appendix(list(nopho0dbh(aml(2012(vs(2.0(2012009030 ... ·...

Appendix list NOPHO-‐DBH AML 2012 vs 2.0 2012-‐09-‐30

Appendix 1 Contract with treatment centres Appendix 2 SAE registration form Appendix 3 SUSAR/death report Appendix 4 MRD Guidelines Appendix 5 PCR guidelines Appendix 6 Guidelines for CRF DNX study Appendix 7 Guidelines for CRF FLADx study Appendix 8 Biobank referral form Appendix 9 Guidelines for patient information

Appendix 1 Study contract 2011-‐11-‐30

AML2012 study contract Contract of Participation of a Clinical Institution:

Hospital: _______________________________ Principal Investigator (local representative):

Name: ___________________________________________________________________

Phone:________________ Fax:________________ e-‐mail:___________________ Contact person for study affairs and mail:

Name: ___________________________________________________________________

Phone:________________ Fax:________________ e-‐mail:___________________ Laboratory for analysis of MRD-analysis by flow cytometry: Name, address, and telephone number:

___________________________________________________________________ Laboratory for analysis of MRD-analysis by PCR Name, address, and telephone number:

___________________________________________________________________

I have thoroughly read and reviewed the study protocol NOPHO AML2012. Having read and understood the requirements and conditions of the study protocol,

1. I agree to treat the patients according to this Protocol, the international good clinical practice principles, the declaration of Helsinki (version 2000) and regulatory authority requirements for source document verification and inspection of the study.

1. I will archive the study documents in accordance to valid national regulations. 2. I agree to inform the Study Chair and/or the National Principal Investigator on

problems in diagnostic and therapeutic decisions. 3. I agree to report to the NOPHO Leukemia Registry within 48 hours

a. any death during induction or in first remission, and b. any SUSARs (suspected unexpected serious adverse events).

This center will participate in the randomised DNX study for AML

□ yes □ no This center will participate in the randomised FLADx study for AML

□ yes □ no Principal Investigator: ______________________________________________________ The signed contract must be sent or faxed to: Jonas Abrahamsson Children’s Cancer Centre Queen Silvias Childrens and Adolescents Hospital, 416 85 Gothenburg Sweden Tlph: +46 707 695159 Fax: +46 31 215486 Email [email protected]

AML2012 Toxicity registration

After each course it is mandatory to register toxicity online according to this form.

Name:__________________________ NOPHO Nr:______________________ Course:_________________ Category No SAE Grade 3 Grade 4 Additional data Need of intensive care

Number of days in ICU:...........

Hypoxia Decreased O2 sat at rest req O2 therapy

Decreased O2 saturation requiring CPAP or assisted ventilation

Days in ventilator:..................

Multi-‐organ failure Shock with azotemia and acid-‐base disturbances; significant coagulation abnormalities

Life-‐threatening (e.g., vasopressor dependent and oliguric or ischemic colitis or lactic acidosis)

ARDS Present with radiologic findings; intubation not indicated

Life-‐threatening respiratory or hemodynamic compromise; intubation or urgent intervention indicated

Infection Pathogen identified iv antibiotics Septic shock/hypotension

Pathogen ................... Fungal infection yes/no Suspected/probable/proven

Abdominal pain Severe pain strongly interfering with daily life activities

Paralytic ileus or intestinal obstruction

Abdominal symptoms Leading to laparotomy

Typhlitis

Symptomatic (e.g. abdominal pain, fever, change in bowel habits with ileus); peritoneal signs

Life-‐threatening consequences; urgent operative intervention indicated

Congestive heart failure (CHF) Mild CHF compensated with

therapy Severe/refractory CHF

Cardiac arrhythmia Requiring intervention Life-‐threatening Specify arrhythmia: ...................

Allergic reaction Bronchospasm requiring parenteral medication Anaphylaxis

Renal dysfunction Creatinine 3-‐6 x UNL Creatinine > 6 x UNL Bilirubin Bilirubin 3-‐10 x UNL Bilirubin > 10 x UNL

Thrombosis Requiring systemic anticoagulation

Severe thrombosis causing organ dysfunction

Haemorrhage Catastrophic bleeding requiring non-‐elective intervention

Organ:...................

Disseminated intravascular coagulation

Laboratory findings and bleeding

Life-‐threatening consequences; urgent intervention indicated

Central neurotoxicity

Somnolence > 50%/day or severe disorientation or hallucinations

Coma or seizures

Appendix 3 SUSAR/Death report form 2012-‐09-‐30

1

SUSAR / Death Report form AML2012

NOPHO # ___________ Treatment Centre___________________________ Country______________ Name ________________________ Date of birth __________________ Type of report Initial Follow-‐up Category Death SUSAR If death Date ______________ Stage Death in CCR Cause Therapy related

Induction death Disease related Death after relapse Therapy and disease related Death after SMN Unknown Date of onset of symptoms of SAE ________________ Is the event due to/complicated by persisting AML Yes No No data

Other seriousness criteria Congenital anomaly/birth defect Other significant medical defects

Expedited reported criteria Involved or prolonged hospitalisation

(Check all appropriate) Involved persistence of significant disability or incapacity Death

SAE description in medical terms:

Case description (Include related symptoms, treatment, outcome and suspected cause:

Appendix 3 SUSAR/Death report form 2012-‐09-‐30

2

Immediately preceding or ongoing course _________________ Drugs at or before onset of SAE_____________________________________________________________________ Last chemotherapy start date _______________ Drugs given __________________________________

SUSAR/death reports are required to be sent within 48 hours of the occurrence of the event. The report should preferably be submitted online in the NOPHO AML2012 database but can also be sent by fax to the NOPHO leukemia registry. The data centre will immediately forward the report to the study and national coordinators and action will be taken according to section 14.2.1 in the AML2012 protocol.

Action taken

Outcome of event Complete recovery Date recovery _________________

Recovered with sequelae Condition improving Condition still present and unchanged Condition deteriorating

Name email and telephone number of reporter

Date of report _____________________

Appendix 4. Guidelines for MRD flow 2012-‐09-‐30

Version September 2012 (Anne) Not final

Background

Many children and adults with acute myeloid leukemia still relapse

after an initial complete response to therapy (ref). Pretreatment risk

assessment based on clinical and biologic features not always

predicts treatment outcome. There is now extensive evidence that

minimal residual disease (MRD) both after induction and

consolidation is highly predictive of relapse (ref, own study).

Moreover, few prospective studies also indicate that clinically

relevant MRD values can be used in risk-‐adjusted treatment (ref). In

addition, evidence is emerging that the detection of leukemic stem

cells may have potential clinical significance (ref).

MRD is monitored using flow cytometry and real time quantitative

polymerase chain reaction (RQ-‐ PCR). The use of RQ-‐PCR is

restricted to specific leukemia disease entities associated with fusion

transcripts or specific gene mutations such as the nucleophosmin 1

mutations. In contrast, flow cytometry that is applied to detect

leukemia-‐associated immunophenotypes (LAIP), is applicable in 80-‐

90% of AML case (ref).

A standard 8 or 10 colours antibody panel depending on the flow

cytometer in use has been selected for the MRD analysis in AML

(tables). The emphasis of the antibody combination design was on

the identification of LAIP that are most frequently seen in the major

AML disease entities (ref). In addition, it was decided to also add one

tube aiming at identifying leukemia stem cells (LSC). All antibody

combinations of the 8 and 10 colours panel are respectively

comprised of 4 and 5 backbone markers including CD34, CD117,


HLA-‐DR, CD45 and CD33 (ref). In order to study LSC and possibly

differentiate LSC from normal HSC, the markers CD123, CD7 and

CD96 were combined with CD38. Unlike normal HSC, CD123 and

CD96 have been reported being expressed by CD34 positive, CD38

negative, CD90 negative leukemic stem cells, respectively in 100 and

66 % of AML cases (ref). CD96 is also demonstrated being positive in

30% of AML as shown by an immunohistochemical study and in a

minor subpopulation of normal CD34+ progenitor cells (ref).

