restriction analysis and digestion of lambda dna
Post on 29-Dec-2015
250 Views
Preview:
TRANSCRIPT
•• Used Used by bacteria to by bacteria to protect against viral protect against viral DNA infectionDNA infection
•• Endonucleases = Endonucleases = cleave within DNA cleave within DNA strandsstrands
•• Over 3,000 known Over 3,000 known enzymesenzymes
DNA Restriction Enzymes DNA Restriction Enzymes
Enzyme Site Recognition
•• Each enzyme digests Each enzyme digests (cuts) DNA at a (cuts) DNA at a specific sequence = specific sequence = restriction siterestriction site
•• Enzymes recognize Enzymes recognize 4- or 6- base pair, 4- or 6- base pair, palindromic palindromic sequences sequences (eg GAATTC)(eg GAATTC)
PalindromePalindrome
Restriction siteRestriction site
Fragment 1Fragment 1 Fragment 2Fragment 2
Common Restriction Enzymes
EEcocoRIRI– – Eschericha coliEschericha coli– – 5 prime overhang5 prime overhang
PPststll– – Providencia stuartiiProvidencia stuartii– – 3 prime overhang3 prime overhang
• Your tasks:
• Cut lambda DNA into a series of fragments using restriction enzymes
• To separate and sort a large group of DNA molecules according to theirsize
• Important note: First add DNA, then restriction buffer, and then the enzymes to the tubes. Use a fresh pipette tip for restriction buffer and each enzyme.
The DNA Digestion Reaction
Restriction Buffer provides optimal conditions
• NaCI provides the correct ionic strength
• Tris-HCI provides the proper pH
• Mg2+ is an enzyme co-factor
•Place the sample tubes in a 37°C water Place the sample tubes in a 37°C water bath or oven for approximately 30 minutesbath or oven for approximately 30 minutes
•While you are waiting, this a good time to While you are waiting, this a good time to cast your agarose gelcast your agarose gel
DNA Digestion Temperature
Why incubate at 37°C?
• Body temperature is optimal for these and most other enzymes
What happens if the temperature istoo hot or cool?
• Too hot = enzyme may be denatured (killed)
• Too cool = enzyme activity lowered, requiring
longer digestion time
Part 1. Prepare Your Samples for Electrophoresis
• Add 2.0 μl of sample loading dye to each of the tubes marked L, P, E, and H in the foam tube holder. Use a fresh tip with each sample to avoid contamination
Part 2. Set Up Your Gel Electrophoresis Chamber
• . Pour enough buffer into the box until it just covers the wells of the gel by 1–2 mm
Part 3. Load your Samples and Run them by Electrophoresis
• Pipette 10 μl from each tube (M, L, P, E, and H) into separate wells in the gel chamber
• Important
• Electrophorese at 100 V for 30–40 minutes
Restriction Fragment Length Polymorphism RFLP
Allele 1Allele 1
Allele 2Allele 2
GAATTCGAATTCGTTAACGTTAAC
GAATTCGAATTCGTTAACGTTAAC
CTGCAGCTGCAGGAGCTCGAGCTC
CGGCAGCGGCAGGCGCTCGCGCTC
PstIPstI EcoRIEcoRI
11 22 33
33Fragment 1+2Fragment 1+2Different Different Base PairsBase PairsNo restriction siteNo restriction site
MM A-1A-1 A-2A-2
Electrophoresis of Electrophoresis of restriction fragmentsrestriction fragments
M: MarkerM: MarkerA-1: Allele 1 FragmentsA-1: Allele 1 FragmentsA-2: Allele 2 FragmentsA-2: Allele 2 Fragments
top related