an integrated bacterial system for the discovery of ...10.1038/s41551-017-0144... · supplementary...
TRANSCRIPT
ArticlesDOI: 10.1038/s41551-017-0144-3
© 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved. © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
An integrated bacterial system for the discovery of chemical rescuers of disease-associated protein misfoldingIlias Matis1,2, Dafni Chrysanthi Delivoria1,2, Barbara Mavroidi3, Nikoletta Papaevgeniou1,4, Stefania Panoutsou1,5, Stamatia Bellou1, Konstantinos D. Papavasileiou1,10, Zacharoula I. Linardaki1,6, Alexandra V. Stavropoulou5, Kostas Vekrellis7, Nikos Boukos8, Fragiskos N. Kolisis2, Efstathios S. Gonos1,9, Marigoula Margarity6, Manthos G. Papadopoulos1, Spiros Efthimiopoulos5, Maria Pelecanou3, Niki Chondrogianni1 and Georgios Skretas1*
1Institute of Biology, Medicinal Chemistry and Biotechnology, National Hellenic Research Foundation, 11635 Athens, Greece. 2School of Chemical Engineering, National Technical University of Athens, 15780 Athens, Greece. 3Institute of Biosciences and Applications, National Center for Scientific Research “Demokritos”, 15310 Athens, Greece. 4Faculty of Biology and Pharmacy, Institute of Nutrition, Friedrich Schiller University of Jena, 07743 Jena, Germany. 5Department of Biology, National and Kapodistrian University of Athens, 15701 Athens, Greece. 6Department of Biology, University of Patras, 26504 Patras, Greece. 7Department of Neuroscience, Center for Basic Research, Biomedical Research Foundation of the Academy of Athens, 11527 Athens, Greece. 8Institute of Nanoscience and Nanotechnology, National Center for Scientific Research “Demokritos”, 15310 Athens, Greece. 9Medical School, Örebro University, 70182 Örebro, Sweden. Present address: 10Institute of Nanoscience and Nanotechnology, National Center for Scientific Research “Demokritos”, 15310 Athens, Greece. *e-mail: [email protected]
SUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited.
NAturE BIoMEDICAL ENGINEErING | www.nature.com/natbiomedeng
1
SUPPLEMENTARY INFORMATION
for the Article
An integrated bacterial system for the discovery of chemical rescuers
of disease-associated protein misfolding
Ilias Matis1,2, Dafni Chrysanthi Delivoria1,2, Barbara Mavroidi3, Nikoletta Papaevgeniou1,4,
Stefania Panoutsou1,5, Stamatia Bellou1, Konstantinos D. Papavasileiou1,, Zacharoula I.
Linardaki1,6, Alexandra V. Stavropoulou5, Kostas Vekrellis7, Nikos Boukos8, Fragiskos N.
Kolisis2, Efstathios S. Gonos1,9, Marigoula Margarity6, Manthos G. Papadopoulos1, Spiros
Efthimiopoulos5, Maria Pelecanou3, Niki Chondrogianni1, Georgios Skretas1*
1Institute of Biology, Medicinal Chemistry & Biotechnology, National Hellenic Research
Foundation, Athens, Greece; 2School of Chemical Engineering, National Technical University of
Athens, Athens, Greece; 3Institute of Biosciences & Applications, National Center for Scientific
Research “Demokritos”, Athens, Greece; 4Faculty of Biology and Pharmacy, Institute of Nutrition,
Friedrich Schiller University of Jena, Jena, Germany; 5Department of Biology, National and
Kapodistrian University of Athens, Athens, Greece; 6Department of Biology, University of Patras,
Patras, Greece; 7Department of Neuroscience, Center for Basic Research, Biomedical Research
Foundation of the Academy of Athens, Athens, Greece; 8Institute of Nanoscience and
Nanotechnology, National Center for Scientific Research “Demokritos”, Athens, Greece; 9Medical
School, Örebro University, Örebro, Sweden
Present address: Institute of Nanoscience and Nanotechnology, National Center for Scientific
Research “Demokritos”, Athens, Greece
*Correspondence to:
Georgios Skretas
Institute of Biology, Medicinal Chemistry & Biotechnology
National Hellenic Research Foundation
48 Vassileos Constantinou Ave
11635 Athens
Greece
Email: [email protected]
2
Table of Contents page
Supplementary Results 4-8
Supplementary Methods 9-22
Supplementary Figures
Figure 1 Characterization of the generated combinatorial oligopeptide library cyclo-
NuX1X2X3-X5. 23-25
Figure 2 Genetic screening for the identification of macrocyclic rescuers of disease-
associated protein misfolding. 26-27
Figure 3 CD and ThT spectra of cyclic peptide:Aβ42 solutions at 2:1 ratio. 28
Figure 4 The selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116 inhibit Αβ-induced
cytotoxicity in vitro. 29-30
Figure 5 The selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116 inhibit Αβ-induced
aggregation and toxicity in vivo in a dose-dependent manner. 31
Figure 6 Sequence analysis of the selected cyclic TXXXR pentapeptides targeting Αβ. 32-33
Figure 7 Computational modelling of ΑβC5-34 and ΑβC5-116 binding to Αβ. 34-35
Figure 8 Genetic screening for the identification of macrocyclic rescuers of mutant SOD1
misfolding and aggregation. 36-37
Figure 9 Sequence analysis of the selected cyclic TXSXW pentapeptides targeting
SOD1(A4V). 38-39
Figure 10 SOD1(A4V) purification and characterization. 40-41
Supplementary Tables
Table 1 PCR primers used in this study. 42-47
Table 2 Bacterial expression vectors used in this study. 48-49
Table 3 Sequencing results of the peptide-encoding regions of 23 randomly selected
clones from the constructed pSICLOPPS-NuX1X2X3, pSICLOPPS-NuX1X2X3X4,
and pSICLOPPS-NuX1X2X3X4X5 vector sub-libraries. 50
Table 4 High-throughput sequencing analysis of the peptide-encoding regions of ~260,000
randomly selected clones from the constructed pSICLOPPS-NuX1X2X3,
pSICLOPPS-NuX1X2X3X4, and pSICLOPPS-Nu X1X2X3X4X5 sub-libraries. 51
Table 5 Sequences and frequency of appearance of the selected cyclic TXXXR
pentapeptides. 51-55
Table 6 Sequences and frequency of appearance of the selected cyclic pentapeptides
resembling ΑβC5-34. 55
Table 7 Sequences and frequency of appearance of the selected cyclic TXXR
tetrapeptides. 55
Table 8 MM–PBSA binding free energy (ΔGbind) calculations of the Aβ-cyclic peptide
complexes. 56
Table 9 MM–PBSA calculated free-energy contributions and standard error of the mean
values of the Aβ-cyclic peptide complexes. 56
Table 10 Hydrogen-bonding interactions between ΑβC5-34 and the Aβ pentameric model
unit. 57
Table 11 Hydrogen bonding interactions between ΑβC5-116 and the Aβ pentameric model
unit. 57
3
Table 12 MM–PBSA binding free energy (ΔGbind) calculations of Aβ complexes with active
and inactive variants of the selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116. 58
Table 13 Sequences and frequency of appearance of the selected cyclic TXSXW
pentapeptides. 58-59
Table 14 Comparison of the molecular properties of the selected cyclic pentapeptides with
those of conventional drugs, oral macrocyclic (MC) drugs and non-oral MC drugs. 60
Supplementary References 61-64
4
Supplementary Results
Quality assessment of the constructed combinatorial library of random cyclic
oligopeptides. Colony PCR of 124 randomly selected clones of the combined pSICLOPPS-
NuX1X2X3-X5 library with intein-specific primers revealed that 88 of them (~71%) contained the
correct insert. Overexpression of the tetra-partite fusion in 150 randomly selected clones using
0.002% arabinose and monitoring of the production of this fusion protein by western blotting using
a mouse anti-CBD primary antibody (New England Biolabs, USA; 1:100,000 dilution) and a goat
anti-mouse HRP-conjugated secondary antibody (Bio-Rad; http://www.bio-rad.com/en-
jp/sku/1706516-goat-anti-mouse-igg-h-l-hrp-conjugate; 1:4,000 dilution), showed that 99 of them
(~66%) produced high yields of the tetra-partite fusion protein (Supplementary Fig. 1c). Among
these 99 clones that produced precursor fusion protein (molecular mass ~25 kDa), 82 clones
(~55% of total clones tested) also yielded a lower molecular weight band (molecular mass ~20
kDa), which corresponds to one of the splicing reaction products, the N-terminal domain of the
Ssp DnaE intein fused to CBD (IN-CBD), after intein splicing and cyclic peptide formation takes
place (Supplementary Figs. 1a, c; data not shown). Therefore, according to these results, the
generated bacterial libraries encoding for cyclic tetra-, penta- and hexapeptide contain
approximately 20,760,000 clones, which express tetra-partite peptide fusions at high levels and
which are capable of undergoing splicing and potentially yielding cyclic peptide products. This
diversity covers fully the theoretical diversity of our combined cyclo-NuX1X2X3, NuX1X2X3X4 and
NuX1X2X3X4X5 libraries (3×203 + 3×204 + 3×205 = 10,104,000) by more than two-fold
(Supplementary Fig. 1b).
DNA sequencing of the peptide-encoding regions of the pSICLOPPS plasmid from twenty
randomly selected clones revealed the presence of all three Nu amino acids Cys, Ser, and Thr at
position 1 and a good representation of the twenty natural amino acids at all other positions within
the tetra-, penta- and hexapeptide sequence (Supplementary Table 3). To evaluate the quality
of the constructed libraries further, we characterized in more detail the amino acid diversity
5
encoded within the generated oligopeptide libraries by performing deep sequencing analysis of
the peptide-encoding region of the combined pSICLOPPS-NuX1X2X3-X5 vector library. ~85% of
the analysed DNA sequences were unique and ~67% of those were found to encode unique cyclic
peptide sequences (Supplementary Table 4). Again, all amino acids were found to be encoded
at all positions of the generated library, albeit with an over-representation of residues
corresponding to Gly (Supplementary Fig. 1d). Taken together, these results suggest that we
have constructed a high-diversity library, which should be encoding the vast majority, if not all, of
the theoretically possible tetra-, penta- and hexapeptide cyclo-NuX1X2X3-X5 sequences.
The selected Aβ-targeting cyclic oligopeptides enhance bacterial Aβ-GFP fluorescence in
an Aβ-specific manner. The increases in bacterial Aβ-GFP fluorescence observed in the
presence of the selected Aβ-targeting cyclic oligopeptides (Table 1, top) were found to be Αβ-
specific, as the isolated pSICLOPPS-NuX1X2X3-X5 vectors from these selected clones did not
enhance the levels of cellular green fluorescence when the sequence of Αβ in the Αβ42-GFP
reporter was replaced with that of each one of two unrelated disease-associated MisPs, the DNA-
binding (core) domain of the human p53 containing a Tyr220Cys substitution (p53C(Y220C))1 and
an Ala4Val substitution of human Cu/Zn superoxide dismutase 1 (SOD1(A4V))2 (Supplementary
Fig. 2c). On the contrary, the selected pSICLOPPS-NuX1X2X3-X5 vectors were efficient in
enhancing the fluorescence of Αβ-GFP containing two additional Αβ variants, Aβ40 and the E22G
(arctic) variant of Aβ42, which is associated with familial forms of AD3 (Supplementary Fig. 2d).
Structure-activity analysis for ΑβC5-116. For the selected peptides corresponding to the
TXXXR motif, residues at positions 3 and 4 were highly variable and included the majority of
natural amino acids, with position 3 exhibiting the highest diversity (Fig. 5e; Supplementary Fig.
6b, c). At position 2, Thr, Ala, and Val were preferred, while aromatic residues (Phe, Trp, Tyr)
were completely excluded from the selected TXXXR peptide pool, in full agreement with our site-
6
directed mutagenesis studies (Fig. 5c). At the highly variable position 3, the complete absence of
the negatively charged amino acids Glu and Asp among the selected sequences was notable
(Fig. 5e; Supplementary Fig. 6b, c). In general, both negatively (Glu and Asp) and positively
charged residues (Lys, His, and Arg) were found to be strongly disfavored among the selected
TXXXR sequences at positions 2 and 3. At position 4, Ala, Asp, and Trp were found to be the
preferred residues. It is noteworthy, that Lys and Gln residues were practically absent from all
positions, while the β sheet-breaking amino acid Pro that is typically included in designed peptide-
based inhibitors of amyloid aggregation4 appeared with strikingly low frequencies (Fig. 5e;
Supplementary Fig. 6b, c).
Prediction of the binding mode of AβC5-34 and AβC5-116 to Αβ. In order to unbiasedly search
for possible binding sites, a single Molecular Dynamics (MD) simulation of 100 ns duration in the
isobaric-isothermal ensemble (NPT) ensued, having five cyclic peptides placed around the Aβ
protofilament centroid at a minimum distance of 5 Å. Spatial Distribution Function (SDF) analysis
of the produced MD trajectories was then performed in conjunction with molecular docking
calculations, which assisted in narrowing the possible binding sites of both AβC5-34 and AβC5-
116 to Αβ down to five possibilities (Supplementary Fig. 7c). Thus, a new series of MD
simulations commenced with durations of 20 ns for each of these possible positions, then
continued further for an additional 20×4 ns to provide a large ensemble of conformations for the
subsequent MM-PBSA calculations. These were performed in order to finally establish the binding
site for each cyclic peptide. The calculations involved 8,000 trajectory frames, with enthalpic (ΔH),
entropic (–TΔS) and total binding free energy (ΔGbind) contributions along with the energetic
analysis of the Αβ/AβC5-34 and Αβ/AβC5-116 complexes provided in Supplementary Tables 8-
9, respectively. Also, per residue contributions to the total enthalpy of each system were
calculated for both complexes. Calculations were performed on all five binding sites and finally
7
showed that only a single site for each cyclic peptide was found to exhibit favorable binding
energetics (Fig. 6a; Supplementary Table 8).
Hydrogen bonding analysis demonstrated that some of these residues participate in the
formation of persistent hydrogen bonds (Fig. 6b; Supplementary Tables 10, 11). Apart from the
hydrogen bond between the R5 –NH2 group of AβC5-116 with the B-L34 oxygen of Αβ (Fig. 6b;
Supplementary Table 11), the residue with the most favorable binding contributions
(Supplementary Fig. 7d), T1 of AβC5-116, also forms a hydrogen bond with D-I32 (Fig. 6b;
Supplementary Table 11). Important residues that favor binding are the hydrophobic residues
A2 and F3 of AβC5-116, along with the Aβ residues A-G33, D-I32, A-M35, B-M35 and D-M35 in
proximity, hence the significant van der Waals contributions to binding (Supplementary Fig. 7d).
Regarding AβC5-34, residues S1, A2 and T5 form hydrogen bonds with the A monomer residues
A21, E22, D23 and I31 of Αβ (Fig. 6b; Supplementary Table 10). Most of these amino acids
also appear as the most favorable contributors to binding, with the exception of D23, which
disfavors binding (Supplementary Fig. 7d). This is in agreement with the less pronounced van
der Waals contribution to the interaction of this cyclic peptide with Αβ.