Interestingly, the LSC antibody combination identifies normal CD34+

precursors expressing CD7 thereby facilitating the MRD detection of

CD7+ AML blasts. In regenerating marrows and to a minor extent

also in marrows of normal donors, the CD123 bright positive

dendritic cell and the CD96 dim positive precursors are

demonstrated which are partly positive for CD7 (figure).

It is estimated that in 80-‐85 % of AML cases, it will be feasible to

identify LAIP using the standard panels. The aim is to reach a MRD

sensitivity of at least 0.1%. Based on the preliminary experience

using the MRD panel, LAIPs can be identified in at least 2 different

MRD tubes. The most specific LAIPs consist of one or more aberrant

markers combined with one brightly expressed progenitor cell

marker as well as a myeloid marker. The quality of the LAIP for MRD

detection depends on its specificity (Spe), its sensitivity (Se) and

stability. The specificity depends on the percentage (%) of LAIP

expression on precursors in normal and regenerating bone marrows.

Since the aberrant expression of markers usually doesn’t exceed 20

%, the latter is defined as the cut-‐off for identifying LAIP. The

sensitivity is determined by the % LAIP on the leukemic cell

population(s) at diagnosis and the number of cells analyzed at


follow-‐up. Three levels of sensitivity can be defined: > 50 % LAP

expression (good), > 20% <50% (intermediate) and >10% <20%

(low) (Dutch-‐Belgian task force for MRD detection in AML in

cooperation with the European Working group on Clinical Cell

Analysis). Third, phenotypic shifts including loss or gain of aberrantly

expressed markers do occur resulting in false negative MRD. Loss of

aberrant expression is more frequent for markers that are dimly

expressed. In contrast, some markers that are negative at the time of

diagnosis may become positive during follow-‐up or at relapse. It is

also noted that MRD detection in AML with monocytic differentiation

may be challenging (ref).

Specimen

Bone marrow or peripheral blood samples are used for diagnosis,

The MRD analysis is performed on bone marrow samples.

Heparin is the anticoagulant of choice for bone marrow samples.

EDTA or heparin tubes can be used for peripheral blood samples,

It is recommended that the sample is processed within 24 hours after

collection.

Antibody panel

It is the responsibility of each laboratory to stain for the cell lineage

as well as myeloid markers that fully characterize the leukemic cell

population according to the recommendations of the WHO

classification of AML (ref WHO). In addition, it is compulsory to

analyze the diagnostic sample with the complete standard MRD panel

in order to identify the tubes showing LAIP.


LAIPs can be frequently identified in at least 2 different MRD tubes. If

none of the standard tubes reveal LAIP, the design of a tailored Ab

tube needs to be considered and be discussed with the national

coordinator.

The standard or tailored MRD antibody combinations chosen at the

time of diagnosis are analyzed on all follow-‐up samples. In addition,

it is recommended to always stain the cells with tube 1 of the

standard panel in order to identify the distribution of the cell

populations. If the sample has an adequate cell count, it should be

considered to stain with all MRD combinations

All monoclonal antibodies have to be titrated before use.

Instrument setup and fluorescence compensation

For the BD platform users, it is recommended to use the set-‐up and

fluorescence compensation procedures as outlined by the Euroflow

consortium (ref).

For the Navios users, … (to be completed)

Sample preparation and staining

Depending on the laboratories’ practice, either a stain, lyse and wash

or lyse, stain and wash method can be used for the analysis of the

samples. However, the chosen procedure needs to be applied on all

samples.If a lyse, stain and wash method is used, bulk lysis of the

sample is performed using NH4CL as described in document X.

The staining is performed according to standard operating

procedures. Briefly, the respective antibody tubes are prepared with

the pretitrated and diluted antibodies to which 50 microliter of cell

suspension is added. The cells are incubated during 15 minutes in


the dark at room temperature and washed twice using PBS 0.1%

BSA. An extratube can be added using a living cell dye such as Syto16

or DRAQ5 (needs to be decided).

The antibody tubes should be acquired on the flow cytometer within

4 hours after staining.

Data acquisition

It is recommended to flush the flow cytometer with destilled H20

before starting the acquisition of the diagnostic or MRD sample as

well as between each antibody tube For diagnostic samples 30 000

total cells are required. In case of MRD samples, between 500 000

and 1 million cells need to be acquired. If cells are acquired until the

tube is empty, the time parameter can be included to gate out events

generated by air bubbles.

Data analysis

Data analysis is performed using the software programs available in

the laboratory.

LAIP is determined on the major leukemic cell populations present in

the diagnostic sample. The major leukemic cell population (s) is (are)

defined on a CD45 versus side scatter (ssc) dotplot. They can be

localized in one or more of the following regions in the CD45 /ssc

dotplot: 1. CD45 dimly positive or negative versus low scc. 2. CD45

positive versus low ssc. 3. CD45 brightly positive versus low to

intermediate ssc. Subsequently, the major leukemic cell population is

further characterized by one or more backbone markers i.e. CD34,

CD117 and/ or HLA-‐DR antigens. The expression of the latter

markers together with CD45 and light scatter finally determine the


gating strategy to be used for MRD evaluation in the follow-‐up

samples. The majority of the myeloid leukemias can be identified by

the expression of CD34 and/or CD117 (ref). If the former markers

are negative, CD133 can be used if positive on the leukemic cell

population. AML with monocytic differentiation are often negative

for the former progenitor cell markers, but are usually distinctly

positive for HLA-‐DR antigens and CD33. Note that CD33 is present in

2 of the standard MRD antibody tubes in the BD panel and in all three

standard tubes of the BC panel.

Next, the expression of the non-‐backbone markers is evaluated for

each of the major leukemic cell populations in order to identify LAIP.

LAIP is characterized by cross lineage expression, asynchronous

expression as well as under or over expression of the analyzed

markers in comparison to the normal reference population. In this

respect, the three major reference populations, including the

CD34+/CD117+, CD34-‐/CD117+ and CD33+/ HLA-‐DR+ cells, have

been characterized for the expression of all non-‐backbone markers in

the respective panels in order to determine their expression in

regenerating and normal bone marrows (figures, to be completed).

Normal reference patterns of hematopoietic differentiation in bone

marrow have been described (ref)

Only, LAIP expressions that exceed > 10% of the leukemic cell

populations are analyzed in the follow-‐up samples. The gating

strategy is described and illustrated in document X ( description and

illustration need to be completed)

Data reporting

The report forms including the diagnostic and MRD


At diagnosis, the reporting include the percentage of the major cell

populations present in the sample, the phenotype of the leukemic cell

population as well as a detailed description of the LAIP as outlined in

the diagnostic form. The Bethesda guidelines should be used when

reporting a marker expression (we need to discuss this, and try to

keep it as simple as possible, f.e only dim/ bright when informative

for LAIP recognition).

The following categories of markers will be reported for the major

leukemic cell population

(a) Progenitor markers: CD34, CD117, CD133, CD135 (include?),

CD123

(b) Myeloid markers: CD11a, CD11b, CD13, CD14, CD15, CD16,

CD35, CD36, CD64, IREM2, MPO

(c) Lymphocyte markers: CD2, CD3, CD4, CD5, CD7, CD19, CD22,

CD56, Tdt

(d) Other markers: CD99, CD184 (?), NG2, CD96, HLA-‐DR, CD38,

CD45

The number of LAIP needs to be reported for each of the standard

antibody tubes that are analyzed. !Discussion is ongoing with respect

to the evaluation of the quality of MRD !

For the MRD samples, the level of residual leukemic cells as well as

their phenotype is reported as outlined in the MRD report form. (cfr

report form in the database, but there is also a need to standardize

the reporting to the clinician). A representative example of a

diagnostic as well as a MRD report is found in document X.

