analysis of hair using microscopic and molecular techniques to ascertain personal identification
TRANSCRIPT
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
1/27
ANALYSIS OF HAIR USING MICROSCOPIC AND
MOLECULAR TECHNIQUES TO ASCERTAIN PERSONAL
IDENTIFICATIONMITOCHONDRIAL DNA ANALYSIS
PROPOSAL
Submitted By
Karki Bijay Kumar ,Shrestha Rojina, Shrivastav Ravi Kumar,
Tiwari Pranita, DasPrasuna Lal
SUBMITTED TO
K.P. SINGH
CO-ORDINATOR
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
2/27
ANALYSIS OF HAIR USING MICROSCOPIC AND MOLECULAR TECHNIQUES TO
ASCERTAIN PERSONAL IDENTIFICATION
Hair is an appendage of the skin that grows out of an organ known as the hair follicle. The root is the
portion that lies in the follicle, and the portion above the skin surface is the shaft. The base of the root is
called the bulb. Hair is composed of a group of proteins (keratins) that interconnect to form stable fibrils.
Keratin protein chains are very complex both histologically and chemically due to the multiplicity of the
cross-linked protein molecules. One of the more important linkages between adjacent keratin chains is the
disulfide bond (-S-S-) that makes the keratin extremely resistant to biological and chemical degradation.
It is through breaking and reforming of the disulfide bonds that hair can be reshaped through a permanent.
Also, toxins, expelled from the body, can be found in the hair.
A hair shaft consists of a translucent outer layer called the cuticle. It consists of overlapping,
nonnucleated, pigment free cells that form scales. These scales are composed of specialized cells that
have hardened (keratinized). The free ends of the scales point away from the root toward the distal end of
the hair shaft. The cuticle structure is different for each type of hair from different animals. The distal
margins for human hair normally do not protrude, leaving the outer margin flat. Animal hair, such as cat
or rabbit is highly serrated and interlocking.
Hair cuticle can be damaged leaving cracked, ragged, or flattened outer or inner cuticular margins. The
cortex is composed of elongated, fusiform, keratinized filaments aligned parallel to the length of the hair.
Variable amounts of air spaces called cortical fusi are interspersed among the cortex. Initially, the fusi are
filled with fluid, but later become filled with air as the hair dries out. Hair color, although influenced by
cortical fusi, the medulla, and cuticular surface is primarily due to the amount of pigment in the cortex.
The coloring is due to pigment granules (melanin) interspersed throughout the cortex. Microscopically,
hairs show only black, brown, and yellow pigment granules. True blond and red hair color pigments are
called phaeomelanin. The size and shape of the pigment granules, as well as their density and distribution
along the shaft, will differ from individual to individual.
Hairs exhibit a cellular column running through the center of the cortex called the medulla. The presence
of this feature varies from individual to individual and between hairs of a given individual. In humans, the
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
3/27
medulla appears dark under transmitted light because it is filled with air. If filled with fluid, the medulla
may take on a yellowish color. If not visible under normal microscopic examination, the medulla may be
more easily observed between crossed polar of a polarizing microscope.
The medulla patterns of animals may be broad, occupying more than half of the shaft diameter.
Human head hair medulla patterns may be classified as absent, fragmental, interrupted, or continuous.
Hair identification consists of determining the species, racial origin, and body or somatic location.
Species origin can readily be distinguished from the cuticle and medulla characteristics. Three racial
groups are used in forensic investigations: Caucasoid, Mongoloid, and Negroid.
Race Includes Diameter Cross Section Pigmentation Cuticle Undulation
Race Includes Diameter Cross
Section
Pigmentation Cuticle Undulation
negroid Black 60-90 um Flat Dense &
clumped
- prevalent
caucasoid Americal, europian,
Mexican &middle
eastern
70-100 oval Evenly
distributed
medium uncommon
mongoloid Orientals and
American, Indian
90-120 round Dense aubum thick never
Table . Racial characteristics of hair. Reference: Bisbing, Richard E., in Saferstein, Editor,
Forensic Science Handbook, Vol. 1, 2nd Ed., Prentice Hall, 2002.
Before a comparison of hair can be made, it must be determined which portion of the body the
hair originated from.
Area of Body Characteristics
Scalp
Head hair; 100-1000 mm long, 25-125 m diameter; 0.4 mm/day growth; small
root; tapered tip, little diameter variation; various medullation; often with
cut tips; may be artificially treated.
Pubic: Pudential; 10-60 mm long; coarse diameter and prominent diameter
variation and buckling; broad medulla; follicular tags common;
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
4/27
asymmetrical cross section twisted and constricted; may be straight,
curved, or spirally tufted.
Vulvar Secondary public hair; finer and shorter than pubic hair; may be abraded.
Chest Pectoral; moderate to considerable diameter variation; long fine archlike tip;
usually longer than public hair.
Beard Facial hair, very coarse; 50-300 mm long; large root irregular structure;
often triangular cross section; complex medullation; blunted or razor-cut
tip; grows 0.40 mm/day.
Axillary: Arm pit; 10-50 mm long; grows 0.30 mm/day; coarse, blunt tip, abraded
or frayed; usually straighter than pubic hair; many cortical fusi;
sometimes yellowed and bleached.
Eyebrow Superciliary; 1 cm long; 0.16 mm/day growth; curved; relatively coarse for length;
smooth curve with punctuate tip and large medulla
Eyelash Ciliary; less than 1 cm long; short curved pointed hair.
Limb Leg and arm hair; 3-6 mm long; fine tip irregularly medullated; often indistinctly and
slightly pigmented.
Ear Tragi, pinnae; downy.
Buttocks Anal hair; short blunted and abraded hair.
Nose: Similar to facial hair (beard)
Hair can be important physical evidence at a crime scene. Hair normally falls from the body over the
course of a day. It will stick to a number of materials, especially fabric and clothing. Hair is not easily
destroyed, even with exposure to moisture and decomposition of accompanying tissue.
There are three types of hair usually seen in animals:
Vibrissa. These are the whiskers of many animals. They are normally tactile and sensitive, such as
the whiskers on a cat.
Bristle. This is the coarse bristle that provides an animal with a protective coat. These guard hairs
can readily be identified by their distinctive appearance and morphology between various
animal families.