The importance of residues found to be involved in the formation of the AβC5-34/ and
AβC5-116/Αβ complexes, as well as the validity of our computational approach, was further tested
by examining selected mutant cyclic peptide sequences: (i) AβC5-34(T5A) (cyclo-SASPA), an
AβC5-34 variant found to be inactive in the bacterial Αβ42-GFP assay (Fig. 5a) (ii) AβC5-116(A2T)
(cyclo-TTFDR), an AβC5-116 variant found to be active in the bacterial Αβ42-GFP assay (Fig. 5c);
(iii) AβC5-116(R5A) (cyclo-TADFA), an AβC5-116 variant found to be inactive in the bacterial
Αβ42-GFP assay (Fig. 5b); and (iv) cyclo-TRDFA, a scrambled variant of AβC5-116 anticipated to
be inactive. In accordance with the experimental observations, AβC5-116(A2T) exhibited
favorable free energy of binding at the same Aβ site (Supplementary Table 12). On the contrary,
all inactive cyclic peptide variants exhibited unfavorable free energies of binding at their
8
corresponding Aβ sites (Supplementary Table 12). Taken together, these results showcase the
validity of the utilized computational approach.
9
Supplementary Methods
Reagents and chemicals
All DNA-processing enzymes were purchased from New England Biolabs (USA) apart from
alkaline phosphatase FastAP, which was purchased from ThermoFisher Scientific (USA).
Recombinant plasmids were purified using NucleoSpin Plasmid from Macherey-Nagel (Germany)
or Plasmid Midi kits from Qiagen (Germany). PCR products and DNA extracted from agarose gels
were purified using Nucleospin Gel and PCR Clean-up kits from Macherey-Nagel (Germany),
respectively. All chemicals were purchased from Sigma-Aldrich (USA), unless otherwise stated.
Isopropyl-β-D-thiogalactoside (IPTG) was purchased from MP Biomedicals (Germany). Stock
solutions of the synthetic cyclic peptides were as follows: 32.5 mM in water for AβC5-34, 10 mM
in 40% DMSO for ΑβC5-116 and 30 mM in 40% DMSO for SOD1C5-4.
Cyclic oligopeptide library construction and initial characterization
Initially, we constructed nine distinct combinatorial cyclic peptide sub-libraries: the cyclo-
CysX1X2X3, cyclo-SerX1X2X3, and cyclo-ThrX1X2X3 tetrapeptide sub-libraries (pSICLOPPS-
CysX1X2X3, pSICLOPPS-SerX1X2X3, and pSICLOPPS-ThrX1X2X3 vector sub-libraries), the cyclo-
CysX1X2X3X4, cyclo-SerX1X2X3X4, and cyclo-ThrX1X2X3X4 cyclic pentapeptide sub-libraries
(pSICLOPPS-CysX1X2X3X4, pSICLOPPS-SerX1X2X3X4, and pSICLOPPS-ThrX1X2X3X4 vector
sub-libraries) and the cyclo-CysX1X2X3X4X5, cyclo-SerX1X2X3X4X5, and cyclo-ThrX1X2X3X4X5
cyclic hexapeptide sub-libraries (pSICLOPPS-CysX1X2X3X4X5, pSICLOPPS-SerX1X2X3X4X5, and
pSICLOPPS-ThrX1X2X3X4X5 vector sub-libraries) (Supplementary Table 2). These vectors
express libraries of fusion proteins comprising four parts: (i) the C-terminal domain of the split Ssp
DnaE intein (IC), (ii) a tetra-, penta-, or hexapeptide sequence, (iii) the N-terminal domain of the
split Ssp DnaE intein (IN), and (iv) a chitin-binding domain (CBD) under the control of the PBAD
promoter and its inducer L(+)-arabinose (Supplementary Fig. 1a). The libraries of genes
10
encoding these combinatorial libraries of random cyclic oligopeptides were constructed using the
degenerate forward primers GS032, GS033, GS034, GS072, GS073, GS074, GS075, GS076,
GS077, individually in pair with the reverse primer GS035, and pSICLOPPS as a template
(Supplementary Table 1). Cys, Ser, and Thr were encoded in these primers by the codons TGC,
AGC, and ACC, respectively, which are the most frequently utilized ones for these amino acids in
E. coli, while the randomized amino acids (X) were encoded using random NNS codons, where
N=A, T, G, or C and S=G or C, as described previously5. A second PCR reaction was conducted
in each case to eliminate mismatches using the aforementioned amplified DNA fragments as
templates, and the forward primers GS069, GS070 and GS071 for the peptide sub-libraries
starting with Cys, Ser, or Thr, respectively, together with the reverse primer GS035. The resulting
PCR products were digested with BglI and HindIII for 5 h and inserted into the similarly digested
and dephosphorylated auxiliary vector pSICLOPPSKanR (see below). The ligation reactions were
optimised at a 12:1 insert:vector molar ratio and performed for 4 h at 16 °C. Approximately 0.35,
0.7 and 3.5 μg of the pSICLOPPSKanR vector were used for each one of the tetra-, penta- and
hexapeptide libraries, respectively. The ligated DNA was then purified using spin columns
(Macherey-Nagel, Germany), transformed into electro-competent MC1061 cells prepared in-
house, plated onto LB agar plates containing 25 μg/mL chloramphenicol and incubated at 37 °C
for 14-16 h. This procedure resulted in the construction of the combined pSICLOPPS-NuX1X2X3-
X5 library with a total diversity of about 31,240,000 independent transformants, as judged by
plating experiments after serial dilutions.
Expression vector construction
For the construction of pETSOD1-GFP, the human SOD1 cDNA was generated by PCR-mediated
gene assembly using the primers GS100, GS101, GS102, GS103, GS104, GS105, GS106,
GS107, GS108, GS109, GS110, and GS111 (Supplementary Table 1). The assembled gene
was further amplified by PCR and the resulting product was digested with NdeI and BamHI, and
11
inserted into similarly digested pAβ42-GFP vector, in the place of Aβ42. For pETSOD1(A4V)-GFP,
SOD1 was amplified by PCR from the pETSOD1-GFP vector using the mutagenic forward primer
GS059 and the reverse primer GS060. The resulting PCR product was then digested with NdeI
and BamHI, and inserted into similarly digested pAβ42-GFP. For pETSOD1(G37R)-GFP,
pETSOD1(G85R)-GFP and pETSOD1(G93A)-GFP construction, SOD1 was mutated by overlap
extension PCR starting from pETSOD1-GFP as a template and using the following sets of primers:
GS058/GS059/GS112/GS113, GS058/GS059/GS114/GS115 and GS058/GS059/GS116/GS117,
respectively. All SOD1 PCR products were then digested with NdeI and BamHI, and inserted into
similarly digested pAβ42-GFP vector.
For the construction of pETSOD1, pETSOD1(G37R), pETSOD1(G85R) and
pETSOD1(G93A), the corresponding SOD1 genes were amplified by PCR from pETSOD1-GFP,
pETSOD1(G37R)-GFP, pETSOD1(G85R)-GFP and pETSOD1(G93A)-GFP, respectively, using
the primers SP006-SP004. For the construction of pΕΤSOD1(A4V), SOD1 was amplified from
pΕΤSOD1(A4V)-GFP using the primers SP007-SP004. All SOD1 PCR products were digested
with XbaI and BamHI, and cloned into similarly digested pET28a(+) (Novagen, USA).
In order to construct pASKSOD1-GFP, pASKSOD1(A4V)-GFP, pASKSOD1(G37R)-GFP,
pASKSOD1(G85R)-GFP and pASKSOD1(G93A)-GFP, the SOD1 genes were sub-cloned from
the corresponding pETSOD1-GFP vectors using XbaI and BamHI, and ligated into similarly
digested pASKp53-GFP (see below). Similarly, pASKSOD1, pASKSOD1(A4V),
pASKSOD1(G85R) and pASKSOD1(G93A) were constructed by sub-cloning the SOD1 genes
from the corresponding pETSOD1 vectors into pASK756 using XbaI and BamHI.
For the construction of pETp53-GFP, a truncated human TP53 gene encoding the DNA-
binding (core) domain of p53 (p53C, amino acids 94-312) was assembled by PCR using the
primers GS118, GS119, GS120, GS121, GS122, GS123, GS124, GS125, GS126, GS127,
GS128, GS129, GS130, GS131, GS132, and GS133. The PCR product was then digested with
NdeI and BamHI, and was inserted into similarly digested pETAβ42-GFP vector. For constructing
12
pETp53(Y220C)-GFP, the p53C-encoding gene was mutated by overlap PCR starting from
pETp53-GFP as a template and using primers GS003, GS004, GS007 and GS008, the PCR
product was digested with NdeI and BamHI, and inserted into similarly digested pAβ42-GFP vector.
pASKp53-GFP was generated by PCR amplification of the gene encoding for p53-GFP from
pETp53-GFP using primers GS002 and GS003 and ligated into pASK75 using the restriction sites
XbaI-HindIII.
For the construction of the pSICLOPPS vectors encoding for variants of the selected
AβC5-34 and AβC5-116 peptides, the auxiliary pSICLOPPSKanR vector was generated initially.
pSICLOPPSKanR was constructed by PCR amplification of the gene encoding aminoglycoside
3'-phosphotransferase (KanR - the enzyme conferring resistance to the antibiotic kanamycin)
from pET28a(+) using primers GS043-DG002, digestion with BglI and HindIII and insertion into
similarly digested pSICLOPPS. For the construction of the vectors pSICLOPPS-ΑβC5-34(S1C),
pSICLOPPS-ΑβC5-34(S1T), pSICLOPPS-ΑβC5-34(S3A), pSICLOPPS-ΑβC5-34(P4A) and
pSICLOPPS-ΑβC5-34(T5A), mutagenic PCR was carried out starting from pSICLOPPS-ΑβC5-
34 and using the forward primers IM033, IM034, IM036, IM037, IM038, respectively, along with
the reverse primer GS035, followed by digestion of the generated product with BglI and HindIII
and insertion into similarly digested pSICLOPPSKanR.
The vectors pSICLOPPS-ΑβC5-116(T1C), pSICLOPPS-ΑβC5-116(T1S), pSICLOPPS-
ΑβC5-116(F3A), pSICLOPPS-ΑβC5-116(D4A), pSICLOPPS-ΑβC5-116(R5A), pSICLOPPS-
ΑβC5-116(A2F), pSICLOPPS-ΑβC5-116(A2S), pSICLOPPS-ΑβC5-116(A2P), pSICLOPPS-
ΑβC5-116(A2T), pSICLOPPS-ΑβC5-116(A2Y), pSICLOPPS-ΑβC5-116(A2H), pSICLOPPS-
ΑβC5-116(A2K), pSICLOPPS-ΑβC5-116(A2E), pSICLOPPS-ΑβC5-116(A2W), pSICLOPPS-
ΑβC5-116(A2R), pSICLOPPS-ΑβC5-116(A2del), pSICLOPPS-ΑβC5-116(F3del) and
pSICLOPPS-ΑβC5-116(D4del) were generated in a similar fashion by starting from pSICLOPPS-
ΑβC5-116 as a template and using the mutagenic forward primers IM027, IM028, IM030, IM031,
IM032, IM043, IM044, IM045, IM046, IM047, IM048, IM049, IM050, IM051, IM052, IM039, IM040
13
and IM041, respectively, along with the reverse primer GS035. Digestion of the generated product
with BglI and HindIII, was followed by insertion into similarly digested pSICLOPPSKanR.
pSICLOPPS-ΑβC5-325, pSICLOPPS-ΑβC5-359, pSICLOPPS-ΑβC5-413, pSICLOPPS-
ΑβC5-479 were generated by PCR amplification using the template pSICLOPPS-Random1 and
the forward primers IM077, IM078, IM080 and IM081, respectively, along with the reverse primer
GS035, digestion with BglI and HindIII and ligation into similarly digested pSICLOPPSKanR.
Vectors pSICLOPPS(H24L;F26A)-ΑβC5-3, pSICLOPPS(H24L;F26A)-ΑβC5-2,
pSICLOPPS(H24L;F26A)-ΑβC5-17 pSICLOPPS(H24L;F26A)-ΑβC6-1,
pSICLOPPS(H24L;F26A)-ΑβC5-34 pSICLOPPS(H24L;F26A)-ΑβC5-26,
pSICLOPPS(H24L;F26A)-ΑβC5-21 pSICLOPPS(H24L;F26A)-ΑβC5-116,
pSICLOPPS(H24L;F26A)-Random1 and pSICLOPPS(H24L;F26A)-Random2 were constructed
by starting from the corresponding pSICLOPPS vectors encoding for the peptides TTVDR (AβC5-
3), TTYAR (AβC5-2), TTTAR (ΑβC5-17), TPVWFD (AβC6-1), TAWCR (ΑβC5-27), TTWCR
(ΑβC5-21), TAFDR (ΑβC5-116), random cyclic peptide 1 (undetermined sequence), random
cyclic peptide 2 (undetermined sequence), respectively, digestion with BglI and HindIII, and
ligation of the resulting inserts into the similarly digested auxiliary vector
pSICLOPPS(H24L;F26A)KanR. The auxiliary pSICLOPPS(H24L;F26A)KanR vector had been
generated previously using primers GS037 and DD015 to amplify and mutate the C-terminal
domain of the Ssp DnaE intein from pSICLOPPS and the resulting PCR product was digested
with NcoI and BglI and inserted into similarly digested pSICLOPPSKanR. All primer sequences
are described in Supplementary Table 1 and all constructed expression vectors are listed in
Supplementary Table 2.
Protein electrophoresis and western blot analysis
The utilized antibodies were a mouse monoclonal, horseradish peroxidase (HRP)-conjugated
anti-polyhistidine antibody (Sigma, USA;
14
http://www.sigmaaldrich.com/catalog/product/sigma/a7058?lang=en®ion=GR) at 1:2,500
dilution, a mouse monoclonal anti-FLAG (Sigma, USA;
http://www.sigmaaldrich.com/catalog/product/sigma/a8592?lang=en®ion=GR) at 1:1,000
dilution, a mouse anti-GFP at 1:20,000 dilution (Clontech, USA;
http://www.clontech.com/SI/Products/Fluorescent_Proteins_and_Reporters/Fluorescent_Protein
_Antibodies/ibcGetAttachment.jsp?cItemId=27547&fileId=5897131&sitex=10020:22372:US), a
mouse anti-Aβ (6Ε10) (Covance, USA;
https://www.antibodypedia.com/gene/668/APP/antibody/1457910/SIG-39320) at 1:2,000 dilution,
a mouse anti-CBD (New England Biolabs, USA; https://www.neb.com/products/e8034-anti-cbd-
monoclonal-antibody) at 1:25,000 or 1:100,000 dilution, and a HRP-conjugated goat anti-mouse
antibody (Bio-Rad, USA; http://www.bio-rad.com/en-jp/sku/1706516-goat-anti-mouse-igg-h-l-hrp-
conjugate) at 1:4,000.
Neuronal cell cultures
The utilized U87MG cells (human glioblastoma-astrocytoma, epithelial-like cell line) were a kind
gift from Dr. Maria Paravatou-Petsotas, Radiobiology Laboratory, Institute of Nuclear &
Radiological Sciences & Technology, Energy & Safety, NCSR “Demokritos” and have been
utilized previously to reproduce successfully published observations from the scientific literature.
