veterans day assembly fall festival recapallsaintsschool.org › upload › files ›...
Post on 25-Jun-2020
3 Views
Preview:
TRANSCRIPT
All Saints Episcopal School 3222 103rd St. Lubbock, TX 79423 806.745.7701 fax 748.0454 allsaintsschool.org
November 11, 2015
DID YOU KNOW? Brook Bowman was named lonestarvarsity.com’s Player of the Week this week!
VETERANS DAY ASSEMBLYVisit the school’s Facebook and Instagram for photos from today’s Veterans Day Assembly. Heartfelt thanks to the veterans who serve and defend our country.
LEGACY EVENTThe school’s annual Legacy Event is Sunday, December 6. This event is a won-derful way to support the school, enjoy a special evening of fun with friends, and mark several items off of your holiday shopping list! Please check out the Legacy section inside this issue, on pages 7-11, for more details!
HIGH SCHOOL ATHLETIC NEWSThe Patriot Cross Country teams and Volleyball team have had much success recently at the state level. Please turn to page six for the exciting de-tails!
INTERNATIONAL MARKET PLACE OPENSOur juniors are sponsoring a Fair Trade Sale to-morrow and Friday, from 8:30-4:30pm in the High School area. Groups in the sale include Eternal
Threads, Amani Africa, and Colores del Pueblo. All proceeds benefi t the partici-pating groups. Each group supports fair trade in developing countries, manages micro-fi nances for small businesses, and encourages community development in education, public health, and women’s rights. Shop early for the holidays and please note: cash and checks only!
U-CAN-SHARE FOOD DRIVE NEWSThe school’s annual U-CAN-SHARE Food Drive is now underway. The school has set a high goal of 12,000 cans! We can achieve this goal with your support and prayer. It was special to have David Weaver and Dani-elle Robertson from the South Plains Food Bank join us in Chapel on our Kick Off Day on November 4.
HIGH SCHOOL ONE ACT PLAY UPDATEThe High School One Act Play team recently competed in TAPPS district competition and is now preparing for the next level. Details on the team’s recent success and what comes next can be found on page fi ve.
FALL FESTIVAL RECAPFall Festival was a great suc-cess! Thank you to every-one who lent a hand to the event. Please take a peek at page 12 for a list of sponsors and volunteers.
The Fall Festival leadership crew is to be commended for a job well done. Thank you to chair Kathleen Burrell, and co-chairs Marci Gutheil and Irma Wisniewski.
Pumpkin ContestWinnersFirst: Evie HeinrichSecond: Gage ClaryThird: Colby MatznerFourth: Elizabeth JohnsonFifth: Noah Garcia
Congratulations to Kinder-garten on bringing the most Treasure Chest donations!
RAFFLE RESULTSFaculty member Shelly Smith won the John Hardy Bracelet and parent Angela Payne won the iPad mini. Thanks to all who purchased raffl e tickets.
Remember: only 355 days until Halloween 2016!
CALENDAR OF EVENTSWednesday, Nov. 11 8:00am Veterans Day Assembly
Thursday, Nov. 12 8:30-4:30pm4:00/5:00/6:00/7:00pm
International Market Place in Garrison Corridor7th Girls/7th Boys/8th Girls/8th Boys BB vs Southcrest
Friday, Nov. 13
10:00-1pm2:00pm
8:30-4:30pm
HS Pre-Area Choir Competition in AbileneProgress Reports DistributedFifth grade field trip, United Supermarkets ArenaTAPPS State Volleyball Semi-final vs. Waxahachie Prep in San AntonioInternational Market Place in Garrison Corridor
Saturday, Nov. 142:00pm
HS All Region Choir Concert, AbileneTAPPS State Volleyball Finals, San Antonio
Monday, Nov. 16 4:30pm Deadline for the Lynn Haney Legacy Santa orders
Tuesday, Nov. 17 9:45am5:00/6:30pm