Wool. Wool or fur provides insulation from wet and cold. These fine hairs cover the bodies of
all mammals.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
5/27
Head and body hair of humans is classified as intermediate hair combining the characteristics of bristle
and wool hairs. Four types of hair appear on the bodies of humans:
Primordial hairs appear as early as the 3rd month of gestation, growing on the upper lip, the
eyebrows, the palms and soles of the fetus. They gradually disappear and are
replaced by softer lanugo hair over the entire body.
Lanugo hairs are normally shed after the 6th month of gestation. They are fine, soft,
unmedullated, and normally unpigmented hairs. The surface of lanugo hair is
smoot with almost indiscriminate scales. It is replaced by vellus and terminal
hairs. Lanugo hair is often observed on an aborted fetus and can be useful in
investigation of possible infanticide.
Vellus hairs are the fine, soft, unmedullated hairs spread uniformly over the the body surface.
They rarely are more than 2 cm in length.
Terminal hair is found on the scalp, eyebrows, eyelashes, and, to a lesser extent, the limbs of
both sexes. Puberty is accompanies by pubic and axillary hair growth such as hair
of the face, chest, back, arms, and legs. The various terminal hair types can be
distinguished by density and morphology.
Forensic significance of hair
Frequently found at crime scene (average human loses approximately 100 head hairs
daily. The falling rate, if the person is under emotional stress, such as in rape/murderattempts, increases )
Relatively chemically and biologically stable : Disulfide cross linking bond between
adjacent keratin chains makes hair to extremely resistant to biological & chemical
degradation for a pretty long period which makes it an extremely helpful tool in medico
legal practice.
No. of alternative are accessible for analysis
Physical examination : Species identification (e.g. from dry meat, scat etc)
Chemical examination : Elemental, drug etc.
Genetically examination: Individualization of organisms. (from nuclear& mt DNA)
It is relatively unnoticeable to the untrained eye; a criminal is not likely to make a specialeffort to destroy hair evidence.
Some other medico-legal importance of hair
Crime cases: Connection between a weapon or even accused and victim.
Identification of motor vehicle responsible for injuries.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
6/27
Rape and Sodomy: Pubic hair of accused may be found on victim or vice versa.
Bestiality: Animal hair may be found on accused underclothing or pubic hair found the
genitals of animals.
Nature of weapon used may confirmed (Types of injury).
Singening of hair indicates burns or close range of firearm injury.
Time of death can be ascertained.
Sex can be determined.
Identification of source of origin and individual identification.
ANIMAL VS HUMAN HAIR
FEATURES HUMAN HAIR ANIMAL HAIR
General Usually delicate CoarseColor Relatively consistent along shaft Profound color changes & bending
Cortex Usually 4 times thicker than medulla Usually less than width of medulla
Distribution Slightly more towards cuticle Central, denser towards medulla of
pigment
Medulla Vary narrow , may be continuous, always present, broader, often
Discontinuous, fragmented or absent varying in appearance
Scales Imbricate, similar along shaft Often showing variation in
structure along shaft from root to tip
Age from hair
The age of an individual cannot be determined definitively by a microscopic examination. Roots
of hair from children will dissolve rapidly in a solution of caustic potash but in older people
roots will resist the treatment
At birth, scalp hair is about 4-5 cm in length.
Pubic hair appears by 13/14th years in girls and 14/15th years in boys.
Axillary hair appears by 14/15th years in girls and 15/16th years in boys.
Facial hair appears in boys between 16 and 18th (first moustache followed by beards).
Scalp hair starts graying by 40 years, pubic above 50 yrs and body hairs above 60 yrs.As individuals age, hair can undergo pigment loss and changes in the configuration of the hair
shaft to become much finer and more variable in diameter.
age Diameter (MM)
12 days 0.024
6 months 0.036
15 yrs 0.053
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
7/27
adults 0.07
Sex from the hair
The sex of an individual is difficult to determine from physical examination of hair.
Microscopically, Barr bodies are comparatively more common in the female cells of the hairbulb. Definitive determination of sex can be accomplished through the staining of sex
chromatin in the cells found in the follicular tissue, but nuclear DNA test will provide more
specific information regarding the possible origin of the hair.
Mitochondrial DNA
Mitochondria are cellular organelles responsible for oxidative phosphorylation (energy
production) and are unique in that they have their own genome existing separate and outside the
nucleus of the cell. The circular genome, comprised of approximately 16,569 base pairs, ispolymorphic and inherited maternally. Mitochondria are abundant within the cytoplasm of cells
with an average of 500 mitochondria per cell with an average of 5 copies of mitochondrial DNA
(mtDNA) per mitochondrion. This is nearly 1200 copies of mtDNA for each copy of nuclearDNA found within a cell. Mitochondria are inherited maternally, meaning all maternal relatives
have the same mtDNA (mother, sister, aunt, grandmother, etc.). It has a heavy (H) strand base
paired to a light (L) strand, defined by the predominance of heavy versus light basecompositions. The coding region of the genome contains 37 genes involved in cellular oxidative
phosphorylation with very few non-coding bases in between the genes. Replication of the
mitochondrial genome originates in the Displacement Loop (D-loop), where the primary source
of polymorphism is found. This non-coding region of the DNA consists of approximately 1,122
base pairs and is referred to as the Control Region. The mutation rate observed in mtDNA isapproximately 10 times that of nuclear DNA which gives rise to the distinguishing
polymorphisms. Because of its circular nature and its relative abundance over nuclear DNA,mitochondrial DNA analysis is helpful in special circumstances for forensic comparison.