This cell line was found to be free of mycoplasma contamination, as judged visually under
microscope observation and by regular DAPI staining of the cell cultures. The utilized
media/agents for U87MG cell cultures were obtained from Biochrom AG (Germany) and PAA
Laboratories (USA). U87MG cells were grown in Dulbecco's modified Eagle medium (DMEM),
supplemented with 10% fetal bovine serum (FBS), 2.5 mM L-glutamine, 1%
penicillin/streptomycin at 37 °C and 5% CO2. For MTT cytotoxicity studies, cells were plated at a
density of 2×104 cells per well in 96-well plates and incubated at 37 °C for 24 h to allow cells to
attach. The medium was subsequently removed and cells were rendered quiescent by incubation
15
in serum-free medium for 24 h. For cell viability measurements cells were subsequently treated
with the indicated concentrations of Aβ in the presence or absence of synthetic peptides, as
described in the corresponding paragraph of the Methods.
The human dopaminergic neuroblastoma cell line SH-SY5Y (kindly provided by Prof.
Leonidas Stefanis, University of Athens, Greece) was maintained in DMEM supplemented with
10% heat-inactivated fetal bovine serum, 2 mM glutamine and 1% non-essential amino acids
(complete medium). SH-SY5Y cells were treated with conditioned medium (CM) produced by (a)
the control cell line CHO and, (b) the Aβ-oligomer-producing cell line 7PA2 (kindly provided by
Prof. Dominic Walsh, Brigham & Women’s Hospital, USA and subsequently validated for their
cytotoxic Αβ-oligomer-secreting activity), derived upon stable transfection of CHO cells with
human APP bearing the Val717Phe familial AD mutation that leads to Aβ overproduction7. Both
CHO and CHO-7PA2 cell lines were maintained in complete medium with or without G418 (200
μg/mL - Invitrogen, USA). SH-SY5Y cells were exposed to solvent (no peptide), 5 μM AβC5-116
or 10 μΜ AβC5-34 for 24 h followed by the addition of the relevant CM derived from 7PA2 cells
(CMAβ) or CHO cells (CMcontrol). All cultures were maintained at 37 °C in a humidified 5% CO2
incubator. For CM preparation, CHO and 7PA2 cells were grown to approximately 90%
confluency, washed with PBS and incubated in serum-free DMEM for approximately 16 h. The
CM was collected and centrifuged to remove cell debris. 7PA2-derived Αβ oligomers and supplied
to primary cortical neurons were prepared, in the presence or absence of the selected cyclic
pentapeptides, in a similar manner.
Immunocytochemistry
Primary mouse cortical neurons were treated for 1 h at 37 °C with vehicle, 1 μΜ Aβ40, 1 μΜ Aβ40
+ 1 μΜ ΑβC5-34 or 1 μΜ Aβ40 + 1 μΜ ΑβC5-116. Aβ40 had been pre-aggregated for 3 d at 37 °C
in the presence or absence of the selected cyclic peptides before addition to neurons. Cell-free
cover slips were also used as negative controls to assess non-specific binding of Aβ to the glass.
16
After treatment, neurons were immunofluorescently labeled for Aβ binding to the cell surface using
the mouse monoclonal anti-Αβ antibody 6E10 (Covance, USA) (1:1000). To discriminate between
Aβ-specific labeling and labeling derived from staining full-length APP, neuronal
immunofluorescence analysis was also performed using the rabbit polyclonal C-terminal anti-APP
antibody R1(57)8 (1:1000), a kind gift from Dr. Pankj Mehta (Institute for Basic Research in
Developmental Disabilities, Staten Island, New York), which does not recognize Αβ. Briefly, after
removing the medium and rinsing with PBS twice, neurons were fixed in 4% paraformaldehyde
(in PBS, pH 7.4) for 15 min at room temperature (RT). Cells were then washed three times with
PBS and non-specific binding was blocked with 10% normal goat serum (NGS), 0.1% Triton X-
100 (in PBS) for 60 min at RT. Then, neurons were doubly immunolabeled by overnight incubation
at 4 oC with 6E10 and R1(57) diluted in PBS, 10% NGS, 0.1% Triton X-100. Subsequently, cells
were rinsed three times with PBS and incubated for 1 h at RT with Alexa Fluor 488-labeled anti-
mouse IgG (ThermoFisher Scientific, USA) and Cy3-labeled anti-rabbit IgG (ThermoFisher
Scientific, USA) secondary antibodies (1:2,500) diluted in PBS, 1% NGS, 1% Triton X-100.
Following washing, cell nuclei were counterstained with DAPI (1:1000) for 5 min, and coverslips
were mounted with mounting medium. Digital images of neurons were acquired using a 40×
objective lens in a Αxio observer Z1 fluorescence microscope (Zeiss, Germany) supported by the
ZEN 2012 (blue edition) software. 15-20 images were obtained for each experimental condition
and experiment. Images of all samples within an experiment were acquired using identical image
acquisition settings for each fluorophore.
In vivo assays in C. elegans
Paralysis assay. Synchronized L4 larvae CL2006 animals (90-120 animals per condition) were
transferred to NGM plates containing living bacteria biosynthetically producing ΑβC5-34, ΑβC5-
116 or a randomly selected cyclic peptide sequence at 20 °C. Synchronized CL4176 animals
(150-300 animals per condition) were transferred to NGM plates containing synthetic ΑβC5-34,
17
ΑβC5-116 or 0.26% DMSO at 16 °C for 48 h before transgene induction via temperature up-shift
to 25 °C. Synchronized offspring were randomly distributed to treatment plates to avoid systematic
differences in egg lay batches. Treatment and control plates were handled, scored and assayed
in parallel. Scoring of paralyzed animals was initiated at day 1 of adulthood for the CL2006 strain
and 24 h after temperature up-shift for the CL4176 strain. Nematodes were scored as paralyzed
upon failure to move their half end-body upon prodding. Animals that died were excluded. Plates
were indexed as 1, 2, 3 etc by an independent person and were given to the observer for scoring
in random order. The index was revealed only after scoring. The log-rank (Mantel–Cox) test was
used to evaluate differences between paralysis curves and to determine P values for all
independent data. n in paralysis figures is the number of animals that paralyzed over the total
number of animals used (the number of paralyzed animals plus the number of dead and censored
animals). Median paralysis values are expressed as mean ± s.e.m.
Dot blot Analysis. CL4176 animals were allowed to lay eggs for 3 h on NGM plates containing
either synthetic peptides or 0.26% DMSO. Paralysis was induced upon temperature up-shift and
the progeny were exposed to either pure peptides or 0.26% DMSO until 50% of the control
population was paralyzed. The animals were then collected and boiled in non-reducing Laemmli
buffer. For dot blot analysis, 1–5 µg of protein lysates were spotted onto 0.2 μm nitrocellulose
membranes (Bio-Rad, USA) after soaking into TBS pre-heated at 80 °C. Immunoblotting was
performed using the anti-Αβ antibody 6E10 (recognizes total Aβ) and the anti-amyloid protein,
oligomer-specific antibody AB9234 (Merck Millipore, Germany;
https://www.merckmillipore.com/INTL/en/product/Anti-Amyloid-Oligomer-Antibody%2C
%CE%B1%CE%B2%2C-oligomeric,MM_NF
AB9234?ReferrerURL=https%3A%2F%2Fwww.google.gr%2F&bd=1). Actin was used as a
loading control. Blots were developed with chemiluminescence by using the ClarityTM Western
ECL substrate (Bio-Rad, USA). Quantification of the ratio of each detected protein to actin using
18
the anti-actin antibody sc-1615 (Santa Cruz, Germany; http://datasheets.scbt.com/sc-1615.pdf),
and normalization to control appears next to each representative blot.
Confocal microscopy analysis. For Aβ3-42 deposit measurements, synchronized (at the L4 larval
stage) CL2331 and CL2179 (control strain) animals exposed to solvent (0.26% DMSO), 10 μΜ
ΑβC5-34 or 5 μM ΑβC5-116 and grown at 20 C (to induce aggregation) until day 2 of adulthood
were collected. Animals were mounted onto 2% agarose pads on glass slides, anesthetized with
10 mM levamisole and observed at RT using a Leica TCS SPE confocal laser scanning
microscope (Leica Lasertechnik GmbH, Germany). The LAS AF software was used for image
acquisition. At least twenty animals/condition in three independent experiments were processed.
Images of whole worms and focused images in the posterior area of nematodes were acquired
with 10 x 0.45 and 20 x 0.70 numerical aperture, respectively.
Computational Methods
In order to study the interactions of the selected cyclic peptides with Aβ and to determine their
possible binding sites, we selected as a model the 3D structure of an Aβ42 protofibril previously
proposed based on data collected by NMR (PDB ID: 2BEG, model 10)9 (Supplementary Fig. 7a),
which has been previously utilized for similar purposes10. Missing residues were added with
Pymol11 and, in accordance to previous studies12, residues 1 to 8 were omitted given their
unimportance for fibril growth13, 14 and for the structural dynamics of the remainder residues13, 15.
The lack of the eight N-terminal residues was tackled by capping with an acetyl group (ACE),
while addition of residues 9 to 16 yielded the final sequence of the monomer, namely
ACE-GY10EVHHQKLVFF20AEDVGSNKGA30IIGLMVGGVV40IA12, bearing a net charge of –2.
Each monomer consists of two β-strands, β1 (residues G9−S26) and β2 (residues I31-A42),
connected by a U-bent turn spanning the four residues N27-A30 (Supplementary Fig. 7a). The
cyclic pentapeptides examined were initially sketched in ACD/ChemSketch,16 and 3D structures
19
were consequently obtained utilizing the ANTECHAMBER module17 of the AMBER 12 suite of
programs16 (Supplementary Fig. 7b).
Molecular docking calculations. Both the Aβ pentameric model (receptor) and cyclic peptide
(ligand) structures were prepared for docking calculations in AutoDock Vina18, by means of
AutoDock Tools 1.5.619, 20. Our docking studies were performed intermediately to MD simulations,
following a scheme which is detailed below, and assisted in revealing regions with affinity towards
peptide binding. Specifically, MD simulations revealed possible regions of peptide affinity
(Supplementary Fig. 7c, top), and docking positions were then delimited by five grid boxes
(Supplementary Fig. 7c, bottom). Partial atomic charges were assigned to all systems according
to the Kollman United Atom scheme, by previously merging non-polar hydrogens to heavy atoms.
Three-dimensional affinity maps were generated by AutoGrid for each peptide atom type along
with electrostatic and desolvation maps for the Aβ pentamer unit. All five grid boxes had 1.000 Å
spacing and dimensions 22×22×22, setting the exhaustiveness equal to 200; the lowest energy
complex structures were then used as initial structures in MD simulations.
Molecular Dynamics simulations. All systems were modeled using the ff99SB force field21, adding
Na+ counter ions to achieve electroneutrality. Water solvent molecules were explicitly added to all
systems by means of the TIP3P model22, by using a truncated octahedron unit cell and by
imposing a distance of at least 15 Å between any atom of the complex and the box boundaries.
This was selected since the Aβ pentameric model shows great flexibility and large conformational
changes were expected to occur during the MD simulations13. Prior to production runs, close
contacts between atoms were removed by performing a total of 20,000 energy minimization
cycles, imposing positional restraints on solute atoms with a harmonic force constant. The
restraint was gradually lifted every 5,000 steps starting from 500 to 10, 2 and 0 kcal mol-1 Å-2,
respectively. The Particle Mesh Ewald (PME) method23, 24 was applied on long-range electrostatic
interactions. Initial heating to 310 K for 100 ps in the NVT ensemble, having a 10 kcal mol-1 Å-2
harmonic force constant restraint on Aβ and peptide atoms, was followed by a 100-ps density
20
equilibration run in the NPT ensemble, imposing the same restraint. Temperature was maintained
by Langevin thermostat25 with a collision frequency equal to 2 ps-1 25 and the non-bonded cutoff
was set to 10 Å. Then, 100-ps unrestrained equilibration runs in the NPT ensemble followed, at
constant pressure of 1 bar using the Langevin barostat. All bonds involving hydrogen were
constrained to their equilibrium bond lengths using SHAKE26 and the integration step was set to
2 fs. Simulations were performed by means of the PMEMD GPU accelerated AMBER module24,
27, 28 using the standard fixed point precision model (SPFP)28. The pentameric model unit was first
subjected to 100 ns MD simulations in order to extract its most preferable conformational state.
Clustering analysis was performed in order to find the most populated cluster of the pentamer unit
by imposing a 2.5 Å RMSD cutoff, using the gromos algorithm29 as implemented within the
g_cluster utility of the GROMACS 4.6.4 software30. The centroid cluster structure accounts for 75%
of the total population, in agreement with previous studies12, and served as the starting point for
subsequent simulations. Then, a single MD simulation of 100 ns duration in the NPT ensemble
ensued, placing five cyclic peptides in a radius of 5 Å around the Aβ pentameric model centroid
unit. Upon completion, spatial distribution functions (SDF) were evaluated by means of the
GROMACS g_spatial module30. SDF analysis revealed areas of preference towards the Aβ
surface (Supplementary Fig. 7c, top), which were then partitioned into five different grid boxes
for docking calculations (Supplementary Fig. 7c, bottom). Binding sites were individually tested
using the lowest energy pose of each one as the initial structure for additional 20-ns MD
simulations. Hydrogen bond (HB) analysis was performed by setting a donor-acceptor distance
cut-off at 3.5 Å and the angle of donor−hydrogen−acceptor at 150° by means of the CPPTRAJ
program. Figures were prepared by means of the VMD software31.
MM–PBSA calculations. The Molecular Mechanics Poisson–Boltzmann Surface Area (MM-PBSA)
method performs well for predicting relative binding energies32. It calculates the interaction energy
in the gas phase with molecular mechanics and estimates the solvation free energy by solving
the Poisson–Boltzmann equation33, 34; the equations can be found elsewhere35. Following the
21
work by Wright et al.36, where the use of multiple replica simulations of relatively short duration
showed well converged energy estimates and improved relative binding strengths of several
HIV‑1 protease inhibitors36, we performed 20×4 ns individual simulations to be used in MM-PBSA
calculations. In calculating the total binding free energy (ΔGbind) contributions of each complex,
8,000 trajectory frames were used for the enthalpy term (ΔH), while the conformational entropy
contribution (–TΔS) was evaluated by normal mode analysis over 1,000 trajectory frames, for
efficiency reasons37.
