 to spring 1977 and was preceded by a population increase in the southern and central Adriatic sea (Vu eti 1983). First notice of its pres-ence in the northern Adriatic came from fishermen who were faced with trawls clogged by the stinging gelatinous organism. It appears that this jellyfish was advected north-wards (Legovi & Benovi 1984) by a strong E-SAd current (eastern south Adriatic current) that intensifies in autumn - winter (Artegiani et al., 1997b). Pelagia noctilucabecame common in the northern Adriatic in the early 80-ties, and reached its highest abundance from 1983-1986.

The most comprehensive data series on distribution of Pelagia noctiluca in different Adriatic sub-basins originates from fishery surveys (Table 1) carried out by Laboratorio di Biologia Marina e Pesca from Fano (Italy), in collaboration with the Croatian Institute of Oceanography and Fisheries, Split. Samples were collected by FAO net (500 mmmesh, 1 m mouth diameter) three times a year (late winter, summer, autumn) from July 1976 to April 1987 and were analysed also for presence and size distribution of Pelagianoctiluca. Generally, a higher abundance of medium sized individuals (3-5 cm bell diam-eter) were recorded during summer, while smaller individuals were more numerous in spring and autumn (Piccinetti Manfrin & Piccinetti 1986). The largest organisms, record-ed in December, had a bell diameter of up to 8.5 cm. The authors concluded that the life cycle of Pelagia noctiluca was about one year. On the basis of size-frequency data they suggested that individuals reached maturity in about seven months and that mortality between March and December was 99.9%. Taking into account the seasonal presence of the smallest individuals Piccinetti, Piccinetti Manfrin & Fiorentini (1991) imply a repro-


Table 1. Pelagia noctiluca distribution in the Adriatic during the period September1976-April 1987 (modifi ed

after Piccinetti Manfrin & Piccinetti, 1983, 1986, 1991, own observations): 1 - number of surveyed stations,

2 - % of positive stations in the northern, middle and southern Adriatic at which Pelagia noctiluca was

present, 3-Pelagia noctiluca presence in the sub basins: northern Adriatic (NA-number of surveyed stations

up to 28) and middle and southern Adriatic (MSA-number of surveyed stations up to 40) during the period

July 1976-April 1987 with numbers of positive stations in sub basins in brackets, 4 - average densities

(standard deviation - SD) of Pelagia noctiluca per 100 m3 at positive stations in the northern Adriatic during

the period July 1983-March 1986

Period

1 2 3 4

Stations

(No.)

%

stat. positive

Sub basin

(No. positive stations)

Avr. abund. NA No./100 m3

(SD)

Jul 76 63 3 MSA (2)

Sep 76 68 4 MSA (3)

Sep 77 58 10 MSA (6), NA (2)

Jul 78 64 41 MSA (20), NA (6)

Mar 79 64 44 MSA (16), NA (12)

Jul 79 64 45 MSA (17), NA (12)

Dec 79 36 25 MSA, NA

Feb 80 43 26 MSA, NA

Jul 80 66 62 MSA, NA

Mar 81 43 39 MSA, NA

Jul 81 64 44 MSA (22), NA (6)

Dec 81 37 43 MSA, NA

Mar 82 37 38 MSA, NA

Jul 82 63 29 MSA (17), NA (1)

Mar 83 64 66 MSA (), NA ()

Jul 83 65 60 MSA (15), NA (14) 4.0 (6.0)

Dec 83 60 40 MSA (11), NA (12) 0.9 (1.5)

Mar 84 54 59 MSA (17), NA (14) 1.0 (1.9)

Jul 84 64 37 MSA (18), NA (5) 0.9 (0.9)

Dec 84 46 39 MSA (11), NA (7) 0.3 (0.1)

Mar 85 58 26 MSA (8), NA (7) 1.2 (1.3)

Jun 85 24 50 MSA (6), NA (6) 1.2 (0.7)


duction period extending over the whole year, with a maximum in winter. Unfortunately, the authors pooled population data from different Adriatic sub-basins, thus masking a plausible difference between the northern and the southern Adriatic populations.

In contrast to these results, Malej & Malej (1992), on the basis of monthly samplings in the northern Adriatic (Gulf of Trieste) during the period December 1984-July 1986, reported that reproduction of Pelagia noctiluca occurred from April to December with a peak in late summer and autumn. Growth seemed to be faster during the warm part of year and estimated growth rates indicated that medusae could reach minimal size at which they may spawn (Rottini Sandrini et al. 1984) in about 5 months. Rottini Sandrini et al. (1984) also reported that ripe gonads in the northern Adriatic population were observed at a smaller size (3.0-6.0 cm bell diameter) than in the central Mediterranean where mature specimens were generally larger than 5.0 cm. In both areas all individuals having bell diameter > 6.0 were mature as also observed by Franqueville (1971) in open Mediterranean waters. Similarly, another gelatinous invader that was introduced to a new environment, viz. Mnemiopsis in the Caspian Sea (this volume) began to reach maturity at a smaller size than in its native area.

Malej & Malej (1992) estimated mortality rates of the northern Adriatic Pelagiapopulation: mortality varied seasonally and was lowest in July-August (0.18-0.2 per month), and highest in late autumn-winter (0.49-0.57 per month). The mortality rate was significantly (negatively) correlated with temperature and (positively) with zooplankton carbon concentration as a proxy for food availability. The average life expectancy was estimated to be 9 months.

Based on oblique hauls (WP2 net, 250 mm mesh, 0.5 m mouth diameter) during the period of yearly peak abundance (in summer-autumn) average Pelagia noctiluca density in the Gulf of Trieste was calculated to be 1.9 ind.100 m-3. However, during the same period patches of significantly higher density were observed by SCUBA divers with a range from 0.1 to 23 ind. m- 3, while shallow surface aggregations frequently contained

Table 1. Continued

Period

1 2 3 4

Stations

(No.)

%

stat. positive

Sub basin

(No. positive stations)

Avr. abund. NA No./100 m3

(SD)

Sep 85 55 42 MSA (21), NA (3) 2.1 (0.9)

Mar 86 58 46 MSA (14), NA (12) 8.8 (21.7)

Sep 86 63 0 -

Apr 87 50 0 -


over 100 ind. m-3 (Malej 1989). Offshore subsurface aggregations in the eastern northern Adriatic could reach abundances up to 20 ind. m-3 and when these masses drifted near shore medusa densities attained 150 to 600 ind. m-3 (Zavodnik 1987).

After maintaining rather high densities for several consecutive years (summer 1978-spring 1986, Malej 1989, Piccinetti Manfrin & Piccinetti 1991, Zavodnik 1991) the Pelagia noctiluca population in the northern Adriatic collapsed rather abruptly for no obvious reason in 1986/87. In the Gulf of Trieste as the northernmost part of the Adriatic, it was moderately abundant until June 1986, but from July on very few individuals were observed and none from winter 1987 on; the me holds true for the middle and southern Adriatic from September 1986 on (Table 1). No systematic surveys of Pelagia noctilucain any Adriatic basin have been carried out since 1987.

4. Environmental conditions and trophic role of Pelagia noctiluca

Pelagia noctiluca is considered a warm water species but was found in the northern Adriatic during the period 1977-1986 over a wide range of temperatures (9 to 26.8°C) and salinities (32 to 38.5 psu). It has been shown in laboratory experiments that Pelagianoctiluca has ceased to move actively and sank at temperatures below 11°C, and at 6°C bell contractions stopped completely; the highest pulsation rates were recorded between 17 and 22°C (Rottini Sandrini 1982).

The Gulf of Trieste, like the whole northern Adriatic Sea, experienced considerable variability in temperature and salinity on a multi-year scale as illustrated in Fig. 2. This figure shows deviations from seasonal averages calculated over 21 years (1978-1999). The period in late 70’s and early 80’s (“Pelagia years”) was characterised by warmer than long term average temperatures in autumn; salinities were above average and tem-peratures lower than usual in summer, all these characteristics being probably indicative of a stronger ingression of southerly waters. Also, there were slightly higher temperatures during winter and spring in the Pelagia years. These probably resulted in a reduced mor-tality rate. Unfortunately, we have neither systematic measurements nor enough data on temperature and salinity in period before Pelagia invaded the northern Adriatic.

Using a simple predator-prey model, Legovi (1987) demonstrated the importance of jellyfish food-source enrichment and applied it to Pelagia in the Adriatic. Changes in the trophic status of the northern Adriatic combined with alteration of the large-scale circula-tion pattern and physical conditions may have thus facilitated establishment of Pelagiain the northern Adriatic. In their analysis of long-term changes in the northern Adriatic ecosystem related to anthropogenic eutrophication, Degobbis et al. (2000) revealed a significant increase in eutrophication that occurred during the 70’s, reaching a maximum in the early 80’s. This increase was related to changes in the nutrient concentrations of the river Po, the largest freshwater input into the Adriatic. They also stated that eutro-phication appeared to decrease in the late 80’s due to the reduction of orthophosphate in the river as a result of legal measures taken by Italian government. Changes in nutrient inputs had a significant impact upon primary production and phytoplankton biomass; these plausibly affected the whole pelagic food chain.


Figure 2. Surface temperature and salinity anomalies for the Gulf of Trieste (0 line indicates average seasonal values for the period 1978-1999)


There was no experimental study relating growth rate with food availability for the northern Adriatic Pelagia population, but significant negative correlation of mortality rate with zooplankton biomass as presumed food source indicates the importance of trophic conditions.

The main prey of Pelagia were crustaceans (copepoda, cladocera), some other gelati-nous zooplankton (siphonophores, hydromedusae, appendicularians, chaetognaths), as well as fish eggs and larvae which were found in its gastric cavity (Malej 1982, Giorgi et al. 1991). Stable isotope and biochemical analysis of Pelagia noctiluca also indicated mesozooplankton as the prevailing food source (Malej et al. 1993). Calculations based on respiration and excretion measurements at different temperatures (Malej 1989b) following Morand et al. (1987) methodology and estimated abundance of Pelagia(Malej 1989 a) indicate that carbon requirements for the non-aggregated autumn popu-lation was 1.2 mg C m-2 d-1 (about 1% of the mesozooplankton carbon biomass daily), while the corresponding value within large Pelagia patches (with average density of 2 m-2) was at least an order of magnitude higher. The corresponding value for daily nitro-gen requirements based on average density of 2 m-2 was 2.4 mg N m-2 d-1 i.e. about 8.8% of the average zooplankton N biomass.

