an overview of gene structure & function...

AN OVERVIEW OF GENE STRUCTURE & FUNCTION PREDICTION Marcus Chibucos, Ph.D. University of Maryland School of Medicine June 2013

Overview & goals • Understand

•  1. How we predict presence & structure of coding and non-coding genes in the genome

•  2. How we know what gene product does & how evidence is used to support this

• When searching databases like FungiDB or InterPro, understand the meaning of terms like: protein motif, domain, ortholog, HMM, EC, GO annotation, and so forth

•  Learn fundamentals with prokaryotes... • Overview of eukaryotes…

GENE STRUCTURAL ANNOTATION

3

What is a gene model?

Yandell and Ence (2012) Nature Reviews Genetics. 13:329-342.

Fundamental methods of pattern detection •  Intrinsic (ab initio/de novo, “from the beginning”)

•  Uses only DNA sequence and the inherent patterns within it •  Canonical features like start & stop codons

• Extrinsic •  Uses additional sources of evidence information

•  Homologous proteins •  mRNA (ESTs, RNA-Seq) •  Synteny

Prokaryotic gene structure

AUG RBS

DNA

mRNA

ATG TAG

UAG

start stop

Open reading frame (ORF)

promotor

RBS

start

Figure: Michelle Giglio, Ph.D., Institute for Genome Sciences, University of Maryland School of Medicine, 2013

Start with DNA sequence

DNA sequence has 6 translation frames •  3 on forward strand, 3 on reverse strand


Each horizontal bar represents one of the translation frames. Tall vertical lines represent translation stops (TAG, TAA, TGA). Short vertical lines represent translation starts (ATG, GTG, TTG).

Graphical display of 6-frame translation


These are examples of the many ORFs in this graphic.

stop

start

Graphical display of 6-frame translation

• What is an “ORF”?

Prokaryotic gene finders • Glimmer

•  http://www.cbcb.umd.edu/software/glimmer •  prok and euk versions

• Prodigal •  http://prodigal.ornl.gov

• GeneMark •  http://exon.gatech.edu

•  prok and euk versions

• EasyGene •  http://www.cbs.dtu.dk/services/EasyGene

• Many others exist…

Glimmer •  Tool uses interpolated Markov models (IMMs) to predict which

ORFs in a genome contain real genes.

•  Glimmer compares nucleotide patterns it finds in a training set of genes known (or believed) to be real to nucleotide patterns of ORFs in the whole genome. ORFs with patterns similar to the patterns in the training genes are considered real themselves.

•  Using Glimmer is a two-part process •  Train Glimmer with genes from organism that was sequenced, which

are known, or strongly believed, to be real genes. •  Run trained Glimmer against the entire genome sequence. •  This is actually how most ab initio gene predictors—including

eukaryotic predictors like Augustus, GeneID, SNAP, and others—work.

these not these

Gathering the training set •  Using verified, published sequences ideal… not always possible

•  Minimum needed is 250 kb of total sequence •  BLAST translated ORFs against a protein database (slow)

•  Keep only very strong matches •  Gather long non-overlapping ORFs (fast) •  Many more complex strategies exist, especially for eukaryotes

Training Glimmer

•  All k-mers from size 5-8 in sequence are tracked •  Frequency of each nucleotide following any given k-mer is

recorded •  This data set is used to build a statistical model that provides

the probability that any given nucleotide will follow any given k-mer

•  This model is used to score the ORFs in the genome •  Those where the patterns of nucleotides/k-mers match the

model are predicted to be real genes

+1

+2

+3

-1

-2

-3

Candidate ORFs

• Choose a minimum length cut-off • Blue ORFs meet this minimum • Each blue ORF will be scored against the model built from

the training genes


Categorizing ORFs as genes or not • Some ORFs will score well to the model (green) • Some will not (red) • Green ORFs will be retained as predicted genes (blue

arrows depicted along the DNA molecule in black at the bottom of the figure)

+1 +2

+3

-1

-2

-3

Potential problems to watch for •  False Positives

•  An ORF is predicted to be a gene, but really isn’t •  May result in overlaps

•  False Negatives •  An ORF is not predicted to be a gene, but really is •  May result in “gaps” in feature predictions

• Wrong start site chosen •  Most genes have multiple start codons near the beginning – it can

be hard to determine which is the true one

+1 +2

+3

-1

-2

-3

Is one of these a False Positive? Probably. Genes don’t generally overlap to this extent in prokaryotes.

•  What about eukaryotes?