SOD1 purification and preparation of stocks and solutions
SOD1 or mutants thereof were overexpressed from the appropriate pET-SOD1 or pASK-SOD1
vectors in E. coli Origami 2(DE3) cells in LB medium containing 50 μg/mL kanamycin (for pET-
SOD1) or 100 μg/mL ampicillin (for pASK-SOD1), 200 μM CuCl2, and 200 μΜ ZnCl2 by the
addition of 0.01 mM IPTG (for pET-SOD1) or 0.2 μg/mL anhydrotetracycline (aTc) (for pASK-
SOD1), either at 37 °C for 2-3 h or at 18 °C for about 16 h. Origami 2(DE3) cells were utilized in
order to provide an oxidizing cytoplasmic environment and to promote correct formation of
disulfide bonds38, which are required for proper SOD1 folding and function39. Under these
conditions, bacterially produced SOD1 is produced in dimeric and enzymically active form
(Supplementary Fig. 10), while it simultaneously co-exists with misfolded, soluble and insoluble
SOD1 oligomeric/aggregated species (Supplementary Fig. 8c; Supplementary Fig. 10). Thus,
as described previously, the acquired protein is found in a state that resembles the conditions
encountered in human cells under stressful or pathogenic conditions40. The appearance of
misfolded SOD1 oligomers/aggregates is enhanced with increasing incubation temperatures
(Supplementary Fig. 10). Thus, for assays that are more appropriate for monitoring the early
steps of SOD1 oligomerization/aggregation, such as dynamic light scattering (DLS), we utilized
SOD1 produced at 18 °C, whereas for assays that are more appropriate for monitoring the later
22
steps of SOD1 aggregation, such as filter retardation, ThT staining and CD spectroscopy, we
utilized SOD1 produced at 37 °C.
Cell pellets from 1 L cultures were collected after SOD1 overexpression by centrifugation,
re-suspended in 20 mL lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0)
and lysed by brief sonication steps on ice. The soluble cell lysate was collected after centrifugation
at 13,000 × g for 15 min at 4 °C, and was mixed with 1 mL Ni-NTA agarose resin (Qiagen,
Germany) for 1 h at 4 °C on a roller mixer before loading onto a 5 mL polypropylene
chromatography column (Pierce, USA). Column-bound protein was washed twice with 10 mL
wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) and eluted in three
fractions, each consisting of 1 mL elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM
imidazole, pH 8.0). Imidazole was removed after protein purification by dialysis against buffer
(100 mM Tris, 300 mM NaCl, 200 μΜ CuSO4 and 200 μM ZnSO4, pH 6.8) overnight at 4 °C. The
purified protein was quantified using the assay described by Bradford41. SOD1 used for DLS
analyses was further purified by size-exclusion chromatography (SEC) using a Superdex75
10/300GL column (GE Healthcare, USA), to isolate the dimeric protein fraction in TBS buffer, pH
7.4. DLS analysis was performed on the purified sample for verification of the dimeric state of
SOD1 (Supplementary Fig. 10). Purified SOD1 was incubated with or without the selected cyclic
peptides in 40 μM solutions in PBS under the indicated conditions.
23
Supplementary Figures
a
b
Peptide type General formulaa Theoretical diversity Actual library
coverage
Tetrapeptides cyclo-NuX1X2X3 3×203 = 24,000
Pentapeptides cyclo-NuX1X2X3X4 3×204 = 480,000
Hexapeptides cyclo-NuX1X2X3X4X5 3×205 = 9,600,000
Combined library cyclo-NuX1X2X3-X5 10,104,000 ×2 aNu=C, S, or T; X=anyone of the twenty natural amino acids
c
24
d
25
Supplementary Figure 1. Characterization of the generated combinatorial oligopeptide library
cyclo-NuX1X2X3-X5. (a) (Left) Schematic of the pSICLOPPS-NuX1X2X3-X5 vector library encoding
the combinatorial oligopeptide library cyclo-NuX1X2X3-X5. Nu: Cys (C), Ser (S), or Thr (T); X: any
of the 20 natural amino acids; NNS: randomized codons, where N=A, T, C or G and S=G or C; IC:
C-terminal fragment of the split Ssp DnaE intein; IN: N-terminal fragment of the split Ssp DnaE
intein; CBD: chitin-binding domain. (Right) Intein-mediated peptide cyclization using SICLOPPS.
The tetra-partite fusion undergoes intein splicing upon intein fragment re-association, leading to
peptide cyclization and the production of the cyclo-NuX1X2X3-X5 library. (b) Theoretical and actual
diversity of the constructed combinatorial cyclo-NuX1X2X3-X5 oligopeptide library, determined as
described in the Supplementary Results and Supplementary Methods sections. (c) Indicative
western blot analysis using an anti-CBD antibody of fourteen randomly selected individual clones
from the constructed cyclo-NuX1X2X3X4X5 hexapeptide sub-library, demonstrating that individual
clones can exhibit variable levels of expression. Lanes 4, 6, 11 and 12 correspond to clones that
contain stop codons or frameshifts and, thus, do not express a full-length IC-peptide-IN-CBD
tetrapartite fusion or generate cyclic peptide product. (d) Heat maps depicting the amino acid
distribution at each position of the constructed cyclo-CysX1X2X3-X5, cyclo-SerX1X2X3-X5, and
cyclo-ThrX1X2X3-X5 oligopeptide libraries, as determined by deep sequencing analysis of the
peptide-encoding region of the generated pSICLOPPS-NuX1X2X3-X5 vector library.
26
a
b
27
c d
Supplementary Figure 2. Genetic screening for the identification of macrocyclic rescuers of
disease-associated protein misfolding. (a) Schematic of the utilized MisP-GFP genetic system for
monitoring MisP folding and misfolding and for identifying macrocyclic rescuers of MisP misfolding
in E. coli cells. (b) SDS-PAGE/western blot analysis using an anti-CBD antibody of the ten
individual selected clones investigated in Table 1 (top). The upper band of ~25 kDa corresponds
to the IC-peptide sequence-IN-CBD precursor, while the lower band of ~20 kDa corresponds to
the processed IN-CBD product, whose appearance is an indication of successful cyclic peptide
formation. CBD: chitin-binding domain. (c) Fluorescence of BL21(DE3) cells co-expressing Αβ42-
GFP, SOD1(A4V)-GFP or p53(Y220C)-GFP, from the vectors pETΑβ42-GFP, pETSOD1(A4V)-
GFP or pETp53(Y220C)-GFP, respectively, together with the cyclic peptides encoded by the
selected clones 7 and 10, which were isolated after the second round of FACS sorting depicted
in Table 1 (top). For each fusion, the fluorescence of the cell population producing a random
cyclic peptide was arbitrarily set to 100. Experiments were carried out in replica triplicates (n=1
independent experiment) and the reported results correspond to the mean value ± s.e.m. (d)
Fluorescence of BL21(DE3) cells co-expressing Αβ-GFP fusions that include the indicated Αβ
variants together with the cyclic peptides encoded by the selected clones 7 and 10, which were
isolated after the second round of FACS sorting depicted in Table 1 (top). Τhe Aβ42-GFP
fluorescence of the cell population producing a random cyclic peptide was arbitrarily set to 100.
Experiments were carried out in replica triplicates (n=1 independent experiment) and the reported
results correspond to the mean value ± s.e.m.
28
a
b
c
Supplementary Figure 3. CD and ThT spectra of cyclic peptide:Aβ42 solutions at 2:1 ratio. (a)
CD spectra of 50 µM Aβ42 in phosphate buffer (10 mM, pH 7.33) in the presence of 100 µM of
ΑβC5-34 or ΑβC5-116. Spectra were collected for a period of 30 days at 33 °C. (b) ThT
fluorescence spectra after ThT addition to the aged (30 d) CD solutions shown in (a). (c) CD
spectra of Αβ-free solutions of ΑβC5-116, ΑβC5-34, and SOD1C5-4 at 50 (black) and 100 µM
(blue) solutions in phosphate buffer (10 mM, pH 7.33) after 30 d at 33 °C.
29
a
b
c
30
d
Supplementary Figure 4. The selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116 inhibit Αβ-
induced cytotoxicity in vitro. (a) Effect of pre-incubation time on the cytotoxicity of Aβ solutions. Cell
viability of primary hippocampal neurons, as determined by the MTT assay, treated for 24 h at 37 °C
with 1 μΜ solutions of Aβ40 or Aβ42, pre-aggregated for time periods ranging from 0–25 d. An MTT
stock solution in Neurobasal-A complete medium was added to each well at a final concentration of
0.5 mg/mL and incubated for 3 h at 37 °C. (b) Cell viability as determined by the MTT assay of
serum-starved U87MG cells treated for 24 h at 37 °C without Aβ (white bars) or with 1 μΜ solutions
of Aβ40 or Aβ42, previously aggregated in the presence or absence of 1 and 2 μΜ of ΑβC5-34 (left)
or ΑβC5-116 (right). A MTT stock solution in DMEM complete medium was added to each well at
a final concentration of 1 mg/mL and incubated for 4 h at 37 °C. Before addition to the cells, all Aβ40
solutions were pre-aggregated for 3 d and all Aβ42 solutions were pre-aggregated for 1 d. (c) Cell
viability as determined by crystal violet staining of SH-SY5Y human neuroblastoma cells exposed
to conditioned medium (CM) containing secreted human Aβ42 oligomers from cultured 7PA2 cells7
(CMΑβ) and treated without cyclic peptide (no peptide), with 10 μΜ AβC5-34, or with 5 μM AβC5-
116, for 2 h. The viability of SH-SY5Y cells exposed το CMΑβ in the absence of cyclic peptide was
set to 100%. The addition of the selected cyclic peptides to CM from control CHO cell cultures did
not affect SH-SY5Y viability. (d) Cell viability of primary mouse hippocampal neurons (left) and
serum-starved U87MG cells (right) as determined by the MTT assay after treatment for 24 h at
37 °C without Aβ (white bars) or with 1 μΜ solutions of Aβ40 or Aβ42, which had been pre-aggregated
in the presence or absence of 1 μΜ SOD1C5-4 for 3 and 1 d, respectively. In (a), (b), and (d), results
are expressed as the percentage of MTT reduction, assuming that the absorbance of control
(untreated) cells was 100%, and the mean values ± s.e.m. of three independent experiments (n=3)
with six replicate wells for each condition are reported. Statistical significances of the differences in
the levels of viability between cells untreated and treated with Αβ (a) or between cells treated with
Αβ in the presence and absence of the selected cyclic peptides (b-d) are presented.
31
Supplementary Figure 5. The selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116 inhibit Αβ-
induced aggregation and toxicity in vivo in a dose-dependent manner. Paralysis curves of C.
elegans CL4176 expressing human Aβ42 and treated with synthetic AβC5-34 (blue) and AβC5-
116 (red) at the indicated concentrations. The “No peptide” sample (control) is common for all
experiments and contains the same amount of solvent (DMSO) as in the samples containing
synthetic cyclic peptides (0.26% final plate concentration). No peptide: mean=29.00±0.1,
n=651/659. AβC5-34 (2 μM): mean=29.20±0.1, n=144/147, ns; AβC5-34 (5 μΜ): mean=
28.78±0.2, n=600/606, P<0.01; ΑβC5-34 (10 μΜ): mean=31.0±0.2, n=789/806, P<0.0001; AβC5-
34 (15 μΜ): mean=28.79±0.2, n=588/599, ns. AβC5-116 (2 μM): mean=29.77±0.2, n=726/736,
P<0.001; ΑβC5-116 (5 μΜ): mean=31.0±0.1, n=733/743, P<0.0001; AβC5-116 (10 μΜ):
mean=32.65±0.2, n=564/571, P<0.001; AβC5-116 (15 μΜ): mean=33.57±0.1, n=151/153,
P<0.001; AβC5-116 (30 μΜ): mean=33.66±0.2, n=80/87, P<0.001
32
a
b
33
c
Supplementary Figure 6. Sequence analysis of the selected cyclic TXXXR pentapeptides
targeting Αβ. (a) Fluorescence of E. coli BL21(DE3) cells co-expressing Aβ42-GFP and four
individual cyclic peptide sequences appearing after the second round of FACS sorting (Fig. 1b)
in the selected population only at low frequencies as shown in Supplementary Table 5. The
fluorescence of the cell population producing a random cyclic peptide (random 1) was arbitrarily
set to 100. Experiments were carried out in replica triplicates (n=1 independent experiment) and
the reported values correspond to the mean value ± s.e.m. (b) Frequency of appearance of
codons corresponding to the twenty natural amino acids at positions 2, 3, and 4 of the peptide-
encoding region of the pSICLOPPS-NuX1X2X3-X5 vectors contained in the bacterial clones
isolated after the second round of FACS sorting (Fig. 1b) that encoded for TXXXR cyclic
pentapeptides (1,901,945 reads corresponding to TXXXR cyclic pentapeptides out of 4,530,567
total reads that appeared more than 50 times in the sorted peptide pool). (c) Frequency of
appearance of the twenty natural amino acids at positions 2, 3, and 4 of the unique TXXXR cyclic
pentapeptides encoded by the pSICLOPPS-NuX1X2X3-X5 vectors contained in the bacterial
clones isolated after the second round of FACS sorting (Fig. 1b) (159 unique peptide sequences
corresponding to TXXXR cyclic pentapeptides out of 605 total unique selected peptide sequences
that appeared more than 50 times in the sorted peptide pool).
34
a
b
c
35
d
Supplementary Figure 7. Computational modelling of ΑβC5-34 and ΑβC5-116 binding to Αβ. (a)
Initial (left) and 100 ns MD simulation (right) cluster centroid structures of the Aβ protofilament
model used in this study. A-E indicate each one of the five Αβ chains comprising the utilized
pentameric Aβ protofilament model. (b) Energy-minimized structures of the selected cyclic
pentapeptides AβC5-34 and AβC5-116 according to the AMBER ff99SB force field21. Each amino
acid is designated by its single-letter abbreviation. (c) (top) Spatial distribution function (SDF)
isosurfaces of the cyclic peptides ΑβC5-34 (red) and ΑβC5-116 (blue) around the Aβ protofibril.
(bottom) SDF-guided partitioning of the Aβ protofibril into five grid boxes, common for both cyclic
peptides, in order to examine possible binding positions. (d) Energy decomposition analysis of
the Aβ/ΑβC5-34 (top) and Aβ/ΑβC5-116 (bottom) complexes. Amino acids with favorable and
unfavorable binding contributions are indicated in blue and red color, respectively.
36
a b
c
d
e f
37
g
Supplementary Figure 8. Genetic screening for the identification of macrocyclic rescuers of
mutant SOD1 misfolding and aggregation. (a) Relative fluorescence of E. coli Origami 2(DE3)
cells overexpressing chimeric SOD1-GFP fusions from the corresponding pETSOD1-GFP
vectors (left), following the addition of 0.01 mM IPTG and growth at 37 °C for 2 h, and from the
corresponding pASKSOD1-GFP vectors (right), by the addition of 0.2 μg/mL aTc and growth at
37 °C for 2 h,. Wild-type (WT) SOD1-GFP fluorescence was arbitrarily set to 100. Mean values ±
s.e.m. are reported (n=3 independent experiments, each one performed in triplicate). (b) Solubility
analysis of SOD1-GFP fusions overexpressed as in (a, left) by SDS-PAGE/western blotting using
an anti-polyHis antibody. Representative data from n=2 independent experiments are presented.