Five categories of MRD level are chosen for the reporting (MRD

report form). If no cells with a leukemic phenotype are

demonstrated, MRD of <0.1 %, negative is reported (as above,


standardized reporting to the clinician is necessary). In addition, the

percentage of the normal CD34+ progenitor cells as well as those of

the major cell populations should also be given.

The data files of the diagnostic samples as well as of the follow-‐up

samples will be evaluated by 2 independent laboratories. The

twinning laboratories are listed in table X. If no consensus on the

MRD level is reached, the expertise of a member of the AML-‐NOPHO

coordinator group will be sought.

A consensus result will be reported on-‐line in the NOPHO database

and to the clinician treating the patient (the time delay for reporting

in the NOPHO database needs to be discussed)

The data files of all samples will be submitted to the NOPHO-‐AML

database. (no details yet how feasible it is).

References (preliminary list)

1. Al-‐Mawali A, D Gilis, and I. Lewis I The role of multiparameter

flow cytometry for detection of minimal residual disease in

acute myeloid leukemia. Am J Clin Pathol. 2009; 131: 16-‐26

2. Al-‐Mawali A, D Gilis, P Hissaria, and I Lewis. Incidence,

sensitivity, and specificity of leukemia-‐associated phenotypes

in acute myeloid leukemia using specific five-‐color

multiparameter flow cytometry. Am J Clin Pathol. 2008;

129:934-‐945.

3. Vidriales M, JF Miguel, A Orfao, E Coustan-‐Smith, D Campana.

Minimal residual disease monitoring by flow cytometry. Best

Practice & Research Clinical Haematology 2003; 4: 599-‐612.


4. Feller N, MA van der Pol, A van Stijn GWD Weijers, AH Westra,

BW Evertse, GJ Ossenkoppele, and GJ Schuurhuis. MRD

parameters using immunophenotypic detection methods are

highly reliable in predicting survival in acute myeloid leukemia.

Leukemia 2004; 18: 1380-‐1390.

5. Langebrake C, U Creutzig, M. Dworzak, O Hrusak, E.

Mejstrikova, F. Griesinger, M Zimmerman, and D Reinhardt.

Residual disease monitoring in childhood myeloid leukemia by

multiparameter flow cytometry: The MRD-‐AML-‐BFM Study

group. J Clin Oncol 2006; 24. 3686-‐3692.

6. Langebrake C, I. Brinkman, A Teigler-‐Schliegel, U. Creutzig, F.

Griesinger and D. Reinhardt. Immunophenotypic differences

between diagnosis and relapse in childhood AML. Implications

for MRD monitoring. Cytometry Part B (Clinical Cytometry)

2005; 63B: 1-‐9.

7. Ossenkoppele GJ, van de Loosdrecht A, and GJ Schuurhuis.

Review of the relevance of aberrant antigen expression by flow

cytometry in myeloid neoplasms. Br J Haematology 2011; 153:

421-‐436

8. Coustan-‐Smith E, Ribeiro RC, Rubnitz JE et al. Clinical

significance of residual disease during treatment in childhood

acute myeloid leukemia. Br J Haematology 2003; 123: 243-‐252

9. Rubnitz JE, H Inaba, GV Dahl et al. Minimal residual disease-‐

directed therapy for childhood acute myeloid leukemia: results

of the AML02 multicentre trial. Lancet Oncology 2010; 11: 543-‐

552

10. Kern W, U. Bacher, C Haferlach, S. Schnittger and T Haferlach.

The role of multiparameter flow cytometry for disease


monitoring in AML. Best Practice & Research Clinical

Haematology 2010; 23: 379-‐390.

11. DiNArdo CD, and SM Luger. Beyond morphology: minimal

residual disease detection in acute myeloid leukema. Curr Opin

Hematology 2012; 19: 82-‐88.

12. Shuurhuis GJ and G Ossenkoppele. Minimal residual disease in

acute myeloid leukemia: already predicting a safe haven.

Expert Rev Hematol 2010; 3: 1-‐5.

13. Van der Velden VHJ, A. van der Sluijs-‐ Geling, Bes Gibson, JG te

Marvelde, PG Hoogveen, WCJ Hop, K. Wheatly, MB Bierings, GJ

Schuurhuis, SSN de Graaf, ER van Wering and JJM van Dongen.

Clinical significance of flowcytometric minimal residual disease

detection in pediatric acute myeloid leukemia patients treated

according to the DCOG ANLL97/ MRC AML12 protocol.

Leukemia 2010; 24: 1599-‐1606.

14. Buccisano F, F Maurillo, A Spagnoli et al. Cytogenetic and

molecular diagnostic characterization combined to

postconsolidation minimal residual disease assessment by flow

cytometry improves risk stratification in adult acute myeloid

leukemia. Blood 2010: 116: 2295-‐2303.

15. Walter RB, TA Gooley, BL Wood et al. Impact of

pretransplantation minimal residual disease as detected by

multiparametric flow cytometry on outcome of myeloablative

hematopoietic cell transplantation for acute myeloid leukemia.

J Clin Oncol 2011; 29: 1190-‐1197.

16. Krause DS and RA Van Etten. Right on target: eradicating

leukemic stem cells. Trends in Molecular Medicine 2007; 13:

470-‐481.


17. Majeti R. Monoclonal antibody therapy directed against human

acute myeloid leukemia stem cells. Oncogene 2011, 30: 1009-‐

1019.

18. Hosen N, CY Park, N Tatsumi, Y Oji, H Sugiyama, M Gramatzki,

AM Krensky, and IL Weissman. CD96 is a leukemi stem cell-‐

specific marker in human acute myeloid leukemia. PNAS 2007;

104: 11008-‐11013.

19. Bakker AB, S Van den Oudenrijn, AQ Bakker, et al. C-‐type lectin-‐

like –like molecule-‐q: a novel myeloid cell surface marker

associated with acute myeloid leukemia. Cancer Res 2004, 64:

8443-‐8450.

20. Van Rhenen A, GA van Dongen, A Kelder, EJ Rombouts, N Feller,

B Moshaver et al. The novel stem cell associated antigen CLL-‐1

aids in discrimination between normal and leukemic stem cells.

Blood 2007; 110: 2659-‐2666.

21. Van Lochem EG, van der Velden VH, Wind HK, te Marvelde JG,

Westerdaal NA, van Dongen JJ. Immunophenotypic

differentiation patterns of normal hematopoiesis in human

bone marrow: reference patterns for age-‐related changes and

disease-‐induced shifts. Cytometry B Clin Cytom 2004; 60:1-‐13.


List of additional documents

1. Antibody panels

2. List of markers / clones

3. Gating strategy (description + illustrations)

4. LAIP descriptions (needs to be discussed whether it needs to be

included; needs to be finalized)

5. LSC gating procedure (needs to be discussed)

6. Report forms (see separate forms)

7. Treatment scheme with MRD time points (cfr Jonas)

8. Bulk lysis / (need to be completed; testing on going)

9. List of laboratories (needs to be completed)


Document 1: Antibody panels

8-‐colours antibody panel (BD platform)

Fitc Pe PerCPCy5.5 PeCy7 APC APC H7

APC Cy7

APC-

A750

HV450

Pacific

Blue

HV500

Pacific Orange

KO

1 CD56 CD13 CD34 CD117 CD33 CD11b HLA-‐DR CD45

2 CD36 CD64 CD34 CD117 CD33 CD14 HLA-‐DR CD45

3 CD15 NG2 CD34 CD117 CD2 CD19 HLA-‐DR CD45

4 CD7 CD96 CD34 CD117 CD123 CD38 HLA-‐DR CD45

5 CD99 CD11a CD34 CD117 CD133 CD4 HLA-‐DR CD45

10-‐colours antibody panel (BC platform)