Mitochondrial DNA analysis of hair, bone and teeth is particularly successful in part due to the
encapsulation of DNA by the exterior of the tissue and protection of mtDNA within layers ofkeratin (hair) and hydroxyapatite (bone and teeth). However, mtDNA is susceptible to the same
type of environmental degradation as nuclear DNA. Fragmentation and degradation of the DNA
can complicate analysis. Additional complications include contamination by laboratory or
environmental sources of DNA not associated with the tissue being analyzed. For this reason,contamination prevention in the laboratory is maximized. Sample segregation is observed at the
outset of evidence analysis in the laboratory. Evidence samples are examined in a separatelaboratory from reference samples. Individual items of evidence are handled separately fromeach other with careful attention to cleaning the work area and implements between eachitem/sample. (6)
Mitochondrial DNA analysis relies upon a strategy of polymerase chain reaction (PCR)
amplifications that focus on the Control Region or smaller regions of interest within the ControlRegion. Primarily these regions of interest have been described as hyper variable region I (HVI),
hyper variable region II (HVII), and hyper variable region III (HVIII) which contain a large
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
8/27
majority of the polymorphisms.(7) A primer set strategy of PCR amplification isolates the
control region with overlapping regions by creating specific amplicons that can be sequenced.The sequencing reactions are carried out in both the forward and reverse (5 to 3 with respect tothe light strand) directions creating redundant DNA sequence data. This sequence data is then
compared to the Revised Cambridge Reference Sequence (rCRS) to produce a summary of the
polymorphisms or differences in sequence from the reference. The cumulative information fromthese sequences is the mitochondrial haplotype (mitotype) for the sample. The DepartmentsmtDNA Section amplification and sequencing strategy is depicted in figure shown below.
Known samples or evidence samples in which high quality DNA would be expected to beobtained can be processed with control region amplifications. Evidence samples in which
degraded or low concentration of DNA is expected to be obtained can be processed with primer
set amplifications.
342bp control region 268bp
HV1 HV2
16024 16569/1 576
Control region primers
F15971 R599
Primer sets 1-4
F15989 PS1 F15 PS3
R16251 R285
F16190 PS2 F155 PS4
R16410 R389
Fig: Primer set strategy(8)
Nuclear DNA vs. Mitochondrial DNA
Nuclear DNA Mitochondrial DNA
Found in nucleus of the cell Found in the mitochondria of the cell2 sets of 23 chromosomes Each mitochondria may have several copies of
the single mtDNA molecule
Used with evidence such as saliva,
semen,blood
Used with evidence such as hair bones, and
teeth
Maternal and paternal Maternal only
Can discriminate between individual of the
same
Cannot discriminate between individuals of the
same maternal lineag
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
9/27
Double helix Circular
Bounded by nuclear envelope Free of a nuclear envelope
DNA packed into chromatin DNA is not packed into chromatin
OBJECTIVES:
Primary objectives:
1. To ascertain whether a transfer may have occurred by comparison of the morphological
characteristics of questioned hairs to know hair samples.
2. Analysis of hair samples using microscopic and molecular methods to ascertain claim of
individuals.
Secondary objectives:
1. To study the correlation of microscopic and mitochondrial hair comparision.
2. To establish the main advantage and disadvantage of using hair as evidence.
3. To highlight the importance of hair in documenting exposure to drug and substance abuse.
Hair AnalysisMaterials & Methods: ( For comparison microscopy)
Hair samples (human and animal hair)
Microscope, 100x to 400x
Microscope slides
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
10/27
Clear nail polish
Forceps
Optional: Glycerin
Optional: cover slip
Safety Precautions
The vapors from the clear nail polish are toxic. Work in a well ventilated space and keep all containers
closed when not in use.
If any clear nail polish gets on your skin, let it dry and remove it with a small amount of acetone (nail
polish remover).
Procedure
Microscopic Hair Comparison ProtocolsThe material is first examined to determinewhether or not it is a hair. If the material is identified
as a hair,a taxonomic characterization is attempted. Distinguishing characteristicsof human and
animal hairs have been known for centuries.Theearliest known forensic report on animal hairs
was made in 1837 and the fundamental method is still employed by mammologists, anthropologists, and forensic scientists. For animal hairs, usually the genus can be specified and
somehairs allow for a finer taxonomic distinction.If the hair is human in origin, then body area,
race, and suitabilityare assessed. The main body areas where hair appears are the head (scalp,eyes, and face), the pubic region, the auxiliary (underarm) regions, the chest, and the limbs.
Hairs that reside in areas betweenthese main regions may have some combination of the traitsof
more than one area and are termed transitional hairs.Race (or major population group) of the
donor of the hair is consideredbased on hair form, hair cross-section, pigmentation patterns,andoverall appearance. Three main categories are usedfor racial estimation: Caucasian, Negroidand
Mongoloid. If a mixture of racial characteristics is such that no one population group s
characteristics predominate, the hair may be termed mixed racial or unclassifiable forpopulation origin.The suitability of the hair for full microscopic comparison isthen determined.
If the hair is determined to be not suitable, then no further microscopic examination is
performed. Hairs may not be suitable due to size, incompleteness, a lack of definablecharacteristics,or damage.
If the hair is determined to be suitable for microscopic analysis, then it is compared against
appropriate known hair samples. Head hairs and pubic hairs are typically suitable for
comparison, but other hairs may also contain sufficient information for a full microscopiccomparison. The main human hair characteristics are: race type, body area, color, length, tip,
root, diameter, cuticle, scales, pigment, medulla, cortex, artificial treatment, damage, and specialcharacteristics. The results of a microscopic examination generally fall into three categories.
First, the questioned hair can be determined to exhibit the same microscopic characteristics as
the known hair samples. Given this result, the questioned hair cannot be excluded and could have
originated from the person who supplied the known reference hairs. Second, the questioned hairmay exhibit similarities to the known hair samples, but unexplainable differences also are
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
11/27
observed. In this instance, no conclusion can be drawn about the origin of the hair. Finally, the
questioned hair can be determined to be dissimilar to the known hairs and therefore could not beassociated with the person who supplied the known reference sample. Hair characteristics are
considered to be polygenic and continuously variable in their expression. If we consider a known
sample to exist as an attenuated range of all possible characteristics, it becomes apparent that two
known samples could coincide sufficiently for a single hair to exhibit the characteristics of morethan one hair in the known samples. This is, however, rare. Microscopic comparison of hairs has
never been considered a positive form of identification and, likewise, mtDNA does not lead to a
unique identification of the donor. The additional value of microscopy is that a large number ofquestioned hairs collected from the evidence can be examined quickly by microscopy and
assessed, which minimizes the time and cost of mtDNA analyses. Many times features and traces
of material on the hairs, unrelated to the issue of identity, can be rapidly ascertained from amicroscopic examination, such as forceful removal, possible blood on the hairs, burning,
crushing, glass cuts, etc. In this way, the investigation can be furthered and valuable probative
information that could not be gleaned from the sequence of the mtDNA is observed and
preserved.
