wolbachia pcr: discover the microbes within! -...
Post on 05-Jun-2018
222 Views
Preview:
TRANSCRIPT
Wolbachia PCR: Discover the Microbes Within!
Overview of the Wolbachia Lab
?
DNA extraction PCR
Gel electrophoresis
Insect identification
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCA
DNA sequencing
Wolbachia lecture �
Images MBL courtesy of MBL
ACAGATGTC
TTGTAATCCG
GCCGTTGGT
GGCATAGGG
AAAGGACAT
TTAG
Bioinformatics
Use Wolbachia to Teach Students About:
Ecology & Biodiversity Entomology
Systematics & Taxonomic Keys Cell Biology & Symbiosis
Developmental Biology & Reproduction Molecular Biology: DNA & PCR
Bioinformatics
What is Symbiosis?
“Humans consist of approximately 10% human !cells and 90% prokaryotic cells, yet the idea of !studying the varied relationships between eukaryotic hosts and prokaryotic symbionts is largely ignored!in biology classes.” ! ! - Seth Bordenstein
Close interactions between different biological species !Mutualism - both species benefit !Commensalism - one species benefits, the other is unaffected !Parasitism - one species benefits, the other is harmed
Symbiosis Examples
http://www.ucmp.berkeley.edu/fungi/lichens/lichens.html http://www.gettyimages.com/detail/sb10064683e-001/The-Image-Bank http://www.cbc.ca/gfx/images/news/photos/2010/01/07/tech-cleaner-fish.jpg http://www.futurity.org/wp-content/uploads/2010/09/cow-11.jpg http://en.wikipedia.org/wiki/File:Malaria.jpg
What is Endosymbiosis?
http://www.caf.wvu.edu/~forage/johnsongrass/jgrassroot.jpg
Any symbiotic relationship in which one symbiont lives within the tissues of the other,
either in the intracellular space or extracellularly
FOME 2007 - Volume 14 No. 1, p. 4-5
http://serc.carleton.edu/microbelife/topics/wolbachia/resources.html
What is Wolbachia? • Obligate intracellular bacteria found in arthropods and nematodes !!• Found in ~66% of arthropod species; among the most abundant intracellular bacterial genus so far discovered!!• Responsible for the induction of a number of reproductive alterations; can alter host biology in diverse ways!!• Transmitted vertically through host eggs; can also move horizontally across species boundaries!!• Can have parasitic, mutualistic & commensal relationships with hosts
Nature 412, 12-14 (5 July 2001) http://www.rochester.edu/news/show.php?id=2963
Wolbachia is a Reproductive Parasite
Nature Reviews Microbiology 6, 741-751 (October 2008)
Def: maternally inherited microbial infections of arthropods that manipulate the reproduction of their host species towards the production or survival of infected female hosts
- Resides mostly within reproductive tissues - Present in mature eggs but not mature sperm - Passed from mother to offspring vertically - Employs 4 strategies to increase # of infected females:
Feminization
http://aces.nmsu.edu/academics/arthropods/living-arthropods-of-new.html
Land crustaceans, order Isopoda, exhibit feminization with Wolbachia infection
• Wolbachia resides in androgen-producing glands and inhibits production of male hormones during development • Causes genotypic males to have female phenotype • First described in isopods
Parthenogenesis
http://commons.wikimedia.org/wiki/File:European_wasp_white_bg02.jpg
Wasps, order Hymenoptera: one type of insect that exhibits Wolbachia-induced parthenogenesis
• A form of asexual or clonal reproduction found females • Growth & development of embryos occurs without male fertilization • Caused by disruption of the cell cycle during oogenesis • Results in diploid female without fertilization
http://commons.wikimedia.org/wiki/File:European_wasp_white_bg02.jpg
Wasps, order Hymenoptera: one type of insect that exhibits Wolbachia-induced parthenogenesis
• A form of asexual or clonal reproduction found females • Growth & development of embryos occurs without male fertilization • Caused by disruption of the cell cycle during oogenesis • Results in diploid female without fertilization
Male Killing
http://berkeley.edu/news/media/releases/2007/07/12_butterfly.shtml
Wolbachia causes MK in some butterfly species, order Lepidoptera
• Wolbachia causes abortion of male embryos during embryogenesis • Ensures better access to food and resources for females
Cytoplasmic Incompatibility
http://www.mbl.edu/news/press_releases/2006/2006_pr_05_19.html
Wolbachia causes CI in Nasonia wasps
• CI is the most frequently found Wolbachia-induced phenotype • Active area of research; mechanism not clearly known • Uninfected males cannot produce viable offspring with infected females and vice-versa • Sperm from Wolbachia-infected males is incompatible with eggs from females that do not harbor the same Wolbachia type
Filarial Nematodes
• Not parasitic but mutualistic in nematodes • Host depends on Wolbachia for development & survival • Horizontally transmissitted (infection)
Filaria Journal 2003, 2:10
Fliarial worm infected with Wolbachia
Infections Disease Control using Wolbachia
Diseases caused by filarial worms: Filariasis, River blindness, Heartworms (dogs)
Kill Wolbachia: Patients treated with antibiotics!