Fitc Pe ECD PC5.5 PeCy7 APC APC -

A700

APC-

A750

BV421

KO

1 CD15 CD13 CD16 CD33 CD117 CD19 CD34 CD45 CD11b HLA-‐DR

2 CD36 CD64 CD56 CD33 CD117 IREM2 CD34 CD45 CD14 HLA-‐DR

3 CD7 CD96 CD45RA CD33 CD117 CD123 CD34 CD45 CD38 HLA-‐DR

4

5

CD99

CD11a

NG2

CD3

CD33

CD33

CD117

CD117

CD133

CD2

CD34

CD34

CD45

CD45

CD4 HLA-‐DR

HLA-‐DR


Document 2: List of antibodies /clones

CD2 APC S5.2 (BD 341024)

CD3 ECD A07748 (BC)

CD4 APC H7 SK3 (BD )

CD4 BV421 RPA-‐T4 (BD 558116)

CD7 Fitc 4H9 (BD)

CD7 Fitc 8H1 (BC Immunotech)

CD11a Pe XXXBiolegend

CD11b APC H7 ICRF44 (BD)

CD11b APC AF750

CD11b BV421 ICRF44 (Biolegend)

CD13 Pe L138 (BD 347406)

CD14 APC H7 MøP9 (BD 560349)

CD14 BV421 M5E2 (Biolegend)

CD15 Fitc MMA (BD)

CD15 Fitc MCS-‐1 (Cytognos CYT-‐15F4)

CD16 ECD 3G8 (BC A 33098)

CD19 APC 13-‐119 (BC)

CD19 APC H7 SJ25C1 (BD)

CD19 APC J3119 (BC IM2470)

CD22 APC S5.2 (BD 341024)

CD33 APC P67.6 (BD )

CD33 PeCy5.5 D3HL60 251 (BC A70198)

CD34 PercP Cy5.5 8G12 (BD)

CD34 APC-‐A700 581 (BC A86354)

CD36 Fitc CLB -‐IVC7 (Sanquin)

CD38 APC AF 750

CD38 APC H7 HB7 (BD)

CD38 BV421 HIT2 (BD)

CD45 APC –A750 1.33 (BC)

CD45 KO 7.33 (BC )

CD45 PO H130 (Invitrogen)


CD45 RA ECD 2H4 (BC IM2711U)

CD56 ECD N901 (NKH-‐1) (BC A82943)

CD56 Fitc NCAM 16.2 (BD)

CD64 Pe 10.1 (Caltag CD6404)

CD96 Pe NK 92.39 (eBioscience)

CD99 Fitc DN16 (Serotec)

CD117 PeCy7 104D2D1 (BC)

CD123 APC AC145 (Miltenyi Biotec)

CD123 APC 7G3 (BD 560087)

CD133 APC AC133 (Miltenyi Biotec 130-‐090-‐826)

HLA-‐DR PB L243 (Biolegend)

HLA-‐DR KO Immu-‐357 (BC)

Irem2 APC UP-‐H2 (Immunostep IREM2A-‐T100)

NG2 Pe 7.1 ( BC IM3454U)


Document 3: Gating stratgy (INFINICYT software)

A. Default dotplots (X-axis versus Y-axis) (The purpose for each of the dotplots is given between brackets)

1. Default 2-dimensional plots for all tubes a. FSC versus SSC (viable cells) b. CD45 versus SSC (blast gate-‐ CD34+ precursors-‐CD117+/CD34-‐

precursors-‐ gating lymphocytes/ monocytes/ granulocytes) c. CD45 versus CD34 (CD34+ precursors) d. CD117 versus CD34 (normal expression pattern of CD34+

precursors and CD117+/-‐ cells) e. HLA-‐DR versus CD117 (normal expression pattern of CD34+

precursors and CD117+/CD34-‐ precursors) f. CD34 versus SSC (CD34+ precursors) g. CD117 versus SSC (CD117+ cells (including CD117+ precursors

and mastcells) 2. Default 2 dimensional plots for tube 1

(HLA-DR-CD45-CD56-CD13-CD34-CD117-CD33-CD11b) a. CD11b versus CD13 (LAIP blasts-‐ maturation pattern of

granulocytes/monocytes) b. CD13 versus CD33 ( LAIP blasts-‐ maturation pattern of

granulocytes) c. CD56 versus CD11b (LAIP blasts-‐granulocytes-‐ monocytes) d. HLA-‐DR versus CD33 (gating monocytes-‐ granulocytes)

3. Default 2-dimensional plots for tube 2 (HLA-DR-CD45-CD36-CD64-CD334-CD117-CD33-CD14)

a. CD36 versus CD64 (LAIP blasts-‐ maturation pattern of monocytes) b. CD36 versus CD14 (LAIP blasts-‐ maturation pattern of monocytes) c. HLA-‐DR versus CD14 (LAIP blasts-‐ maturation pattern of

monocytes) d. HLA-‐DR versus CD33 (gating monocytes-‐ granulocytes)

4. Default 2-dimensional plots for tube 3 (HLA-DR-CD45-CD15-NG2-CD34-CD117-CD2-CD19)

a. CD15 versus NG2 (LAIP blasts) b. CD15 versus CD2 (LAIP blasts) c. NG2 versus CD19 (LAIP blasts) d. HLA-‐DR versus CD19 (gating CD19+ B-‐cells)

5. Default 2-dimensional plots for tube 4 (HLA-DR- CD45-CD7-CD96-CD34-CD117-CD123-CD38)

a. CD123 versus CD7 (LAIP blasts-‐gating T/NK-‐cells)


b. CD38 versus CD96 (gating CD96+ /CD34+ precursors (CD38 bright positive / CD96 positive)-‐ leukemic stem cells)

c. CD96 versus CD7 (LAIP blasts) d. CD123 versus CD38 (LAIP blasts) e. HLA-‐DR versus CD123 (gating dendritic cells-‐basophils)

6. Default 2-dimensional plots for tube 5 (HLA-DR-CD45-CD99-CD11a-CD34-CD117-CD133-CD4)

a. CD4 versus CD11a (gating monocytes-‐ CD11a expression pattern of granulocytes-‐ monocytes)

b. CD99 versus CD11a (LAIP blasts) c. CD99 versus CD133 (LAIP blasts) d. CD99 versus CD4 (normal expression pattern ofCD99 with respect

to CD4+ T-‐cells-‐ reference))

B. Standard table of Populations

C. Gating procedures


1. Diagnostic sample

1.1. Gate the viable cells using light scatter features (FSC-‐SSC) 1.2. Gate the events in ’blastgate’ on the CD45 versus SSC dotplot: 3 possible

gates may be encountered 1.2.1. CD45 negative – low /intermediate SSC 1.2.2. CD45 positive – low / intermediate SSC 1.2.3. CD45 bright positive – low/intermediate SSC

1.3 Gate singlets of the leukemic blasts (FSC –SSC) (DIVA: Width -‐ Hight?) 1.4 Determine the expression of the backbone markers 1.5 Determine the expression of the tube-‐specific markers 1.6 Determine the leukemia-‐associated immunophenotypes (LAIP)

(description according to Bethesda criteria) 1.7 Determine the reference image of the leukemic blasts 1.8 Determine the gating strategy / dotplots for the detection of the leukemic

blasts by determining 1.8.1 the blastgate of interest 1.8.2 the progenitor cell marker (s) 1.8.3 the myeloid marker (s) 1.8.4 the leukemia-‐associated marker (s)

2. Follow- up sample 2.1. Determine residual leukemic cells following the gating strategy

identified at diagnosis 2.1.1. Gate the viable cells using light scatter features (FSC-‐SSC) 2.1.2. Gate the events in the ’ blastgate’ on CD45 versus SSC dotplot (see

infra for definition of blastgate in follow-‐up samples) 2.1.3. Gate on the positive progenitor marker (s) 2.1.4. Gate on the positive myeloid marker (s) 2.1.5. Gate on the clustered events on the FSC –SSC dotplot 2.1.6. Identify the LAIP and compare with reference image

