an introduction to dna microarrays rebecca fry, ph.d. (and leona samson)
DESCRIPTION
An Introduction to DNA microarrays Rebecca Fry, Ph.D. (and Leona Samson). http://www.buffalo.edu/UBT/UBT. What is a DNA Microarray?. genes or gene fragments attached to a substrate (glass). Tens of thousands of spots/genes =entire genome in 1 experiment A Revolution in Biology. - PowerPoint PPT PresentationTRANSCRIPT
-
An Introduction to DNA microarrays
Rebecca Fry, Ph.D.(and Leona Samson)
http://www.buffalo.edu/UBT/UBT
-
What is a DNA Microarray?genes or gene fragments attached to a substrate (glass)Hybridized slideTwo dyesImage analyzed Tens of thousands of spots/genes=entire genome in 1 experimentA Revolution in Biology
-
mRNA Analysis MethodsNorthern Blot (Single Gene analysis)
Microarray Technology (Genome Wide Experiment)
-
mRNAs separated on gel according to sizemRNAs transferred to a membrane and hybridized with small number (1-5) of radioactively labeled DNA probes. Probe corresponds to gene of interestTarget RNA is spatially fixed and the labeled probe is in solution Low throughputNORTHERN BLOTS
-
i.e., your cloned gene(s)
-
Number of Genes in Different Organisms
-
i.e., your cloned gene(s)We could just 35,000 Northern to monitor expression of all genes!!!
-
Northern BlotsImmobilized mRNA population hybridized with labeled probe representing one gene
DNA MicroarraysImmobilized probes hybridized with labeled mRNA population representing all expressed genes
-
Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations
-
EGFP ORF1846ATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAGGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGADesigning Oligo Probes70 mer oligo
specific to gene of interest
-
Number of Genes in Different Organisms
-
Spotted microarraysLiquid HandlingResuspension of oligoswww.qiageninstruments.com Overview of fabrication of spotted microarraysIntroduction
-
Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations
-
562 nmcy3cy5www.amersham.comcy3cy5
Differential dye incorporationcy5 less well than cy3Light sensitivity: cy5 more easily degradedProtect your reactions from light!!
664 nm510 nmIntroductioncy3 and cy5: Commonly used dyes
-
www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes
IntroductionEGFP KDCombined in equal amounts
Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNAEGFPCo-hybridized to array
-
www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes
IntroductionCombined in equal amounts
Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNACo-hybridized to array
yellow cy3=cy5red cy5>cy3green cy3>cy5EGFP KDEGFP
-
cDNA Two Color ChipsTarget preparation Array preparation
summary
-
This is the kind of thing you will see in YOUR microarray experiments
-
Whats happening at each spot?
-
cDNA Chip vs. Northern Blot
-
Two Popular Microarraying Platformswww.molgen.mpg.deSpotted microarrayscDNA: PCR products (500-1,000bp)synthesized oligos (70 mer)
>10,000 probesAffymetrixGene Chip500,000 probes25 mer (represents a fragment of a gene)IntroductionCommercially available Oligo microarraywww.the-scientist.com
-
So..what gene probes are represented on the array you will use??EGFP, p53, EXO1, AAG, ATM, and ATR.But we added in a bunch more!!
-
POLQPRKDCPRSS25RAD1RAD17RAD18RAD23ARAD23BRAD50RAD51RAD51CRAD51L1RAD51L3RAD52RAD54BRAD54LRAD9RECQL4REV1LalkB homologBreast cancer 1Excision repairGrowth arrest and DNA-damage-inducibleNo homology toHuman sequences
Alien DNA
ABHABH2ABH3ADPRTADPRTL2ADPRTL3APEXAPEXL2ATMATRBIDBLMBRCA1BRCA2
BTG1CASP2CASP3CASP8CASP9CCNHCDK2CDK4CDK6CDK7CDK8CETN2DCLRE1ADDB1DDB2
DMC1DUTEGFPENDOGERCC1ERCC2ERCC3ERCC4ERCC5EXO1FANCAFANCCFANCEFANCFFEN1FOSERCC6
G22P1GADD45AGADD45BGADD45GGTF2H4HAP1HCNPHSU24186HUS1JUNLIG1LIG3LIG4MAD2L2
-
28SLiver 18S28S6 kb4 kb2 kb1 kb0.5 kb0.2 kbElectropherogram (28S/18S Ratio~2)RNA quality controlLad, 1,2Gel Image (in silico) Sharp, Clear Bands
Pre-labeling quality control:
Determine RNA Quality Agilent Bioanalyzer: 50-500 ngNo more formaldehyde gels!!
-
Microarray MeasurementsScannerImage Analysis.txt or .xls fileImage Analysis: Spotted arrays
The title of this talk is the design and implementation fo t DNA microarray experiments
Always difference between cy3 and cy5, there is obvious structural difference with an additional double bond