+1 +2

+3

-1

-2

-3

Is this a false negative? Probably. There are not large regions without gene content in prokaryotes. Why might this happen? If a region of DNA is different in composition than the rest of the genome then the gene finders will score the ORFs poorly when in fact they are real genes. Different composition may come about in many ways – one common way is through lateral (or horizontal) transfer. Things such as phage integration, transposition, etc.)

•  What about eukaryotes?

Translation start site considerations

20

- Start site frequency: ATG >> GTG >> TTG - Ribosome binding site (RBS): AG rich sequence 5-11 bp upstream of the start codon - Similarity to match proteins, in BER & multiple alignments - In example below (showing just the beginning of one BER alignment--here the DNA sequence reads down in columns for each codon), homology starts exactly at the first atg (the current chosen start, aa #1), there is a very favorable RBS beginning 9 bp upstream of this atg (gagggaga). There is no reason to consider the ttg, and no justification for moving to the second atg (this would cut off some similarity and it does not have an RBS).

RBS upstream of chosen start

3 possible start sites

This ORF’s upstream boundary BER match

When two ORFs overlap (boxed areas), the one without similarity to anything (another protein, an HMM, etc.) is removed. If both don’t match anything, other considerations such as presence in a putative operon and potential start codon quality are considered. Small regions of overlap are allowed (circle).

Overlap analysis

21

Areas of the genome with no genes and areas within genes without any kind of evidence (no match to another protein, HMM, etc., such regions may include an entire gene in case of “hypothetical proteins”) are translated in all 6 frames and searched against a non-redundant protein database.

Interevidence regions

22

It’s not just about proteins • Can predict many

genes beyond protein coding ones

Manatee genome viewer

http://manatee.igs.umaryland.edu/ http://manatee.sourceforge.net/igs/index.shtml

Artemis gene model curation tool

http://www.sanger.ac.uk/resources/software/artemis/

…now things get more

complicated

Eukaryotic gene structure prediction

Gene finder evaluation •  Sensitivity (Sn) measures false negatives

•  The fraction of a known reference feature that is predicted by a gene predictor = TP / (TP + FN)

•  Specificity (Sp) measures false positives •  The fraction of the prediction that overlaps a

known reference feature = TP / (TP + FP)

•  Assessed at different levels –  Base –  Exon –  Transcript –  Gene

Intrinsic (ab initio) success rates • Prokaryotic – very good >95% correct • Eukaryotic – not so good ~50% correct (shown below)

http://bioinf.uni-greifswald.de/augustus/accuracy (accessed May 2013)

Complexities of eukaryotic gene finding •  Large genomes in eukaryotes

•  Low coding density; in proks virtually all long ORFs encode gene, but not so in euks

•  Genomic repeats •  Non-canonical (ATG) start codon •  Splicing (exons & introns)

•  Alternative splicing (40-50% genes) •  Pseudogenes •  Long genes or short genes •  Long introns •  Non-canonical introns •  UTR introns •  Overlapping genes on opposite strands •  Nested genes overlapping on strand or in intron •  Polycistronic peptide coding genes

•  One mRNA codes for several very short (~11 aa) peptides… regulatory function •  Even if you have some RNA (helpful) transcription not always active

•  Need multiple biological conditions

Masking repeats is essential •  RepeatMasker (http://www.repeatmasker.org) finds

interspersed repeats & low complexity DNA sequences by comparing DNA sequence to curated genomic-specific libraries •  Simple Repeats – 1-5 bp duplications such as A, CA, CGG •  Tandem Repeats - 100-200 bases found at centromeres & telomeres •  Segmental Duplications - 10-300 kilobases blocks copied to another

genomic region •  Interspersed Repeats

•  Processed pseudogenes, retrotranscripts (short-interspersed elements- SINES): Non-functional copies of RNA genes reintegrated into the genome via reverse transcriptase

•  DNA transposons •  Retrovirus retrotransposons •  Non-retrovirus retrotransposons (long interspersed elements- LINES)

•  ~50% of human genomic DNA currently will be masked

•  RepeatModeler searches for repeats ab initio and can find not previously characterized repeats

Repeats yield similarities in non-homologous regions

Alkes L. Price, Neil C. Jones and Pavel A. Pevzner (June 28, 2005) http://bix.ucsd.edu/repeatscout/repeatscout-ismb.ppt

GENE1

GENE2

GENE1

GENE2

Using unmasked genomic DNA

Using masked genomic DNA

Predicted genes that are actually repeats

Using masked genomic DNA

Using unmasked genomic DNA

Gene predictors

Repeats Predicted models

No models

Multiple predictors give different results on same data set •  Factors affecting gene predictor results

•  Underlying algorithm •  Program parameters •  Training set (number and quality of models) •  Additional extrinsic inputs (expression data, protein/genome alignment)

Fungus species 1 Fungus species 2 GeneMark-ES (self training) 9,024 9,527 Augustus trained on Botrytis 8,194 9,011 Augustus trained on Neurospora 7,335 7,955 GeneID trained on Stagnospora 10,313 12,894 GeneID trained on Sclerotinia 10,691 13,837 GLEAN consensus 8,705 9,523

Which model is “correct”?