5:00pm
Senior picturesJV/V Boys Basketball @ SmyerBoard of Trustees Meeting, Board Room Annex
Wednesday, Nov. 18 All Day6:30pm
Eat Out Day at HayashiEighth grade Student/Parent Meeting, Band Hall
Thursday, Nov. 19 6:00pm4:00/5:00/6:00/7:00pm
HS Theater performance, Kirby Commons7th Girls/7th Boys/8th Girls/8th Boys BB vs Christ the King
Friday, Nov. 208:30am
10:00-12:00pm2:15pm
HS Debate in CanyonSecond/Third grade Thanksgiving programFourth grade Field Trip, International Cultural CenterEighth grade Student/Faculty BB game
Saturday, Nov. 21 HS Debate in Canyon continuesHS Academic Practice meet at Texas TechTAPPS State One Act Play competition
Sunday, Nov. 22 TAPPS State One Act Play competition continues
Monday, Nov. 235:00/6:30pm
Thanksgiving break - School NOT in sessionJV/V Boys Basketball @ Midland Classical
Tuesday, 24-27 Thanksgiving break continues - School NOT in session
Tuesday, Dec. 1 4:00/5:00/6:30pm JV Boys/V Girls/V Boys Basketball @ Christ the King
LOOKING AHEADDec. 3 PS, Pre-K, K, P1 and First grade carol eventDec. 3-5 V Boys BB @ Lamesa Tournament ASES 7th/8th grade Girls BB TournamentDec. 4 First grade Field TripDec. 6 Legacy EventDec. 7 MS Girls and Boys BB @CtK JV Boys, V Girls & V Boys BB vs PCADec. 10 HS Choir field trip Hour of CodeDec. 10-12 ASES 7th/8th grade Boys BB TournamentDec. 11-12 HS Boys BB Tournament in FloydadaDec. 11 Fourth grade celebrates St. Lucia DayDec. 14 MS Girls and Boys BB vs. Kingdom Prep JV Boys/V Girls/V Boys BB @ Amarillo AscensionDec. 17 MS Girls and Boys BB @ SouthcrestDec. 18 DRESS UNIFORM Advent Festival of Lessons and Carols All School dismisses at Noon JV Boys/V Girls/V Boys BB @ Midland TrinityDec. 21-Jan. 4 Christmas/New Year’s Break - School is NOT in sessionDec. 21 JV Boys/V Girls/V Boys BB @ PCADec. 29-31 V Boys BB @ the AMBUCS Caprock Tourn.Jan. 2 JV Boys/V Girls/V Boys BB @ WF ChristianJan. 5 School resumes
Please note: When a game is listed as “vs.” it is a home game. When listed as “@” it is an away game.
Follow @GoAllSaintsPats on Twitter for the latest
in Patriot Athletics.
CongratulationsPatriot Artists
of the WeekAinsley
Wisniewski (k) - 11/2Annabelle
Needham (p1) - 11/9
3
CHAPEL PARTICIPANTSNov 12 (Thurs) Nov 13 (Fri) Nov 16 (Mon) Nov 17 (Tues) Nov 18 (Wed)
Lesson Ripon Tarafdar Blake Sherwood Madison Roberts Joseph Paone Tanusha NathPsalm Isabella Stallcup Scott Sanford Emily Payne Rowe Osborne Colby Matzner
Acolytes Ellis FoxGrady Geihsler
Abby HarrisCampbell Howe
Paden KeithBilal Kharrat
Razanne MalkiMaddie Matthews
Colby MatznerTanusha NathRowe OsborneJoseph Paone
Emily PayneMadison Roberts
Scott SanfordBlake Sherwood
Isabella StallcupRipon Tarafdar
Lee TaylorRodney Thomas
Nov 19 (Thurs) Nov 20 (Fri) Nov 30 (Mon) Dec 1 (Tues) Dec 2 (Wed)Lesson Maddie Matthews Paden Keith Campbell Howe Grady Geihsler Hunter EpprightPsalm Razanne Malki Bilal Kharrat Abby Harris Ellis Fox Mason Dawson
Acolytes Avery ThompsonSophie Thwaits
Daniel VermillionKate White
Regan AndrewsAbigail Barritt
Lauren BayouthNicholas Blevins
Sadie BlueWalker Blue
Sara CarothersDiego Cervera
Portia ClaryChloe ConoverMason DawsonHunter Eppright
Ellis FoxGrady Geihsler
Abby HarrisCampbell Howe
Please remember, if your student is scheduled to acolyte, he or she needs to be in Jones Gym no later than 7:45 a.m. on the morn-ing in which he/she is scheduled to serve. After 7:45 a.m., we find replacements as needed, in order to provide time to practice.
DID YOU KNOW? The Int’l Market Place is the spot to start your holiday shopping. See the attached flyer!