2.2. Determine the distribution of the respective cell populations (of

viable cells) in the following order 2.2.1. CD34 positive myeloid precursors ( tubes 1,2, 3 and 5)

2.2.1.1. Gate the events in blastgate on the CD45 versus SSC dotplot using the quadrant bordering erythroblasts and mature lymphocytes respectively on the X-‐axis and mature granulocytes on the Y-‐axis

2.2.1.2. Gate the CD34+ events on the CD45 versus SSC dotplot

2.2.1.3. Gate the clustered events with low FSC and SSC


2.2.1.4. Inspect the normal pattern of expression of the CD33+/CD34+ precursors (gating on the CD33 positive events on the HLA-‐DR versus CD33 dotplot) for the specific markers in tube 1 and 2

2.2.1.5. Inspect the normal pattern of expression of the CD117+/CD34+ precursors for the specific markers in tube 3 and 5

2.2.2. CD34 positive’ myeloid’ precursors ( tube 4)

2.2.2.1. Gate on the CD123 bright positive + /HLA-‐DR + events on the HLA-‐DR versus CD123 dotplot and make invisible

2.2.2.2. Gate the events in blastgate on the CD45 versus SSC dotplot using the quadrant bordering erythroblasts and mature lymphocytes respectively on the X-‐axis and mature granulocytes on the Y-‐axis

2.2.2.3. Gate the CD34+ events on the CD45 versus SSC dotplot

2.2.2.4. Gate the clustered events with low FSC and SSC 2.2.2.5. Gate the CD38 bright positive /CD96 dim positive

events on the CD38 versus CD96 dotplot and make invisible

2.2.2.6. Gate the CD123 dim positive events on the CD38 versus HLA-‐DR dotplot which are the remaining myeloid precursors

2.2.3. CD34 positive lymphoid precursors

2.2.3.1. If tube 3 is not stained: Use the gating strategy as above but in the last step gate on the CD33 negative events on the HLA-‐DR versus CD33 dotplot in either tube 1 or 2

2.2.3.2. If tube 3 is stained: Gate the HLA-‐DR and CD19 positive cells on the HLA-‐DR versus CD19 dotplot

2.2.3.3. Gate the clustered events on the FSC and SSC dotplot

2.2.3.4. Gate the CD34+ events on the CD45 versus CD34 dotplot

2.2.4. CD117 positive / CD34 negative precursors (if of interest- of viable cells excluding the CD34+ precursor that are non-visible)

2.2.4.1. Gate the CD117+ events on the CD117 versus SSC dotplot (exclude the CD117 bright positive events)


2.2.4.2. Gate on the CD45 dim events on the CD45 versus SSC dotplot

2.2.4.3. Inspect the normal pattern of expression of the non-‐erytroid CD117 positive /CD34 negative population on the default dotplots for tubes 1, 2, and 3

2.2.5. Monocytes (all viable cells selected except CD34+ precursors that are non-visible)

2.2.5.1. Gate CD33 bright positive / HLA-‐DR positive events on the HLA-‐DR versus SSC dotplot for tubes 1 and 2

2.2.5.2. Verify whether the gated cells are localized in the mature monocyte gate on the CD45 versus SSC dotplot

2.2.6. Granulocytes (all viable cells selected except CD34 + precursorcells and monocytes)

2.2.6.1. Gate CD33 dim positive /HLA-‐DR negative events on the HLA-‐DR versus SSC dotplot for tubes 1 and 2

2.2.6.2. Verify whether the gates cells are localized in the granulocyte gate on the CD45 versus SSC dotplot

2.2.7. Lymphocytes 2.2.7.1. Gate the CD45 bright positive / low SCC events on

the CD45 versus SSC dotplot 2.2.7.2. Gate the clustered events on the FSC and SSC dotplot

2.2.8. Erytroblasts 2.2.8.1. Gate CD36 positive and CD64 negative events on the

CD36 versus CD64 dotplot 2.2.8.2. Gate on the CD45 negative /dim positive events and

low SSC events on the CD45 versus SSC dotplot 2.2.9. Dendritic cells

2.2.9.1. Gate the CD123 bright positive and HLA-‐DR positive events on the CD123 versus HLA-‐DR dotplot

2.2.9.2. Gate the clustered events on the FSC versus SSC dotplot


Document 4: List of reported immunophenotypic

aberrancies in AML (ref)

* Myeloid marker: CD117, CD13, CD33, CD14, CD15, CD64, CD65

* Progenitor marker: CD34, CD117 and CD133

* # lower specificity

1. CD45 negative blast region (erytroid cell region)

Discordant antigen expression

• CD34+ / and myeloid marker (other than erytroid markers)

• CD117+ / and myeloid marker (other than erytroid

markers)

• CD133+ / and myeloid marker (other than erytroid

markers) #

• Combinations of CD34, CD117, CD133 and myeloid marker

(other than erytroid markers)

Cross lineage antigen expression

• CD34+ / and CD7+ and / or myeloid marker




2. CD45 dim+ blast region

(note that this region comprises a basket of many cell populations

including CD34 myeloid (lineage negative), neutrophil, erytroid,


monocytic and dendritic cell progenitorcells, CD34+ and CD34-‐ B-‐

cell precursor cells, basophils, and dendritic cells, some NK-‐cells)


• CD34+ / HLA-‐DR-‐ and myeloid marker

• CD34+ / CD117-‐ /HLA-‐DR+ and myeloid marker

• CD34+ / CD117-‐ /HLA-‐DR-‐ and myeloid marker

• CD34+ /CD15+ and/ or other myeloid marker #

• CD34+ /CD14+ and /or other myeloid marker

• CD34+ / CD11b+ and / or myeloid marker

• CD34+ / CD13-‐ and other myeloid marker

• CD34+ / CD33-‐ and other myeloid marker

• CD117+/CD34-‐ / HLA-‐DR+ and/ or other myeloid marker

• CD117+/ HLA-‐DR-‐ and / or other myeloid marker #

• CD117+ /CD15+ and / or other myeloid marker #

• CD117+ /CD11b+ and /or other myeloid marker

• CD117+ /CD13-‐ and other myeloid marker

• CD117+ /CD33-‐ and other myeloid marker

• CD133+ /CD34-‐ and myeloid marker


• CD34+ /CD7+ and myeloid marker


• CD34+ / CD2+ and myeloid marker #


• CD34+ / CD56 (bright)+ and myeloid marker

• CD34+ /CD4+ and other myeloid marker (f.e CD15)





• CD117 + /CD56+ and myeloid marker

3. CD45 bright + blast region (monocytes and dendritic cells)


• CD34+ /CD14+ and/ other myeloid marker

• CD117+ /CD34-‐ /HLA-‐DR+ /CD33+

• HLA-‐DR-‐ /CD33+

• HLA-‐DR+ /CD13-‐ #

• HLA-‐DR+ /CD11b-‐ #

• HLA-‐DR+ /CD56+ /CD4+

• HLA-‐DR+ /NG2+

• CD33+/CD13-‐/CD15+

• CD33+ /CD15-‐ #

• CD33+ /CD15+ / CD11b-‐ #

• CD33+ /CD13 dim+


• Monocytic marker+ /CD19+

• Monocytic marker + /CD2+


Document 5: LSC gating

Document 6: Report forms (see attached pages)


Document 7: Bulk lysis of the sample using NH4CL

Before lysis, a WBC count is performed. The estimated amount

of cells to be sampled equals the number of antibody tubes

times 2 million cells.