(c) Solubility analysis of SOD1 variants overexpressed as in as in (a, left) by SDS-PAGE/western
blotting using an anti-polyHis antibody. Representative data from n=2 independent experiments
are presented. The assay was performed using E. coli Origami 2(DE3) cells overexpressing GFP-
free SOD1 from the corresponding pETSOD1 vectors by the addition of 0.01 mM IPTG at 37 °C
for 2 h. (d) SDS-PAGE/western blot analysis using an anti-polyHis antibody of E. coli Origami
2(DE3) cells overexpressing GFP-free SOD1 from the corresponding pASKSOD1 vectors by the
addition of 0.2 μg/mL aTc at 37 °C for 2 h. (e) Western blot analysis using an anti-CBD antibody
of the four individual selected clones investigated in Table 1 (bottom). The upper band of ~25
kDa corresponds to the IC-peptide sequence-IN-CBD precursor, while the lower band of ~20 kDa
corresponds to the processed IN-CBD product, whose appearance is an indication of successful
cyclic peptide formation. CBD: chitin-binding domain. (f) Fluorescence of E. coli Origami 2(DE3)
cells co-expressing SOD1(A4V) or Αβ42-GFP from the vectors pETSOD1(A4V)-GFP or pETΑβ42-
GFP, respectively, together with the cyclic peptides encoded by the selected clones 1-4
investigated in Table 1 (bottom). SOD1(A4V)-GFP fluorescence of the cell population producing
a random cyclic peptide was arbitrarily set to 100. Experiments were carried out in replica
triplicates (n=1 independent experiment) and the reported data correspond to the mean value ±
s.e.m. (g) Solubility analysis of SOD1(A4V)-GFP overexpressed with/without the four selected
cyclic peptide sequences shown in Fig. 7c by SDS-PAGE/western blotting using an anti-polyHis
antibody.
38
a
39
b
Supplementary Figure 9. Sequence analysis of the selected cyclic TXSXW pentapeptides
targeting SOD1(A4V). (a) Frequency of appearance of codons corresponding to the twenty
natural amino acids at positions 2 and 4 of the peptide-encoding region of the pSICLOPPS-
NuX1X2X3-X5 vectors contained in the bacterial clones after the fourth round of FACS sorting (Fig.
7b) that encoded for TXSXW cyclic pentapeptides (3,939,406 reads corresponding to TXSXW
cyclic pentapeptides out of 4,243,704 total reads that appeared more than 50 times in the sorted
peptide pool). (b) Frequency of appearance of the twenty natural amino acids at positions 2 and
4 of the unique TXSXW cyclic pentapeptides encoded by the pSICLOPPS-NuX1X2X3-X5 vectors
contained in the bacterial clones isolated after the fourth round of FACS sorting (Fig. 7b) (46
unique peptide sequences corresponding to TXSXW cyclic pentapeptides out of 367 total unique
selected peptide sequences that appeared more than 50 times in the sorted peptide pool).
40
a
b
41
c
d
Supplementary Figure 10. SOD1(A4V) purification and characterization. (a) DLS analysis of
SOD1(A4V) immediately after IMAC purification (as purified) following overexpression in E. coli
Origami 2(DE3) cells at 18 °C (blue) or 37 °C (orange). (b) SEC analysis of SOD1(A4V) as in (a).
(c) SDS-PAGE, native PAGE, and in-gel activity42 analysis of SOD1(A4V) fractions collected after
SEC as described in (b). The esterolytic enzyme EstDZ243 (MW=28.4, pI=5.96) was utilized as a
MW marker for native PAGE. (d) DLS analysis of SOD1(A4V) immediately after SEC following
overexpression in E. coli Origami2(DE3) cells at 18 °C and IMAC purification.
42
Supplementary Tables
Supplementary Table 1. PCR primers used in this study.
Name Primer sequence (5'à3') Use
GS032 GGAATTCGCCAATGGGGCGATCGCCCACAATTGC(NNS)3TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the CysX1X2X3 sub-library. BglI site is underlined.
GS033 GGAATTCGCCAATGGGGCGATCGCCCACAATAGC(NNS)3TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the SerX1X2X3 sub-library. BglI site is underlined.
GS034 GGAATTCGCCAATGGGGCGATCGCCCACAATACC(NNS)3TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the ThrX1X2X3 sub-library. BglI site is underlined.
GS072 GGAATTCGCCAATGGGGCGATCGCCCACAATTGC(NNS)4TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the CysX1X2X3X4 sub-library. BglI site is underlined.
GS073 GGAATTCGCCAATGGGGCGATCGCCCACAATAGC(NNS)4TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the SerX1X2X3X4 sub-library. BglI site is underlined.
GS074 GGAATTCGCCAATGGGGCGATCGCCCACAATACC(NNS)4TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the ThrX1X2X3X4 sub-library. BglI site is underlined.
GS075 GGAATTCGCCAATGGGGCGATCGCCCACAATTGC(NNS)5TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the CysX1X2X3X4X5 sub-library. BglI site is underlined.
GS076 GGAATTCGCCAATGGGGCGATCGCCCACAATAGC(NNS)5TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the SerX1X2X3X4X5 sub-library. BglI site is underlined.
GS077 GGAATTCGCCAATGGGGCGATCGCCCACAATACC(NNS)5TGCTTAAGTTTTGGC
Degenerate forward primer for the construction of the ThrX1X2X3X4X5 sub-library. BglI site is underlined.
GS035 AAAAAAAAGCTTTCATTGAAGCTGCCACAAGG
Reverse primer annealing to CBD. HindIII site is underlined.
GS069 AAAAAAGCCAATGGGGCGATCGCCCACAATTGC
Forward zipper primer for the construction of the Cys sub-libraries. BglI site is underlined.
GS070 AAAAAAGCCAATGGGGCGATCGCCCACAATAGC
Forward zipper primer for the construction of the Ser sub-libraries. BglI site is underlined.
GS071 AAAAAAGCCAATGGGGCGATCGCCCACAATACC
Forward zipper primer for the construction of the Thr sub-libraries. BglI site is underlined.
GS100 ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATC
Forward primer for the SOD1 gene assembly (segment 1).
43
GS101 CACACCTTCACTGGTCCATTACTTTCCTTCTGCTCGAAATTGATGATGCCCTGCACTGGG
Reverse primer for the SOD1 gene assembly (segment 1).
GS102 GGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCC
Forward primer for the SOD1 gene assembly (segment 2).
GS103 CTGGTACAGCCTGCTGTATTATCTCCAAACTCATGAACATGGAATCCATGCAGGCC
Reverse primer for the SOD1 gene assembly (segment 2).
GS104 CAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGG
Forward primer for the SOD1 gene assembly (segment 3).
GS105 GTCTCCAACATGCCTCTCTTCATCCTTTGGCCCACCGTGTTTTCTGGATAGAGG
Reverse primer for the SOD1 gene assembly (segment 3).
GS106 GAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCG
Forward primer for the SOD1 gene assembly (segment 4).
GS107 CCTGAGAGTGAGATCACAGAATCTTCAATAGACACATCGGCCACACCATCTTTGTC
Reverse primer for the SOD1 gene assembly (segment 4).
GS108 CTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCAC
Forward primer for the SOD1 gene assembly (segment 5).
GS109 GCCCAAGTCATCTGCTTTTTCATGGACCACCAGTGTGCGGCCAATGATGC
Reverse primer for the SOD1 gene assembly (segment 5).
GS110 GCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGC
Forward primer for the SOD1 gene assembly (segment 6).
GS111 TTGGGCGATCCCAATTACACCACAAGCCAAACGACTTCCAGCGTTTCCTGTCTTTGTAC
Reverse primer for the SOD1 gene assembly (segment 6).
GS059 AAAAAAGGATCCACTAGTTTGGGCGATCCCAATTACACC
Reverse primer for the construction of pETSOD1-GFP, pETSOD1(A4V)-GFP, pETSOD1(G37R)-GFP, pETSOD1(G85R)-GFP and pETSOD1(G93A)-GFP. BamHI site is underlined.
GS060 AAAAAACATATGGCGACGAAGGTGGTGTGCGTGCTG
Forward primer for the construction of pETSOD1(A4V)-GFP. NdeI site is underlined.
GS058 AAAAAACATATGGCGACGAAGGCCGTGTGCGTG
Forward primer for the construction of pETSOD1-GFP, pETSOD1(G37R)-GFP, pETSOD1(G85R)-GFP and pETSOD1(G93A)-GFP. NdeI site is underlined.
GS112 GTGGGGAAGCATTAAAcGACTGACTGAAGGCC
Forward overlap primer for SOD1(G37R) mutagenesis.
GS113 GGCCTTCAGTCAGTCgTTTAATGCTTCCCCAC
Reverse overlap primer for SOD1(G37R) mutagenesis.
GS114 CATGTTGGAGACTTGcGCAATGTGACTGCTG
Forward overlap primer for SOD1(G85R) mutagenesis.
44
GS115 CAGCAGTCACATTGCgCAAGTCTCCAACATG
Reverse overlap primer for SOD1(G85R) mutagenesis.
GS116 CTGCTGACAAAGATGcTGTGGCCGATGTGTC
Forward overlap primer for SOD1(G93A) mutagenesis.
GS117 GACACATCGGCCACAgCATCTTTGTCAGCAG
Reverse overlap primer for SOD1(G93A) mutagenesis.
SP006 AAAAAATCTAGAAGGAGGAAACGATGGACTACAAGGACGACGATGACAAGGCGACGAAGGCCGTGTGCGTG
Forward primer for the construction of pETSOD1(WT), pETSOD1(G37R), pETSOD1(G85R) and pETSOD1(G93A). XbaI site and FLAG-tag are underlined.
SP004 AAAAAAAGCTTGGATCCTTAGTGGTGGTGGTGGTGGTGTTGGGCGATCCCAATTACACC
Reverse primer for the construction of pETSOD1, pETSOD1(A4V)-GFP, pETSOD1(G37R), pETSOD1(G85R) and pETSOD1(G93A). HindIII, a BamHI site and 6×His-tag are underlined.
SP007 AAAAAATCTAGAAGGAGGAAACGATGGACTACAAGGACGACGATGACAAGGCGACGAAGGTGGTGTGCGTG
Forward primer for the construction of pETSOD1(A4V). XbaI site and FLAG-tag are underlined.
GS002 AAAAAAAAGCTTCTCGAGttaGTGGTGGTGGTGGTGGTGTTTGTAGAGTTCATCCATGCC
Reverse primer for the construction of GFP fused protein constructs. HindIII site and 6×His-tag are underlined.
GS118 ATGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGC
Forward primer for TP53 gene assembly (segment 1).
GS119 GGAGTACGTGCAAGTCACAGACTTGGCTGTCCCAGAATGCAAGAAGCCCAGACGGAAACC
Reverse primer for TP53 gene assembly (segment 1).
GS120 GACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACC
Forward primer for TP53 gene assembly (segment 2).
GS121 CCGGGCGGGGGTGTGGAATCAACCCACAGCTGCACAGGGCAGGTCTTGGCCAGTTGGC
Reverse primer for TP53 gene assembly (segment 2).
GS122 GATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAG
Forward primer for TP53 gene assembly (segment 3).
GS123 CAGCGCTCATGGTGGGGGCAGCGCCTCACAACCTCCGTCATGTGCTGTGACTGCTTGTAG
Reverse primer for TP53 gene assembly (segment 3).
GS124 CCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATC
Forward primer for TP53 gene assembly (segment 4).
GS125 CCAAATACTCCACACGCAAATTTCCTTCCACTCGGATAAGATGCTGAGGAGGG
Reverse primer for TP53 gene assembly (segment 4).
GS126 GCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCC
Forward primer for TP53 gene assembly (segment 5).
45
GS127 GTGGTACAGTCAGAGCCAACCTCAGGCGGCTCACAGGGCACCACCACACTATG
Reverse primer for TP53 gene assembly (segment 5).
GS128 GGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATG
Forward primer for TP53 gene assembly (segment 6).
GS129 GTGTGATGATGGTGAGGATGGGCCTCCGGTTCATGCCGCCCATGCAGGAACTGTTAC
Reverse primer for TP53 gene assembly (segment 6).
GS130 CCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTG
Forward primer for TP53 gene assembly (segment 7).
GS131 GTGCGCCGGTCTCTCCCAGGACAGGCACAAACACGCACCTCAAAGCTGTTCCGTCCCAG
Reverse primer for TP53 gene assembly (segment 7).
GS132 GAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACG
Forward primer for TP53 gene assembly (segment 8).
GS133 GGTGTTGTTGGACAGTGCTCGCTTAGTGCTCCCTGGGGGCAGCTCGTGGTGAGGCTCCCC
Reverse primer for TP53 gene assembly (segment 8).
GS003 AAAAAATCTAGAAGGAGGAAACGCATATGTCATCTTCTGTCCCTTCCCAG
Forward primer for the construction of p53 protein constructs. XbaI site is underlined.
GS004 AAAAAAGGATCCCTGCAGGGTGTTGTTGGACAGTGCTCG
Reverse primer for the construction of the p53 protein fusion with GFP. BamHI site is underlined.
GS007 AGTGTGGTGGTGCCCTgTGAGCCGCCTGAGGTTG
Forward point mutagenesis primer for the construction of the p53(Y220C)-GFP fusion. Lower case indicates point mutation.
GS008 CAACCTCAGGCGGCTCAcAGGGCACCACCACACT
Forward point mutagenesis primer for the construction of the p53(Y220C)-GFP fusion. Lower case indicates point mutation.
GS043 AAAAAAGCCAATGGGGCATGAGCCATATTCAACGGGAAAC
Forward KanR primer. BglI site is underlined.
DG002 TTTTTTAAGCTTTTAGAAAAACTCATCGAGC
Reverse KanR primer. HindIII site is underlined.
IM033 CTAGCCAATGGGGCGATCGCCCACAATtgcGCCTCGCCGACGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-34(S1C). Lower case indicates modification. BglI site is underlined.
IM034 CTAGCCAATGGGGCGATCGCCCACAATaccGCCTCGCCGACGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-34(S1T). Lower case indicates modification. BglI site is underlined.
IM036 CTAGCCAATGGGGCGATCGCCCACAATAGCGCCgcgCCGACGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-34(S3A). Lower case indicates modification. BglI site is underlined.
46
IM037 CTAGCCAATGGGGCGATCGCCCACAATAGCGCCTCGgcgACGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-34(P4A). Lower case indicates modification. BglI site is underlined.
IM038 CTAGCCAATGGGGCGATCGCCCACAATAGCGCCTCGCCGgcgTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-34(T5A). Lower case indicates modification. BglI site is underlined.
IM027 CTGCTAGCCAATGGGGCGATCGCCCACAATtgcGCGTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(T1C). Lower case indicates modification. BglI site is underlined.
IM028 CTGCTAGCCAATGGGGCGATCGCCCACAATagcGCGTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(T1S). Lower case indicates modification. BglI site is underlined.
IM030 CTGCTAGCCAATGGGGCGATCGCCCACAATACCGCGgcgGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(F3A). Lower case indicates modification. BglI site is underlined.
IM031 CTGCTAGCCAATGGGGCGATCGCCCACAATACCGCGTTCgcgCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(D4A). Lower case indicates modification. BglI site is underlined.
IM032 CTGCTAGCCAATGGGGCGATCGCCCACAATACCGCGTTCGACgcgTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(R5A). Lower case indicates modification. BglI site is underlined.
IM043 CTAGCCAATGGGGCGATCGCCCACAATACCtttTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2F). Lower case indicates modification. BglI site is underlined.
