answer practice questions
TRANSCRIPT
8/3/2019 Answer Practice Questions
http://slidepdf.com/reader/full/answer-practice-questions 1/3
8/3/2019 Answer Practice Questions
http://slidepdf.com/reader/full/answer-practice-questions 2/3
True-False-Explain (4 pts. each):
Indicate if each statement below is true or false. Give a brief (one sentence) explanation of why you chose that
answer.
6. ____F____ Different cells within a single individual have different DNA content. This difference in DNA
content generates differences in cell structure and function.
Same DNA content, but differences in gene expression.
7. ____F____ The first three nucleotides on an mRNA molecule are AUG, resulting in this tri-nucleotide being
called the “start” codon.
The first three TRANSLATED nucleotides are AUG, but there is a significant amount of nucleic acid 5’
of the AUG translational start codon. These 5’ sequences are important for ribosome binding, RNA
stability, etc.
Questions and Problems
8. You have been working for years to identify the gene that encodes a particular short polypeptide thatfunctions to inhibit kinase proteins in certain cells. Using recombinant DNA techniques, you finally isolate a
region of DNA that you believe encodes this polypeptide. The nucleotide sequence of the region of double-
stranded DNA that encodes your polypeptide is provided below. Using this DNA sequence, the accompanying
chart indicating the codon encoding each amino acid, and your knowledge of transcription and translation,
answer the following questions:
3’- CCTATACTCCCGCTATGGGGGATCTTAACAAATCATAC -5’ Template DNA Strand
5’- GGATATGAGGGCGATACCCCCTAGAATTGTTTAGTATG -3’ Non-template Strand
_ - _____________________________________________________ - _ mRNA
a. (4 pts.) In the space provided, indicate the sequence and orientation of the mRNA transcribed from this
DNA. (Assume that this entire region of DNA is transcribed.)
5’ – GGAUAUGAGGGCGAUACCCCCUAGAAUUGUUUAGUAUG 3’
b. (2 pts.) Find the open reading frame (ORF) within the sequence above. How many amino acids long is the
polypeptide chain encoded by the ORF present within this sequence? Nine
c. (4 pts.) What is the amino acid sequence encoded by this ORF?
N-Met-Arg-Ala-Ile-Pro-Pro-Arg-Ile-Val-C
2
8/3/2019 Answer Practice Questions
http://slidepdf.com/reader/full/answer-practice-questions 3/3
d. (2 pts.) Indicate the nucleotide sequence of the anticodon that recognizes the third codon of your open reading
frame, clearly showing which are the 5’ and 3’ ends of the anticodon sequence. 3’ – CGC – 5’
9. (9 pts.) Indicate what effect each of the following alterations or mutations would have on translation of a
particular protein. Would translation be eliminated, reduced, unchanged, or increased? Indicate the reason(s)
you provided this answer.
Alteration Effect on translation Reason(s)
a. Creating Nonsense mutation No functional protein pre-matured termination
b. Removal of poly A tail. Reduced translation mRNA is less stable (susceptible to
degradation by exonuclease)
c. Deletion of Shine-Dalgarno No translation this sequence helps recruit the ribosome to the
sequence mRNA to initiate protein synthesis
10. (8 pts.) You have been working on developing a drug that acts as an antifungal agent. You identify a
particularly potent compound that prevents fungi from producing many of their normal proteins. Furtheranalysis of this compound, however, shows that it does not directly inhibit protein translation. Interestingly,
additional testing shows that the compound binds RNA, but not DNA.
Propose a mechanism by which this compound reduces the production of some proteins.
Provide specific mechanism for interfering with some aspect of RNA metabolism.
3