Although these are rather rough estimates, they indicate that Pelagia exerted signifi -cant predatory pressure on the plankton community. Likewise, in the case of the other gelatinous invader, Mnemiopsis in the Black Sea (this volume), there are strong indica-tions of shifts in zooplankton community structure in affected areas during periods of medusa swarming. Malej (1989 c) observed a reduced abundance of copepods relative to cladocerans, and a significant increase of Noctiluca, Ctenophora and Thaliacea during the Pelagia years in the northern Adriatic. Changes related to these jellyfish swarms were also observed in other Mediterranean areas (Morand & Dalot 1985).

5. Population dynamics and modelling

Our approach was to use time series analysis of a population size structure obtained from December 1984 to July 1986 and data on growth and mortality (Malej & Malej 1992) to project Pelagia noctiluca population density over time. A model using a Leslie matrix (Leslie 1945) modified after Hughes (1984), applying size rather than age, was devel-oped and used to simulate population growth e.g. changes in the abundance of different size classes over time.

Sampled Pelagia individuals were each assigned to one of five size classes using measurements of bell diameter: <1.0 cm; 1.0 < 3.5 cm (immature medusae); 3.5 < 6.0 cm (conditionally mature); 6.0 < 8.5 cm (mature); and class >8.5 cm bell diameter.The fun-damental time unit of the model was one month. During each time interval (one month) a specimen may either die or survive; surviving individuals may grow (G), stay the same size (loop - L), or shrink (S). The incorporation of demographic parameters such as shrinkage (regression) and loop into the matrix reflects the ability of gelatinous organ-isms to shrink, stop reproducing, recover from shrinking and return to sexual maturity (Hamner & Jensen 1974, Larson 1987, own observations). Surviving individuals from class one (<1.0 cm) are allowed only to grow, those from class two (1 to <3.5 cm) may


grow and stay the same size but not shrink, and class five (>8.5) do not grow. The model also assumes that during one month an individual could neither grow nor shrink by more than one size class. Recruits to the smallest class are contributed only by individuals larger than 3.5 cm (classes three, four, and five) with an increasing proportion of repro-ducing medusae in larger size classes.

A projection matrix and corresponding column vectors (Table 2) indicate: elements along the top row represent the recruits per time unit to size classes 3, 4, and 5, while classes 1 and 2 do not reproduce, so the value is set to 0. The elements along sub-diagonal (G) represent the probability of net growth into a larger size class, while the diagonal (L) describes the likehood of an individual remaining in the same size class. Finally, the probabilities above the diagonal represent shrinkage (S) as a contribution to the next smaller size class. The size-specific mortality rate (D) is 1 minus the sum of probabilities in each column. It means that an individual which neither grew to the next bigger size class, remained the same size, or shrank to next smaller class, died. Most models of population dynamics using Leslie’s matrix keep the matrix coefficient constant, while we incorporated seasonal changes using three different matrices for spring (April-May), sum-mer-autumn (June-November) and winter (December-March). The output of the model was abundance of Pelagia noctiluca individuals in five size-classes after a pre-set time.

Table 2. A graphical presentation of the project matrix model (left) with a projection matrix and

corresponding column vectors (right)


The simulation began by introducing an arbitrary number of Pelagia of selected sizes (population having specified size structure at time x: n(x)) in autumn and then running the model with matrix coefficients that were varied seasonally over a range of values that might reasonably occur in the Adriatic Sea. The model was run for a period of 10 years. We examined the effects of maturation at an earlier age (=smaller size), of the introduction of loop and shrinkage terms, and the effect of seasonally faster growth rate. Additionally, we compared runs with and without immigration of new Pelagia individu-als from the south Adriatic; it was assumed that new medusae were introduced in the northern Adriatic population during the autumn period.

Our results indicate that earlier maturation had the most important effect on Pelagiapopulation density: setting the reproduction term in size class three to zero halved the number of individuals in one year. Generally, maturation at an earlier age (smaller size) is considered as sign of stress. However, it could also be a mechanism that enable invad-ers to survive in the new environment upon arrival.

Variations of the growth rate term in our model as well as the introduction of the loop term had only slight effects, while elimination of the shrinkage term reduced the popula-tion density by almost 1/3 in one year. This also is an important ability in an environment where food conditions are not stable but pulsed allowing organisms to survive periods of food shortage and then resume growth and reproduction.

Additional immigration of medusae also had only a slight effect on the simulated population density. Our model reproduced rather well the seasonal changes of abundance in different size-classes but forecasted a gradual decrease in population density over a ten year period unless unrealistically high values of coefficients were used. Also, we were not able to simulate the sudden collapse of population as it was observed in the summer-autumn 1986, unless the mortality rate was increased in all size classes. Such a change may be attributed to environmental influences operating at a large scale or, more prob-ably, disease that is likely to spread fast when population density is high.

Although field results suggested that Pelagia noctiluca established a viable, self-sus-tained population in the northern Adriatic, modelling indicates a gradual decrease in its population density. The reason for the sudden population collapse remains unknown.

6. Acknowledgements

We thank J. Forte for calculations and for graphing temperature and salinity anomalies, V. Berneti for obtaining much of the literature and Matevž for patient and helpful dis-cussions of the model.

References

Artegiani, A., D. Bregant, E. Paschini, N. Pinardi, F. Raichich & A. Russo, 1997a. The Adriatic Sea General

Circulation. Part I: Air-Sea Interactions and Water Mass Structure. Journal of Physical Oceanography 27:

1492-1514

Artegiani, A., D. Bregant, E. Paschini, N. Pinardi, F. Raichich & A. Russo, 1997b. The Adriatic Sea General


Circulation. Part II: Baroclinic Circulation Structure. J. Phys. Oceanogr. 27: 1515-32

Avian, M. & L. Rottini Sandrini, 1994. History of scyphomedusae in the Adriatic Sea. Boll. Soc. Adriat. Sci.

Nat. Trieste 1: 5-12

Babi , K, 1913. Planktonic coelenterates in the Adriatic Sea. Rad. JAZU 200: 196-202

Benovi , A, 1991. The aspect of jellyfish distribution in the Adriatic Sea. In: In: UNEP, Jellyfish blooms in the

Mediterranean, MAP Technical Rep. Ser. 47: 41-50

Catalano, G., M. Avian & R. Zanelli, 1985. Influence of salinity on the behavior of Pelagia noctiluca (Forsskal)

(Scyphozoa, Semaeostomeae). Oebalia 11: 169-179

CIESM, 2001. Gelatinous zooplankton outbreaks: theory and practice. CIESM Workshop Series 14, 112 pp.,

Monaco

Cushman Roisin, B., M. Ga i , P.-M. Poulain & A. Artegiani, 2001. Physical Oceanography of the Adriatic

Sea. Kluwer Academic Publishers, 304 pp.

Degobbis, D., R. Precali, I. Ivan i , N. Smodlaka, D. Fuks & S. Kveder, 2000. Long-term changes in the

northern Adriatic system related to anthropogenic eutrophication. International Journal of Environmental

Pollution 13: 495-533

Fonda Umani, S., P. Franco, E. Ghirardelli & A. Malej, 1992. Outline of oceanography and plankton of the

Adriatic Sea. In: Marine Eutrophication and Population dynamics (G. Colombo et al. eds), Olsen&Olsen,

Denmark, 347-365

Franqueville, C., 1971. Macroplancton profond de Mediterranee. Tethys 3: 11-56

Galil, B. S., E. Spanier & W. W. Ferguson, 1990. The scyphomedusae of the Mediterranean coast of Israel,

including two Lessepsian migrants new to the Mediterranean. Zoologische Mededelingen 64: 95-105

GESAMP, 1997. Opportunistic settlers and the problem of the ctenophore Mnemiopsis leidyi invasion in the

Black Sea. Reports and Studies of GESAMP 58, 84 pp.

Giorgi, R., M. Avian, S. de Olazabal & L. Rottini Sandini, 1991. Feeding of Pelagia noctiluca in open sea.

In: UNEP, Jellyfish blooms in the Mediterranean. MAP Technical Report Series 47: 102-111

Goy, J., S. Dallot & P. Morand, 1989. Long term fluctuations of Pelagia noctiluca (Cnidaria, Scyphomedusa)

in the western Mediterranean Sea. Deep-Sea Research 36: 269-279

Hamner, W. M. & R. M. Jensen, 1974. Growth, degrowth, and irreversible cell differentiation in Aurelia aurita.

American Zooloologist 14: 833-849

Hughes, T. P., 1984. Population dynamics based on individual size rather than age: a general model with a reef

coral example. Am. Nat. 123: 778-795

Issel R., 1922. Nuove indagini sul plankton nelle aque di Rovigno. Mem. Com. Talass. Ital. 202

Larson, R. J., 1987. A note on the feeding, growth, and reproduction of the epipelagic Scyphomedusa Pelagia

noctiluca (Forsskal). Biol. Oceanogr. 4: 447-454

Leslie, P. H., 1945. The use of matrices in certain population mathematics.Biometrika 5: 213-45

Legovi , T., 1987. A recent increase in jellyfish populations: a predator-prey model and its implications. Ecol.

Model. 38: 243-256

Legovi , T. & A. Benovi , 1984. Transpost of Pelagia noctiluca swarms in the South Adriatic. In: UNEP,

Jellyfish blooms in the Mediterranean, 185-193

Malej, A., 1982. Unusual occurrence of Pelagia noctiluca in the Adriatic Sea. Acta Adriatica 23: 97-102

Malej, A., 1989a. Behavior and trophic ecology of the jellyfi sh Pelagia noctiluca (Forsskal, 1775). Journal of

Experimental Marine Biology and Ecology 126: 259-270

Malej, A. 1989b. Respiration and excretion rates of Pelagia noctiluca (Semaeostomaeae, Scyphozoa). Proc. 21st

European Marine Biology Symposium, Polish Academy of Science, 107-112

Malej, A. 1989c. Shifts in size-classes and structure of net zooplankton in the presence of the jellyfish Pelagia


noctiluca (Scyphozoa). Biol. Vestnik 37: 35-46

Malej, A. 2001. Are irregular plankton phenomena getting more frequent in the northern Adriatic Sea?. In:

Gelatinous zooplankton outbreaks: theory and practice. CIESM Workshop Series 14: 67-68

Malej, A. & M. Malej, 1992. Population dynamics of the jellyfi sh Pelagia noctiluca (Forsskal, 1775).