The red blood cells are lysed by adding a working dilution of

NH4CL to the cell suspension. The volume of NH4Cl to be used

should exceed 15 times the volume of the cell suspension. The

sample is incubated during 15 minutes by gentle mixing, and

then centrifuged at 800g during 10 minutes. The cell pellet is

resuspended in 10 ml of PBS 0.1% followed by centrifugation

at 500 g during 5-‐10 minutes,. The cell pellet is finally

resuspended in x times of 50 µL of PBS 0.1%)


Document 8

Twinning laboratories (to be discussed/ coordinates need to be

completed)

Sweden: 5 centres?

1. Stockholm (Leonie Saft)

2. Uppsala (?)

3. Gøteborg (Linda and Stefan )

4. Lund (?)

5. Umeå (?)

Denmark : 1 centre

Copenhagen (Hanne Marquart)

Finland: 2 ? centres

Helsinki (Sanna Siitonen)

Turku (Tarja-‐Tertu Pelliniemi)

Kuopia (X)

Norway: 1 centre

Oslo: Anne Tierens

Hong Kong: 1 centre (Clarence Lam)

The Netherlands: 1 centre ( Den Haag, Valerie de Haas)

Belgium: 1 centre (Gent, Jan Philippé)


Document 5

List of laboratories

Appendix 5. Guidelines for PCR quantification. 2012-09-30

Analysis of mRNA transcripts for quantification of gene fusion transcripts Determination of MRD Variation in reagent choice, protocols and laboratory platforms will lead to slightly different values when monitoring Minimal Residual Disease (MRD) by the detection of fusion transcripts by real time quantitative polymerase chain reaction (qPCR). Therefore, the same laboratory should analyse both initial and follow-up samples from the same patient for an accurate determination of MRD. Sample collection Two samples with at least 5 ml of peripheral blood (PB) and/or 1 ml of bone marrow (BM) aspirate is recommended for MRD analysis. However, the analysis is based on the occurrence of nucleated cells rather than the volume. Therefore, a larger quantity may be needed if the leukocyte count is low in order to achieve adequate sensitivity. EDTA should be used as an anticoagulant. The samples are sent uncentrifuged to the laboratory. Since it is important to reduce degradation of mRNA transcripts before analysis, the sample should ideally reach the laboratory within 24 hours. Alternatively; PAX gene tubes (PreAnalytiX) which conserves the RNA at the sampling procedure may be used. Pre-purification Whole blood/bone marrow (buffy coat) or isolation of mononuclear cells (MNC) can be used for RNA purification. Erythrocytes need to be removed before extraction of RNA. Various techniques can be used to separate MNC, the most commonly used is separation with ficoll (Ficoll, Lymphoprep, Histopaque), a technique used by most molecular biology labs. Purification of RNA The buffy coat or isolated MNC should be lysed in RLT or RLT+ buffer (Qiagen), TRIzol (Invitrogen) or other equivalents and purification of RNA should be performed according to protocols corresponding to each lysis buffer. RNA from blood collected in PAX gene tubes is extracted using a specific protocol with reagents from PreAnalytix/Qiagen. In all cases, great care should be taken in order to avoid RNA degradation. Preparation of cDNA Following RNA extraction, complementary DNA (cDNA) is synthesised, preferably using random hexamer primers. This may a critical step and an optimized protocol should be used [2,4] qPCR assay For quantitative measurements, real-time quantitative PCR (qPCR) is used. For increased specificity, labelled hydrolysis probes, which are designed to hybridize to a region between the PCR-primers, is recommended. Alternatively, double strand DNA intercalating dyes, e.g. SYBR Green, could be used. According to the EAC-program, the following primer and probe sets have been recommended for detection of CBFb-MYH11 in cases with inv(16)(p13q22) or t(16;16)(p13;q22) and RUNX1-RUNX1T1 in cases with t(8;21)(q22;q22)[1, 2]:


CBFb-MYH11 ENF803 (forward primer) 5´- CATTAGCACAACAGGCCTTTGA -3´ ENPr843 (probe) 5´- Fam-TCGCGTGTCCTTCTCCGAGCCT-Tamra -3´ ENR862 (reverse primer A) 5´- AGGGCCCGCTTGGACTT -3´ ENR863 (reverse primer D) 5´- CCTCGTTAAGCATCCCTGTGA -3´ ENR865 (reverse primer E) 5´- CTCTTTCTCCAGCGTCTGCTTAT -3´ RUNX1-RUNX1T1 ENF701 (forward primer) 5´-CACCTACCACAGAGCCATCAAA -3´ ENP747 (probe) 5´-Fam-AACCTCGAAATCGTACTGAGAAGCACTCCA-Tamra -3´ ENR761 (reverse primer) 5´-ATCCACAGGTGAGTCTGGCATT -3´ For detection of MLL-MLLT3 (MLL-AF9) in cases with t(9;11)(p22;q23) the following primer and probe sets have been recommended [3]: MLL-MLLT3 MLL-F1 exon 8 (forward primer) 5´-CGCCTCAGCCACCTACTACAG-3´ MLL-F2 exon 9 (forward primer) 5´-AGGAGAATGCAGGCACTTTGA-3´ MLLT3-R1 exon 9 (reverse primer) 5´- TCACGATCGCTGCAGAATGT-3´ MLLT3-R2 exon 5 (reverse primer) 5´- TGGCAGGACTGGGTTGTTC-3´ MLLT3-R3 exon 4 (reverse primer) 5´- GCTGCTGCTGCTGGTATGAAT-3´ MLL-T1 (probe) 5´-Fam-CGCCAAGAAAAGAAGTTCCCAAAACCACT-Tamra-3´ MLL-T2 (probe) 5´-Fam-CATCCTCAGCACTCTCTCCAATGGCAATA-Tamra-3´ Specific protocols for the qPCR assay may vary depending on the platform used. In all cases, strict precautions should be undertaken in order to avoid contamination. Moreover, positive and negative controls should be included in all experiments. For quantification, standards which span the dynamic range of the assay should be used. To certify linearity of the assay, the correlation coefficient of a standard curve should be at least 0.98. In addition to the genes of interest, the samples should also be assayed for at least one internal reference gene. The transcript value obtained from these(is) gene is used to normalize the expression of fusion gene analyzed. As reference gene(s) c-abl oncogene 1 (ABL1) or glucuronidase beta (GUSB) are recommended. The following primers and probe have been recommended [4]: ABL1 ENF1003(forward primer) 5´-TGGAGATAACACTCTAAGCATAACTAAAGGT -3´ ENPr1043 (probe) 5´-Fam-CCATTTTTGGTTTGGGCTTCACACCATT-Tamra-3´ ENR1063 reverse primer) 5´- GATGTAGTTGCTTGGGACCCA-3´ GUSB ENF1102 (forward primer) 5´-GAAAATATGTGGTTGGAGAGCTCATT-3´ ENPr1142 (probe) 5´-Fam-CCAGCACTCTCGTCGGTGACTGTTCA-Tamra-3´ ENR1162 (reverse primer) 5´-CCGAGTGAAGATCCCCTTTTTA-3´ Calculations The obtained copy number of fusion transcripts are divided by the copy number of the internal reference gene. The resulting ratio is multiplied by 100 to be expressed as percentage. MRD is


calculated by dividing the present value with the value obtained at diagnosis and presented as the fraction of remaining transcripts. References 1. van Dongen, J.J., et al., Standardized RT-PCR analysis of fusion gene transcripts from

chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia, 1999. 13(12): p. 1901-28.

2. Gabert, J., et al., Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program. Leukemia, 2003. 17(12): p. 2318-57.

3. Jansen, M.W., V.H. van der Velden, and J.J. van Dongen, Efficient and easy detection of MLL-AF4, MLL-AF9 and MLL-ENL fusion gene transcripts by multiplex real-time quantitative RT-PCR in TaqMan and LightCycler. Leukemia, 2005. 19(11): p. 2016-8.

4. Beillard, E., et al., Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using 'real-time' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe against cancer program. Leukemia, 2003. 17(12): p. 2474-86.