UNITED WAY DRIVE UPDATEThe school met its goal of raising $2,000 for the Lubbock Area United Way! To celebrate, a school wide sopapilla party was held on Friday, November 6. Many thanks to the NJHS Officers who spearheaded the Drive and to all who contributed. Way to go, Patriots!
MUSIC NEWSOn Saturday, October 24, the Texas Music Educators Association held auditions for its Region 16 Orches-tra. The following Seventh grade students auditioned: Yash Mittal - Violin and Sami Sharif - Cello. The following Sixth grade students auditioned: Mia Garza - Cello, Harrison Hensley - Cello, and Avery Wis-niewski - Cello. Yash, Sami, Harrison, and Avery earned chairs with the Orchestra. Mia earned an alternate position. There were more than 30 cellists and 54 violinists at the competition. Congratulations to all!
CHRISTMAS CAROLINGPLC through First grade students will be Christmas Caroling on Thursday, December 3 at the Village Shop-ping Center (82nd and Quaker) Open House. Preschool and Pre-Kindergarten will sing at 5:45pm and Kindergarten, Pre-First and First grade will sing at 6:15pm. Participating students will need to wear long-sleeved All Saints red shirts, long jeans, All Saints fleece jackets or red sweaters. Holiday head gear is also encouraged. PLC-First grade parents, please return the green permission slips to Mrs. Cameron or you may email her at ccameron@allsaintsschool.org to let her know if your child is going to attend the event. Come support our youngest Patriots as we kick off the season with music.
PATRIOT PATRONAGE PROGRAMThe Patriot Patronage Program is excited to give you the new business of the month! J. Thompson & Co., located in the Silent Night Village in Post is giving All Saints 10% back from all purchases in which the buyer mentions All Saints at checkout. J. Thomp-son & Co. is a home décor and furniture store with different types of home accents. This would be a great day trip with some friends, or just make the stop when traveling out of town for Thanksgiving. Don’t forget to mention our school at the time of purchase. Spread the word to your friends and family. Happy Shopping!
4
TECHNICALLY SPEAKING with Dr. Penny CarpenterAll Saints third grader Gavin Farley had the opportunity to travel to Churchill, Manitoba and connect with classmates using Google Hang-outs and a webcam. A webcam in the classroom enabled a two-way video call. Like an expert talk show host, Gavin interviewed polar bear scientist, Dr. Steve Amstrup, from a mobile buggy while a polar bear roamed outside the vehicle. Class-mates had opportunities to ask questions of Gavin and Dr. Amstrup. You can read some of the questions and responses on the twitter feed, @AllSaintsSTEM. Did you know November 1-7 was Polar Bear Week? The event coincides with the fall polar bear migration to Churchill, where polar bears gather to wait for freeze-up on Hudson Bay so they can return to hunting seals.
HOUR OF CODEThe Hour of Code is coming! During Computer Science Education Week, December 7-13, All Saints stu-dents will join a global movement with more than 100 million learners in 180 countries to promote com-puter science. On Thursday, December 10 at 6:00pm, All Saints fifth grade students will host hands-on, hour-long activities for parents and students of all ages. Mark your calendars now.
MIDDLE SCHOOL STUDENT COUNCILThe first Student Council Lock-In was a huge success! Thank you for allowing your student to participate and thank you to all of the chaperones.
SEVENTH GRADE THANK YOUSeventh grade collected 91 coats for Womens Protective Services and Family Promise for its annual Advent project. Thank you to Mrs. Tran, Mrs. Maples, Ms. Smith and Mrs Whitaker for their help.
LOWER SCHOOL NEWSSecond and Third grade will be performing their Thanksgiving program after Chapel on Friday, November 20. Second grade will dress as Native American Indians and Third grade will dress as Pilgrims. They will feast together that day at lunch. Thank you to the parents who helped with Second grade Pumpkin Math.
THANKS TO OUR D.O.G.S.Last Saturday, a group of our D.O.G.S. (Dads of Great Students) gathered to in-stall new tether ball poles in the Lower School playground. Thank you to these dads, plus a granddad or two, for their work on a brisk fall morning!
Follow @AllSaintsSTEM on Twitter for the latest on Patriot Technology.
Don’t forget to use the hashtag#ASESPride
on all of your PatriotPosts!
2015-2016 Lunch TimesPS: 12-12:30 in PLCPre-K: 11:25-11:50K/P1: 11:30-12:00
1st & 2nd Grade: 11:45-12:152nd Grade: 11:45-12:153rd Grade: 12:50-1:154th Grade:12:50-1:15
Middle School: 12:27-1:07High School: 1:20-2:10
DID YOU KNOW? There are three different world languages offered in our High School? Can you name them?