In: Marine Eutrophication and Population Dynamics (Eds. Colombo G., Ferrara I.) Olsen & Olsen,

Fredensborg, 215-219

Malej A., J. Faganeli & J. Pezdi . 1993. Stable isotope and biochemical fractionation in the marine pelagic food

chain: the jellyfi sh Pelagia noctiluca and net zooplankton. Mar. Biol. 116: 565-570

Mayer, A. G., 1910. Medusae of the world. Vol. I-III. Carnegie Institution, Washington

Morand, P., S. Dallot, 1985. Variations annuelles et pluriannuelles de quelques especes du macroplancton cotier

de la Mer Ligure. Rapports de la Commission Internationale pour la Mer Mediteraneene 29: 295-297

Morand, P., C. Carre & D. C. Biggs, 1987. Feeding and metabolism of the jellyfi sh Pelagia noctiluca

(Scyphomedusa, Semaeostomeae). Journal of Plankton Research 9: 651-655

Piccinetti Manfrin, C. & C. Piccinetti, 1983. Distribuzione di Pelagia noctiluca in Adriatico dal 1976 al 1983.

Nova Thalassia 6 (Suppl): 51-58

Piccinetti Manfrin, C. & C. Piccinetti, 1986. Distribuzione di Pelagia noctiluca in Adriatico negli anni 1983.e

1984. Nova Thalassia 8: 99-102

Piccinetti Manfrin, C., C. Piccinetti & M. Fiorentini, 1991. Considerations sur la distribution de la Pelagia

noctiluca (Forsskal) dans l’Adriatique de 1976 a 1987. In: UNEP, Jellyfish blooms in the Mediterranean.

MAP Technical Report Series 47: 133-140

Purcell, J. E., A. Malej & A. Benovi , 1999. Potential links of jellyfish to eutrophication and fisheries. In:

Ecosystems at the land-sea margin: drainage basin to coastal sea (Eds. Malone T., A. Malej, L.W. Harding

Jr., N. Smodlaka, E.R. Turner). American Geophysical Union, Coastal and Estuarine Studies 55: 241-263

Purcell, J. E., M. W. Graham & H. J. Dumont (eds), 2001. Jellyfish Blooms: Ecological and Societal

Importance. Developments in Hydrobiology. Kluwer Academic Publ. Dordrecht, 334 pp. Reprinted from

Hydrobiologia 451.

Rottini Sandrini, L., 1982. Effect of water temperature on the motility of Pelagia noctiluca (Forskal).

Experientia 38: 453-454

Rottini Sandrini, L., M. Avian, V. Axiak & A. Malej, 1984. The breeding period of Pelagia noctiluca

(Scyphozoa, Semaeostomeae) in the Adriatic and Mediterranean Sea. Nova Thalassia 6: 65-75

UNEP, 1984. Workshop on Jellyfish blooms in the Mediterranean. 221 pp.

UNEP, 1991. Jellyfish blooms in the Mediterranean. MAP Technical Rep. Ser. 47, 320 pp.

Vucetic, T., 1983. Fluctuations in the distribution of the scyphomedusae Pelagia noctiluca (Forskal) in the

Adriatic. Oceanologica Acta 207-211

Zavodnik, D., 1987. Spatial aggregations of the swarming jellyfi sh Pelagia noctiluca (Scyphozoa). Marine

Biology 94: 265-269

Chapter 17

Caulerpa taxifolia: 18 years of infestation in the Mediterranean Sea

THIERRY THIBAUT & ALEXANDRE MEINESZGestion de la Biodiversité EA 3156Laboratoire Environnement Marin Littoral, Université de Nice-Sophia Antipolis, Faculté des Sciences, Parc Valrose, 06108 Nice cedex 02 - FRANCEcorresponding author: [email protected]

Keywords: Caulerpa taxifolia, introduced species, Mediterranean Sea.

After 18 years of invasion, the situation with Caulerpa taxifolia in the Mediterranean is out of control. Eradication is no longer an option. The last hope remaining is in the use of biological control measures. This introduced species, of aquarium origin, has already reached six Mediterranean countries and more than 131 km2 of coastal area are affected. The alga deeply modifies the habitat and has incisive impacts on the native flora and fauna. Because of its presence in the aquarium trade all around the world, C. taxifolia is predicted to cause problems elsewhere as well. Recently, it was discovered in California and Australia.

1. Introduction

The tropical green alga Caulerpa taxifolia (Vahl) C. Agardh has been spreading in the Mediterranean Sea since its introduction there in 1984 (Meinesz & Hesse 1991). At the end of 2000, approximately 131 km2 of benthos had been concerned in 103 independent areas along 191 km of coastline in six countries (Spain, France, Monaco, Italy, Croatia and Tunisia) (Meinesz et al., 2001). Recently, the problem moved to the temperate region of the US (California) and to Australia, where the same invasive strain was discovered in 2000 (Schafelke et al., 2001; Williams & Grosholz 2002). Large regions neighbouring the affected areas appear favourable to further colonization, and there is no reason to believe that spreading will slow down in the years to come.

287




2. Original range and basic ecology

The distribution of non-invasive strains of C. taxifolia is circumtropical and limited by the winter Sea Surface Temperature (SST). It does not survive under temperatures below 19°C. An exception is the population of Moreton Bay (Queensland, Australia), where the winter SST drops to 16°C and which is probably the location from which the invasive strain was originally derived.

Figure 1. Temperature response the Mediterranean strain of Caulerpa taxifolia (Komatsu et al. 1997)

Caulerpa taxifolia, like the other species of the genus Caulerpa is coenocytic, pseu-doperrenial, and its reproduction is both sexual (monoecious, holocarpy) and vegetative (by fragmentation) (Feldmann 1954, Meinesz 1980). But the invasive strain has special features, which allow it to spread rapidly and out-compete other species in the invaded ecosystems (Figs. 2, 3):- Presence of giant fronds under low light conditions (Meinesz & Hesse 1991),- No sexual reproduction (Carvalho et al., 1998; Zuljevic & Antolic 2000)- Resistance to cold temperatures (Komatsu et al., 1997) (Fig. 1),- Presence of a high concentration of secondary metabolites (Guerriero et al., 1992,

1993),- Ubiquitous occurrence, forming dominant, large and dense colonies (Meinesz et al.,

1993, 1995, Thibaut 2001).

Caulerpa taxifolia: 18 years of infestation in the Mediterranean Sea 289

Figure 2. Morphology of the invasive strain of Caulerpa taxifolia (A) and the non invasive strain (B)

Figure 3. Incomplete reproduction cycle of Caulerpa taxifolia developing in the Mediterranean Sea (Carvahlo et al . 1998)


Recent genetic studies have confirmed the aquarium origin of the invasive C. taxifolia(Jousson et al., 1998, 2000; Windenman et al., 2001; Meusnier et al., 2001). Indeed, a large-scale inquiry revealed that a temperate, low temperature resistant strain of C. taxifolia has been cultivated in aquariums in northern Europe since the end of 1960 and found its way to the Museum of Monaco (1980) and from there to the sea in 1984 (Meyer & Meinesz 2001). Previous analysis of the dynamic of the invasion had already shown that the initial point of the invasion was Monaco (Meinesz & Hesse 1991; Meinesz et al., 1993; Meinesz & Boudouresque 1996). A discovery of C. taxifolia in front of the public aquarium of Notojima (Japan) confirms its presence in and dispersal by the aquarium trade all over the world. However, here the alga died in winter (SST under 8°C) (Komatsu, pers. comm).

Because of its “higher plant morphology”, C. taxifolia develops on all kind of substrates (rocks, sand, mud, seagrass and eelgrass beds), in exposed or sheltered environments, from few meters below the surface to more than 50 m deep (Meinesz & Hesse 1991). The only non-suitable substrates are instable ones, like ripple-marks sands. Analysis of all the affected areas show that C. taxifolia can spread as well in areas free of human activities as in polluted zones (Meinesz et al., 2000). The develop-ment of C. taxifolia is not nutrient-limited either (Delgado et al., 1995; Cecherelli & Cinelli 1997).

3. Effects of C. taxifolia on other biota

The impact of C. taxifolia on benthic ecosystems is important and the large quantities of its biomass are one of the most important factors explaining its impact on native species (Thibaut 2001). The alga deeply modifies the habitat (homogenisation) (Harmelin-Vivien et al., 1999), which leads to a deep disturbance of the Mediterranean coastal flora and fauna.

Figure 4. Homogenization of habitats invaded by Caulerpa taxifolia (Harmelin-Vivien et al. 2001)


3.1. EFFECTS ON ALGAL COMMUNITIES

According to Verlaque & Fritayre (1994), colonisation by C. taxifolia of rocky substrates leads to a strong decrease in autochthonous algal species (Fig. 4). Indeed, the species richness decreases by 25 to 55%, compared to non-invaded zones. The highest perturbations are observed at the end of summer and in autumn, when the development of C. taxifoliais maximal. Specific studies show that the productivity and the growth of the embryos of Cystoseira barbata f. aurita (Stockouse) C. Agardh (Pheophytes) are affected by C. taxifolia invasion (Gomez-Garreta et al., 1996). The productivity of the Rhodophytes Gracilaria bursa-pastoris (S.G. Gmelin) P.C. Silva is less affected (Ferrer et al., 1997; Rollino et al., 2001).

3.2. EFFECTS ON PHANEROGAMS

The eelgrass Cymodocea nodosa (Ucria) Ascherson is a favourable substrate for the development of C. taxifolia. Ceccherelli & Cinelli (1997) observed a decrease in shoot density in invaded C. nodosa beds, because C. taxifolia fronds are higher than the phanerogam leaves, which shade it (Ceccherelli & Cinelli 1999).