Protein alignments

Consensus model

Models from three different predictors/conditions

We rely on certain conventions • Rules are based on gene composition & signal

•  First, what is the basic structure of a gene? •  Coding region (exon) is inside ORF of one reading frame •  All exons on same strand for a given gene •  Exons within a gene can have different reading frame

•  Inherent frequency patterns exist…

Dimer frequency distribution • Dimer frequency in protein sequence is not evenly

distributed and is organism specific •  Some amino acids “prefer” to be next to one another •  Most dicodons are biased toward either coding or non-coding, not

neutral

• Expected frequency of dimer •  If random = 0.25% (1/20 * 1/20) •  If a dimer has lower than expected frequency, protein less likely to

contain it… and the reasoning follows that if a sequence does contain it, it is less likely to exist in a coding region

•  Example: In human genome, AAA AAA appears 1% of time in coding regions and 5% of time in non-coding regions

Modified from: http://en.wikipedia.org/wiki/File:Intron_miguelferig.jpg

http://en.wikipedia.org/wiki/File:Pre-mRNA_to_mRNA.svg

Splicing •  Find all GT/AG donor/acceptor sites •  Score with position-specific scoring matrix

(PSSM) model

splice donor

splice acceptor

poly- pyrimidine

tract branch point

Position Specific Scoring Matrix (PSSM) 1 2 3 4 5 6 7 8

A

G

C

U

1 1 1 0 0 0 1 1

0

4

0

2

1

1

1

2

2 5 0 0 2 1

2

1 0 0 5 0

0 0 4 1

Let’s say you look at 5 splice donor (GU) sites: !ATCGUCGC!UCAGUGGC!CUCGUCCC!GUCGUUAC!CACGUCUA!

Gene Gene finders use this information to predict where gene features are. For this to work, one must have confirmed splice sites to use for training. These are not always available for new genomes… and some splice sites are non-canonical… and some genes are alternatively spliced… so it can become somewhat complex.

Translation start prediction • Position-specific scoring matrix (PSSM)

•  Certain nucleotides tend to be in position around start site (ATG), and others not so

•  Such biased nucleotide distribution is basis for translation start prediction

Figure courtesy of Sucheta Tripathy http://www.slideshare.net/tsucheta/29th-june2011

Mathematical model •  Fi(X): freq. of X (A, G, C, T) in position I • Score string by Σ log (Fi (X)/0.25)

Figure courtesy of Sucheta Tripathy http://www.slideshare.net/tsucheta/29th-june2011

Pattern-based exon & gene prediction •  Assess different criteria

•  Coding region inside ORF (start & stop, no interrupting stops) •  Dimer frequency •  Coding score •  Donor site score •  Acceptor site score

•  Other factors to consider •  GC content •  Exon length distribution •  Polymerase II promoter elements (GC box, CCAT box, TATA region) •  Ribosome binding site •  Polyadenylation signal upstream poly-A cleavage site •  Termination signal downstream poly-A cleavage site

Example of ab initio gene predictor flow

http://genome.crg.es/software/geneid/

Confirming a predicted gene with cDNA

http://pasa.sourceforge.net/

26 exons!

Extrinsic evidence & manual curation • Expression data

•  EST (expressed sequence tag) sequences •  RNA-Seq reads

•  mRNAàcDNA •  High throughput sequencing •  Align reads to genome sequence

• Homology based approaches •  Protein (or expression data) sequences from other organisms •  Nucleic acid conservation via tblastx or many other methods •  Ortholog mapping/synteny

• Experimentally confirmed gene products & gene families •  Manual curation is often done by experts in a domain

mRNA

cDNA

GCTAATGCGAAGTCCTAGACCAGATTGAC ATGCGATGCAGCTGACGCTGGCTAATGCG CGCATAGCCAGATGACCATGATGCGATGC TGACAGATTAGACAGTAGGACAGATAGAC ……..many millions of reads

Reads mapped to genome with gene models

?