Appendix 6. Instruction for CRF DNX study AML2012 2012-‐09-‐30

Instruction for Case Report Form DNX study

The CRF for the DNX study will have five main parts all of which will be reported online.

The toxicity reports after course one and two (see app 2) Bone marrow outcome data D22 BM after ECM/ECDx Cellularity (aplasia/hypoplasia/normal) BM blast count D22 MRD flow data as reported by the clinician and the laboratory MRD flow category (clinician) (<0.1/0.1-‐4.9/5-‐14.9/≥15%/no sensitive LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%

Compliance control and result of last BM prior to course 2 In patients with ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells on d22 (no sensitive LAIP) Was course 2 started immediately (within three days) yes/no If no give reason (patient severely ill/other) If other specify In patients with < 5% leukaemic cells (LAIP) or < 5% blast cells on d22(no sensitive LAIP) Was repeat BM done (yes/no) If no specify reason Result of the last BM prior to course 2 MRD flow category (clinician) (<0.1/0.1-‐4.9/5-‐14.9/≥15%/no LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5% All above should be registered no later than two weeks from start of course 2

Overall outcome measures • CR obtained (yes/no ; after which course ; date) • Event registration (resistant disease/relapse/early death/death in CR/SMN)

Events should be registered immediately. • Followup status. This should be updated after each course and subsequently at least twice

yearly until five years from diagnosis

Cardiac toxicity Clinical evaluation and UCG is performed at six time points (at diagnosis, before course 2, before course 3 and one, five and ten years from diagnosis). Results are documented as clinical signs of cardiac dysfunction and fractional shortening or ejection fraction.

Appendix 7. Instruction for CRF FLADx study AML2012 2012-‐09-‐30

Instruction for Case Report Form FLADx study The CRF for the FLADx study will have five main parts all of which will be reported online.

The toxicity report after course two (see app 2) Bone marrow outcome data In patients with <5% leukaemic cells (LAIP) or < 5% blast cells (no sensitive LAIP) after course 1 Result of the BM prior to consolidation or start of salvage therapy MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no LAIP)

MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5% In patients with ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells (no sensitive LAIP) after course 1. D22 BM after ADxE/FLADx Cellularity (aplasia/hypoplasia/normal) BM blast count (percent) D22 MRD flow data as reported by the clinician and the laboratory MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no sensitive LAIP) MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%

Compliance control in patients with ≥ 5% LC after course one and result of last BM prior to consolidation or salvage In patients who on d22 after course 2 have ≥5% leukaemic cells (LAIP) or ≥ 5% blast cells (no sensitive LAIP) Was salvage therapy given immediately (within three days) yes/no If no give reason (patient severely ill/severe aplasia discussed with PI/other) If other specify In patients who on d22 after course 2 have <5% leukaemic cells (LAIP) or < 5% blast cells (no sensitive LAIP) Was repeat BM done (yes/no) If no specify reason Result of the last BM prior to consolidation or start of salvage therapy MRD flow category (clinician) (<0.1/0.1-‐4.9/≥5%/no LAIP)

MRD flow (lab) LAIP description LAIP sensitivity (yes, sensitivity ≤ 0.1%/yes, sensitivity ≤ 5%/no) Fraction of leukaemic cells if LAIP sensitivity at least 5%

Appendix 7. Instruction for CRF FLADx study AML2012 2012-‐09-‐30

All above should be registered no later than two weeks from start of consolidation or salvage therapy.

Overall outcome measures • CR obtained (yes/no ; after which course ; date) • Event registration (resistant disease/relapse/early death/death in CR/SMN)

Events should be registered immediately. • Followup status. This should be updated after each course and subsequently at

least twice yearly until five years from diagnosis

Cardiac toxicity Clinical evaluation and UCG is performed at six time points (at diagnosis, before course 2, before course 3 and one, five and ten years from diagnosis). Results are documented as clinical signs of cardiac dysfunction and fractional shortening or ejection fraction.

Appendix 8 AML 2012 Biobank 2012-09-30

1

NOPHO BIOBANKING INSTRUCTIONS The LLC and NOPHO board decided 2006 to build a common biobank for future collaborative NOPHO-studies of childhood ALL and AML. The biobank is located in Uppsala, Sweden. The biobank consists of bone marrow and blood samples frozen as cell pellets and vital frozen cells from children with leukaemia. Samples should be collected: • At diagnosis (all patients) • At relapse(s) (all patients) Sampling Bone marrow: 2-5 ml in 2 heparinized tube containing 2 ml 0,9% NaCl Blood: 7 ml in 1 heparinized test tube, if LPK < 50 2 tubes Referral form is to be filled in and sent with the samples. For further details se “Referral form” and “Samples and Transport instructions”. Responsible persons: Britt-Marie Frost Postal address: Akademiska barnsjukhuset, SE-75185 Uppsala tel 0046 (0)18 611 00 00 (vx), alt 611 58 83 fax 0046 (0)18 50 09 49 [email protected] Josefine Palle Address, tel, fax: see above [email protected] Maria Lindström Uppsala Biobank, Klinisk patologi och cytologi Rudbecklaboratoriet C5 75185 Uppsala tel 0046 (0)18 6113746 [email protected] 20121004


2

Sampling and Transport instructions for NOPHO Biobanking

Sampling of all patients at diagnosis and relapse: Bone marrow: 2-5 ml in 2 heparinized test tube containing 2 ml 0.9 % saline Blood: 7 ml in 1 (if LPK<50 2 tubes) heparinized test tube Referral form is to be filled in and sent with the samples. Preliminary notification Preliminary notification that a sample is being sent must be made to the laboratory by:

Fax 0046(0)18553354 or E-mail [email protected] or Phone 0046(0)186113746 (always on fridays)

Transportation Transportation has to be arranged and paid by each unit. The sample must be kept at room temperature. Make sure that the sample is delivered to the lab in Uppsala on the following day, preferably before noon. For samples sent on Fridays, make the preliminary notification by telephone AND make sure that the courier will deliver it on Saturday, this might require special arrangements. Address Samples can be sent all days of the week

Klinisk kemi och farmakologi Ingång 61, provinlämningen, 2 trappor Akademiska Sjukhuset SE-751 85 Uppsala Sweden

121004


3

Referral form for NOPHO BIOBANKING

Send samples to: + Klinisk kemi och farmakologi Ingång 61, provinlämningen, 2 trappor Akademiska Sjukhuset SE - 751 85 Uppsala

Sweden Keep at room temperature.

The sample should reach the laboratory the next day. Address of sender (unit, hospital, phone no.) Name of patient and date of birth

Always notify when a sample is going to be sent to: Fax: 0046 (0)18 55 33 54 or E-mail: [email protected] or phone: 0046 (0) 18 611 37 46 (always telephone on Fridays ) From: Physician: .............................................. Date and time for sampling: .................................... White blood cells (WBC)109/l: ................................ Material for biobanking ¨ Bone marrow tubes…...... ¨ Blood tubes.................... INSTRUCTIONS Bone marrow: 2-5 ml in 2 heparinized tubes containing 2 ml 0.9 % saline Blood: 7 ml in heparinized tube, if LPK < 50 send 2 tubes Arrival date, time:........................ If problems: contact Britt-Marie Frost, Josefine Palle or Maria Lindström (operator) +46 (0)18 611 00 00. 121004

Appendix 9 Guidelines for Patient information 2012-‐09-‐30

Guidelines for patient information This appendix contains a template for information to guardians and a consent form. These documents need to be adapted to national requirements. In particular page 1 of the information to guardians is adapted to Swedish requirements. Both documents should be signed by the national coordinator of each country and no signature from the study chair is required.


Information to guardians

NOPHO-DBH AML 2012

Research study for treatment of children and adolescents with acute myeloid leukemia

We would like to ask if you accept that your child participates in a scientific research study. You can read about the purpose and how the study is performed on the next page. It is entirely voluntary to participate and even if you at one time have given consent you are at any time free to change your mind and withdraw the child from the study without having to specify any reason. This applies even if you have signed the written consent form.