The competition between C. taxifolia and the seagrass Posidonia oceanica L. Dellile is complex and needs to be carefully studied, because of the importance of this latter phanerogam to the Mediterranean coastal ecosystem (Fig. 5). Indeed, P. oceanica is the plant species that is most widespread and has the highest biomass of all Mediterranean macrophytes. These seagrass beds act as a nursery, as food, and as a refuge for an impor-tant number of invertebrates and vertebrate species. Out of the 104 invaded areas in France, 58 show competition between P. oceanica and C. taxifolia (Meinesz et al., 2000). Some sites are completely invaded (Villèle & Verlaque 1995; Belsher et al., 1998), some are simply affected by isolated C. taxifolia thalli, and others are surrounded by dense C. taxifolia meadows but not colonised (Villèle & Verlaque 1995, Ceccherelli & Cinelli 1999b). Recent studies show that the shoot density of P. oceanica beds is an impor-tant factor in its colonisation. Indeed, seagrass beds not affected by human activities (low shoot density, change of structure) act as a natural barrier against the evolution of C. taxifolia (Thibaut 2001).

3.3. EFFECTS ON FISH POPULATIONS

The impact on fish assemblages depends on the structural complexity of the substrate. Indeed, on invaded substrates with a high structural complexity (P. oceanica beds, rocks, corraligenous), the species richness (-27%), the fish density (-34%) and the individual biomass (-50%) all decrease (Harmelin-Vivien et al., 2001).

More specific studies show that the number of individuals of certain species strongly decrease. Examples include Serranus cabrilla Linnaeus 1785, Coris julis Linnaeus1758, Diplodus sargus Linnaeus 1758, Symphodus ocellatus Forsskål, although other species, like Serranus sciba Linnaeus 1758, are more tolerant (Gelin et al., 1998; Francour et al., 1995).


Figure 5. Confrontation between Caulerpa taxifolia and Posidonia oceanica

When substrates with a low structural complexity (Cymodocea nodosa meadows, dead mats, snad and mud) are invaded, changes in fish composition are observed, with an immigration of species usually restricted to P. oceanica beds (Labridae, some Sparidae and Scorpaenidae) and an emigration of some species otherwise common on this sub-strate (fl atfish, Triglidae, some Sparidae).

3.4. EFFECTS ON SEA URCHINS

Ganteaume et al. (1998) and Lemée et al. (1996) showed that Paracentrotus lividusLamarck, 1816 can feed on C. taxifolia and is able to use this alga as an exclusive source of food, at least for some time, but with important physiological costs (loss of spines, increase of the righting time, decrease of the gonado-somatic rate and decrease of the number of mature individuals). P. lividus do not graze on C. taxifolia during summer and autumn (Boudouresque et al., 1996). In situ observations have shown a 77% decrease of the P. lividus population in an invaded area (Ruitton & Boudouresque 1994).

3.5. EFFECTS ON THE MEIOFAUNA AND MACROFAUNA

The dominance of dense C. taxifolia meadows facilitates over-sedimentation (Finzer & Poizat 1996), which is deeply changing the colonized habitat by an increase of the mud fraction and a development of reduced conditions in the sediment. The meiofauna composition is also affected: whatever the substrate, nematods, nemertineans and polychaetes increase at the expense of copepods (Poizat & Boudouresque 1996). Changes in the macrobenthos include a decrease in total specific richness, especially at low depth. The amphipods and the molluscs are the most affected groups. Also, the


quantitative richness evolves towards a generally poorer condition in the invaded zones (Bellan-Santini 1995; Bellan-Santini et al., 1996).

Preliminary studies on the impact of C. taxifolia upon the vagile invertebrate fauna of P. oceanica beds have shown (Stadelmann 2000, Veillard 2000):(i) an important decrease of the number of individuals of herbivorous prosobranchs,

gasteropods and crustaceans,(ii) a decrease in the specific richness (-17% of crustacean species) with a trend to the

complete disappearance of some species,(iii) an increase of species usually living in muddy substrates, such as the ophiurian

Amphiura chiaje.

3.6. EFFECTS ON PARASITES

Bartoli & Boudouresque (1997) have shown a transmission failure of parasites (Digenea) in sites colonized by Caulerpa taxifolia.

4. Failure of measures to control the further spread of Caulerpa

None of the Mediterranean countries affected by C. taxifolia chose the “shoot first and ask questions later” strategy developed in California. Thus, in 2002, the situation in the Mediterranean (also in Australia) ran out of control and the only management efforts undertaken are the surveillance (yearly mapping of each colony) and the raising of the public awareness (300,000 leaflets distributed to divers, fishermen and sailors in 8 differ-ent languages) (Meinesz et al., 2000).

Eradication efforts (by chemical and physical techniques) are still undertaken to con-trol small patches but their efficiency is controversial (Cottalorda et al., 1996; Escoubet et al., 1998; Gavach et al., 1998). One of the most recent solutions is the use of biologi-cal control with specific predators in order to control (but not eradicate) the expansion of C. taxifolia. To this end, studies show that some species of mollusca of the group of the sacoglossa could be suitable agents of control. The mediterranean species Oxynoeolivacea and Lobiger serradifalci have turned out to be poor candidates (Thibaut & Meinesz 2000; Zuljevic et al., 2001), but the tropical species Elysia subornata shows a high potential (Meinesz et al. 1996, Coquillard et al., 2000; Thibaut et al., 2001).

To make things even worse, the Mediterranean Sea now faces a new Caulerpa inva-sion (Verlaque et al., 2000; Boudouresque & Verlaque 2002), this time by Caulerparacemosa var. occidentalis, which is spreading even faster than C. taxifolia (Fig. 6). Currently, 11 countries have become affected by propagules and by sexual reproduction dispersal (Renoncourt & Meinesz, 2002).


References

Bartoli, P & C. F. Boudouresque, 1997. Transmission failure of parasites (Digenea) in sites colonized by the

recently introduced alga Caulerpa taxifolia. Marine Ecology Progress Series 154: 253-260.

Bellan-Santini, D, 1995. Faune d’invertébrés du peuplement à Caulerpa taxifolia. Données préliminaires pour

les côtes de Provence (Méditerranée Nord-Occidentale). Biologia Marina Mediterranea 2: 635-643.

Bellan-Santini, D, P. Arnaud, G. Bellan & M. Verlaque, 1996. The influence of the introduced tropical alga

Caulerpa taxifolia, on the biodiversity of the Mediterranean marine biota. Journal of the marine Biological

Association of the UK 76: 235-267.

Belsher, T., J. Dimeet, J-M. Raillard, E. Emery, M. Boutbien, C. Prudhomme & R. Pucci, 1998. Acquisition

d’éléments qualitatifs et quantitatifs sur l’expansion de Caulerpa taxifolia en 1996 (Alpes Maritimes,

Var et Principauté de Monaco). In Third International Workshop on Caulerpa taxifolia, Marseille, 19-20

September 1997 (eds, Boudouresque C-F, Gravez V, Meinesz A, Palluy F), pp. 33-43. GIS Posidonie

Publication

Boudouresque, C-F. & M. Verlaque, 2002. Biological pollution in the Mediterranean Sea: invasive versus

introduced macrophytes. Marine Pollution Bulletin 44: 33-38.

Boudouresque, C-F, Lemee R, Mari X & Meinesz A, 1996. The invasive alga Caulerpa taxifolia is not a suit-

able diet for the sea urchin Paracentrotus lividus. Aquatic Botany 53: 245-250.

Figure 6. Caulerpa racemosa var. occidentalis, a new introduced and invasive Caulerpa species in the Mediterranean Sea


Carvahlo, N, Liddle L, Caye G & Meinesz A, 1998. Current knowledge on the biological cycle of the genus

Caulerpa and karyological studies on Caulerpa taxifolia. In Third International Workshop on Caulerpa

taxifolia, Marseille, 19-20 September 1997 (eds, Boudouresque C-F, Gravez V, Meinesz A, Palluy F),

pp. 127-132. GIS Posidonie Publication.

Ceccherelli, G. & F. Cinelli, 1997. Short-term effects of nutrient enrichment of the sediment and interac-

tions between the seagrass Cymodocea nodosa and the introduced green alga Caulerpa taxifolia in a

Mediterranean bay. Journal of Experimental Marine Bioloy and Ecology 217: 165-177.

Ceccherelli, G. & F. Cinelli, 1999. Effects of Posidonia oceanica canopy on Caulerpa taxifolia size in a north-

western Mediterranean bay. Journal of Experimental Marine Biology and Ecology 240: 19-36.

Coquillard, P. & D. R. C. Hill, 1997. Modélisation et simulation d’écosystèmes. Des modèles déterministes aux

simulations à événements discrets. Masson Paris.

Coquillard, P. T. Thibaut, D. R. C. Hill, J. Gueugnot, C. Mazel & Y. Coquillard, 2000. Simulation of the mol-

lusc Ascoglossa Elysia subornata population dynamics: application to the potential biocontrol of Caulerpa

taxifolia growth in the Mediterranean Sea. Ecological Modelling 135: 1-16.

Cottalorda, J-M., P. Robert, E. Charbonnel, J. Dimeet, V. Ménager, M. Tillman, J. Vaugelas de & E. Volto,

1996. Eradication de la colonie de Caulerpa taxifolia découverte en 1994 dans les eaux du Parc National

de Port-Cros (var, France). In Second International Workshop on Caulerpa taxifolia, Barcelona, 15-17

December 1996 (eds, Ribera MA, Ballesteros E, Boudouresque C-F, Gomez A, Gravez V), pp. 149-156.

Publicacions Universitat Barcelona.

Delgado, O, C. Rodriguez-Prieto, E. Gacia & E. Ballesteros, 1995. Lack of severe nutient limitation in

Caulerpa taxifolia (Vahl) C. Agardh, an introduced seaweed spreading over the oligotrophic Northwestern

Mediterranean. Botanica Marina 38: 557-563.

Escoubet, S., D. Dupeux & P. Escoubet, 1998. Utilisation du chlorure de sodium comme moyen d’éradication

de Caulerpa taxifolia (Vahl) C. Agardh. In Third International Workshop on Caulerpa taxifolia, Marseille,

19-20 September 1997 (eds, Boudouresque C-F, Gravez V, Meinesz A, Palluy F), pp. 117-124. France:

GIS Posidonie Publication.

Feldman, J., 1954. Sur la classification des Chlorophycées siphonées. In VIIIe Congrés International de

Botanique de Paris. Rapp. et Comm. Section 17: 96 - 97.

Ferrer, E., A. Gomez Garreta & M. A. Ribera, 1997. Effect of Caulerpa taxifolia on the productivity of two

Mediterranean macrophytes. Marine Ecology Progress Series 149: 279-287.