IM044 CTAGCCAATGGGGCGATCGCCCACAATACCagcTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2S). Lower case indicates modification. BglI site is underlined.
IM045 CTAGCCAATGGGGCGATCGCCCACAATACCccgTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2P). Lower case indicates modification. BglI site is underlined.
IM046 CTAGCCAATGGGGCGATCGCCCACAATACCaccTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2T). Lower case indicates modification. BglI site is underlined.
IM047 CTAGCCAATGGGGCGATCGCCCACAATACCtatTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2Y). Lower case indicates modification. BglI site is underlined.
IM048 CTAGCCAATGGGGCGATCGCCCACAATACCcatTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2H). Lower case indicates modification. BglI site is underlined.
IM049 CTAGCCAATGGGGCGATCGCCCACAATACCaaaTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2K). Lower case indicates modification. BglI site is underlined.
IM050 CTAGCCAATGGGGCGATCGCCCACAATACCgaaTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2E). Lower case indicates modification. BglI site is underlined.
47
IM051 CTAGCCAATGGGGCGATCGCCCACAATACCtggTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2W). Lower case indicates modification. BglI site is underlined.
IM052 CTAGCCAATGGGGCGATCGCCCACAATACCcgtTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2R). Lower case indicates modification. BglI site is underlined.
IM039 CTAGCCAATGGGGCGATCGCCCACAATACCTTCGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(A2del). BglI site is underlined.
IM040 CTAGCCAATGGGGCGATCGCCCACAATACCGCGGACCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116 (F3del). BglI site is underlined.
IM041 CTAGCCAATGGGGCGATCGCCCACAATACCGCGTTCCGGTGCTTAAGTTTTGGC
Forward primer for the construction of pSICLOPPS-AβC5-116(D4del). BglI site is underlined.
IM077 CTAGCCAATGGGGCGATCGCCCACAATaccaccaccgtgcgtTGCTTAAGTTTTGGCACCGAAATTTTAACCG
Forward primer for the construction of pSICLOPPS-AβC5-479. Lower case indicates peptide DNA sequence. BglI site is underlined.
IM078 CTAGCCAATGGGGCGATCGCCCACAATaccgcgatgtggcgtTGCTTAAGTTTTGGCACCGAAATTTTAACCG
Forward primer for the construction of pSICLOPPS-AβC5-359. Lower case indicates peptide DNA sequence. BglI site is underlined.
IM080 CTAGCCAATGGGGCGATCGCCCACAATaccgtgtggattcgtTGCTTAAGTTTTGGCACCGAAATTTTAACCG
Forward primer for the construction of pSICLOPPS-AβC5-325. Lower case indicates peptide DNA sequence. BglI site is underlined.
IM081 CTAGCCAATGGGGCGATCGCCCACAATaccagccatgcgcgtTGCTTAAGTTTTGGCACCGAAATTTTAACCG
Forward primer for the construction of pSICLOPPS-AβC5-413. Lower case indicates peptide DNA sequence. BglI site is underlined.
GS037 CTATAACTATGGCTGGAATG Forward primer annealing to the pSICLOPPS backbone, before the 5’-end of the C-terminal domain of the Ssp DnaE intein.
DD015 TTTTTTGCCCCATTGGCTAGCAGAgcATTAaGGTCTTGGGGAAGACCAATATC
Reverse primer for the H24L/F26A mutagenesis of the C-terminal domain of the Ssp DnaE intein (IC). Lower case indicates modification. BglI site is underlined.
48
Supplementary Table 2. Bacterial expression vectors used in this study.
Plasmid Encoded Protein Marker Origin of
replication Source
pΕΤΑβ42-GFP Aβ42-GFP KanR ColE1 Prof. M. H.
Hecht
pΕΤΑβ42(F19S;L34P)-GFP Αβ42(F19S;L34P)-GFP KanR ColE1 Prof. M. H.
Hecht
pETSOD1-GFP SOD1-GFP KanR ColE1 This work
pETSOD1(A4V)-GFP SOD1(A4V)-GFP KanR ColE1 This work
pETSOD1(G37R)-GFP SOD1(G37R)-GFP KanR ColE1 This work
pETSOD1(G85R)-GFP SOD1(G85R)-GFP KanR ColE1 This work
pETSOD1(G93A)-GFP SOD1(G93A)-GFP KanR ColE1 This work
pETSOD1 FLAG-SOD1-6×His KanR ColE1 This work
pETSOD1(A4V) FLAG-SOD1(A4V)-6×His KanR ColE1 This work
pETSOD1(G37R) FLAG-SOD1(G37R)-6×His KanR ColE1 This work
pETSOD1(G85R) FLAG-SOD1(G85R)-6×His KanR ColE1 This work
pETSOD1(G93A) FLAG-SOD1(G93A)-6×His KanR ColE1 This work
pETp53-GFP p53C-GFP KanR ColE1 This work
pETp53(Y220C)-GFP p53C(Y220C)-GFP KanR ColE1 This work
pASKp53-GFP p53C-GFP-6×His AmpR ColE1 This work
pASKSOD1-GFP SOD1-GFP-6×His AmpR ColE1 This work
pASKSOD1(A4V)-GFP SOD1(A4V)-GFP-6×His AmpR ColE1 This work
pASKSOD1(G37R)-GFP SOD1(G37R)-GFP-6×His AmpR ColE1 This work
pASKSOD1(G85R)-GFP SOD1(G85R)-GFP-6×His AmpR ColE1 This work
pASKSOD1(G93A)-GFP SOD1(G93A)-GFP-6×His AmpR ColE1 This work
pASKSOD1 FLAG-SOD1-6×His AmpR ColE1 This work
pASKSOD1(A4V) FLAG-SOD1(A4V)-6×His AmpR ColE1 This work
pASKSOD1(G85R) FLAG-SOD1(G85R)-6×His AmpR ColE1 This work
pASKSOD1(G93R) FLAG-SOD1(G93A)-6×His AmpR ColE1 This work
pSICLOPPS IC-SGGYLPPL-IN-CBD CmR ACYC Prof. S.
Benkovic
pSICLOPPS-CysX1X2X3 sub-library IC-CysX1X2X3-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-SerX1X2X3 sub-library IC-SerX1X2X3-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-ThrX1X2X3 sub-library IC-ThrX1X2X3-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-CysX1X2X3X4 sub-library
IC-CysX1X2X3X4-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-SerX1X2X3X4 sub-library
IC-SerX1X2X3X4-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-ThrX1X2X3X4 sub-library
IC-ThrX1X2X3X4-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-CysX1X2X3X4X5 sub-library
IC-CysX1X2X3X4X5-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-SerX1X2X3X4X5 sub-library
IC-SerX1X2X3X4X5-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-ThrX1X2X3X4X5 sub-library
IC-ThrX1X2X3X4X5-IN-CBD sub-library
CmR ACYC This work
pSICLOPPS-ΑβC5-34 IC-SASPT-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-34(S1C) IC-CASPT-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-34(S1T) IC-TASPT-IN-CBD CmR ACYC This work
49
pSICLOPPS-ΑβC5-34(S3A) IC-SAAPT-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-34(P4A) IC-SASAT-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-34(T5A) IC-SASPA-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116 IC-TAFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(T1C) IC-CAFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(T1S) IC-SAFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(F3A) IC-TAADR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(D4A) IC-TAFAR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(R5A) IC-TAFDA-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2F) IC-TFFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2W) IC-TWFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2Y) IC-TYFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2S) IC-TSFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2T) IC-TTFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2E) IC-TEFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2R) IC-TRFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2H) IC-THFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2K) IC-TKFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(A2P) IC-TPFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(delA2) IC-TFDR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(delF3) IC-TADR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-116(delD4) IC-TAFR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-325 IC-TVWIR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-359 IC-TAMWR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-413 IC-TSHAR-IN-CBD CmR ACYC This work
pSICLOPPS-ΑβC5-479 IC-TTTVR-IN-CBD CmR ACYC This work
pSICLOPPS-Random1 IC-unknown peptide sequence1-IN-CBD
CmR ACYC This work
pSICLOPPS-Random2 IC-unknown peptide sequence2-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-2 IC(H24L;F26A)-TTYAR-IN-CBD CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-3 IC(H24L;F26A)-TTVDR-IN-CBD CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-17 IC(H24L;F26A)-TTTAR-IN-CBD CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-21 IC(H24L;F26A)-TTWCR-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-26 IC(H24L;F26A)-TAWCR-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-34 IC(H24L;F26A)-SASPT-IN-CBD CmR ACYC This work
pSICLOPPS(H24L;F26A)-ΑβC5-116
IC(H24L;F26A)-TAFDR-IN-CBD CmR ACYC This work
pSICLOPPS(H24L;F26A)-AβC6-1 IC(H24L;F26A-TPVWFD-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-SOD1C5-2
IC(H24L;F26A)-TASFW-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-SOD1C5-4
IC(H24L;F26A)-TWSVW-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-SOD1C5-6
IC(H24L;F26A)-TFSMW-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-Random1
IC(H24L;F26A)-unknown peptide sequence1-IN-CBD
CmR ACYC This work
pSICLOPPS(H24L;F26A)-Random2
IC(H24L; F26A)- unknown peptide sequence2-IN-CBD
CmR ACYC This work
50
Supplementary Table 3. Sequencing results of the peptide-encoding regions of 23 randomly
selected clones from the constructed pSICLOPPS-NuX1X2X3, pSICLOPPS-NuX1X2X3X4, and
pSICLOPPS-NuX1X2X3X4X5 vector sub-libraries.
Clone number DNA sequence of peptide-encoding
gene Encoded peptide
sequence
C4-1 TGC GGC AAG GTG CGKV
C4-2 TGC CGC CAC CGG CRHR
C4-3 AGC GCG TCC GGG SASG
C4-4 AGC ACG CGC CGG STRR
C4-5 ACC AAC TGG GTC TNWV
C4-6 ACC AGG GCC TCC TRAS
C4-7 AGC CGG GTG CTC SRVL
C4-8 ACC AAC TGG CCG TNWP
C5-1 TGC AAC TTG GTC TGG CNLVW
C5-2 TGC TGC GCG GCG GGG CCAAG
C5-3 TGC GCG TCG CGG GGG CASRG
C5-4 AGC TTC GTG GAG GGG SFVEG
C5-5 ACC TGC CCC GTG TAG TCPV*
C5-6 ACC CCG GCG CGG TGC TPARC
C5-7 ACC TCG GGC GCG TAG TSGA*
C6-1 TGC GGG CGG GGG TGG ACG CGRGWT
C6-2 TGC TGC AGC GGC TGC CGG CCSGCR
C6-3 TGC AAG TCG GGG CAC GGC CKSGHG
C6-4 AGC TTG GTG CCG TAC CTG SLVPYL
C6-5 AGC GCC TAG GGC GGG CCC SA*GGP
C6-6 AGC GAG GGG GGG GGG G Frame shift
C6-7 ACC TCG CTC TAG TCC CAC TSL*SH
C6-8 ACC AGG GGG GGC AGG GGG TRGGRG
*: stop codon
51
Supplementary Table 4. High-throughput sequencing analysis of the peptide-encoding regions
of ~260,000 randomly selected clones from the constructed pSICLOPPS-NuX1X2X3,
pSICLOPPS-NuX1X2X3X4, and pSICLOPPS-Nu X1X2X3X4X5 sub-libraries.
Number of reads
Unique DNA sequences
Unique peptide sequences
cyclo-NuX1X2X3 tetrapeptides
3,448 2,648 (77%) 2,034 (59%)
cyclo-NuX1X2X3X4
pentapeptides 6,348 5,519 (87%) 4,537 (71%)
cyclo-NuX1X2X3X4X5
hexapeptides 250,756 213,763 (85%) 168,003 (67%)
Combined cyclo-NuX1X2X3-X5 library
260,552 221,930 (85%) 174,574 (67%)
Supplementary Table 5. Sequences and frequency of appearance of the selected cyclic TXXXR
pentapeptides as determined by high-throughput sequencing of the isolated pSICLOPPS-
NuX1X2X3-X5 vectors after the second round of bacterial sorting for enhanced Αβ42-GFP
fluorescence.