2016 Lun12-12:30200000000000000000000000000000000000000000000001616161616161661616161616161616161661161616161616161616161616166666616161611111611 LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLuuuuuuuuuuuuuuuuuuuuuuuu12 12222 3
Follow @AllSaintsSTEM
Bring your Bring your cans for the U-cans for the U-CAN-SHARE CAN-SHARE
Food drive!Food drive!
opportunity to travel toi G l H
y ur PatriotPost
niiiiiiiiiiiiityttytyttttytttytty
Posts!
5
DID YOU KNOW? The OAP team play is loosely based on the Biblical story of the Judgment of Solomon.
THEATER NEWSThe All Saints High School One Act Play team is advancing to the TAPPS state contest November 20-21 in Tyler by win-ning its district contest. Seven cast members earned All-Star honors.
The contest requires all plays be performed in one act last-ing no more than 40 minutes. Sixty percent of the scoring is based upon acting while 40 percent is judged on other ele-ments like sets, costumes, and lighting.
Sophomore Raymond Rider was named as the District Best Actor while senior Matt Harper was named as the District’s Outstand-ing Crew Member. Senior Keely Umstot and freshmen Susannah Bumstead and Brooke Stevenson were named to the All Star Cast. Sophomore John-Gamble Streit and senior Alyssa Smith were named on the Honorable Mention All Star Cast. Congratulations to these individuals and to the entire cast and crew on its district success!
The cast performed the one-act play, The Caucasian Chalk Circle, written by Bertikt Brecht. The play is a parable about a Russian peasant girl who rescues a baby and becomes a better mother than its wealthy natural parents. The kitchen maid finds the child and seeks refuge far from her home to protect the child from soldiers looking to kill anyone from the Russian aristocracy. The maid is forced to deny her own en-gagement to a man she loves, marry another man, and claim the child as her own. At the end of the war, the wealthy mother tries to reclaim her son in order to inherit her husband’s estate after he was killed during the war. A court battle ensues and the judge determines to settle the custody case with the Caucasian Chalk Circle test. The judge’s decision awards the child to the peasant servant and awards her a divorce decree allowing her to marry her betrothed.
The One Act Play team is performing the play on November 19 at 6:00pm in Kirby Commons. Make plans now to support this team as it prepares for state competition later this month!
6
HIGH SCHOOL CROSS COUNTRYOn Halloween, the High School Cross Country boys and girls teams travelled to Waco to defend their team State Champi-onship titles. Both teams are coached by Madeline Livergood. The course was a mudfest, having received rain all week, including seven inches the day before the race. After hours of delays, the 1A girls race fi nally began as the fi rst race of the day. The competing girls team consisted of: senior Catherine Latour, juniors Kennedy Eaker and Riley Higgins, sopho-mores Tatum Harper and Lily McKay, and freshmen Sara Phy and Laela Tello.
Finishing in the Top Ten and earning All-State honors were: Lily McKay, who fi nished 6th; Laela Tello, who fi nished 8th, and Riley Higgins, who fi nished 10th. Upperclassmen Kennedy Eaker, who fi nished 11th, and Catherine Latour, who fi nished 13th, were eligible and both earned Academic All State honors. Rounding out the individual fi nishes were Tatum Harper and Sara Phy, who fi nished 19th and 22nd respectively. 49 girls completed the race, under sloppy conditions.
The boys competed immediately following the girls race. The competing boys team consisted of: seniors Matt Harper
and Ben Tipton, junior Brett Berger, sophomores Austin Hickle and Luke Stuart, and freshmen Ret Taylor and Myles Tipton.
Ret Taylor won and is the TAPPS 1A State Champion! Joining Ret in the Top Ten and earning All-State honors is Ben Tipton, who fi nished 10th. Ben, as an upperclassman, was eligible and earned Academic All State honors. Rounding out the team’s individual results were: Matt Harper, who fi nished 17th; Luke Stuart, who fi nished 21st; Myles Tipton, who fi nished 29th; Brett Berger, who fi nished 38th, and Austin Hickle, who fi nished 44th. More than 100 boys completed the race, which proved chal-lenging with deteriorating course conditions and a steady mist falling.