If you accept participation it is required that the guardians (usually both parents) sign the written consent form.

This consent also means that you accept the collection of data regarding your child and the child’s disease as well as the result of laboratory analyses in a research database which we then use for evaluation of the study results. Blood and bone marrow samples that are taken within the study are kept in a biobank prior to analysis. You can at any time demand that these samples are disposed of. The information concerning your child is kept so that no unauthorized access can occur. All persons who in any way handle the data obey professional secrecy and only a restricted few people involved in the study have access to the database.

In Gothenburg, Sahlgrenska University Hospital, under regulation of the Privacy protection Law (SFS 1998;204), is responsible for handling of personal data. You can contact the Personal Data Compliance Officer at the hospital if you wish to have an extract over registered data and, if warranted, help with corrections.

The consent also signifies that you allow the Swedish Medical Product Agency, Regional ethics committee in Göteborg and the external monitor of the study to access your child’s medical records. These monitors are also under professional secrecy.

In case an injury should occur due to participation in the study your child is covered by The Patient Injury Act.

If You have additional questions please feel free to contact me or your treating physician.

With kind regards

National coordinator


NOPHO-DBH AML 2012

Research study for treatment of children and adolescents with acute myeloid leukemia

This study concerns children and adolescents with acute myeloid leukemia who are treated in The Netherlands, Belgium, Hong Kong, Estonia or the Nordic countries. The main purpose of the study is to investigate if the risk of relapse can be reduced by improving the first two courses of chemotherapy (see figure).

Background

Prognosis in acute myeloid leukemia in children has improved but still approximately 1/3 of the patients suffer from relapse. It has been shown that the number of leukemic cells (LC) that remain after the first two treatment courses is the most important factor to predict the risk of relapse. Today, for the majority of children, we have sensitive methods that allow us to detect very low numbers of LC and we use these to measure the number of LC in the bone marrow both after the first and second course. It is very important to detect a poor response to treatment since even these children have a good chance of cure if the treatment is intensified with stem cell transplantation (SCT).

Since the side effects of SCT are more severe than those of conventional therapy it is important to design the first two courses so that as many children as possible have a good treatment response.

AML 2012 is built on the collective world experience of research and treatment of AML. We know that the treatment is effective but now wish to investigate if we can improve both the first and second treatment course.

DaunoXome study course 1. Drugs from the so called anthracycline group are among the most effective in AML but have a downside that they at high cumulative doses can affect heart function. In AML 2012, mitoxantrone is used as the standard anthracycline in the first course. We now want to test if the drug DaunoXome has a better effect with less cardiac side effects. Both drugs have been used extensively in childhood AML with good results but no study has directly compared the two drugs and therefore we do not know if either of the drugs is better.

FLADx study course 2. AML 2012 uses a three-‐drug combination named ADxE as standard therapy in the second arm. Another three-‐drug combination, FLADx has been proven to be very effective in treatment of relapsed AML. Since relapses in general are more resistant to therapy we want to test if FLADx is more effective than ADxE in treatment of newly diagnosed AML. Both combinations are thoroughly tested in children and, although no direct comparative study has been performed, we have no reason to believe that either combination has the risk of more side effects.


How is the study performed?

Thus we want to investigate two major things. In the first course we test if DaunoXome is more effective than mitoxantrone and in the second course we test if FLADx is more effective than ADxE. In order to obtain reliable results neither doctor nor guardian or patient can choose which treatment to give. Instead a randomization procedure is used for both studies. Randomization means that a computer, uninfluenced by any person, randomly assigns each patient to which treatment to give. If you do not wish to participate in any of the two studies the standard treatment arm will be given with mitoxantrone in the first course and ADxE as second course.

The administration of the different treatment arms do not differ much. In the first course mitoxantrone is given as a 30 minute infusion on day 6-‐10 whereas DaunoXome is given as a one hour infusion on day 6, 8 and 10. The second course differs a bit more in that ADxE is eight days long whereas FLADx is six days. We do not expect that any of the treatment arms has more side effects either during or after treatment.

The effect of the treatment is evaluated by measuring the number of remaining LC in the bone marrow three weeks after start of the first course and immediately before starting the third treatment course. It is common and normal that additional bone marrow investigations need to be done particularly after the first course. These investigations need to be performed in all children, regardless if they are in the study or not, so that we can steer the treatment correctly. Therefore, participation in the study does not include any extra investigations. We would however wish to take an additional sample of 2 ml of bone marrow. This is used for research purposes to develop even more sensitive methods to measure the number of leukemic cells.

Are there any risks involved in the study?

Treatment for AML needs to be very intensive so all children are expected to have fairly severe side effects. Virtually all children have infections and many also injuries of the mucosal membranes after each of the two first courses. The drugs we are testing in both courses are all well studied in treatment of childhood AML. From these experiences we do not expect that children receiving DaunoXome in the first course or FLADx in the second will have more side effects. We will however document side effects carefully in order to determine if there is any difference between the treatment arms.

We also know that all the treatment alternatives are very effective. What we don’t know is if either of the arms are better and the aim of the study is to find this out.

Are there any advantages of participating in the study?

AML 2012 is a modern and effective treatment protocol for AML. We hope and believe that the protocol strategy will improve prognosis for all children regardless if they participate in the study or not. It may be that the study arms (DaunoXome in course 1 or FLADx in course 2) are even more effective and that children treated with these may benefit. However, I want to emphasize again that we do not know if any arm is more effective and it could be that the standard treatment is better. In all circumstances the study will answer important questions and lead to benefit for future patients with AML


The results of the study will be published in international scientific journals.

Finally I would once again want to point out that participation is voluntary. If you do not wish to participate your child will receive the standard arms of the protocol. If you have additional questions feel free to contact me or your treating physician.

City 2012-‐10-‐05

National coordinator


Overview of induction therapy

The first randomization is done at the latest on day 5 in the first course. It assigns the patients to either receive mitoxantrone (standard arm – MEC) or DaunoXome (study arm –DxEC) from day 6 in the first course. The second randomization is performed as soon as the results from the day 22 bone marrow are at hand. It assigns patients to either receive the three-‐drug combination ADxE (standard arm) or the three-‐drug combination FLADx (study arm)


Course 1

Overview of the two treatment arms in the first randomization (DaunoXome study)


Course 2

Overview of the two treatment arms in the second randomization (FLADx study)


Declaration of consent for participation in the study NOPHO-‐DBH AML 2012. A research study for treatment of children and adolescents with

acute myeloid leukemia Name of child: ________________ Date of birth:___________ I hereby declare that I, having received both oral and written information, agree to participate or let my child participate in all or parts of the study NOPHO-‐DBH AML 2012 as signed in the three boxes below. I accept that information regarding my/my child’s disease and treatment is registered in the research database and that the competent authority of ..... and an external monitor can take part of my / my child’s medical records. I also accept that some blood and/or bone marrow samples are collected in a biobank. I have received information that I at any time can request that these samples are disposed of. I am also aware that it is entirely voluntary to participate in the study and that I at any time can withdraw from future participation in the study. I hereby give my consent to participating in the randomization for course 1 (DaunoXome study) Date: _______ Signature: __________________

The child Date: _______ Signature ___________________ Date:______ Signature:____________

Guardian Guardian Date: _______ Signature ___________________

Physician I hereby give my consent to participating in the randomization for course 2 (FLADx study) Date: _______ Signature: __________________



Physician I hereby give my consent to, at the time of bone marrow punctures necessary for treatment, the collection of a small extra amount of bone marrow for research on characterization and identification of leukemic cells Date: _______ Signature: __________________



Physician

appendix(list(nopho0dbh(aml(2012(vs(2.0(2012009030 ... ·...

Documents