Diseases caused by insect vectors of: West Nile virus, Dengue fever, Milaria!
Introduce Wolbachia: will control mosquito populations!
http://www.thehindu.com/multimedia/dynamic/00006/FILARIASIS_6739e.jpg
Evolutionary Consequences
ABOVE: http://daily.swarthmore.edu/2009/2/19/gilbert-vatican/
• Wolbachia is an important selective force behind evolution
• It can accelerate & alter the evolution of it’s host in many ways
• An current area of intensive research
• How have Wolbachia induced evolutionary change?
Lateral Gene Transfer
Approximately one-third of sequenced invertebrate genomes contain Wolbachia gene insertions
Widespread Lateral Gene Transfer from Intracellular Bacteria to Multicellular Eukaryotes
Hotopp et al., 317 (5845): 1753-1756, September 2007
• Insertional events may contribute to host chromosomal rearrangements: - Acquisition of new genes (gain-of-function) - Disruption of existing genes (loss-of-function) • May play a part in reproductive isolation and speciation • Allow species to acquire new genes and functions extremely quickly http://www.rochester.edu/news/photos/hi_res/hi137.jpg
Evidence of Wolbachia Induced Evolution
Mating behavior alteration Males are rarer Competition between females increases
Loss of sex
Parthenogenesis causes reproductive isolation Loss of functioning sex mechanisms Reduced genetic diversity
Speciation and Extinction
Accumulation of mutations between isolated groups Decreasing population productivity
The Endosymbiotic Theory
Certain organelles originated as free-living bacteria that were taken inside another cell as endosymbionts
• Mitochondria developed from α-proteobacteria • Chloroplasts from cyanobacteria
What does this symbiosis tell us !about the nature of our own cells?!!Could Wolbachia be the next mitochondria? It is maternally inherited also a proteobacteria
Wolbachia PCR
• PCR reaction with Master and Primer mixes • Duplex reaction with insect and Wolbachia-specific primers:
Cytochrome oxidase I: component of electron transport chain, 709 bp Wspec: 16s ribosomal subunit specific to Wolbachia, 438 bp
Students can expect a positive Wolbachia diagnosis in one out of five insects.!
1. 100bp Ladder 2. Fly from SJSU lab, ‘11 3. Ladybug from Mt. View, ‘09 4. Aphids from my tomato plant, ‘10 5. Ant from Sunnyvale, ‘09 6. Large mosquito from San Mateo, ‘09 7. Wol+ control, Nasonia, ‘10
1 2 3 4 5 6 7
709 bp
438 bp
Sequencing and Bioinformatics 1. Students submit positive Wolbachia PCR samples for ! DNA sequencing !!2. BLAST the results to see if they matches a known
sequence!!3. Upload the Wolbachia sequence with those in a national
database (http://discover.mbl.edu/search.php)!
Basic Local Alignment Search Tool
National Center for Biotechnology Information
Bioinformatics is like using Google for DNA sequences
The Wolbachia Project http://discover.mbl.edu/
Encourage nationwide participation in the collection of new scientific data on bacterial endosymbionts (Wolbachia) Enhance student interest in science through an integrative lab series spanning biodiversity to molecular biology Professional development workshops for teachers: April 16-18 2011
How Students Contribute
Students who collect their own insect will have a much greater interest in and ownership over the project!
• The Wolbachia scientific community isn’t big enough to adequately ! sample the world’s arthropod populations for infection rates!!• Students are potentially the biggest assets in helping scientists !!• This is an effective motivator because it is publishable online ! at the project’s web site and is accessible by other students, ! teachers, families, and scientists.!
Student generates and uploads data on the infection !rate & geographic distribution of Wolbachia!
Key Steps for Obtaining Sharable Data
• Insect handling – Store insect in alcohol and freeze upon collection
• Record keeping – Collection site, date, insect photos, identification
• DNA handling – Use a very small portion of insect abdomen for DNA extraction – Store DNA and PCR products in the freezer
• Send complete information – Gel image
• BLAST new Wolbachia sequence – Information about “subgroup”
Acknowledgements
MBL and The Wolbachia Project Seth Bordenstein, Vanderbilt University John Werren, University of Rochester
The International Wolbachia Conference Group
top related