Nu
mb
er
Peptide name
Aminoacid sequence Number of reads
Reads/Total TXXXR
reads (%)
Reads/Total pentapeptide
reads (%)
Reads/Total peptide
reads (%)
1 ΑβC5-2 T T Y A R 304,753 16.023 7.506 6.727
2 ΑβC5-3 T T V D R 214,461 11.276 5.282 4.734
3 ΑβC5-5 T T T W R 175,510 9.228 4.323 3.874
4 ΑβC5-7 T T L H R 134,018 7.046 3.301 2.958
5 ΑβC5-8 T T F A R 96,700 5.084 2.382 2.134
6 ΑβC5-9 T V L D R 89,669 4.715 2.209 1.979
7 ΑβC5-12 T T W A R 65,929 3.466 1.624 1.455
8 ΑβC5-13 T A L D R 62,792 3.301 1.547 1.386
9 ΑβC5-15 T A N V R 47,855 2.516 1.179 1.056
10 ΑβC5-17 T T T A R 40,135 2.110 0.989 0.886
11 ΑβC5-18 T T I A R 37,150 1.953 0.915 0.820
12 ΑβC5-19 T V W D R 37,091 1.950 0.914 0.819
13 ΑβC5-20 T T I S R 37,044 1.948 0.912 0.818
14 ΑβC5-21 T T W C R 36,295 1.908 0.894 0.801
15 ΑβC5-22 T V L W R 35,820 1.883 0.882 0.791
16 ΑβC5-25 T T L A R 28,989 1.524 0.714 0.640
17 ΑβC5-26 T A W C R 28,391 1.493 0.699 0.627
18 ΑβC5-27 T T S A R 28,188 1.482 0.694 0.622
19 ΑβC5-29 T T L E R 27,514 1.447 0.678 0.607
20 ΑβC5-30 T S T A R 27,456 1.444 0.676 0.606
21 ΑβC5-35 T V R D R 25,428 1.337 0.626 0.561
22 ΑβC5-41 T G W A R 21,784 1.145 0.537 0.481
23 ΑβC5-44 T A W A R 20,807 1.094 0.512 0.459
52
24 ΑβC5-45 T T W V R 20,798 1.094 0.512 0.459
25 ΑβC5-46 T L L W R 19,957 1.049 0.492 0.440
26 ΑβC5-47 T T I D R 19,735 1.038 0.486 0.436
27 ΑβC5-50 T A L A R 19,433 1.022 0.479 0.429
28 ΑβC5-51 T S V D R 19,249 1.012 0.474 0.425
29 ΑβC5-53 T T V W R 18,669 0.982 0.460 0.412
30 ΑβC5-66 T T H W R 14,304 0.752 0.352 0.316
31 ΑβC5-67 T A R D R 14,213 0.747 0.350 0.314
32 ΑβC5-73 T T R D R 12,894 0.678 0.318 0.285
33 ΑβC5-80 T S V H R 10,181 0.535 0.251 0.225
34 ΑβC5-82 T A V W R 9,781 0.514 0.241 0.216
35 ΑβC5-83 T T G C R 9,362 0.492 0.231 0.207
36 ΑβC5-89 T A T D R 7,984 0.420 0.197 0.176
37 ΑβC5-94 T V L F R 7,442 0.391 0.183 0.164
38 ΑβC5-102 T T Y N R 6,067 0.319 0.149 0.134
39 ΑβC5-105 T V R W R 5,450 0.287 0.134 0.120
40 ΑβC5-116 T A F D R 4,243 0.223 0.105 0.094
41 ΑβC5-117 T T R C R 4,237 0.223 0.104 0.094
42 ΑβC5-118 T T F W R 4,216 0.222 0.104 0.093
43 ΑβC5-121 T I K D R 3,970 0.209 0.098 0.088
44 ΑβC5-123 T T V H R 3,371 0.177 0.083 0.074
45 ΑβC5-126 T T L L R 3,016 0.159 0.074 0.067
46 ΑβC5-129 T T L F R 2,630 0.138 0.065 0.058
47 ΑβC5-130 T A Y H R 2,594 0.136 0.064 0.057
48 ΑβC5-136 T A L H R 2,026 0.107 0.050 0.045
49 ΑβC5-139 T T S P R 1,904 0.100 0.047 0.042
50 ΑβC5-146 T T W S R 1,612 0.085 0.040 0.036
51 ΑβC5-147 T A M H R 1,611 0.085 0.040 0.036
52 ΑβC5-155 T S L D R 1,251 0.066 0.031 0.028
53 ΑβC5-158 T T G A R 1,172 0.062 0.029 0.026
54 ΑβC5-162 T S V W R 1,094 0.058 0.027 0.024
55 ΑβC5-173 T T H A R 953 0.050 0.023 0.021
56 ΑβC5-176 T A G W R 945 0.050 0.023 0.021
57 ΑβC5-177 T A T A R 925 0.049 0.023 0.020
58 ΑβC5-184 T V L A R 818 0.043 0.020 0.018
59 ΑβC5-185 T T F N R 800 0.042 0.020 0.018
60 ΑβC5-188 T G M R R 768 0.040 0.019 0.017
61 ΑβC5-189 T T V A R 757 0.040 0.019 0.017
62 AβC5-190 T L C L R 739 0.039 0.018 0.016
63 ΑβC5-192 T G L A R 720 0.038 0.018 0.016
64 ΑβC5-198 T S W C R 679 0.036 0.017 0.015
65 ΑβC5-209 T T R A R 580 0.030 0.014 0.013
66 ΑβC5-215 T T P W R 524 0.028 0.013 0.012
53
67 ΑβC5-218 T V L H R 497 0.026 0.012 0.011
68 ΑβC5-223 T G L D R 464 0.024 0.011 0.010
69 ΑβC5-230 T T S D R 442 0.023 0.011 0.010
70 ΑβC5-239 T T M H R 384 0.020 0.009 0.008
71 ΑβC5-242 T T S T R 376 0.020 0.009 0.008
72 ΑβC5-244 T T R V R 366 0.019 0.009 0.008
73 ΑβC5-245 T T R F R 364 0.019 0.009 0.008
74 ΑβC5-248 T T T H R 339 0.018 0.008 0.007
75 ΑβC5-250 T H A W R 334 0.018 0.008 0.007
76 ΑβC5-252 T V I W R 331 0.017 0.008 0.007
77 ΑβC5-253 T T W F R 327 0.017 0.008 0.007
78 ΑβC5-255 T T S R R 325 0.017 0.008 0.007
79 ΑβC5-258 T T S C R 301 0.016 0.007 0.007
80 ΑβC5-260 T T W T R 295 0.016 0.007 0.007
81 ΑβC5-262 T T S S R 286 0.015 0.007 0.006
82 ΑβC5-263 T H L A R 284 0.015 0.007 0.006
83 ΑβC5-264 T S G A R 282 0.015 0.007 0.006
84 ΑβC5-266 T T L R R 274 0.014 0.007 0.006
85 ΑβC5-270 T A T W R 266 0.014 0.007 0.006
86 ΑβC5-272 T C M W R 254 0.013 0.006 0.006
87 ΑβC5-275 T A H V R 249 0.013 0.006 0.005
88 ΑβC5-276 T S W A R 249 0.013 0.006 0.005
89 ΑβC5-278 T T W L R 241 0.013 0.006 0.005
90 ΑβC5-291 T T L D R 213 0.011 0.005 0.005
91 ΑβC5-294 T T P H R 207 0.011 0.005 0.005
92 ΑβC5-298 T T R G R 201 0.011 0.005 0.004
93 ΑβC5-299 T T V G R 200 0.011 0.005 0.004
94 ΑβC5-301 T T T R R 191 0.010 0.005 0.004
95 ΑβC5-304 T S I N R 182 0.010 0.004 0.004
96 ΑβC5-305 T T A D R 181 0.010 0.004 0.004
97 ΑβC5-315 T T S E R 158 0.008 0.004 0.003
98 ΑβC5-316 T T C A R 157 0.008 0.004 0.003
99 ΑβC5-317 T T A W R 156 0.008 0.004 0.003
100 ΑβC5-320 T T V E R 150 0.008 0.004 0.003
101 ΑβC5-321 T T T F R 148 0.008 0.004 0.003
102 ΑβC5-323 T A V D R 147 0.008 0.004 0.003
103 ΑβC5-325 T V W I R 144 0.008 0.004 0.003
104 ΑβC5-329 T T V R R 141 0.007 0.003 0.003
105 ΑβC5-333 T H V R R 137 0.007 0.003 0.003
106 ΑβC5-343 T N L D R 125 0.007 0.003 0.003
107 ΑβC5-344 T T P G R 125 0.007 0.003 0.003
108 ΑβC5-348 T T L T R 119 0.006 0.003 0.003
109 ΑβC5-355 T A T V R 115 0.006 0.003 0.003
54
110 ΑβC5-359 T A M W R 110 0.006 0.003 0.002
111 ΑβC5-361 T T K W R 108 0.006 0.003 0.002
112 ΑβC5-362 T T W D R 107 0.006 0.003 0.002
113 ΑβC5-364 T T M A R 106 0.006 0.003 0.002
114 ΑβC5-365 T T G G R 106 0.006 0.003 0.002
115 ΑβC5-366 T T M V R 105 0.006 0.003 0.002
116 ΑβC5-375 T N L A R 97 0.005 0.002 0.002
117 ΑβC5-376 T I R D R 96 0.005 0.002 0.002
118 ΑβC5-378 T T T G R 96 0.005 0.002 0.002
119 ΑβC5-379 T R L G R 95 0.005 0.002 0.002
120 ΑβC5-381 T T H T R 93 0.005 0.002 0.002
121 ΑβC5-382 T T I T R 92 0.005 0.002 0.002
122 ΑβC5-384 T T Y T R 90 0.005 0.002 0.002
123 ΑβC5-385 T T L Y R 90 0.005 0.002 0.002
124 ΑβC5-389 T H L D R 89 0.005 0.002 0.002
125 ΑβC5-391 T L L I R 88 0.005 0.002 0.002
126 ΑβC5-392 T T C D R 87 0.005 0.002 0.002
127 ΑβC5-393 T T G R R 87 0.005 0.002 0.002
128 ΑβC5-394 T T V S R 86 0.005 0.002 0.002
129 ΑβC5-395 T T Q H R 85 0.004 0.002 0.002
130 ΑβC5-396 T T T P R 84 0.004 0.002 0.002
131 ΑβC5-399 T A F A R 82 0.004 0.002 0.002
132 ΑβC5-405 T T S H R 78 0.004 0.002 0.002
133 ΑβC5-410 T V L G R 76 0.004 0.002 0.002
134 ΑβC5-411 T T Q R R 75 0.004 0.002 0.002
135 ΑβC5-413 T S H A R 74 0.004 0.002 0.002
136 ΑβC5-415 T T T C R 74 0.004 0.002 0.002
137 ΑβC5-422 T A W R R 72 0.004 0.002 0.002
138 ΑβC5-428 T T C G R 69 0.004 0.002 0.002
139 ΑβC5-434 T T S G R 65 0.003 0.002 0.001
140 ΑβC5-438 T T T S R 62 0.003 0.002 0.001
141 ΑβC5-440 T A T G R 61 0.003 0.002 0.001
142 ΑβC5-441 T A W D R 61 0.003 0.002 0.001
143 ΑβC5-443 T T H H R 60 0.003 0.001 0.001
144 ΑβC5-448 T A Y A R 58 0.003 0.001 0.001
145 ΑβC5-449 T A N A R 58 0.003 0.001 0.001
146 ΑβC5-450 T R D V R 58 0.003 0.001 0.001
147 ΑβC5-452 T H V D R 58 0.003 0.001 0.001
148 ΑβC5-453 T L F W R 57 0.003 0.001 0.001
149 ΑβC5-459 T T A A R 55 0.003 0.001 0.001
150 ΑβC5-463 T V V D R 54 0.003 0.001 0.001
151 ΑβC5-464 T T P A R 54 0.003 0.001 0.001
152 ΑβC5-469 T T I G R 53 0.003 0.001 0.001
55
153 ΑβC5-472 T M Y A R 51 0.003 0.001 0.001
154 ΑβC5-473 T H V A R 51 0.003 0.001 0.001
155 ΑβC5-474 T T W P R 51 0.003 0.001 0.001
156 ΑβC5-475 T T G D R 51 0.003 0.001 0.001
157 ΑβC5-479 T T T V R 50 0.003 0.001 0.001
158 ΑβC5-481 T V F G R 50 0.003 0.001 0.001
159 ΑβC5-483 T R V G R 50 0.003 0.001 0.001
Sum 1,901,945 100 46.847 41.980
Supplementary Table 6. Sequences and frequency of appearance of the selected cyclic
pentapeptides resembling ΑβC5-34 as determined by high-throughput sequencing of the isolated
pSICLOPPS-NuX1X2X3-X5 vectors after the second round of bacterial sorting for enhanced Αβ42-
GFP fluorescence.
Supplementary Table 7. Sequences and frequency of appearance of the selected cyclic TXXR
tetrapeptides as determined by high-throughput sequencing of the isolated pSICLOPPS-
NuX1X2X3-X5 vectors after the second round of bacterial sorting for enhanced Αβ42-GFP
fluorescence.
Nu
mb
er
Peptide name
Amino acid sequence
Number of reads
Reads/ Total TXXR
reads (%)
Reads/ Total tetra-
peptide reads (%)
Reads/ Total
peptide reads (%)
1 ΑβC4-9 T T C R 258 34.492 1.428 0.006
2 ΑβC4-11 T T R R 248 33.155 1.372 0.005
3 ΑβC4-31 T T S R 67 8.957 0.371 0.001
4 ΑβC4-34 T R G R 63 8.422 0.349 0.001
5 ΑβC4-35 T T G R 61 8.155 0.338 0.001
6 ΑβC4-41 T R R R 51 6.818 0.282 0.001
Sum 748 100 4.139 0.017
Nu
mb
er
Peptide name
Amino acid sequence
Number of reads
Reads/ Total SASPT-like reads (%)
Reads/ Total
pentapeptide reads (%)
Reads/ Total peptide
reads (%)
1 ΑβC5-34 S A S P T 25673 97.349 0.632 0.567
2 ΑβC5-216 S I C P T 516 1.957 0.013 0.011
3 ΑβC5-380 S I T P T 94 0.356 0.002 0.002
4 ΑβC5-387 S H S P T 89 0.337 0.002 0.002 Sum 26,372 100 0.645 0.578
56
Supplementary Table 8. MM–PBSA binding free energy (ΔGbind) calculations of the Aβ-cyclic
peptide complexes (units are in kcal mol-1). Enthalpy (ΔH) values correspond to calculations
performed on a total of 8,000 frames of 20×4 ns trajectories, while entropy (–TΔS) was calculated
for 1,000 frames corrected from the same trajectories. Total binding energy (ΔGbind) and standard
error of the mean values are also provided.
Cyclic peptide ΔH –TΔS ΔGbind
ΑβC5-34 –23.68 ± 0.06 18.79 ± 0.15 –4.88 ± 0.08
ΑβC5-116 –29.68 ± 0.04a 23.50 ± 0.14a –6.18 ± 0.06b aStandard error of the mean, 𝑠 = (𝑠𝑡𝑎𝑛𝑑𝑎𝑟𝑑 𝑑𝑒𝑣𝑖𝑎𝑡𝑖𝑜𝑛)/√𝑁, where N is the number of trajectory
frames used in calculations (8,000 for enthalpy (𝑛1) and 1,000 for entropy (𝑛2), respectively).
bPooled standard error of the mean, 𝑆 = √[(𝑛1 − 1)(𝑠1)2 + (𝑛2 − 1)(𝑠2)2]/(𝑛1 + 𝑛2 − 2)
Supplementary Table 9. MM–PBSA calculated free-energy contributions and standard error of
the mean values of the Aβ-cyclic peptide complexes.
Cyclic peptide Energy (kcal mol–1)
ΑβC5-34 ΔEvdW –31.60 ± 0.03
ΔEelec –41.73 ± 0.11
ΔEMM, gas –73.33 ± 0.07
ΔGPB 52.35 ± 0.09
ΔGelec(tot)a 10.62 ± 0.10
ΔGNP –2.70 ± 0.00
ΔGsolv 49.65 ± 0.05
ΑβC5-116 ΔEvdW –42.04 ± 0.04
ΔEelec –29.79 ± 0.06
ΔEMM, gas –68.83 ± 0.05
ΔGPB 43.05 ± 0.05
ΔGelec(tot)a 16.26 ± 0.06
ΔGNP –3.90 ± 0.00
ΔGsolv 39.16 ± 0.03 aΔGelec(tot)= ΔEelec + ΔGPB
57
Supplementary Table 10. Hydrogen-bonding interactions between ΑβC5-34 and the Aβ
pentameric model unit. Aβ participating residues are designated by their monomer unit letter.
Interaction Acceptor Acceptor Atom
Donor Donor atom
Occurrence (%)
1 ΑβC5-34-T5 OG1 A-A21 N 67.4
2 A-A21 O ΑβC5-34-T5 N 40.3
3 ΑβC5-34-S1 O A-D23 N 38.7
4 ΑβC5-34-A2 O A-I31 N 29.6
5 A-A21 O ΑβC5-34-S1 N 29.5
6 A-E22 OE1 ΑβC5-34-S1 OG 18.4
7 A-E22 OE1 ΑβC5-34-S1 OG 17.6
Supplementary Table 11. Hydrogen bonding interactions between ΑβC5-116 and the Aβ
pentameric model unit. Aβ participating residues are designated by their monomer unit letter.
Interaction Acceptor Acceptor Atom
Donor Donor atom Occurrence (%)
1 D-I32 O ΑβC5-116-T1 OG1 80.2
2 B-L34 O ΑβC5-116-R5 NH2 67.7
3 A-G26 O ΑβC5-116-R5 NH1 59.6
58
Supplementary Table 12. MM–PBSA binding free energy (ΔGbind) calculations of Aβ complexes
with active and inactive variants of the selected cyclic pentapeptides ΑβC5-34 and ΑβC5-116
(units are in kcal mol-1). Enthalpy (ΔH) values correspond to calculations performed on a total of
8,000 frames of 20×4 ns trajectories, while entropy (–TΔS) was calculated for 1,000 frames
corrected from the same trajectories. Total binding energy (ΔGbind) and standard error of the mean
values are also provided.