Finzer, P. & C. Poizat, 1996. Influence de l‘algue introduite Caulerpa taxifolia sur la sédimentation au Cap

Martin (Alpes-Maritimes, France). In Second International Workshop on Caulerpa taxifolia, Barcelona,

15-17 December 1996 (eds, Ribera MA, Ballesteros E, Boudouresque C-F, Gomez A, Gravez V), pp.

365-373. Publicacions Universitat Barcelona.

Francour, P., M. Harmelin-Vivien, J. G. Harmelin & J. Duclerc, 1995. Impact of Caulerpa taxifolia coloniza-

tion on the littoral ichtyofauna of North-Western Mediterranean Sea: preliminary results. Hydrobiologia

300/301: 345-354.

Ganteaume, A, J. Gobert, P. Malestroit, V. Ménager, P. Francour & C. F. Boudouresque, 1998. In vitro con-

sumption of Caulerpa taxifolia (Chlorophyta) by an accustomed and non-accustomed Paracentrotus livi-

dus (echinoid): seasonal variation. Journal of the marine Biological Association of the UK 78: 239-248.

Gavach, C., L. Bonnal, M. Uchimura, R. Sandeaux, J. Sandeaux, R. Souard, B. Lamaze, J-C. Lasserre,

C. Fougairolle, J-F. Combes & V. Gravez, 1998. Destruction de Caulerpa taxifolia par la technique de

la couverture à ions cuivriques. Développement pré-industriel et premiers essais. In Third International

Workshop on Caulerpa taxifolia, Marseille, 19-20 September 1997 (eds Boudouresque C-F, Gravez V,

Meinesz A, Palluy F), pp. 101-104. France: GIS Posidonie Publication.


Gelin, A., S. Arigoni, P. Francour, J. G. Harmelin & M. Harmelin-Vivien, 1998. Réponse des populations

de certains poissons Serranidae et Labridae à la colonisation des fonds par Caulerpa taxifolia en

Méditerranée. In Third International Workshop on Caulerpa taxifolia, Marseille, 19-20 September 1997

(eds Boudouresque C-F, Gravez V, Meinesz A, Palluy F), pp. 197-208. GIS Posidonie Publication.

Gomez-Garreta, A., A. Ferrer & M. A. Ribera, 1996. Impact de Caulerpa taxifolia sur les zygotes de Cystoseira

mediterranea (Fucales). In Second International Workshop on Caulerpa taxifolia, Barcelona, 15-17

December 1996 (eds Ribera MA, Ballesteros E, Boudouresque C-F, Gomez A, Gravez V), pp. 277-280.

Publications of the Universitat Barcelona.

Guerriero, A., A. Meinesz, M. D’Ambrosio & F. Pietra, 1992. Isolation of toxic and potentially toxic-sesqui and

monoterpenes from the tropical green seaweed Caulerpa taxifolia which has invaded the region of Cap

Martin and Monaco. Helvetica Chimica Acta 75: 689-695.

Guerriero, A., F. Marchetti, M. D’Ambrosio, S. Senesi, F. Dini & F. Pietra, 1993. New ecotoxicologically and

biogenetically relevant terpenes of the tropical green seaweed Caulerpa taxifolia which is invading the

Mediterranean. Helvetica Chimica Acta 76: 855-864.

Harmelin-Vivien, M., P. Francour & J. G. Harmelin, 1999. Impact of Caulerpa taxifolia on Mediterranean fi sh

assemblages: a six year study. In UNEP: Proceedings of the Workshop on Invasive Caulerpa species in

the Mediterranean, Heraklion, Crete, Greece, 18-20 March 1998, MTS n° 125, (ed UNEP), pp. 127-138.

UNEP.

Harmelin-Vivien, M., P. Francour, J. G. Harmelin, L. Le Direac’h, 2001. Dynamics of fish assemblage modi-

fications caused by the introduced alga Caulerpa taxifolia near Menton (France). In Fourth International

Workshop on Caulerpa taxifolia, Lericci, 1-2 February 1999 (eds Gravez V, Ruitton S, Boudouresque C-F,

Le Direac’h L, Scabbia G, Verlaque M), pp. 236-245. France: GIS Posidonie Publication.

Jousson, O., J. Pawlowski, L. Zaninetti, A. Meinesz & C. F. Boudouresque, 1998. Molecular evidence for

the aquarium origin of the green alga Caulerpa taxifolia introduced ro the Mediterranean Sea. Marine

Ecology Progress Series 172: 275-280.

Jousson, O., J. Pawlowski, L. Zaninetti, F. W. Zechman, F. Dini, G. Di Guiseppe, R. Woodfield, A. Millar &

A. Meinesz A, 2000. Invasive alga reaches California. Nature 408: 157-158.

Rollino, S., M. Knopfler-Peguy & A. Gremare, 2001. Impact écologique de Caulerpa taxifolia sur le

développement de Cystoseira barbata. In Fourth International Workshop on Caulerpa taxifolia, Lericci,

1-2 February 1999 (eds Gravez V, Ruitton S, Boudouresque C-F, Le Direac’h L, Scabbia G, Verlaque M),

pp. 175-184. France: GIS Posidonie Publication.

Komatsu, T., A. Meinesz & D. Buckles, 1997. Temperature and light responses of alga Caulerpa taxifolia

introduced into the Mediterranean Sea. Marine Ecology Progress Series 146: 145-153.

Lemée, R., C-F. Boudouresque, J. Gobert, P. Malestroit, X. Mari, A. Meinesz, V. Menager & S. Ruitton,

1996. Feeding behavior of Paracentrotus lividus in presence of Caulerpa taxifolia introduced in the

Mediterranean. Oceanologica Acta 19: 245-253.

Meinesz, A., 1980. Contribution à l’étude des Caulerpales (Chlorophytes) avec une mention particulère aux

espèces de la Méditerranée occidentale. Ph. D. Thesis, University of Nice, France.

Meinesz, A. & B. Hesse, 1991. Introduction et invasion de l‘algue tropicale Caulerpa taxifolia en Méditerranée

nord-occidentale. Oceanologica Acta 14: 415-426.

Meinesz, A., J. de Vaugelas, B. Hesse B & X. Mari, 1993. Spread of the introduced tropical green alga Caulerpa

taxifolia in northern Mediterranean waters. Journal of applied Phycology 5: 141-147.

Meinesz, A., L. Benichou, J. Blachier, T. Komatsu, R. Lemée, H. Molenaar & X. Mari, 1995. Variations in

the structure, morphology and biomass of Caulerpa taxifolia in the Mediterranean Sea. Botanica Marina

38: 499-508.


Meinesz, A., J. Melnyk, J. Blachier & S. Charrier, S, 1996. Etude préliminaire, en aquarium, de deux

ascoglosses tropicaux consommant Caulerpa taxifola: une voie de recherche pour la lutte biologique.

In Second International Workshop on Caulerpa taxifolia, Barcelona, 15-17 December 1996 (eds Ribera

MA, Ballesteros E, Boudouresque C-F, Gomez A, Gravez V), pp. 157-161. Publications of the Universitat

Barcelona.

Meinesz, A. & C. F. Boudouresque, 1996. Sur l’origine de Caulerpa taxifolia en Méditerranée. Comptes

Rendus de l’Académie des Sciences, Paris, série III, Sciences de la Vie/Life Sciences 319: 603-613.

Meinesz, A., J-M. Cottalorda, D. Chiaverini, D. Garcia, T. Thibaut & J. de Vaugelas, 2000. Suivi de l’invasion

de l’algue tropicale Caulerpa taxifolia en Méditerranée. Situation en France au 31 décembre 2000. Nice:

Laboratoire Environnement Marin Littoral.

Meinesz, M., Belsher T, Thibaut T, Antolic B, Ben Mustapha K, Boudouresque C-F, Chiaverini D, Cinelli F,

Cottalorda J-M, Djellouli A, El Abed A, Orestano C, Grau AM, Iveša L, Jaklin A, Langar H, Massuti-

Pascual E, Peirano A, Tunesi L, Vaugelas J de, Zavodnik N, Zuljevic A, 2001. The introduced alga

Caulerpa taxifolia continues to spread in the Mediterranean. Biological Invasions 3: 201-210.

Meusnier, I., J. L. Olsen, W. T.Stam, C. Destombe & M. Valero, 2001. Phylogenetic analyses of Caulerpa

taxifolia (Chlorophyta) and of its associated bacterial microflora provide clues to the origin of the

Mediterranean introduction. Molecular Ecology 10: 931-946.

Meyer, U. & A. Meinesz, 2001. Inquiry on the aquarium cultivation of Caulerpa taxifolia in Europe before its

introduction to the Mediterranean Sea. In Fourth International Workshop on Caulerpa taxifolia, Lericci,

1-2 February 1999 (eds Gravez V, Ruitton S, Boudouresque C-F, Le Direac’h L, Scabbia G, Verlaque M),

pp. 7-11. France: GIS Posidonie Publication.

Poizat, C. & C. F. Boudouresque, 1996. Meiofaune du sédiment dans les peuplemennts à Caulerpa taxifolia du

Cap Martin (Alpes-aritimes, France). In Second International Workshop on Caulerpa taxifolia, Barcelona,

15-17 December 1996 (eds Ribera MA, Ballesteros E, Boudouresque C-F, Gomez A, Gravez V), pp. 375-

386. Publications of the Universitat Barcelona.

Renoncourt, L. & A. Meinesz, 2002. Formation of propagules on an invasive strain of Caulerpa racemosa

(Chlorophyta) in the Mediterranean Sea. Phycologia 41: 533-535

Ruiton, S. & C. F. Boudouresque, 1994. Impact de Caulerpa taxifolia sur une population de l’oursin

Paracentrotus lividus à Roquebrune-Cap Martin (Alpes-maritimes, France). In First International

Workshop on Caulerpa taxifolia, Nice, 17-18 January 1992 (eds, Boudouresque C-F, Meinesz A, Gravez

V), pp. 371-378. France: GIS Posidonie Publication.

Schaffelke, B., N. Murphy & S. Uthicke, 2002. Using genetic techniques to investigate the sources of the

invasive alga Caulerpa taxifolia in the three new locations in Australia. Marine Pollution Bulletin 44:

204-210

Stadelmann, B., 2000. Impact de l’invasion de Caulerpa taxifolia dans les herbiers à posidonies sur la

faune vagile invertébrée de l’infralittoral méditerranéen français (Arthropodes Crustacés et Annélides

Polychètes). Diplôme de l’Université de Genève, Suisse.