1.  Gene model is confirmed by transcript information 2.  Part of the gene model is confirmed but the exons

predicted in the middle do not have transcript evidence. Does this mean they are not real? Not necessarily.

3.  Transcript sequencing allows for novel gene detection. There is transcript evidence for the presence of a gene (or at least transcription) in an area of the genome without a gene model currently predicted.

1 2 3

RNA-seq of transcripts as evidence for gene models

Splice boundaries and alternate transcripts

• Some reads will span the intron/exon boundaries

• Allows for verification of gene models

• Observation of alternate transcripts

Intron

http://en.wikipedia.org/wiki/File:RNA-Seq-alignment.png

Multiple genome alignment & conservation

Experimentally based manual curation • We have

experimentally characterized protein •  What do I know

about this gene family?

• What do I know about genes in general? •  No introns in

multiples of three, short introns, et cetera

Leverage comparative genomics

Arnaud, et al. (2010) Nucleic Acids Res.

38(Database issue): D420-7.

Gather models for ab initio training set •  Get models verified via expression, homology, or manual curation

•  Use manually curated genes from your organism •  Generate preliminary ab initio model set and then do a homology search

at Swiss-Prot, retaining most-conserved genes •  Use CEGMA (Core Eukaryotic Genes Mapping Approach) to predict

highly conserved genes •  Align proteins from related organisms to your genome with splice-aware

aligner, thus creating models with exon boundaries that have homologs •  Align RNA-seq or EST reads to your genome to create or update

existing models.

•  Use models with multiple sources & remove highly similar ones OR •  Use pre-existing training set related to your organism

•  For example, I could use chicken if I am studying finch •  Many software packages provide parameter files for common organisms

Run gene finder as online or stand alone • Augustus web has text &

graphical output à Click!

Predictions stored in GFF3 or GFF2 or GTF format

RNA-Seq can show differential expression of alternative transcripts

Combiners •  Incorporate multiple evidence types including ab initio

predictions, expression data, and homology—and these usually perform the best •  Glean •  Evidence Modeler (EVM) •  Jigsaw •  Maker (actually a whole pipeline that can be used online) •  PASA (combines predicted structures with expression data) •  And more…

• Note that many ab inito predictors, for example Augustus, incorporate other data types such as protein alignments or expression data

One example, the Glean combiner •  Glean paper at http://genomebiology.com/2007/8/1/R13 •  Top track below is a statistically derived combination of the ones below it

Example of annotation pipeline •  Fungal Genome Annotation Standard Operating

Procedure (SOP) at JGI •  Repeat masking •  Mapping ESTs (BLAT) from organism and publicly available

proteins from related taxa (BLASTx) •  Ab initio (FGENESH, GeneMark), homolgy-based (FGENESH+,

Genewise seeded by BLASTx against nr), EST-based (EST_map) gene prediction

•  EST clustering to improve gene models •  Filtering overlapping gene models based on protein homology and

EST support to derive “best” model •  Non-coding genes with tRNAscan-SE •  …ready for functional annotation

http://genome.jgi.doe.gov/programs/fungi/FungalGenomeAnnotationSOP.pdf

nGASP – the nematode genome annotation assessment project

http://www.biomedcentral.com/1471-2105/9/549

Take home message •  Intrinsic & extrinsic prediction methods •  Intrinsic gene finders need high-quality training datasets in

order to produce good predictions •  “Correct” gene predictions are a moving target

•  Note the steady decrease in the number of predicted genes as the human genome is further curated

• Gene finders & gene finding pipelines produce predictions, which must be verified and refined – do not take them at face value

•  The more pieces of high-quality evidence you add to the process the better

•  In eukaryotes especially, there is not necessarily only one correct model

PROTEIN FUNCTIONAL ANNOTATION

60

Annotation defined

61

•  annotate – to make or furnish critical or explanatory notes or comment. -- Merriam-Webster dictionary

•  genome annotation – the process of taking the raw DNA sequence produced by the genome-sequencing projects and adding the layers of analysis and interpretation necessary to extract its biological significance and place it into the context of our understanding of biological processes.

-- Lincoln Stein, PMID 11433356

•  Gene Ontology (GO) annotation – the process of assigning GO terms to gene products… according to two general principles: first, annotations should be attributed to a source; second, each annotation should indicate the evidence on which it is based.