General procedures in microscopy;
Hair is best examined using a microscope at 200 to 800x. (Oil immersion, 1000x, is not recommended.)
At higher magnifications, the depth of field of viewing is reduced. To examine a sample of hair, a small
amount of clear nail polish is placed on a microscope slide and allow it to partially dry. The hair is laid
on the damp nail polish. This will make a quick mount for microscopic analysis. The nail polish is
allowed to dry before viewing the hair sample. The microscope is adjusted to 100 xs to locate the hair for
viewing. Once the hair is centered in the view of the objective and focused, the magnification is increased
to 200x, 300x, 400x, or 800x.
If a hair has simply fallen out from a follicle, the root of the hair should be visible at one end and may
taper to almost a point at the other end. If the hair has been cut, then the end where it was cut will show a
flat or blunt end. If the hair has been pulled out, as in a struggle, then some of the follicle should be
attached to the root. Collect hairs of different colors from individuals in the room and compare them.
To view the cuticle structure of a hair, place a small amount of clear nail polish on a microscope slide and
allow it to partially dry. Lay the hair on the damp nail polish. (The hair should not sink into the nail
polish. If it does, the polish is still too wet. Allow the polish to dry some more, then try another hair
sample.) Allow the polish to just barely dry (It may still have a tacky surface), then carefully lift the hair
off of the dried polish.
An impression of the hair remains in the polish. Adjust the microscope to 100x to locate the hair
impression for viewing. Once the impression is centered in the view of the objective and focused, increase
the magnification to 300 xs or 400x. Adjust the fine focus up and down slightly to best view the
impression of the cuticle surface of the hair.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
12/27
The impression is best viewed by reducing the illumination on the slide to produce what is known as a
dark field, creating shadows of the hair impression.
The human hair is compared with dog hair, cat hair, and hair from any other pet or animal which may be
available.
For each hair used, the color and structure is noted. Draw a sketch of the different hairs you examined,
showing the hair structure, medulla, and the cuticle structure.
Mitochondrial DNA
Sequence analysis of human mitochondrial DNA (mtDNA) extracted from a single hair shaft (1
to 2 cm in length) is a valid and reliable method. The mtDNA comprises less than 1% of total
cellular DNA, but, in contrast to nuclear DNA, exists in high copy number in each cell. Thus,successful results from hair are more likely with mtDNA analysis than when employing other
DNA typing strategies. The non-coding control region, approximately 1100 base pairs in length,
contains two hypervariable regions, HVI and HVII. The hypervariable regions can be readily
sequenced such that a high degree of information can be obtained for discriminating betweenmaternally unrelated individuals. Maternally related individuals will share the same mtDNA type
and generally cannot be differentiated using mtDNA alone. Also, some mtDNA sequences are
more common than others. Therefore, mtDNA also is not considered a unique identifier.
Procedure;
Hair Characteristics and Other Determinations
Human or Other Animal Origin
Human hair can be distinguished from other animal hair by examining features, such as scale
pattern, medulla, root, color, hair length, and shaft configurations.
10.2. Somatic Origin
Somatic origin types may include scalp, pubic, facial, limb and body, and eyebrow and eyelash
hairs. Somatic origin of human hair can usually be established by considering features, such as
length, cross-sectional shape, shaft configuration, medullary configuration, texture, taper, and
appearance of the root.
Racial origin:Features, such color, shaft configuration, cross sectional shape, pigment distribution, hair
diameter, and cuticle can be used to classify hair as having characteristics typical of particular
racial groups, such as Caucasoid, Negroid, and Mongoloid. The examiner should be alert to the
possibility of mixed racial characteristics and typical features. Opinions about the racial origin of
a hair should be formulated with caution
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
13/27
10.5. References
Bisbing, R. E. Human hair in a forensic perspective. In: Proceedings of the International
Symposium on Forensic Hair Comparisons. Federal Bureau of Investigation, U.S. Government
Printing Office, Washington, DC, 1985, pp. 35-44.
Hicks, J. W. Human hairs: Introduction. In: Microscopy of Hairs: A Practical Guide and Manual.
Federal Bureau of Investigation, U.S. Government Printing Office, Washington, DC, 1977, pp. 6-
24.
Ogle, R. R. and Fox, M. J. Atlas of Human Hair. CRC, Boca Raton, Florida, 1999, pp. 11-53.
Robertson, J. Forensic and microscopic examination of human hair. In: Forensic Examination of
Hair. Taylor and Francis, London, 1999, pp. 79-154.
11.1. DNA Profiling of Hairs
Almost every cell type in the human body is nucleated. Chromosomes are contained in the
nucleus. Nuclear DNA (nDNA) is the major component of these chromosomes. In contrast,
mitochondrial DNA (mtDNA) is located in mitochondria, which are found in the cytoplasmic
portion of all cells. Numerous mitochondria are present in each of these cells; therefore, there
are many more copies of mitochondrial DNA in each cell. Although nuclear DNA is inherited
from both parents, mitochondrial DNA is inherited solely from the mother. When appropriate, the
analysis of nuclear DNA is the recommended approach because of its potentially greater
discrimination power.
Human hairs are amenable to nuclear DNA and mitochondrial DNA analyses. DNA analysis
should always be considered in those cases when the source of a hair is crucial to an
investigation. The condition and microscopical assessment of the hair will determine which type
of DNA analysis should be employed.
Hair roots that are in the active growing phase (anagen) contain an abundance of nucleatedcells in the root and in the surrounding sheath material. Shed hairs from telogen follicles are the
most commonly encountered in casework. Telogen hairs without follicular tissue may not be
amenable to nuclear DNA analysis because of the lack of nucleated cells. These hairs may
contain sufficient mitochondrial DNA in their roots and hair shafts for analysis.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
14/27
DNA analyses are destructive techniques and consume portions of the hair. A full and detailed
microscopical comparison with possible known sources of hair should be done prior to DNA
analysis because it cannot always be done afterwards. Microscopy and DNA analysis are often
complementary. In some instances, the microscopical hair comparison may be inconclusive
because the hair is fragmentary or the known hair sample was collected years after the
questioned hair. These hairs can still be analyzed for DNA. Hairs that are excluded as having
come from a person by a microscopical examination may not require DNA analysis.