Thibaut, T., 2001. Etude fonctionnelle, contrôle et modélisation de l’invasion d’une algue introduite en

Méditerranée: Caulerpa taxifolia. Ph. D. Thesis, Université Paris VI, 271 p.

Thibaut, T. & A. Meinesz, 2000. Are the Mediterranean ascoglossan molluscs Oxynoe olivacea and Lobiger

serradifalci suitable agents for a biological control against-the invading tropical alga Caulerpa taxifolia?

Comptes Rendus de l’Académie des Sciences, Paris, série III, Sciences de la Vie/Life Sciences 323:

477-488.

Thibaut, T., A. Meinesz, P. Amade, S. Charrier, K. De Angelis, S. Ierardi, L. Mangialajo, J. Melnick & R. Vidal,

2001 Elysia subornata (Mollusca) a potential control agent of the alga Caulerpa taxifolia (Chlorophyta)


in the Mediterranean Sea. Journal of the Marine Biolological Association of the UK, 81: 497-504.

Veillard, N., 2000. Impact de l’invasion de Caulerpa taxifolia dans les herbiers à posidonies sur la faune

vagile invertébrée de l’infralittoral méditerranéen français (Mollusques et Echinodermes). Diplôme de

l’Université de Genève, Switserland.

Verlaque, M. & P. Fritayre, 1994. Mediterranean algal communities are changing in face of the invasive alga

Caulerpa taxifolia (Vahl) C. Agardh. Oceanologica Acta 17: 659-672.

Verlaque, M., C. F. Boudouresque, A. Meinesz & V. Gravez, 2000. The Caulerpa racemosa complex

(Caulerpales, Ulvophyceae) in the Mediterranean Sea. Botanica Marina 43: 49-68.

Villèle, X. de & M. Verlaque, 1995. Changes and degradation in a Posidonia oceanica bed invaded by the intro-

duced tropical alga Caulerpa taxifolia in the North Western Mediterranean. Botanica Marina 38: 79-87.

Wiedenmann, J., A. Baumstark, T. L. Pillen, A. Meinesz & W. Vogel, 2001. DNA fingerprints of Caulerpa

taxifolia provide evidence for the introduction of an aquarium strain into the Mediterranean Sea and its

close relationship to an Australian population. Marine Biology 38: 229-234.

Williams, S. L,. & E. D. Grosholz, 2002. Preliminary reports from the Caulerpa taxifolia invasion in southern

California. Marine Ecology Progress Series 233: 307-310

Zuljevic, A. & B. Antolic, 2000. Synchronous release of male gametes of Caulerpa taxifolia (Caulerpales,

Chlorophyta) in the Mediterranean Sea. Phycologia 39: 157-159.

Zuljevic, A., T. Thibaut, H. Elloukal & A. Meinesz, 2001. Sea slug disperses the invasive Caulerpa taxifolia in

the Mediterranean. Journal of the marine Biological Association of the UK 81: 343-344.

PART 4

Conclusions from the meeting

HENRI J. DUMONT et al. Conclusions from the meeting . . . . . . . . . . . . . . 301

Chapter 18

Conclusions from the meeting

HENRI J. DUMONT1,TAMARA A. SHIGANOVA2 & ULRICH NIERMANN3

1 Animal Ecology, Ghent University, Ledeganckstraat 35, B-9000 Ghent2 Shirzov Institute of Oceanology, Nakhimovskii pr. 36, Moscow, russia3 Marine ecology, Am sackenkamp 37, 23774 Heiligenhafen, Germany

What is it that made the invasion of the Black, and later of the Caspian Sea, by Mnemiopsis leidyi such a “success”? Why did the invasion apparently take place in the 1980s and not earlier? These questions generated much discussion among the partici-pants of the NATO ARW-workshop. The prevalent view was that both ecosystems – but especially the Black Sea – had been stripped of their top predatory fi sh first, leaving an ecological void to a new invader that found itself free of consumers here on the one hand, and with a very large amount of food available to itself on the other hand. While there is little doubt that overfishing of the Black Sea small pelagic fish paved the way for an increase in zooplankton, the preferred food of the Mnemiopsis, another argument was advanced as well: that a global change in general circulation patterns caused a decline in anchovy, and gave the zooplankton a boost. It is also quite possible that man-made effects (pollution, eutrophication) exacerbated the climate effect, and gave propagules of Mnemiopsis a head start. As a corollary to this statement, it was felt that several unsuc-cessful introductions of Mnemiopsis may have preceded the successful one. Unsuccessful introductions would simply go unnoticed, since the population of even a fist-sized jelly like Mnemiopsis in a water-body the size of the Black Sea should be many millions of individuals before it would become observable.

The same reasoning in principle applies to Beroe cf ovata, this highly specific preda-tor of Mnemiopsis that first “appeared” in 1997, and is now firmly believed to have the same origin as Mnemiopsis itself, viz. the East Coast of the Americas. Ballast water may have transported live Beroe to the Black Sea on many earlier occasions, but these attempts were doomed to fail as long as not enough Mnemiopsis was available for Beroeto survive.

Beroe soon reversed the situation in the Black Sea. Mnemiopsis was reduced to low levels, and in the wake of its decimation, zooplankton and fish recruitment recovered

301




to almost pre-Mnemiopsis levels. Interestingly, no fish or zooplankton species appeared to have been lost from the Black Sea fauna, even if at the height of the Mnemiopsisoutbreak, they had became so rare as to be unobservable by standard monitoring methods, and were generally treated in the papers of the 1990s as having disappeared.

The Lenin canal traffic made it a certainty that Mnemiopsis would also reach the Caspian. The question was not to know whether, but when this would occur. Rumours about Mnemiopsis in the Mid - and South Caspian started circulating as early as 1996, but the first certified sighting only happened in 1999. After that, the population expanded at an unanticipated speed, and the growth rate is currently estimated at twice that in the Black Sea, even if the dynamics are slightly different.

Specimens in the Caspian are smaller than in the Black Sea; that they become big-ger further north, where salinity is increasingly suboptimal but plankton stocks are larger, suggests a hunger affect. Currently, only the freshest parts of the Caspian are Mnemiopsis-free; there is evidence of considerable mortalities in specimens being car-ried here by currents, such as in the NE Sector, which is part of Kazakhstan. Salinity combines here with a relative high load of suspended solids to create a hostile environ-ment to the comb-jelly.

Like in the Black Sea, Mnemiopsis in the Caspian is temperature-limited. In the Black Sea, the site(s) where the jellies spend winter are not accurately known (but in fact, can only be the deeper aerated layers of the South basin). Overwintering in the Caspian takes place in the warm South basin, in front of the Iranian coasts. Here, specimens can be found around the year.

Clearly, one difference with the Black Sea invasion is that the invasion of the Caspian cannot be attributed to climatic factors, but to an absence of predators and strong com-petitors.

Such competitors would include the zooplankton-eating pelagic sardines, the kilka of the Caspian. But Mnemiopsis somehow gets to the food first, as testified by the empty stomachs of most kilka in the post-invasion era. Because it also eats the pelagic eggs of the fish, it is as well a predator as a competitor to them. This double effect undoubtedly contributes to the rapidity with which Mnemiopsis has conquered the Caspian. Other factors that contribute to its success are its high fecundity, and hermaphroditic mode of reproduction.

The Caspian zooplankton was typically composed of up to 20-25 species of Crustaceans, mostly onychopod cladocerans and calanoid copepods. The cladocerans were largely endemic to the lake, and therefore totally naive to a new predator. They were also the first to go; soon, however, the copepods also suffered and after a short while, only a single Copepod, Acartia tonsa, was left. It is probably no coincidence that this is itself an invader.

How it manages to co-exist with Mnemiopsis is still unclear: it is a good swimmer, that may dart away from an approaching jelly, and it also has strong, protective spines on its antennules, but on the other hand, large numbers of them are found in Mnemiopsis stom-achs. Evidently, these losses must be smaller than the recruitment plus survival. Rapid reproduction, with a suite of generations across the year, and evasive vertical migration to layers deeper than those inhabited by Mnemiopsis come to mind as effective survival strategies.

Conclusions from the meeting 303

Lack of food triggered a collapse of kilka, although there is circumstantial evidence that kilka schools actively avoid Mnemiopsis swarms. What this is about is currently unknown, but the fish may simply avoid the mucus that is released by the ctenophores, and might clog their gills. But the top predators of the Caspian are the kilka fi shermen, and another mammal, the Caspian Seal. They were the next dominos to fall. Iranian and Azeiri fisheries greatly suffered, while in Caspian Seal, a classical ecological phenome-non became apparent. As energy intake became limiting, the partition of available energy into maintenance and reproduction shifted towards maintenance, and reproduction all but ceased. In the long run, that may only lead to the demise of the population. On top of this, the Caspian Seal had been badly hit by canine distemper virus in the past few years, and many thousands died; how many currently survive the Mnemiopsis ordeal, from a population originally estimated at c. 360,000 specimens, is uncertain, but the seal’s future surely looks bleak.

What to do about the Mnemiopsis disaster? One option, as always, is to do nothing, and hope that nature will find a way to self-regulate the situation. There are scientists who favour this solution, especially because the literature is replete with examples of well-meant introductions that led to failure or even exacerbated an already hopeless situation. However, where enough ecological wisdom is available, another option is to help nature a little, and do what the GESAMP-experts recommended (but never implemented) as early as 1996: introduce a predator of Mnemiopsis, as prey-specific as possible. Beroe cfovata immediately comes to mind here. It has the advantage of already having reached the Black Sea by itself, where it has led to a surprisingly rapid recovery of the ecosystem. The Black Sea currently shows much les “scars” of the past invasion that had been antici-pated. In fact, no side-effects of Beroe’s “spontaneous” introduction have been noted to date, so there is little reason to expect things in the Caspian to evolve differently.

Of course there will be a price to pay, and that could consist of the fact that the Caspian will forever become home to both jellies, since basic principles of predator-prey interactions tell us that, when the couple has long co-existed, it as evolved a limit cycle. Or does it? It was argued that jelly is of no use to man, unless a way can be found to transform it to something useful, like fish meat. Should one day enough become known about the life-cycle of a jelly-eating fish like Peprilus triacanthus, introduction of this species could be contemplated, with an aim at extending the food chain by another level, that of man harvesting the fish. Man is not a prudent predator, and anything hunted by him invariably faces extinction. So might Peprilus, but the advantage here is that is can always be re-introduced.