-- http://www.geneontology.org

What do our predicted genes do? • What we would like:

•  Experimental knowledge of function •  Literature curation •  Perform experiment •  Not possible for all proteins in most organisms (not even close in most)

• What we actually have: •  Sequence similarity

•  Similarity to motifs, domains, or whole sequences •  Protein not DNA for finding function •  Shared sequence can imply shared function •  All sequence-based annotations are putative until proven experimentally

62

Basic set of protein annotations •  protein name - descriptive common name for the protein

•  e.g. “ribokinase”

•  gene symbol - mnemonic abbreviation for the gene •  e.g. “recA”

•  EC number - only applicable to enzymes •  e.g. 1.4.3.2

•  role - what the protein is doing in the cell and why •  e.g. “amino acid biosynthesis”

•  supporting evidence •  accession numbers of BER and HMM matches •  TmHMM, SignalP, LipoP •  whatever information you used to make the annotation

•  unique identifier •  e.g. locus ids

63

Alignments/Families/Motifs

64

•  pairwise alignments –  two protein’s amino acid sequences aligned next to each

other so that the maximum number of amino acids match •  multiple alignments

–  3 or more amino acid sequences aligned to each other so that the maximum number of amino acids match in each column

–  more meaningful than pairwise alignments since it is much less likely that several proteins will share sequence similarity due to chance alone, than that 2 will share sequence similarity due to chance alone. Therefore, such shared similarity is more likely to be indicative of shared function.

•  protein families –  clusters of proteins that all share sequence similarity and

presumably similar function –  may be modeled by various statistical techniques

•  motifs –  short regions of amino acid sequence shared by many

proteins •  transmembrane regions •  active sites •  signal peptides

Important terms to understand •  homologs

•  two sequences have evolved from the same common ancestor •  they may or may not share the same function •  two proteins are either homologs of each other or they are not. A protein can

not be more, or less, homologous to one protein than to another. •  orthologs

•  a type of homolog where the two sequences are in different species that arose from a common ancestor. The fact of the speciation event has created the two copies of the sequence.

•  orthologs often, but not always, share the same function •  paralogs

•  a type of homolog where the two sequences have arisen due to a gene duplication within one species

•  paralogs will initially have the same function (just after the duplication) but as time goes by, one copy will be free to evolve new functions, as the other copy will maintain the original function. This process is called “neofunctionalization”.

•  xenologs •  a type of ortholog where the two sequences have arisen due to lateral (or

horizontal) transfer

65

66

ancestor

speciation to orthologs

duplication to paralogs

one paralog evolves a new function

lateral transfer to a different species

makes xenologs

“neofunctionalization” – the duplicated gene/protein develops a new function

Pairwise alignments •  There are numerous tools available for pairwise

alignments •  NCBI BLAST resources •  FASTA searches •  Many more

• At IGS we use a tool called BER (BLAST-extend-repraze) that combines BLAST and Smith-Waterman approaches •  Actually much of bioinformatics is based on reusing tools in new

and creative ways…

67

BER

68

BLAST

modified Smith- Waterman Alignment

genome’s protein set vs.

Significant hits (using a liberal cutoff) put into mini-dbs for each protein

non-redundant protein database

vs.

Query protein is extended

mini-database from BLAST search

, mini-db for protein #1

mini-db for protein #2

, mini-db for protein #3

... mini-db for protein #3000

Mini database

BER alignment

Extended Query protein by 300 nt

BER Alignment

69

…to look through in-frame stop codons and across frameshifts to determine if similarity continues

Extensions in BER

71

The extensions help in the detection of frameshifts (FS) and point mutations resulting in in-frame stop codons (PM). This is indicated when similarity extends outside the coordinates of the protein coding sequence. Blue line indicates predicted protein coding sequence, green line indicates up- and downstream extensions. Red line is the match protein.

ORFxxxxx 300 bp 300 bp

FS

PM

FS or PM ? two functionally unrelated genes from other species matching one query protein could indicate incorrectly fused ORFs

end5 end3

search protein

match protein

similarity extending through a frameshift upstream or downstream into extensions

similarity extending in the same frame through a stop codon

?

normal full length match

*

!

!

How do you know when an alignment is good enough to determine function? • Good question! No easy answer…

• Generally, you want a minimum of 40%-50% identity over the full lengths of both query and match with conservation of all important structural and catalytic sites

• However, some information can be gained from partial alignments •  Domains •  Motifs

• BEWARE OF TRANSITIVE ANNOTATION ERRORS

72

Pitfalls of transitive annotation

•  Current public datasets full of such errors •  A good way to avoid transitive annotation errors is to require

that in a pairwise match, the match annotation must be trusted •  Be conservative

•  Err on the side of not making an annotation, when possibly you should, rather than making an annotation when probably you shouldn’t.