As a team, the girls dominated, scoring 25 points better than the second place team and as a result, repeated as TAPPS 1A STATE CHAMPIONS! The boys team scored 12 points better than the second place team and also repeated as TAPPS 1A STATE CHAMPIONS!
HIGH SCHOOL VOLLEYBALLAfter winning the TAPPS 1A District and earning a Bi-District Championship bye, Varsity Volleyball hosted the Area Championship match on November 3. All Saints beat Wichita Christian to claim the match. The team travelled to Abilene last Saturday to play North Central Texas Academy for the Regional title. In a fi erce back-and-forth battle, the Patriots won and have earned a trip to the TAPPS State playoffs. The var-sity squad includes: juniors Brook Bowman-c, Kennedy Eaker-c, and Presley Eaker; sophomores Tatum Harper, Abby Macha, and Lily McKay-c; and freshmen Katie Bayouth, Syriah Flores, and Sara Phy. The team is coached by Kimberli Swett and Hailey Clark. Good luck at State, Patriots!
MIDDLE SCHOOL BASKETBALLMiddle School Basketball has opened its season with games against KPA, Lubbock Christian, and Plainview Christian. The Eighth grade boys team is undefeated and the Eighth grade girls team enjoyed a big win over Lubbock Christian. Both Seventh grade teams swept Plainview Christian. All of the teams are back in action hosting Southcrest Christian in Jones gym on Thursday. See you there!
HIGH SCHOOL BASKETBALLHigh School Boys Varsity and Junior Varsity Basketball teams opened its seasons last night in Patriot Gym, in hard fought losses to TAPPS 3A Midland Classical Academy. Next up on the schedule for both teams are scrimmages next week against 2014-2015 UIL 2A Regional Semi-Finalist Smyer. The High School Girls Varsity season gets underway later this month.
DID YOU KNOW? All Saints families have names that start with every letter of the alphabet except X!
7
YOU Can win this 2016 Mercedes!!
Your support of this year's Legacy Car Raffle will help the school raise important funds! Every All Saints family is asked to sell a minimum of FIVE RAFFLE TICKETS. To encourage everyone to sell, we are offering one free ticket as a bonus for you, every time you sell five tickets. Re-member that each ticket admits two guests to the Legacy Event on December 6. Here are a few fun raffle facts:
• The raffle prize (car) is purchased by the school. Ticket sales are important as the car costs must be raised and exceeded in order for the school to profit. Last year's raffle raised approximately $40,000.
• Only 2,000 tickets will be sold.
• The winner need not be present to win - out of town tickets may be sold.
• The car may be traded, upgraded, or sold by the winner.
• Want to see the Mercedes? It is parked on our campus each day. If you would like to see the interior, please contact Dawndi or Celeste in the Advancement Office and we will be happy to show it to you.
LegacyEvent News
DID YOU KNOW? The ticket deadline for submitting your completed ticket forms and money is Friday, November 20.
If you want to continue selling tickets to family and friends over the Thanksgiving holiday, please do! You may then turn in your ticket forms and money on Monday, November 30.
Tickets will remain on sale at school and at the Legacy Event.
8
LEGACY AUCTION SNEEK PEEK!The Legacy Committee is excited to share a few of the fabulous auction items coming to this year’s event. There will be something for everyone to love in the silent, bid board, and live auctions. Here are just a few of the items awaiting your bid!
SILENT AUCTION• Would you like Saint Nick or Mrs. Claus to make a personal visit to your home? We have an inside
connection with the North Pole! Come bid.• Love Sports? Come bid on riding lessons, shooting range practice, sports camps, a personal trainer, or
an autographed TTU flag.• Looking for unique holiday gifts? Every All Saints class is contributing a special gift to our auction this
year and you won’t want to miss these.• TTU Tailgating package, Couples Wine Dinner, Little Girl’s Dream Dress-Up Box, Fitness Package,
YETI Cooler with Artisan Beer Collection, and much more!
COMING TO BID BOARD• Custom TTU Fire Pit for your backyard• Beautiful jewelry from Heather Henry and David Yurman• Trip packages to Santa Fe and Fredricksburg• Catered Dinner for eight in the home of Dr. Mike and Sharon Bennett• Reserved seats for your favorite All Saints events
LIVE AUCTION• Napa Valley Sip and Soar - tour the wine country by hot air balloon!
• Drest to Impress! A per-sonalized shopping experience at Drest.
• Love to Hunt? Bid on a Pig Hunt for four with lodging and meals.