Laboratory experiments with Beroe adjusted to Caspian water (a process that takes about three days, using Black Sea-derived Beroe) confirm the South Caspian aquatic environment as adequate for Beroe, even if its full cycle culture in this medium has not (yet) been achieved (larvae died in aquaria at a relatively early stage of development).

What other lessons do the jelly invaders of the Ponto-Caspian teach us? In the Black Sea, a bloom of Aurelia cf aurita preceded that of Mnemiopsis. Aurelia, like Pelagia in the Adriatic (see hereafter) may have freely (i.e. without human help) invaded the Black Sea from the Mediterranean. In the Caspian, the 1999 invasion involved both Aureliaand Mnemiopsis, but Aurelia subsequently disappeared or almost disappeared (few ephyrae, the larval stage of Aurelia, were seen in 2001). In the Black Sea, the decline in


Mnemiopsis after the arrival of Beroe was accompanied by a resurgence of Aurelia. This circumstantial evidence indicates an antagonism between both jellies, but the nature of their interaction remains unknown.

Next, the Ponto-Caspian invasions were discussed against the broader background of similar invasions in the Mediterranean and Baltic Seas. Not only jellies were included, but other groups, even Caulerpa (a marine macroalga). The latter, a species which may propagate fully vegetatively, is now considered impossible to eradicate from the Mediterranean. The best one can hope to do is limit the damage. The case of the cnidar-ian, Pelagia, which expanded from the central to the north of the Adriatic Sea in the 1980s, is to be considered a “natural” expansion, but for the fact that eutrophication (much food) may have facilitated its range extension to an environment with a possibly suboptimum salinity. Moreover, the success of Pelagia was only temporary, so that its invasion of the north may be classified as a non-success story.

To the question whether all aquatic invasions have the same controlling factor in com-mon, the answer was found to be no. Several – but fortunately few – factors appear to be of paramount importance. The following variables were cited, with a broad range (wide tolerance) typical of successful invaders: temperature, salinity, and food range (size and type). Further, rapid development from egg to maturity (short development time), high lifetime fertility, and a mode of reproduction involving either vegetative propagation, or unisexual (parthenogenetic) reproduction, or self-fertilisation frequently occur. The mode of feeding of an explosive invader can be very different: autotrophic or heterotro-phic, with many species actively hunting carnivores. An absence or scarcity of species able to consume the invading species themselves was found to be a rather strong condi-tion to success in the vast majority of cases documented. Presence of an abundance of food for the invader, with the prey often absolutely naive to the new predator (absence of co-evolution) was another factor identified, while newly released propagules may also benefit from being almost parasite-free in their new environment.

A combination of two among these factors was found sufficient to guarantee a suc-cessful invasion in the cases examined. The last two (much food, no predators) lead to an unusual (much higher than normal) survival rate in the invading population, and seems to be a strong precondition to the establishment of a viable invading population.

It was also stated (though not fully substantiated) that a closed or formerly closed aquatic ecosystem might be more receptive to invaders, with the Baltic Sea, that “sea of invaders”, a prominent example. Estuaries might also be among the more receptive sites. They have, on average, a richer invasive fauna than open coastlines, but it was argued that this might be an artefact of estuaries receiving more shipping traffic, hence more ballast water. In favour of the “closed environment” pleads the argument that neither Mnemiopsis nor Beroe were very successful in expanding from the Black Sea to the Mediterranean, but this may simply reflect the fact that brackish-water is the opti-mal environment of both ctenophores. Seawater is tolerated by both, but when given a choice, they prefer estuaria. In addition, food conditions should also be a factor of great weight, and again, these are better in estuaries than in the open Sea. That Mnemiopsis in the Caspian Sea is often found and reaches its largest size in the shallow, eutrophic north, at or close to the lower limit of its salt tolerance, also reflects the importance of the food factor.

Conclusions from the meeting 305

Oddly, the Ponto-Caspian is not just a target for invasive species, but it acts as a donor as well. The connecting and damming of all major rivers of Europe and part of West Asia opened a door to the world for a number of euryhaline, eurythermic Caspian spe-cies, mainly crustaceans, but also molluscs and cnidarians. It soon appeared that these species were not over-adapted to their original environment, and thus poor competitors. On the contrary, by their broad salinity and temperature tolerance, they turned out to be successful expanders, often displacing native species in the process. From the Baltic Sea, an important target area, with a fauna now predominantly composed of invaders, some were secondarily transported by ship ballast water to the Great Lakes of North America. Here, in their turn, they caused great economic losses.

This has become known as the paradox of the Caspian predicament: while numerous species endemic to its basin are currently threatened with extinction as a consequence of the presence of Mnemiopsis (but see earlier: extinction may be hard to measure, except in the case of a large mammal like the Caspian Seal), almost as many Caspian endemics recently managed to break out of this former confinement, and become problem spe-cies in brackish - and freshwaters elsewhere. The bizarre onychopod Cercopagis pengoi(probably a name that stands for a group of species) that clogs nets and other fi shing devices in the Baltic Sea, and has been transported to the Great Lakes of North America, already the recipient of Caspian mollusc species, Dreissena spp, is another case in point. But all Western European rivers are increasingly infected with Caspian Amphipods, Mysids, mollusc and worm species. These, too, displace the original inhabitants of these environments, and may therefore be called pest species. In most cases, the ultimate causes of their unexpected success remain unclear: is it again lack of predators, or are other factors involved as well?

Invasive species research is well on its way of evolving into a new branch of ecology.

Abra ovata 258Abundance of Beroe ovata 158Acartia sp. 22, 24

clausi 13, 17, 44, 50, 56, 115, 118, 131tonsa 94-96, 195, 243, 258, 302

Adriatic Sea 6, 275Aegean Sea 113, 126, 128, 274Ahinski Canal 212Åland Sea 242Aleutian Islands 20Amathillina cristata 224Ambient temperature 115Ammonium 106Amphipoda 50, 56, 57, 224Anchovy 7, 18, 34, 35, 45, 57, 62

collapse of 14eggs 4, 132in the Black Sea 10landings 4larvae 4stock 4, 6, 10, 25

Turkisch anchovy catch 8Annelida 221Anomalocera patersoni 145, 150Anquillicola crassus 237, 247Appendicularians 56Archaeobdella esmonti 222Archaeological objects 247Artemia salina 195Astacus astacus colchius 228

leptodactylus 222, 228Aurelia 141, 142, 150

aurita 4, 13, 14, 22, 24, 34-35, 42-43,56, 58, 72, 137, 138, 173

cf aurita 303Azerbaijan 203-204

Bacteria 107Bacterial loop 58Bacterioplankton 33, 36, 44, 89, 94

Balanus improvisus 237, 240, 247, 260Balearic Islands 6Ballast water 72, 114, 138, 212, 224, 241, 301, 305Baltic Sea 22, 24, 223, 225, 227, 237-238, 241, 247, 250, 260, 304Bekdash region 201Benthic groups 56Bering Sea 3, 19, 22Beroe cucumis 168

forskalii Lesson 170gracilis Künne 170ovata sensu Chun 156, 168ovata sensu Mayer 156, 168

Biodiversity 63, 98Biomass 18, 43,-45, 48, 77, 80, 104, 106, 201

estimation 6of Phytoplankton 99of algae 58

Bivalvia 57, 94-96Black Sea whiting 48, 52, 57Blackfordia virginica 221Boccardia redeki 242Bolinopsis 114

Bolinopsis infundibulum 130Bolinopsis mikado 130Bolinopsis vitrea 113, 117, 119, 125, 130

Bosporus 114, 155, 156, 167, 171, 194current 161

Bothnian Sea 239Bottlenose dolphin 53, 54Bottom-up effect 108Brachionus quadridentatus 96Bream 45Bryozoa 221Bythotrephes cederstroemi 241

longimanus 223, 241

Calanipeda aquaedulcis 94-96, 224Calanus euxinus 44, 56

Index

307



308

Canine distemper virus 303Cape Galata 139, 145Cascading effects 33Caspian coast of Iran 194Caspian roach (vobla) 101Caspian Sea Biodiversity Database (CSBD) 258Caspian Seal 71, 105, 303

reproduction 105Caspian sprat 178Caspihalacarus hyrcanus 222Caspiobdella fadejewi 222 Caulerpa sp. 304

C. taxifolia 265, 287, 291C. racemosa var. occidentalis 293

Centropages hamatus 22, 24kroyeri 145, 150ponticus 44, 56

Ceratium fusus 59Ceratoscopilus maderenis 119Cercopagis pengoi 223, 237, 240, 241, 242,243, 247, 251, 258, 260, 262, 266, 305Chaetognatha 159Cheleken region 201Chesapeake Bay 13Chlorophyll «a» 63, 66, 99, 107Chrysaora hysoscella 276

melanaster 3, 20 quinquecirrha 13

Cirripedia 95Cladocera 45, 46, 50, 56, 94, 96, 148, 159, 281Clausocalanus sp. 117, 131Clearance rates 117, 129, 130Climate change 5, 108

factors 302zones 74

Clupea pallasi 20Clupeonella delicatula caspia 107

engrauliformis 107grimmi 107

Coccolithophores 22, 23Competition 9, 291, 302

Cooling water 247Copepoda 13, 22, 45, 50, 94-97, 115, 125, 145, 148, 159, 162, 224, 281Cordylophora caspia 214, 221, 237, 247Coris julis 291Cornigerius bicornis 223

maeoticus 223Corophium

curvispinum 214, 221 maeoticum 214 mucronatum 214 robustum 225 sowinskyi 225 robustum 224

Cotylorhiza tuberculata 276Crassostrea gigas 260, 265Crimean peninsula 226Crustaceans 305CTAB extraction protocol 170Ctenophore prey-predator couple 137Cumacea 56, 228Cymodecea nodosa 291Cystobranchus fasciatus 222Cystoseira barbata f. aurita 291