73

A B

B C

C D

Transitive Annotation is the process of

passing annotation from one protein (or

gene) to another based on sequence

similarity:

A’s name has passed to D from A through several intermediates. -This is fine if A is similar to D. -This is NOT fine if A is NOT similar to D Transitive annotation errors are easy to make and happen often.

Trusted annotations •  It is important to know what proteins in our search

database are characterized. •  proteins marked as characterized from public databases

•  Gene Ontology repository (more on this later) •  GenBank (only recently began)

•  UniProt •  proteins at “protein existence level 1” •  Proteins with literature reference tags indicating characterization

74

•  Swiss-Prot •  European Bioinformatics Institute (EBI) and Swiss Institute of

Bioinformatics (SIB) •  all entries manually curated •  http://www.expasy.ch/sprot •  annotation includes

•  links to references •  coordinates of protein features •  links to cross-referenced databases

•  TrEMBL •  EBI and SIB •  entries have not been manually curated •  once they are accessions remain the same but move into Swiss-Prot •  http://www.expasy.ch/sprot

•  Protein Information Resource (PIR) •  http://pir.georgetown.edu

75

UniProt UniProt http://www.uniprot.org

UniProt 76

Enzyme Commission

•  not sequence based •  categorized collection of enzymatic reactions •  reactions have accession numbers indicating the type of

reaction, for example EC 1.2.1.5 •  http://www.chem.qmul.ac.uk/iubmb/enzyme/ •  http://www.expasy.ch/enzyme/

81

Recommendations of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology on the Nomenclature and

Classification of Enzymes by the Reactions they Catalyse

All ECs starting with #1 are some kind of oxidoreductase Further numbers narrow specificity of the type of enzyme A four-position EC number describes one particular reaction

EC number Hierarchy

82

Example entry for one specific enzyme

83

Metabolic pathway databases • KEGG

•  http://www.genome.jp/kegg/

• MetaCyc/BioCyc •  http://metacyc.org/ •  http://www.biocyc.org/

• BRENDA •  http://www.brenda-enzymes.info/

84

Hidden Markov models (HMMs) •  Statistical model of the patterns of amino acids in a multiple alignment of

proteins (called the “seed) which share sequence and, presumably, functional similarity

•  Two sets routinely used for protein functional annotation •  TIGRFAMs (www.tigr.org/TIGRFAMs/) •  Pfam (pfam.sanger.ac.uk)

•  Each TIGRFAM model is assigned to a category which describes the type of functional relationship the proteins in the model have to each other –  Equivalog - one specific function, e.g. “ribokinase” –  Subfamily - group of related functions generally with different substrate

specificities, e.g. “carbohydrate kinase” –  Superfamily - different specific functions that are related in a very general

way, e.g. “kinase” –  Domain - not necessarily full-length of the protein, contains one functional

part or structural feature of a protein, may be fairly specific or may be very general, e.g. “ATP-binding domain”

87

Annotation attached to HMMs •  Functionally specific HMMs have specific annotations

–  TIGR00433 (accession number for the model) •  name: biotin synthase •  category: equivalog •  EC: 2.8.1.6 •  gene symbol: bioB •  Roles:

–  biotin biosynthesis (TIGR 77/GO:0009102) –  biotin synthase activity (GO:0004076)

•  Functionally general HMMs have general annotations –  PF04055

•  name: radical SAM domain protein •  category: domain •  EC: not applicable •  gene symbol: not applicable •  Roles:

– enzymes of unknown specificity (TIGR role 703) – catalytic activity (GO:0003824) – metabolism (GO:0008152)

88

HMM building

Alignments of functionally related proteins act as training sets for HMM building

Statistical Model

Model specific to a family of proteins, generally found across many species

Proteins from many species


HMM scores

90

•  When a protein is searched against an HMM it receives a BITS score and an e-value indicating the significance of the match

•  The search protein’s score is compared with the trusted and noise cutoff scores attached to the HMM •  proteins scoring above the trusted cutoff can be assumed to be

members of the family •  proteins scoring below the noise cutoff can be assumed NOT to be

members of the family •  when proteins score in-between the trusted and noise cutoffs, the

protein may be a member of the family and may not.

