an introduction to dna microarrays rebecca fry, ph.d. (and leona samson)

30
Introduction to DNA microarrays Rebecca Fry, Ph.D. (and Leona Samson) http://www.buffalo.edu/UBT/UBT

Upload: brooke

Post on 17-Feb-2016

41 views

Category:

Documents


0 download

DESCRIPTION

An Introduction to DNA microarrays Rebecca Fry, Ph.D. (and Leona Samson). http://www.buffalo.edu/UBT/UBT. What is a DNA Microarray?. genes or gene fragments attached to a substrate (glass). Tens of thousands of spots/genes =entire genome in 1 experiment A Revolution in Biology. - PowerPoint PPT Presentation

TRANSCRIPT

  • An Introduction to DNA microarrays

    Rebecca Fry, Ph.D.(and Leona Samson)

    http://www.buffalo.edu/UBT/UBT

  • What is a DNA Microarray?genes or gene fragments attached to a substrate (glass)Hybridized slideTwo dyesImage analyzed Tens of thousands of spots/genes=entire genome in 1 experimentA Revolution in Biology

  • mRNA Analysis MethodsNorthern Blot (Single Gene analysis)

    Microarray Technology (Genome Wide Experiment)

  • mRNAs separated on gel according to sizemRNAs transferred to a membrane and hybridized with small number (1-5) of radioactively labeled DNA probes. Probe corresponds to gene of interestTarget RNA is spatially fixed and the labeled probe is in solution Low throughputNORTHERN BLOTS

  • i.e., your cloned gene(s)

  • Number of Genes in Different Organisms

  • i.e., your cloned gene(s)We could just 35,000 Northern to monitor expression of all genes!!!

  • Northern BlotsImmobilized mRNA population hybridized with labeled probe representing one gene

    DNA MicroarraysImmobilized probes hybridized with labeled mRNA population representing all expressed genes

  • Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations

  • EGFP ORF1846ATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAGGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGADesigning Oligo Probes70 mer oligo

    specific to gene of interest

  • Number of Genes in Different Organisms

  • Spotted microarraysLiquid HandlingResuspension of oligoswww.qiageninstruments.com Overview of fabrication of spotted microarraysIntroduction

  • Need to achieve two things:Immobilize thousands of probes specific for individual genes Label mRNA populations

  • 562 nmcy3cy5www.amersham.comcy3cy5

    Differential dye incorporationcy5 less well than cy3Light sensitivity: cy5 more easily degradedProtect your reactions from light!!

    664 nm510 nmIntroductioncy3 and cy5: Commonly used dyes

  • www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes

    IntroductionEGFP KDCombined in equal amounts

    Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNAEGFPCo-hybridized to array

  • www.genetics.ucla.eduLabeled cDNA preparationRNASample 2Spotted MicroarrayTarget preparationReverse transcriptionFlourescent dyes

    IntroductionCombined in equal amounts

    Spotted microarray target preparationDirect labelingcy5cy3cDNAcDNACo-hybridized to array

    yellow cy3=cy5red cy5>cy3green cy3>cy5EGFP KDEGFP

  • cDNA Two Color ChipsTarget preparation Array preparation

    summary

  • This is the kind of thing you will see in YOUR microarray experiments

  • Whats happening at each spot?

  • cDNA Chip vs. Northern Blot

  • Two Popular Microarraying Platformswww.molgen.mpg.deSpotted microarrayscDNA: PCR products (500-1,000bp)synthesized oligos (70 mer)

    >10,000 probesAffymetrixGene Chip500,000 probes25 mer (represents a fragment of a gene)IntroductionCommercially available Oligo microarraywww.the-scientist.com

  • So..what gene probes are represented on the array you will use??EGFP, p53, EXO1, AAG, ATM, and ATR.But we added in a bunch more!!

  • POLQPRKDCPRSS25RAD1RAD17RAD18RAD23ARAD23BRAD50RAD51RAD51CRAD51L1RAD51L3RAD52RAD54BRAD54LRAD9RECQL4REV1LalkB homologBreast cancer 1Excision repairGrowth arrest and DNA-damage-inducibleNo homology toHuman sequences

    Alien DNA

    ABHABH2ABH3ADPRTADPRTL2ADPRTL3APEXAPEXL2ATMATRBIDBLMBRCA1BRCA2

    BTG1CASP2CASP3CASP8CASP9CCNHCDK2CDK4CDK6CDK7CDK8CETN2DCLRE1ADDB1DDB2

    DMC1DUTEGFPENDOGERCC1ERCC2ERCC3ERCC4ERCC5EXO1FANCAFANCCFANCEFANCFFEN1FOSERCC6

    G22P1GADD45AGADD45BGADD45GGTF2H4HAP1HCNPHSU24186HUS1JUNLIG1LIG3LIG4MAD2L2

  • 28SLiver 18S28S6 kb4 kb2 kb1 kb0.5 kb0.2 kbElectropherogram (28S/18S Ratio~2)RNA quality controlLad, 1,2Gel Image (in silico) Sharp, Clear Bands

    Pre-labeling quality control:

    Determine RNA Quality Agilent Bioanalyzer: 50-500 ngNo more formaldehyde gels!!

  • Microarray MeasurementsScannerImage Analysis.txt or .xls fileImage Analysis: Spotted arrays

    The title of this talk is the design and implementation fo t DNA microarray experiments

    Always difference between cy3 and cy5, there is obvious structural difference with an additional double bond