Cyclic peptide ΔH –TΔS ΔGbind
ΑβC5-34(T5A) –10.72 ± 0.03a 16.03 ± 0.15a 5.31 ± 0.06b
ΑβC5-116(A2T) –28.03 ± 0.04 24.90 ± 0.17 –3.13 ± 0.07
ΑβC5-116(R5A) –21.14 ± 0.04 23.87 ± 0.17 2.73 ± 0.07
Scrambled ΑβC5-116 (cyclo-TRDFA)
–16.40 ± 0.04 22.48 ± 0.16 6.08 ± 0.07
aStandard error of the mean, 𝑠 = (𝑠𝑡𝑎𝑛𝑑𝑎𝑟𝑑 𝑑𝑒𝑣𝑖𝑎𝑡𝑖𝑜𝑛)/√𝑁, where N is the number of trajectory
frames used in calculations (8,000 for enthalpy (𝑛1) and 1,000 for entropy (𝑛2), respectively).
bPooled standard error of the mean, 𝑆 = √[(𝑛1 − 1)(𝑠1)2 + (𝑛2 − 1)(𝑠2)2]/(𝑛1 + 𝑛2 − 2).
Supplementary Table 13. Sequences and frequency of appearance of the selected cyclic
TXSXW pentapeptides as determined by high-throughput sequencing of the isolated
pSICLOPPS-NuX1X2X3-X5 vectors after the fourth round of bacterial sorting for enhanced
SOD1(A4V)-GFP fluorescence.
Nu
mb
er
Peptide name
Aminoacid sequence Number of reads
Reads/ Total
TXSXW reads (%)
Reads/Total pentapeptide
reads (%)
Reads/ Total
peptide reads (%)
1 SOD1C5-1 T A S W W 1255761 31.877 30.963 29.591
2 SOD1C5-2 T A S F W 744622 18.902 18.36 17.547
3 SOD1C5-3 T S S F W 700047 17.77 17.261 16.496
4 SOD1C5-4 T W S V W 543999 13.809 13.413 12.819
5 SOD1C5-5 T A S H W 330358 8.386 8.146 7.785
6 SOD1C5-6 T F S M W 208879 5.302 5.15 4.922
7 SOD1C5-7 T A S M W 108582 2.756 2.677 2.559
8 SOD1C5-9 T V S F W 31319 0.795 0.772 0.738
9 SOD1C5-11 T L S F W 3069 0.078 0.076 0.072
10 SOD1C5-13 T A S R W 1485 0.038 0.037 0.035
11 SOD1C5-14 T A S S W 1459 0.037 0.036 0.034
12 SOD1C5-18 T A S L W 1054 0.027 0.026 0.025
13 SOD1C5-20 T S S S W 966 0.025 0.024 0.023
14 SOD1C5-23 T G S V W 751 0.019 0.019 0.018
15 SOD1C5-25 T W S L W 683 0.017 0.017 0.016
16 SOD1C5-27 T L S M W 619 0.016 0.015 0.015
17 SOD1C5-31 T W S A W 576 0.015 0.014 0.014
18 SOD1C5-32 T G S W W 563 0.014 0.014 0.013
19 SOD1C5-33 T R S V W 554 0.014 0.014 0.013
59
20 SOD1C5-39 T S S L W 432 0.011 0.011 0.01
21 SOD1C5-44 T A S T W 361 0.009 0.009 0.009
22 SOD1C5-46 T S S V W 356 0.009 0.009 0.008
23 SOD1C5-53 T T S W W 295 0.007 0.007 0.007
24 SOD1C5-65 T A S V W 245 0.006 0.006 0.006
25 SOD1C5-74 T C S W W 208 0.005 0.005 0.005
26 SOD1C5-75 T P S F W 208 0.005 0.005 0.005
27 SOD1C5-76 T T S F W 203 0.005 0.005 0.005
28 SOD1C5-80 T F S T W 171 0.004 0.004 0.004
29 SOD1C5-82 T S S M W 164 0.004 0.004 0.004
30 SOD1C5-89 T V S W W 144 0.004 0.004 0.003
31 SOD1C5-93 T D S W W 136 0.003 0.003 0.003
32 SOD1C5-105 T S S W W 112 0.003 0.003 0.003
33 SOD1C5-106 T R S W W 106 0.003 0.003 0.002
34 SOD1C5-109 T W S M W 99 0.003 0.002 0.002
35 SOD1C5-116 T A S G W 96 0.002 0.002 0.002
36 SOD1C5-130 T P S W W 82 0.002 0.002 0.002
37 SOD1C5-135 T R S F W 79 0.002 0.002 0.002
38 SOD1C5-140 T S S Y W 76 0.002 0.002 0.002
39 SOD1C5-143 T L S V W 72 0.002 0.002 0.002
40 SOD1C5-148 T Y S W W 71 0.002 0.002 0.002
41 SOD1C5-160 T F S V W 62 0.002 0.002 0.001
42 SOD1C5-164 T C S V W 60 0.002 0.001 0.001
43 SOD1C5-167 T V S S W 59 0.001 0.001 0.001
44 SOD1C5-168 T R S H W 58 0.001 0.001 0.001
45 SOD1C5-182 T G S A W 53 0.001 0.001 0.001
46 SOD1C5-188 T A S Y W 52 0.001 0.001 0.001
Sum 3,939,406 100 97.134 92.829
60
Supplementary Table 14. Comparison of the molecular properties of the selected cyclic
pentapeptides with those of conventional drugs, oral macrocyclic (MC) drugs and non-oral MC
drugs.
Propertya Conventional
drugs Oral MC drugsb
Non-oral MC drugsb
AβC5-34c AβC5-116c SOD1C5-4c
MW ≤500 600 to1200 600 to1300 443 590 659
cLogP ≤5 -2 to 6 -7 to 2 -1.9 -3.5 2.3
PSA (Å2) ≤140 180 to 320 150 to 500 197 265 210
HBDs ≤5 ≤12 ≤17 7 10 9
HBAs ≤10 12 to 16 9 to 20 8 10 9
NRB ≤10 ≤15 ≤30 3 10 7 aAbbreviations - MW: molecular weight; cLogP: calculated octanol/water partition coefficient; PSA: polar surface area; HBD: hydrogen bond donor; HBA: hydrogen bond acceptor; NRB: number of rotatable bonds. bAccording to Villar et al.44 cAs determined using PerkinElmer ChemBio3D
61
Supplementary References
1. Wang, G. & Fersht, A.R. First-order rate-determining aggregation mechanism of p53 and its
implications. Proc. Natl. Acad. Sci. U.S.A. 109, 13590-13595 (2012).
2. Stathopulos, P. et al. Cu/Zn superoxide dismutase mutants associated with amyotrophic
lateral sclerosis show enhanced formation of aggregates in vitro. Proc. Natl. Acad. Sci. U.S.A.
100, 7021-7026 (2003).
3. Nilsberth, C. et al. The 'Arctic' APP mutation (E693G) causes Alzheimer's disease by
enhanced Aβ protofibril formation. Nat. Neurosci. 4, 887-893 (2001).
4. Soto, C. et al. β-sheet breaker peptides inhibit fibrillogenesis in a rat brain model of
amyloidosis: implications for Alzheimer's therapy. Nat. Med. 4, 822-826 (1998).
5. Tavassoli, A. & Benkovic, S.J. Split-intein mediated circular ligation used in the synthesis of
cyclic peptide libraries in E. coli. Nat. Protoc. 2, 1126-1133 (2007).
6. Skerra, A. Use of the tetracycline promoter for the tightly regulated production of a murine
antibody fragment in Escherichia coli. Gene 151, 131-135 (1994).
7. Walsh, D.M. et al. Naturally secreted oligomers of amyloid β protein potently inhibit
hippocampal long-term potentiation in vivo. Nature 416, 535-539 (2002).
8. Fotinopoulou, A. et al. BRI2 interacts with amyloid precursor protein (APP) and regulates
amyloid β (Aβ) production. J. Biol. Chem. 280, 30768-30772 (2005).
9. Lührs, T. et al. 3D structure of Alzheimer's amyloid-β(1-42) fibrils. Proc. Natl. Acad. Sci. U.S.A.
102, 17342-17347 (2005).
10. Bieschke, J. et al. Small-molecule conversion of toxic oligomers to nontoxic β-sheet–rich
amyloid fibrils. Nat. Chem. Biol. 8, 93-101 (2012).
11. Schrödinger, L.L.C. The PyMOL Molecular Graphics System, Version 1.8 (2015).
12. Kahler, A., Sticht, H. & Horn, A.H. Conformational Stability of Fibrillar Amyloid-Beta
Oligomers via Protofilament Pair Formation - A Systematic Computational Study. PloS One
8, e70521 (2013).
13. Horn, A.H. & Sticht, H. Amyloid-β42 oligomer structures from fibrils: a systematic molecular
dynamics study. J. Phys. Chem. B 114, 2219-2226 (2010).
14. Paravastu, A.K., Petkova, A.T. & Tycko, R. Polymorphic fibril formation by residues 10-40 of
the Alzheimer's β-amyloid peptide. Biophys. J. 90, 4618-4629 (2006).
15. Takeda, T. & Klimov, D.K. Probing the effect of amino-terminal truncation for Aβ1-40 peptides.
J. Phys. Chem. B 113, 6692-6702 (2009).
62
16. Case, D. A. et al. AMBER 12. (http://www.ambermd.org) (University of California, San
Francisco, 2012)
17. Wang, J.M., Wang, W., Kollman, P.A. & Case, D.A. Automatic atom type and bond type
perception in molecular mechanical calculations. J. Mol. Graph. Model. 25, 247-260 (2006).
18. Trott, O. & Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a
new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 31, 455-
461 (2010).
19. Morris, G.M. et al. AutoDock4 and AutoDockTools4: Automated Docking with selective
receptor flexibility. J. Comput. Chem. 30, 2785-2791 (2009).
20. Sanner, M.F. Python: A programming language for software integration and development. J.
Mol. Graph. Model. 17, 57-61 (1999).
21. Hornak, V. et al. Comparison of multiple Amber force fields and development of improved
protein backbone parameters. Proteins 65, 712-725 (2006).
22. Jorgensen, W.L., Chandrasekhar, J., Madura, J.D., Impey, R.W. & Klein, M.L. Comparison
of simple potential functions for simulating liquid water. J. Chem. Phys. 79, 926-935 (1983).
23. Darden, T., York, D. & Pedersen, L. Particle mesh Ewald: an N∙Log(N) method for Ewald
sums in large systems. J. Chem. Phys. 98, 10089-10092 (1993).
24. Salomon-Ferrer, R., Götz, A.W., Poole, D., Le Grand, S. & Walker, R.C. Routine Microsecond
Molecular Dynamics Simulations with AMBER on GPUs. 2. Explicit Solvent Particle Mesh
Ewald. J. Chem. Theory Comput. 9, 3878-3888 (2013).
25. Izaguirre, J.A., Catarello, D.P., Wozniak, J.M. & Skeel, R.D. Langevin stabilization of
molecular dynamics. J. Chem. Phys. 114, 2090-2098 (2001).
26. Ryckaert, J.P., Ciccotti, G. & Berendsen, H.J.C. Numerical integration of the cartesian
equations of motion of a system with constraints: molecular dynamics of n-alkanes. J.
Comp. Phys. 23, 327-341 (1977).
27. Götz, A.W. et al. Routine Microsecond Molecular Dynamics Simulations with AMBER on
GPUs. 1. Generalized Born. J. Chem. Theory Comput. 8, 1542-1555 (2012).
28. Le Grand, S., Götz, A.W. & Walker, R.C. SPFP: Speed without compromise-A mixed
precision model for GPU accelerated molecular dynamics simulations. Comput. Phys.
Commun. 184, 374-380 (2013).
29. Daura, X. et al. Peptide Folding: When Simulation Meets Experiment. Angew. Chem. Int. Ed.
Engl. 38, 236-240 (1999).
63
30. Hess, B., Kutzner, C., van der Spoel, D. & Lindahl, E. GROMACS 4: Algorithms for highly
efficient, load-balanced, and scalable molecular simulation. J. Chem. Theory Comput. 4, 435-
447 (2008).
31. Humphrey, W., Dalke, A. & Schulten, K. VMD: Visual molecular dynamics. J. Mol. Graph. 14,
33-38 (1996).
32. Hou, T.J., Wang, J.M., Li, Y.Y. & Wang, W. Assessing the Performance of the MM/PBSA and
MM/GBSA Methods. 1. The Accuracy of Binding Free Energy Calculations Based on
Molecular Dynamics Simulations. J. Chem. Inf. Model. 51, 69-82 (2011).
33. Kollman, P.A. et al. Calculating Structures and Free Energies of Complex Molecules:
Combining Molecular Mechanics and Continuum Models. Acc. Chem. Res. 33, 889-897
(2000).
34. Gohlke, H., Kiel, C. & Case, D.A. Insights into Protein–Protein Binding by Binding Free
Energy Calculation and Free Energy Decomposition for the Ras–Raf and Ras–RalGDS
Complexes. J. Mol. Biol. 330, 891-913 (2003).
35. Leonis, G., Steinbrecher, T. & Papadopoulos, M.G. A Contribution to the drug resistance
mechanism of Darunavir, Amprenavir, Indinavir, and Saquinavir complexes with HIV-1
protease due to flap mutation I50V: A systematic MM–PBSA and thermodynamic integration
study. J. Chem. Inf. Model 53, 2141-2153 (2013).
36. Wright, D.W., Hall, B.A., Kenway, O.A., Jha, S. & Coveney, P.V. computing clinically relevant
binding free energies of HIV-1 protease inhibitors. J. Chem. Theory Comput. 10, 1228-1241
(2014).
37. Miller, B.R. et al. MMPBSA.py: An efficient program for end-state free energy calculations. J.
Chem. Theory Comput. 8, 3314-3321 (2012).
38. Bessette, P.H., Åslund, F., Beckwith, J. & Georgiou, G. Efficient folding of proteins with
multiple disulfide bonds in the Escherichia coli cytoplasm. Proc. Natl. Acad. Sci. U.S.A. 96,
13703-13708 (1999).
39. Valentine, J.S., Doucette, P.A. & Zittin Potter, S. Copper-zinc superoxide dismutase and
amyotrophic lateral sclerosis. Annu. Rev. Biochem. 74, 563-593 (2005).
40. Banerjee, V. et al. Superoxide Dismutase 1 (SOD1)-derived peptide inhibits amyloid
aggregation of familial amyotrophic lateral sclerosis SOD1 mutants. ACS Chem. Neurosci. 7,
1595-1606 (2016).
41. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254 (1976).
64
42. Kuo, W., Huang, C., Shih, C. & Jinn, T. Cellular extract preparation for superoxide dismutase
(SOD) activity assay. Bio Protoc. 3, e811 (2013).
43. Zarafeta, D. et al. Metagenomic mining for thermostable esterolytic enzymes uncovers a new
family of bacterial esterases. Sci. Rep. 6 (2016).
44. Villar, E.A. et al. How proteins bind macrocycles. Nat. Chem. Biol. 10, 723-731 (2014).