N Statistical

Model

T

Statistical Model

The person building the HMM will search the new HMM against a protein database and decide on the trusted and noise cutoff scores

HMM databases

91

Alignments of functionally related proteins act as training sets for HMM building

N Statistical

Model

T

Database of HMM models, each specific to one protein family and/or functional level

Add this model to the database

Model specific to a family of proteins, generally found across many species

Proteins from many species

Examples: Pfam and TIGRFAM


0 100 -50

0 100 -50

0 100 -50

…above trusted: the protein is a member of family the HMM models

…below noise: the protein is not a member of family the HMM models

…in-between noise and trusted: the protein MAY be a member of the family the HMM models

T N

P

0 100 -50

...above trusted and some or all scores are negative: the protein is a member of the family the HMM models

The cutoff scores attached to HMMs, are sometimes high and sometimes low and sometimes even negative. There is no inherent meaning in how high or low a cutoff score is, the important thing is the query protein’s score relative to the trusted and noise scores.

92

Orthologous groups • COGs – have not been updated in a long time •  eggNOG – newer, more complete

93

A

B

C

1

2

3

Bi-directional best BLAST

Motif searches 94

•  PROSITE - http://www.expasy.ch/prosite/ –  “consists of documentation entries describing protein domains,

families and functional sites as well as associated patterns to identify them.”

•  Center for Biological Sequence Analysis - http://www.cbs.dtu.dk/ –  Protein Sorting (7 tools)

•  Signal P finds potential secreted proteins •  LipoP finds potential lipoproteins •  TargetP predicts subcellular location of proteins

–  Protein function and structure (9 tools) •  TmHMM finds potential membrane spans

–  Post-translational modifications (14 tools) –  Immunological features (9 tools) –  Gene finding and splice sites (9 tools) –  DNA microarray analysis (2 tools) –  Small molecules (2 tools)

One-stop shopping - InterPro •  InterPro

•  Brings together multiple databases of HMM, motif, and domain information.

•  Excellent annotation and documentation •  http://www.ebi.ac.uk/interpro/

95

Making annotations • Use the information from the evidence sources to decide

what the gene/protein is doing • Assign annotations that are appropriate to your

knowledge •  Name •  EC number •  Role •  Etc.

96

Main Categories: Amino acid biosynthesis Purines, pyrimidines, nucleosides, and nucleotides Fatty acid and phospholipidmetabolism Biosynthesis of cofactors, prosthetic groups, and carriers Central intermediary metabolism Energy metabolism Transport and binding proteins DNA metabolism Transcription Protein synthesis Protein Fate Regulatory Functions Signal Transduction Cell envelope Cellular processes Other categories Unknown Hypothetical Disrupted Reading Frame Unclassified (not a real role)

Each main category has

several subcategories.

TIGR roles

Names (and other annotations) should reflect knowledge

98

•  specific function –  Example: “adenylosuccinate lyase”, purB, 4.3.2.2

•  varying knowledge about substrate specificity –  A good example: ABC transporters

•  ribose ABC transporter •  sugar ABC transporter •  ABC transporter

–  choosing the name at the appropriate level of specificity requires careful evaluation of the evidence looking for specific characterized matches and HMMs.

•  family designation - no gene symbol, partial EC –  “Cbby family protein” –  “carbohydrate kinase, FGGY family”

•  hypotheticals –  “hypothetical protein” –  “conserved hypothetical protein”

Names can be problematic…. • ….because humans do not always use precise and

consistent terminology

• Our language is riddled with •  Synonyms – different names for the same thing •  Homonyms – different things with the same name

•  This makes data mining/query difficult •  What name should you assign? •  What name should you use when you search UniProt or NCBI or

any other database?

99

Synonyms •  Within any domain do people use precise & consistent language?

•  Take biologists, for example… •  Mutually understood concepts – DNA, RNA, protein •  Translation & protein synthesis

•  Synonym: one thing, more than one name •  Enzyme Commission reactions

•  Standardized id, official name & alternative names

100

http://www.expasy.ch/enzyme/2.7.1.40

Homonyms •  Different things known by same name •  Common in biology

•  Sporulation •  Vascular (plant vasculature, i.e. xylem & phloem, or vascular smooth

muscle, i.e. blood vessels?)

101

Endospore formation Bacillus anthracis!

Reproductive sporulation Asci & ascospores, Morchella elata (morel)

http://en.wikipedia.org/wiki/File:Morelasci.jpg ©PG Warner 2008 (accessed 17-Sep-09)

http://www.microbelibrary.org/

ASMOnly/details.asp?id=1426&Lang=

©L Stauffer 2003 (accessed 17-Sep-09)

Standardization with controlled vocabularies (CVs) • An official list of precisely defined terms used to classify

information & facilitate its retrieval •  Flat list •  Thesaurus •  Catalog

102

http://www.nlm.nih.gov/nichsr/hta101/ta101014.html

A CV can be “…used to index and retrieve a body of literature in a bibliographic, factual, or other database. An example is the MeSH controlled vocabulary used in MEDLINE and other MEDLARS databases of the NLM.”