In cases when useable DNA was not extracted from a hair, comparison microscopy may have
provided an association of the questioned hair to the known hairs. Therefore, microscopical hair
comparisons should be performed prior to DNA analysis. In addition, there will be instances
when mitochondrial DNA may not provide adequate discrimination among people. People of the
same maternal line of descent may not have different mitochondrial DNA types. In these cases,
a microscopical examination might provide sufficient discrimination of their hair to associate a
questioned hair to a particular person in that family group. A combination of mitochondrial DNA
and comparison microscopy will often help to exclude or provide a stronger association than the
use of either technique alone.
Preparing Hair Evidence for DNA Analysis
The hair examiner may need to isolate and prepare the hair for DNA analysis. The hair should
be prepared and transferred in such a way as to minimize contamination and degradation. If the
hair is Unmounted, place the appropriate portion of the hair in a clean container.
Mounted in a temporary mounting medium, remove the hair from the medium. Clean with an
appropriate solvent, dry, and place the appropriate portion of the hair in a clean container.
Mounted in a semipermanent mounting medium, soak the slide in a solvent that dissolves the
mountant until the coverslip can be removed. The coverslip can also be removed by rapid
chilling (e.g., liquid nitrogen, dry ice). Remove the hair and rinse off remaining mountant with
solvent. Place the appropriate portion of the hair in a clean container.Reinspect the hair slide and container to ensure that the transfer of the appropriate portion of
the hair was complete.
Reagents, Materials And Equipment For General DNA Isolation
Bleach, 10% commercial (7mM sodium hypochlorite solution)
Boiling Water Bath
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
15/27
Ethanol
ForcepsFreezer, -20C
Gloves
Heat Block
HoodIncubator (56C)
Isopropanol
Kim-wipes
Laboratory coats
Magnetic Stirring/Hot Plate
Mask, SurgicalMicrocentrifuge
Microcentrifuge tubes, screw-top and regular top (1.7 ml to 2.0 ml)
Pipettes (P-2, P-10, P-20, P-100, P-200, P-1000)
Racks, tube
Refrigerator, 4CSafety glasses
ScalpelScissors
Sleeve Protectors
Spin-EASE Tubes
Tips, aerosol-resistant (e.g., for P-10, P-100, P-1000 pipettes)Ultraviolet Crosslinker
Vortex
Waste containers (general, biohazard, Sharps)Water, ultra-pure
Weigh Boats
2.1 Chelex ExtractionsChelex may be used for extraction of DNA from reference specimens containing ample
amounts of high quality DNA (e.g., a whole blood or buccal sample from a victim or suspect). If
a Chelex extraction does not yield suitable DNA, then an organic extraction will be attempted.
Reagents, Supplies And Equipment For Organic ExtractionsAluminum Oxide Grinding StonesAmicon Ultra-4 Concentrators
Bleach, 10% commercial (7mM sodium hypochlorite solution)
Centrifuge (fixed angle or swinging bucket rotor)ChiselCompound microscope
Demineralization Buffer
Dremel Tool
Emery Wheel
Ethanol, Absolute
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
16/27
Extraction buffer (10 mM Tris, 100 mM NaCl, 50 mM EDTA, pH 8.0, 0.5% SDS)
HammerMicrocon YM-30 concentrators
n-Butanol
Nutator
Phenol/Chloroform/Isoamyl Alcohol (25:24:1)Proteinase K (20 mg/ml)
Sonicator
Stereo microscopeTE Buffer (10 mM Tris, 1mM EDTA, pH 7.5)
Terg-a-zyme
Tissue GrindersWarring Blender
Xylene
Organic Extraction of DNA from Loose HairsClean micro tissue grinders with 10% bleach, water, and ethanol, in that order. Allow to
dry completely before using.
Irradiate the micro tissue grinders in the UV crosslinker according to Appendix F.
Carefully remove up to 2 cm of hair shaft material from proximal end of the hair and
place in a sterile, appropriately labeled, microcentrifuge tube.
NOTE: A stereo or compound microscope may be used in making the determination of theproximal end of the hair by observing the root end (if present) or the directionality of the scales
of the hair or hair fragment. (Refer to Appendix A regarding collection and evaluation of hairs.)
Add 1.0 ml of 5% Terg-a-zyme solution (UV sterilized) and place the tube in thesonicator for approximately 20 minutes.
Remove the 1.7 ml tube from the sonicator and carefully remove the 5% Terg-a- zymesolution.
Repeat Terg-a-zyme washes three times.
Rinse the hair with 1.0 ml of 100% ethanol. Recap tube. Gently agitate several times.
Remove the 100% ethanol. Rinse the hair with 1.0 ml of ultra-pure water. Recap tube,
agitate several times and remove water.
Prepare reagent blank for each sample as follows: Add 187 l of Extraction buffer to
micro tissue grinder. Briefly simulate grinding. The reagent blank will be the last specimenprocessed for the remaining steps.
Transfer the reagent blank into a labeled 1.7 ml microcentrifuge tube.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
17/27
To the same micro tissue grinder add 130 l of extraction buffer and place hair(s) in themicro tissue grinder.
Grind until fragments of hair are no longer visible .
Transfer the solution into a labeled 1.7 ml microcentrifuge tube.
Add an additional 57 l of extraction buffer to the micro tissue grinder to rinse andtransfer it to the 1.7 ml microcentrifuge tube with the sample.
Add 5 l of Proteinase K and 8 l of DTT. Vortex and pulse spin.
Incubate at 56C for a minimum of 2 hours.
Add 200 l phenol/chloroform/isoamyl alcohol.
Vortex thoroughly. Centrifuge for 2 minutes at approximately 10,000 x g in a
microcentrifuge.
Transfer upper aqueous layer to a sterile, appropriately labeled microcentrifuge tube. If
necessary, repeat extraction with phenol/chloroform/isoamyl alcohol until the interface is clean.Dispose of phenol waste in the appropriate waste container.
Add 200 l n-butanol.
Vortex thoroughly. Centrifuge 2 minutes at approximately 10,000 x g in a
microcentrifuge.
Remove and discard most of the n-butanol upper layer into the appropriate wastecontainer.