• Want to Golf? Escondido trip for four with airfare, casita, golf, & meals.
• Reserved Parking at All Saints - four of the best parking spots.
• Puppy Love! Your kids will fall in love with our 6-week-old male Morkie.
DID YOU KNOW? This year’s Birthday penny from Chapel is a butterfly, a symbol of The Resurrection.
9877-544-8555
info@winspireme.com
Winspire, Inc.
Laguna Hills, CA
HHHHoootttt AAAAiiiirrr BBBBaaalllllllloooooonnn RRRRiiiiddddeee,,, WWWWiiiinnneeerrryyy TTTTooouuurrrsss &&&& TTTTaaasssttttiiiinnngggsss,,, CCCChhhhaaauuuffffffffeeeuuurrr,,, MMMMeeerrriiiittttaaagggeee RRRReeesssooorrrtttt aaannndddd SSSSpppaaaHHHHHooooooottttttt AAAAAAAiiiiiiirrrrrrr BBBBBBBaaaaaaallllllloooooooooooooonnnnnnn RRRRRRRiiiiiiidddddddeeeeeee,,,,,,, WWWWWWWiiiiiiinnnnnnneeeeeeerrrrrrryyyyyyy TTTTTTTooooooouuuuuuurrrrrrrsssssss &&&&&&& TTTTTTTaaaaaaassssssstttttttiiiiiiinnnnnnngggggggsssssss,,,,,,, CCCCCCChhhhhhhaaaaaaauuuuuuuffffffffffffffeeeeeeeuuuuuuurrrrrrr,,,,,,, MMMMMMMeeeeeeerrrrrrriiiiiiitttttttaaaaaaagggggggeeeeeee RRRRRRReeeeeeesssssssooooooorrrrrrrttttttt aaaaaaannnnnnnddddddd SSSSSSSpppppppaaaaaaa33333--NNNNNiiiiigggghhhhhttttt SSSSStttttaaaayyyy wwwwiiiiittttthhhhh AAAAAiiiiirrrrfffffaaaarrrreeee fffffoooorrrr 222223333333------NNNNNNNiiiiiiiggggggghhhhhhhttttttt SSSSSSStttttttaaaaaaayyyyyyy wwwwwwwiiiiiiittttttthhhhhhh AAAAAAAiiiiiiirrrrrrrfffffffaaaaaaarrrrrrreeeeeee fffffffooooooorrrrrrr 2222222
Suggested Retail Value:
Priceless
Enjoy an early morning journey in a hot air balloon, soaring above the magnificent Napa Valley, including a post-flight Champagne breakfast. Then
visit some of Napa’s best wineries in style with 6 hours of chaufferred luxury
sedan service.
1
For more information,see Package Description.
1From any major metropolitan airport in the 48 contiguous U.S. 2A full-service travel team who will book all reservations for your Winspire Experience.
10
The Legacy Committee is excited to announce that legendary craftsman Lynn Haney has designed a special All Saints Santa Claus exclusively for our school. These hand-crafted Santas are available for pre-order for a limited time and will be available for pickup the week of our Legacy event. (Santas may also be ordered on the evening of Legacy for late-December delivery). The All Saints Santas are $350. If you would like Lynn to personalize your Santa with your child's name (or family name) the price is $375. Please turn in your order form by November 16 for December delivery. Forms may be mailed or hand-delivered to the All Saints Administration Office, 3222 103rd Street, 79423.