•  Benefits of CVs –  Allow standardized descriptions –  Synonyms & homonyms

addressed –  Can be cross-referenced

externally –  Facilitate electronic searching

Ontology: CV with defined relationships •  Formalizes knowledge of subject with precise textual definitions •  Networked terms; child more specific (“granular”) than parent

103

National Drug File

An example is the Gene Ontology with three controlled vocabularies • Molecular Function

•  What the gene product is doing

• Biological Process •  Why the gene product is doing what it does

• Cellular component •  Where a gene product is doing what it does

104

The Gene Ontology

• A good example of a biological ontology

• Relationships among networked, defined terms

• Vascular terms shown with relationships

Example: a GO annotation •  Associating GO term with gene product (GP)

•  GP has function (6-phosphofructokinase activity) •  GP participates in process (glycolysis) •  GP is located in part of cell (cytoplasm) •  Linking GO term to GP asserts it has that attribute

•  Based on literature or •  computational methods

•  Always involves: •  Learning something about gene product •  Selecting appropriate GO term •  Providing appropriate evidence code •  Citing reference [preferably open access] •  Entering information into GO annotation file

106

Annotation becomes a series of ids linked to other proteins/genes/features

• GO:0005887 • GO:0008272 • GO:0015419 • GO:0043190

107

This protein is integral to the plasma membrane and is part of an ATP-binding cassette (ABC) transporter complex. It functions as part of a transporter to accomplish the transport of sulfate across the plasma membrane using ATP hydrolysis as an energy source.

=

108 Term name

GO ID (unique numerical identifier)

Precise textual definition that describes some aspect of the biology of the gene product

Synonyms for searching, alt. names, misspellings…

GO slim

Ontology relationships (next page)

Definition reference

Genomes can be compared •  High-level biological process terms used to compare

Plasmodium and Saccharomyces (made by “slimming”)

109

MJ Gardner, et al. (2002) Nature 419:498-511

The importance of evidence tracking

110

I conclude that you are a cat.

Why? - You look like other cats I know - I heard you meow and purr

Why? - You look like other protein kinases I know - You have been observed to add phosphate to proteins

I conclude that you code for a protein kinase.

•  The process of functional annotation involves assessing available evidence and reaching a conclusion about what you think the protein is doing in the cell and why.

•  Functional annotations should only be as specific as the supporting evidence allows •  All evidence that led to the annotation conclusions that were made must be stored. •  In addition, detailed documentation of methodologies and general rules or guidelines

used in any annotation process should be provided.

Knowledge & annotation specificity

Available evidence for three genes

Corresponding GO annotations •  How much can we accurately say?

Types of Evidence • Experiments (the only truth) • Pairwise/multiple alignments • HMM/domain matches scoring above trusted cutoff • Metabolic Pathway analysis • Match to an ortholog group (COG,eggNOG) • Motifs

112

The Evidence Ontology • Two main classes • ECO terms have standardized definitions & references

• Related to GO evidence codes

• Allows standardizing evidence description and searching by evidence type

Evidence Ontolgy & GO Codes

114

Approximately 20 GO codes exist …some of the over 250 ECO terms

The big picture: an example pipeline

115

DNA Sequence (assembly, masking)

Automatic Annotation using the evidence hierarchy of Pfunc

Searches: Pairwise BER searches against UniRef100 HMM searches against Pfam and TIGRfam Motif searches with LipoP, THMHH, PROSITE NCBI COGs Prium profiles

Automated start site and gene

overlap correction

translation

RNA finding: tRNAScan, RNAMMER, homology searches

Predicted RNA Genes

Gene Prediction

Predicted protein coding genes

MySQL database using the Chado

schema

Genome viewer/editor

Flat files of annotation information

Some concluding themes… •  The best annotation comes from looking at multiple

sources of evidence •  It is important to track and check the evidence used in an

annotation • Do not assume the annotation you see on a protein is

correct unless it comes from a trusted source • Always err on the side of under-annotating rather than

over-annotating • Consider using UniProt (UniRef) for searches, not NCBI

nr, simply for the depth of information it provides.

116

an overview of gene structure & function...

Documents