Label a sufficient number of pre-assembled, irradiated Microcon YM-30 concentrators.
Add 300 l TE buffer to the sample reservoir of the Microcon concentrators.
Transfer the lower aqueous layer to the sample reservoir of the Microcon concentrators.
Avoid pipetting any residual n-butanol.
Centrifuge column at a maximum of 1,000 x g for 15-30 minutes or until sample has spunthrough. Discard filtrate.
Add 300 l TE buffer and centrifuge 15-30 minutes at a maximum of 1,000 x g until thebuffer has spun through.
Add 60 l of TE buffer to the filter side of each Microcon concentrator.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
18/27
Place a retentate cup on the top of each concentrator.
Briefly vortex the Microcon concentrators with the retentate cups pointing upward.
Invert each concentrator with its retentate cup and centrifuge in a microcentrifuge at asetting of 10,000 x g for 3 minutes.
Discard the concentrators. Measure the volume of the retentate with the pipette. Add TEbuffer if necessary to bring volume to 100 l. Transfer retentate to a sterile, appropriatelylabeled, microcentrifuge tube.
MITOCHONDRIAL DNA AMPLIFICATION
The HVI/HVII Region-Sequence Typing Kit is useful for the detection of sequence variation at
18 positions within the hyper variable regions I and II of the human mitochondrial DNA(mtDNA) genome through Linear Array Hybridization and is an effective tool to screen multiple
evidence or multiple reference samples. Amplification of mtDNA using primer set primers are
effective for subsequent cycle sequencing of samples which may contain low levels or degraded
DNA. Control region primers are used routinely for reference samples and evidence sampleswhich potentially have an abundant amount of mtDNA.
Special Precautions
Dedicated lab coats are worn in the mtDNA isolation laboratory, replace at least weekly.
Personnel entering the mtDNA isolation laboratory will step onto adhesive floor mats, top layer
changed when no longer effective.
The mtDNA amplification of samples will be performed in a dedicated laminar flow hood,
separate from the DNA extraction hood(s).
Disposable gloves, surgical mask, lab coat and sterile sleeves will be used. Fresh 10% bleach
will be applied to the gloves before beginning amplification set up.Aerosol-resistant pipette tips will be changed between samples.
Negative amplification controls will be included with each amplification reaction.
Laminar hoods are UV irradiated prior to use.
Tubes and racks are UV irradiated prior to use.
All work surfaces and pipettes will be thoroughly cleaned with fresh 10% bleach. Isopropanol orethanol may be used to remove any residual bleach from the surfaces.
Evidence samples will be amplified separately from known reference samples.
The samples will be listed on the case worksheets in the order in which they wereprocessed/handled.
Reagents, Materials And Equipment
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
19/27
Bleach, 10% commercial (7 mM sodium hypochlorite solution)
Bovine Serum Albumin (BSA) (0.625 g/l), DNA gradeDeoxynucleotide triphosphate (dNTP) mix, 2.5 mM of each dNTP (dATP, dCTP, dGTP, dTTP)
Freezer, -20C
Gloves
Kim-wipesLaboratory coat
Laminar flow hood
Mask (surgical or dust)Microcentrifuge
PCR buffer, 10X (100mM Tris-HCl, pH 8.3; 500 mM KCl; 15 mM MgCl2)
Pipettes (P-2, P-10, P-20, P-100, P-200, P-1000)Positive control DNA (HL-60 or other in-house equivalent)
Primers, 10 M (see full listing below)Racks, tube
Refrigerator, 4C
Roche-HVI/HVII mtDNA Primer MixRoche-mtDNA Reaction Mix
Safety glassesSleeves, disposable
Taq Gold DNA Polymerase
Thermal cycler GeneAmp PCR Systems 9700Tips, aerosol-resistant (e.g., for P-10, P-100, P-1000 pipettes)
Tubes, microcentrifuge (1.7 ml to 2.0 ml)
Tubes, thin-walled PCR (0.2 ml)
Ultraviolet crosslinker
Mitochondrial DNA AmplificationWaste containers (general, biohazard, Sharps) Water, ultra-pure
General Guidelines
Use the LinearArray Hybridization to screen samples when multiple evidence or reference
samples are submitted. If an evidence or reference sample canbe eliminated, analysis
canbediscontinued at the Linear Array Hybridization.See chapter 9.2 for further instructions.
Limited samples (small stains or hair fragments less than 2cm) will be directly sequenced.
Amplify evidence with Primer Set 2first when sample quality/quantity may be insufficient
todetermine if results wouldbe obtained with the subsequent primer sets.
No more than4 samples (evidence orreference) may be amplified together in a batch.
Batches of samples will be amplified in the following order and will maintain this ordering
through cycle sequencing.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
20/27
Evidence Samples Reference Samples
Negative Control Negative Control
Sample 1 Known 1
Reagent Blank 1 Known 2
Sample 2 Known 3
Reagent Blank 2 Known 4Sample 3 Reagent Blank
Reagent Blank 3 Positive Control
Sample 4 Reagent Blank 4
Positive Control
HVI/HVII Region-Sequence mtDNA primers / sequences
HVI & HVII primers (X denotes Biotin)F15975-93B 5'-XCTCCACCATTAGCACCCAA
R16418-01B 5'-XATTTCACGGAGGATGGTGF15-34B 5'-XCACCCTATTAACCACTCACG
R429-10B 5'-XCTGTTAAAAGTGCATACCGC
Primer pairs for samples withhigh levels of DNA that are of good quality (Reference & Evidence
Samples)
Control Region(CR)F15971/ R599Primer pairs for samples withlow levels ofDNA that may be degraded (Evidence Samples)
Primer Set 1 (PS1) F15989/R16251
Primer Set 2 (PS2) F16190/R16410-m19
Primer Set 3 (PS3) F15/R285Primer Set 4 (PS4) F155/R389
Primer sequences
F15971 5TTA ACT CCA CCA TTA GCA CC 3
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
21/27
F15989 5 CCC AAA GCT AAG ATT CTA AT 3
F16190 5 CCC CAT GCT TAC AAG CAA GT 3R16251 5 GGA GTT GCAGTT GAT GT 3
R16410-m19 5 GAG GATGGT GGT CAA GGG A 3
F15 5 CAC CCT ATT AAC CAC TCA CG3F155 5 TAT TTA TCG CAC CTA CGT TC 3R285 5 GTT ATGATG TCT GTG TGG AA3
R389 5CTGGTT AGGCTG GTG TTA GG 3R599 5 TTG AGG AGG TAA GCT ACA TA 3
MITOCHONDRIAL DNA AMPLIFICATION PRODUCT EVALUATION
The product gel is used to determine the success of the amplification process and for assessing
the concentration of amplified mitochondrial DNA (mtDNA) that should be used for sequencing
or detection with the LINEAR ARRAY hybridization assay. SYBR Green is used to detect DNA
by staining. It intercalates with the double stranded DNA molecule and fluoresces under UV
light. A UV transilluminator, at a wavelength of 302 nm, is used to visualize the fluorescent
reaction. The DNA Molecular Weight Marker XIV ladder consists of double stranded DNA
fragments ranging in length from 100 to 2642 bp. The fragments corresponding to the following
sizes also correspond to known concentrations.