Name: _________________________________Phone: ______________ Email: ___________________________
Child's Name: _______________________________ Child's Grade: _________________
Quantity: ________ Personalization: Yes No
If personalized, names of children OR family name: _________________________________________________________________________________________________________________________________________
Method of Payment (payment MUST accompany order form): Payment Enclosed: Check ________ Cash _______ Credit Card____________ Charge to my: VISA MC American Express Discover Account # ___________________________ Expiration Date______________ Zip Code __________________ Authorization Code _____________________ (3 or 4 digit number on back of card)
Questions? Feel free to call Dawndi or Celeste in the Office of Institutional Advancement: 806-745-7701
Handcrafted All Saints Santas for sale
11
Childcare for
Legacy Event
Sunday, December 6th, 5:30 PM to 9:30 PM
All Saints School Patriot Learning Center
All Saints students, school-age siblings and friends are welcome. A pizza dinner will be served. There is no charge for this service. Child’s Name ______________________________________
Age _____ Phone Number _______________________ Please return form to the office by Friday, December 4th. Pat Brimberry (806) 300-4868
12
THANK YOU TO OUR FALL FESTIVAL SPONSORS
It’s SCARY how much we appreciate you! Booth Sponsors and Donors:
*ASCO*Barragan Family* Barritt Family* BC and the Tyler Family*Belk Family* Blevins Family* Berman Family* Body Works* Brooks Family*BumsteadFamily* Burrell Family*Callahan Family*Clearley Family *Cost Co *D’Alise Family*
Duemer Family* Evans Family* Gaines Family* Garcia Family* Rajeev Gill Family* GillFamily* *Gutheil Family* Hancock Family*Hebison Family* Helton Family* HigginsFamily* Hillin Family* Hocker Family* Holguin Family* Howe Family*Fischenich
Family*Janes Family* Johnston Family* Kerby Family* Key Family* Lampe Family*Mahajan Family*Martinelli Family* McDonald Family *Mead Family* Mercer Family*Kelly Mitchell Family* Mitchell Family* Mooty Family* Moss Family* Needham Family*Nothing Bundt Cakes * Owen Family* Paone Family* Perez Family* Pinkston Family*Reasoner Family* RE Janes Gravel *Renfroe Family* Robinson Family* Rogers Family*Rushing Family* Sam’s Club* *Seeking Sitters * Sharif Family*Sizer Family* Chad Smith
Family*Kevin Smith Family* Marvin Smith Family*Paul Smith Family* St. ClairFamily*Staggs Family* *Stephen Joseph and the Taylor Family*Strong Family* SullivanFamily * United Supermarkets * Verdugo Family* Vermillion Family* Wade Family*Jordan Wheatley Builders and the Wheatley Family*White Family* Wischmeyer
Family*Wisniewski Family* Wolfe Family*Yalew Family* Yates Family*
And, special thanks to our wonderful Volunteers, including:* Miller Girls* Kappa Alpha Theta*First Bank & Trust*NJHS and Annie Bray Cox*All Saints Parent Board*DOGS* All Saints High School Students and Gwen Belk*ALL of our wonderful Bake Sale Bakers*Priya Gill
*All Saints Administration* Misty Deeds* Fidel Castrejon and Buck Maples*Oscar Flores*All SaintsTheatre Department and Paula Chanda*Celebration DJ* Lindy Long* Coach Robertson* CarolineJanes*Becky Kerby* Elizabeth Massengale* Jenni Gaines*Heather Hocker*Amanda Mead* SomerJaynes*Second Grade and Teachers*Petra Clary* Lisa Gregg* Veronica Young*Melissa Keller*Cliff
Hillin*Amanda Hensley*Nathan Reid*Darby Barragan* Janice Lampe* Kara Wischmeyer* Blarney StoneEquestrian Center* Minis & Friends* Jaemie Steinmetz*Paige McKay*Libby White*Cami Callahan*DeePaone*Eric Etheredge*Judy Briggs*Kevin Smith* *Ashley Nicholas* Robert Lance Jewelers* All Saints
Eighth Graders & Becky Addington*Meg Rushing*Marbella Tran*Ali Johnson*Angie Lane*AudraSmith*Kacee Harvey*Heather Mooty*Families that donated Treasure Chest Items & Stuffed
Animals*Kindergarten and Teachers* Chanda Dihenia*
Thank you for a wonderful event. All proceeds are directly invested back into our children andschool. We are thankful for our All Saints Family! Irma, Marci & Kathleen
13
In te rna t ional Marke t P laceF e a t u r i n g 1 0 0 % F a i r T r a d e p r o d u c t s
All Saints High School Juniors are sponsoring a Fair Trade sale in
the Kirby Commons on November 12th and 13th (Thursday and
Friday) from 8:30 to 4:30. All proceeds from the sale will return
to the groups who supplied the goods;. Each group supports fair
trade in developing nations, manages microfinance for small
businesses, and encourages community development in
education, public health, and women’s rights.
Highlights
Find handmade, Fair Trade Items.
Shop early for the holidays.
Buy something fun or unusual.
Support artisans from developing
nations.
Enjoy!
Products from: Eternal Threads, Amani Africa, and Colores del Pueblo For a preview, check out their websites.
Cash and checks only
All Saints School 3222 103rd Street
Date: 11/12– 11/13/2015
Time: 8:30 AM– 4:30 PM
top related