Dactyliosolen fragilissimus 42Daily ration 195Danube River 209, 225-226, 228Dardanelles 114, 126, 155Dardanelles plume 114Decapoda 50, 57, 228Delphinus delphis L. 52demersal plankton 107Dendrocoelum romanodanubiale 221, 226Detritus 59Diatoms 18, 42Diet of whiting 63Digenea 293Digestion time 195, 196Dikerogammarus bispinosus 225

haemobaphes 222, 225 villosus 224-226

Dinoflagellates 59Diplodus annularis 45

309

Diplodus sargus 291Displacement volume 118DNA sequence data 167Dniester River 225Dogfish 50Dolphins 33, 34, 37, 52-54, 58Dortmund-Ems Canal 212Dreissena sp 305

bugensis 214, 222 polymorpha 212, 214, 221, 222,

237, 240, 247, 258, 261, 262, 266

Dry weight 118

Eastern and Western gyres (of Black Sea) 59Echinogammarus ischnus 224

warpachowskyi 224Eelgrass 291Eggs

production 73of fish 108

El Niño 5Elbe-Havel Canal 212Elysia subornata 293Emiliana huxleyi 22Endemic species 177, 209Engraulis encrasicolus 118Engraulis encrasicolus 7

encrasicolus maeoticus 56, 65encrasicolus ponticus 45, 56, 65

Epifluorescence 36Eriocheir sinensis 260, 261, 266Eurytemora grimmi 96Eutrophication 108, 150Evadne spinifera 131

tergestina 131Excretion rates 115Exotic species 259

FAO database on introductions of aquatic species 266Fecundity 93, 125, 189, 302

of Beroe 190Finow Canal 212

Fish 101demersal species 58diets 63populations 291

Fisheries 4, 108, 247Flagellata 42Food-web effects 108

Gelatinous food-web 34Gelatinous plankton 72, 119, 137, 141, 148Gelendzhik Bay 37, 38, 40GIS applications 268Glenodinium pilula 43Global Information system on Fishes (FishBase) 266Global invasive species database 260Gmelina costata 214

kuznetzowi 224 pusilla 214

Golubaya Bay 37Gracillaria bursa-pastoris 291Grazing rate 73, 99Great Lakes of North America 305Grey mullet 45Growth 194Gulf of Trieste 279Gut fullness 35Gymnocalanus grimaldii 96Gymnodinium sanguineum 43

Halicyclops sarsi 94-96Harmful blooms 138Hemimysis anomala 226Hermaphroditism 14, 302Herring 20Heterocope caspia 96, 224Heterotrophic flagellates 36Hobsonia ß orida 222Horse mackerel 45, 62Hydrology 118Hydrozoa 221Hypania invalida 221Hypaniola kowalewskii 221, 222Hypanis colorata 214, 221, 223

310

Ichthyoplankton 36, 45, 48, 62, 63, 114, 115, 118, 131, 159Information systems 257Infusoria 36, 44Intentional introductions 239Invasions 33

Invasion biology 250Invasion corridors 239Invasive alien species 257

Ionian Sea 6, 274Isopoda 50, 226ITS-1 sequences 171

Jaera istri 226Jelly samples 82Jelly species 82, 141Jellyfish 18, 22, 273

biomass 19blooms 5, 22

Jelly-plankton 137

Kaunas Reservoir 224

Kazakhstan 205Keratella tropica 96Kerch Strait 35, 38, 60Kiel Bight 13Kilka 96, 100, 103, 104, 108, 302

Kilka fishery 26Kilka stocks 101

Krasnovodsk bay 201Kremenchuk reservoir 222Kuybyshev reservoir 223

LakesBalkash 226Beloye 214Ontario 223

Larval fish 13, 108Lenin canal 302Lenkoran 204Leslies’ matrix 282Limnocletodes behningi 224Limnomysis benedeni 224, 226Limnos Island 115, 126Lithoglyphus naticoides 222

Liza aurata 258 saliens 258

Lobata 114Lobiger serradifalci 293Lotka-Volterra oscillation 63

Macrofauna 292Maeotias marginata 221Main-Danube Canal 209, 212, 225, 229Mallotus villosus 20Manayunkia caspica 222Marenzelleria viridis 237, 242, 251Marmara Sea 155, 156, 158, 161, 162, 163Matrix model 282Mediterranean horse mackerel 62Mediterranean Sea 287Meiofauna 292Merlangus merlangus 48

merlangus euxinus 50, 52Meroplankton 107, 159Mesocosm experiments 44Mesozooplankton 22, 24, 34, 56, 73, 94, 115, 118, 130, 131, 137, 140, 144, 150, 160

abundance 131biomass 203groups 146

Metabolic rates 129, 130Meteorological events 14Microplankton 36, 44, 58, 107

biomass 33Middle Caspian 77, 78, 81, 97, 99, 106, 204Migration corridors 211

pathways 214Mittelland Canal 212, 224, 227Modelling 281Moerisia maeotica 221Molecular phylogenetics 171Mollusca 222, 305Monaco 290Moskva River 222, 225Moudros Bay 127Mucus 44, 58, 59, 65, 107

311

Mugil saliens 45 soiuy 58, 260

Mullus barbatus ponticus 50, 52Mustela vison 237, 247Mya arenaria 240, 260, 265Mysidacea 56, 226

Nanoplankton 24Narragansett Bay 5, 128Nauplii 95Nemunas River (Lithuania) 226Neogobius melanostomus 258, 266Nitrogen 106Nitzschia tenuirostris 42Noctiluca miliaris 159Noctiluca scintillans 34, 45North Atlantic Oscillation (NAO) 5, 17North Pacific (NP) Index 21North Sea 15Northeastern Black Sea 33, 38, 48, 54Northern Adriatic 273Northern Caspian 77, 78, 81, 83, 85, 86, 91, 94, 97, 101, 106North-Western shelf (of the Black Sea)Nutrients 107

Obesogammarus crassus 224 obesus 225

Oder-Havel Canal 212Oikopleura dioica 22, 45, 58

sp. 24Oithona nana 13

plumifera 118, 131 similis 22, 24, 56

Oligochoerus limnophilus 221Oncaea sp. 118, 131Oncorhynchus sp 240Onychopoda 94, 209Open databases 257Orconectus limosus 228Overfishing 4, 14, 108, 301

on anchovy 9Oxygen consumption 92, 183, 196

content 189Oxynoe olivacea 293

Paracalanus parvus 24, 44, 56, 58, 117-118, 131Paracentrotus lividus 292Paramysis baeri 226

intermedia 226 lacustris 224, 226 ullskyi 226

Paranais frici 222Parthenogenetic reproduction 304PCR amplification 170Pelagia noctiluca 273, 274, 276, 279Pelagia sp. 304Penilia avirostris 45, 58, 118, 131Peprilus triacanthus 303Phoca caspica 105Phocoena phocoena 53Photic zone 23PhytoplanktonPhytoplankton 23, 33, 35-36, 42, 43, 58, 65, 71, 73, 89, 97, 106, 107, 108

biomass 59blooms 59

Picoplankton 42Planktivorous fish 107Pleopis tergestina 45Pleurobrachia pileus 35, 42, 43, 65

rhodopis 168Podonedvadne trigona 223Polychaeta 50, 51, 57Polyphemus exiguus 95Polypodium hydriforme 221Pontella mediterranea 56, 145, 150Pontogammarus aralensis 224

crassus 224 maeoticus 224 robustoides 224 sarsi 224 subnudus 224

Posidonia oceanica 291Potamopyrgus antipodarum 242, 265Potamothrix heuschri 222

vejdovskyi 222Predation 9, 59, 108, 302, 303

rate 55predatory fish 108

312

Prey availability 132Primary production 106Prorocentrum minimum 240Proterorhinus marmoratus 266Protozoa 95Psammoryctides deserticola 222Psetta maxima maeotica 50Pseudocalanus elongatus 44, 56

minutus 24Pseudocuma cercaroides 228Pseudonitzschia delicatissima 42Pseudosolenia calcar-avis 42Pterocuma pectinata 228

Raja clavata 50, 52Rapana venosa 260Recycling of nutrients 106Red Mullet 15, 50, 52, 62Reproduction 304

rate 92, 93, 125Respiration 194

rate 92, 115, 196Rhine

basin 221-224, 229, 230River 209, 212, 226

Rhine-Herne Canal 212Rhizosolenia calcar-avis 258Rhisostoma pulmo 138, 276Rhythropanopeus harrisii 260, 265Rim Current 59Rotifera 94, 96

Sagitta setosa 50, 51, 56Saline front 118Salinity 60, 71, 74, 81, 83, 86, 105, 114, 115, 117, 129, 132, 157, 161, 179, 280, 302, 304

fields 76tolerance 177effects of low values 118, 193, 194

Salzgitter Canal 227Saratov reservoir 223Sardinella aurita 119Saronikos Gulf 114, 126

Schizopera neglecta 224Schizorhynchus eudoreloides 228Sea of Azov 178, 179Sea of Marmara 114Sea surface temperature (SST) 17Sea Urchins 292Seals 108Self-fertilisation 304Serranus cabrilla 291

sciba 291Southern Caspian 77, 78, 80, 83, 99, 204Sprat 34, 48, 50, 51

stomach fullness 63Sprattus sprattus 13

sprattus phalericus 48, 50, 56, 65

Squalus acanthias 50Stenogammarus carausui 224Sturgeons 107Stygobromus ambulans 225Symphodus ocellatus 291Synchaeta neapolitana 96

stylata 95 stylata 96

Temperature 55, 74, 94, 106, 114, 117, 129, 157, 161, 183, 187, 280, 304

fields 75range 177

Teredo navalis 237, 240, 247Theodoxus danubialis 223

pallasi 223Thermocline 74Thornback ray 50Top predators 65Top-down control 65, 108Trachurus mediterraneus ponticus 45, 57, 65Trawling 35Turbellaria 221Turbot 50Turkmenistan 201Tursiops truncatus ponticus 53

Unisexual species 304

313

Ural River 74

Valvata naticina 223Varna Bay 139Victorella pavida 221Volga River 74, 223Volga-Baltic Waterway 212Volga-Don Canal 72

Weather patterns 18Whiting 50, 51Whiting stomach fullness 63Wind-induced turbulence 18Winter convection 59World’s Worst Invasive Alien Species 261

Yolk-sac larvae 4

Zooflagellates 58Zooplanktivorous fish 34Zooplankton 9, 13, 17, 20, 22, 35, 44-46, 48, 55, 60, 62-63, 65, 71, 94, 96-97, 99, 106, 114, 117, 119, 131, 132, 137, 151, 156, 162, 194, 301, 302

mortality 151recovery 151stock 107

aquatic invasions in the black, caspian, and mediterranean seas (2004) ww

Documents