RESEARCH HYPOTHESIS
The presence of hair can associate a suspect to a victim or a suspect/victim to a crime scene
primarily because hairs can be transferredfrom the suspect to the victim and/or vice-versa during
physical contact.
Literature Review
Human hair has a significant potential in forensic anthropology and has been extensively used in
forensic investigations. Investigators believe that their presence can associate a suspect to avictim or a suspect/victim to a crime scene primarily because hairs can be transferred from the
suspect to the victim and/or vice-versa during physical contact.(1)
The use of the comparison microscope to perform side-by-side analysis of hairs collected froma crime scene and hairs from a suspect or victim first occurred in 1934 by Dr. Sydney Smith.This method of comparison helped solve the murder of an eight-year-old girl. Further advances
in hair analysis continued throughout the 20th century as technological advances allowed for
comparison of hairs through chemical methods. Today, hair analysis includes neutron activationanalysis and DNA fingerprinting and is considered a standard tool in trace evidence analysis.(5)
Drugs and toxics are incorporated into hair through three different modalities:
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
22/27
Passive diffusion to the hairmatrix from the blood and successive incorporation in the hair shaft
during keratinization. Within the hair shaft drugs are bound to proteins, melanin or lipids.Correlation between blood and hair concentrations of the substances is not always linear and
sometimes the distribution of the substances along the shaft does not correlate well with the time
of exposure. Transfer to the formed hair shaft from sebum and sweat. Transfer to the formed
shaft from the environment.External contamination may alter hair analysis and thereforedecontamination processes are necessary to avoid false-positive results due to passive
environmental exposure. Hair decontamination relies on the fact that substances transferred into
hair by passive exposure are loosely bound to the surface of the shaft and can be removed byappropriate washing procedures.(2)
The microscopic comparison of morphological characteristics of human hairs has been accepted
both scientifically and legally for decades. The advent of mitochondrial DNA (mtDNA)
sequencing provides an additional test in the repertoire for assessing source association between
a questioned hair and an individual. Neither the microscopic nor molecular analysis alone, ortogether, enables absolute positive identification; together, however, these methods can be
complementary examinations.(3)
Hair is a biological polymer with over ninety percent of its dry weight being made up of keratinprotein. Keratins are cystine-containing proteins, which forms two large groups called
Intermediate filament proteins and Intermediate filament associated proteins that are almost
equally abundant in most hairs. Of the several types of bonds that stabilize the keratin molecule,the most unique is S-S-. This S-Slinkage is formed by two cystine residues contained in
adjacent polypeptide chains and itis this disulfide bond that is mainly responsible for keratins
resistance to destruction. Research work on the elucidation of genes encoding structural proteins
of the human hair follicle has significant developments were made in both the characterization ofhuman hair keratins, as well as the hair keratin associated proteins. The human hair follicle is a
structure, which is formed as a result of epithelio-mesenchymal interactions initiated around thethird month of fetal development. It is very complex, consisting of more than twenty differentcell types distributed into six main areas. These areas are the connective tissue sheath, the dermal
papilla, the outer root sheath, the inner root sheath, the shaft and the sebaceous gland. This
complex appendage behaves in a unique pattern in mammals as, after a hair production phase, itinvolutes in situ before entering a resting phase after which it renews in a cyclical but stochastic
fashion. The hair follicle thus is a fully auto-nomous skin append-age with its own hormonal
control, its own autocrine and paracrine network and its own cycle, appearing as an incrediblycomplex and stable structure that summarizes the main rules of tissue homeostasis . As a result,
studies on the histo-physiology of the hair follicle are now gaining a great importance
Structurally, hair consists of: a) an inner cortex comprising spindle-shaped cells, and b) an outer
sheath called the cuticle. Each cortical cell consists of many fibrils. In between the fibrils a softermaterial called the matrix is present which grows from a hair follicle. The fibrils run to form the
fiber axis. The cuticle consists of scaleshaped layers and is responsible for much of the
mechanical strength of the hair fiber. The cuticle is made up of a number of layers, which varies
from one species to another. Typical human hair has six to eight layers of cuticle.(1)
Hairs are readily available for transfer, easily transferred, and resilient. Hair examination may be
used for associative and investigative purposes and to provide information for crime scene
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
23/27
reconstruction. The ability to perform a forensic microscopical hair comparison is dependent on
a number of factors. These factors include the following:
Whether an appropriate known hair sample is representative.
The range of features exhibited by the known hairs.
The condition of the questioned hair.The training and experience of the hair examiner.
The usage of the appropriate equipment and methodology.
DNA analysis can be performed on hair but should be performed only after an initial
microscopical assessment. A full and detailed microscopical comparison with possible known
sources of hair should be done prior to DNA analysis. Microscopical comparisons cannot always
be done after DNA analysis, which is destructive to at least a portion of the hair. DNA analysisshould always be considered in those cases when the source of a hair is crucial to an
investigation.(4)
Neutron activation analysis (NAA) is a particularly useful technique that can identify up to 14different elements in a single two-centimeter-long strand of human hair. The hair is placed in anuclear reactor and bombarded with high-energy neutrons. Different elements will give off
gamma radiation with different signals. These signals can be recorded and interpreted to
determine concentrations of elements in the sample. Elements such as antimony, argon, bromine,copper, gold, manganese, silver, sodium, and zinc can be identified and quantified using NAA.
The probability of the hairs of two individuals having the same concentration of nine different
elements is about one in a million.(5)
11.3. References
1. Jaydip Sen: Human Hair in Personal Identification andDocumenting Drug and Substance Abuse, Anthropologist, 12(1): 47-58 (2010)
2) Bianca Maria Piraccini, Massimiliano Pazzaglia, Antonella TostiBianca Maria Piraccini,
Massimiliano Pazzaglia, Antonella Tosti: Hair in Forensic Medicine, chapter 28.
3)Max M. Houck,1M.A. and Bruce Budowle,2 Ph.D.: Correlation of Microscopic and
Mitochondrial DNA Hair Comparisons, J Forensic Sci, Sept. 2002, Vol. 47, No. 5Paper ID JFS2001398_475
4) Scientific Working Group on Materials Analysis. Trace evidence quality assurance guidelines,
Forensic Science Communications [Online]. (January 2000). Available:
www.fbi.gov/hq/lab/fsc/backissu/jan2000/swgmat.htm .
5) Lee, Henry. Physical Evidence in Forensic Science. Tucson, AZ: Lawyers & Judges
Publishing, 2000.
6) Anderson, S., et. al. (1981) Sequence and organization of the human mitochondrial genome.
Nature, 290: 457-465.
http://www.fbi.gov/hq/lab/fsc/backissu/jan2000/swgmat.htmhttp://www.fbi.gov/hq/lab/fsc/backissu/jan2000/swgmat.htmhttp://www.fbi.gov/hq/lab/fsc/backissu/jan2000/swgmat.htm -
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
24/27
7) Andrews, R. M., et. al. (1999) Reanalysis and revision of the Cambridge Reference Sequence
for human mitochondrial DNA.Nature Genetics, 23: 147.
8) Wilson, M. R., et. al. (1995) Validation of mitochondrial DNA sequencing for forensic
casework analysis.International Journal of Legal Medicine, 108: 68-74.
9) Mitochondrial DNA Section Procedures Manual DFS Document 212-D100 Issued by Biology
Program Manager Revision 3I: 2-February-2011 Page 7 of 101
DiZinno, J. A., Wilson, M. R., and Budowle, B. Typing of DNA derived from hairs. In: Forensic
Examination of Hair. Taylor and Francis, London, 1999, pp. 155-173.
Hellman, A., Rohleder, U., Schmitter, H., and Wittig, M. STR typing of human telogen hairs: A
new approach, International Journal of Legal Medicine(2001) 114:269-273.
Linch, C. A., Smith, S. L., and Prahlow, J. A. Evaluation of the human hair root for DNA typing
subsequent to microscopic comparison, Journal of Forensic Sciences(1998) 43:305-314.Linch, C. A., Whiting, D. A., and Holland, M. M. Human hair histogenesis for the mitochondrial
DNA forensic scientist, Journal of Forensic Sciences(2001) 46:844-853.
Gaudette, B. D. Evidential value of hair examination. In: Forensic Examination of Hair. Taylor
and Francis, London, 1999, pp. 243-257.
Bisbing, R. E. Forensic identification and association of human hair. In: Forensic Science
Handbook. Vol. 1, 2nd ed., R. Saferstein, ed. Pearson Education, Upper Saddle River, New
Jersey, 2002, pp. 390-428.
Houck, M. M., Bisbing, R. E., Watkins, T. G., and Harmon, R. P. Locard exchange: The scienceof forensic hair comparisons and the admissibility of hair comparison evidence: Frye and
Daubert considered, Modern Microscopy Journal [Online]. (March 2004). Available:
www.modernmicroscopy.com.
Bio-Rad Laboratories. Chelex 100 and Chelex 20 Chelating Ion Exchange Resin, InstructionManual, rev B (1996).
Comey, C. T., et. al. (1994) DNA extraction strategies for amplified fragment length
polymorphism analysis.Journal of Forensic Sciences, 39: 1254-1269.
Comey, C. T., et. al. (1993) PCR amplification and typing of the HLA DQ gene in forensicsamples.Journal of Forensic Sciences, 38: 239-249.
Fisher, D. L., et. al. (1993) Extraction, evaluation, and amplification of DNA from decalcifiedand undecalcifiedUnited States Civil War bone.Journal of Forensic Sciences, 38: 60-68.
Hochmeister, M., et. al. (1991) Typing of deoxyribonucleic acid (DNA) extracted from compact
bone from human remains.Journal of Forensic Sciences, 36: 1649-1661.
Holland, M.M., et. al. (1993) Mitochondrial DNA sequence analysis of human skeletal remains:identification of remains from the Vietnam War.Journal of Forensic Sciences, 38: 542-553.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
25/27
Loreille, O. M., et. al. (2007) High efficiency DNA extraction from bone by total
demineralization. Forensic Science International: Genetics, 1: 191-195.
Millipore Corporation. Amicon Ultra-4 Centrifugal Filter Devices User Guide, rev A (04/2007)
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
26/27
12. Other Analytical Techniques
Other analyses may be performed on hairs that have been chemically altered or have trace
materials on the surface, such as dyed hairs or hair care products. These techniques are
beyond the scope of these guidelines because they are not used widely.
14.1. Identification of a Hair, Racial Group, Somatic Origin, and Other Features
An item can be identified as a human hair. It may also be classified by its racial and somatic
characteristics. Other features may be identified that could assist in an investigation.
14.2. Dissimilarity
If significant differences exist in the macroscopic and/or microscopic characteristics exhibited by
the questioned and known hairs, the questioned hairs cannot be associated with the source of
the known hairs.
The following circumstances may add weight to a conclusion of dissimilarity:
Known and questioned hairs exhibit gross differences (e.g., racial, color, diameter, chemical
treatment).
Adequate known samples are available.
Known hair has little intrasample variation.
-
8/2/2019 Analysis of Hair Using Microscopic and Molecular Techniques to Ascertain Personal Identification
27/27
The following circumstances may weaken a conclusion of dissimilarity:
Known and questioned hairs exhibit some similarities and no gross differences.
Inadequate known samples.
Inadequate questioned hairs.
Known hair has large intrasample variation.