profiling microglia from ad donors and non-demented ... · 3/18/2020 · to examine the effect of...
Post on 10-Aug-2020
4 Views
Preview:
TRANSCRIPT
1
Profiling microglia from AD donors and non-demented elderly in 1
acute human post-mortem cortical tissue 2
3
Astrid M. Alsema1, #, Qiong Jiang1, #, Laura Kracht1, #, Emma Gerrits1, Marissa L. Dubbelaar1, 4
Anneke Miedema1, Nieske Brouwer1, Maya Woodbury3, Astrid Wachter4, Hualin S. Xi3, 5
Thomas Möller3, Knut P. Biber4, Susanne M. Kooistra1, Erik W.G.M Boddeke1,a and Bart J.L. 6
Eggen1,a * 7
8
1 Department of Biomedical Sciences of Cells & Systems, Section Molecular Neurobiology, 9
University of Groningen, University Medical Center Groningen, Antonius Deusinglaan 1, 10
9713AV Groningen, the Netherlands. 11
3 Foundational Neuroscience Center, AbbVie Inc., Cambridge, Massachusetts, United States of 12
America 13
4 Neuroscience Discovery, AbbVie Deutschland GmbH & Co. KG, Ludwigshafen, Germany 14
#These authors contributed equally to this work. 15
aThese authors share senior authorship. 16
*Correspondence: 17
Prof. dr. Bart J.L. Eggen 18
b.j.l.eggen@umcg.nl 19
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
2
Abstract 20
Microglia are the tissue-resident macrophages of the central nervous system (CNS). Recent 21
studies based on bulk and single-cell RNA sequencing in mice indicate high relevance of 22
microglia with respect to risk genes and neuro-inflammation in Alzheimer’s disease. Here, we 23
investigated microglia transcriptomes at bulk and single cell level in non-demented elderly and 24
AD donors using acute human post-mortem cortical brain samples. We identified 9 human 25
microglial subpopulations with heterogeneity in gene expression. Notably, gene expression 26
profiles and subcluster composition of microglia did not differ between AD donors and non-27
demented elderly in bulk RNA sequencing nor in single-cell sequencing. 28
Keywords: Alzheimer's disease, microglia, single-cell RNA sequencing, barcoded Smart-seq2, 29
human 30
31
Introduction 32
Alzheimer’s disease (AD), one of the most prevalent age-related neurodegenerative disorders, 33
is characterized by extracellular deposition of β-amyloid protein (Aβ) and intra-neuronal 34
neurofibrillary tangles in the neocortex [1]. 35
Functional changes occurring in microglia cells have been proposed as an important factor in 36
AD pathology [2,3]. AD single nucleotide polymorphism (SNP) heritability was recently found 37
to be highly enriched in microglia enhancers [4]. Multiple genes associated with increased 38
susceptibility for sporadic AD are preferentially expressed in microglia, including APOE, CR1, 39
CD33, INPP5D, PLCG2, MS4A6A and TREM2 [5,6]. In AD mouse models, microglia have 40
been implicated in Aβ seeding, Aβ plaques are surrounded by activated microglia, microglia 41
protrusions physically interact with insoluble Aβ aggregates and microglia around plaques 42
undergo transcriptional changes [7–12]. Sustained depletion of microglia in 5xFAD mice 43
prevents Aβ plaque formation in parenchymal tissue, rather showing Aβ accumulation in the 44
brain vasculature [13]. The functional changes occurring in microglia during AD pathology 45
seem to be diverse [14] and the exact role that microglia play in AD pathology is still unknown. 46
Many efforts have been made in AD mouse models to identify subpopulations of microglia that 47
are associated with AD pathology. A microglial neurodegenerative subpopulation was 48
discovered by Krasemann and colleagues that was associated with Aβ plaques and triggered by 49
phagocytosis of apoptotic neurons [9]. This transcriptional phenotype was characterized by 50
increased Spp1, Itgax, Axl, Lilrb4, Clec7a, Ccl2, Csf1, and Apoe and decreased P2ry12, 51
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
3
Tmem119, Olfml3, Csf1r, Rhob, Cx3cr1, Tgfb1, Mef2a, Mafb, and Sall1 expression levels [9]. 52
At the same time, a highly similar gene expression change, associated with microglia 53
surrounding Aβ plaques was reported by Keren-Shaul and colleagues [8], termed disease-54
associated microglia (DAMs). Using single-cell RNA-sequencing these DAMs were 55
subdivided into two sequential stages, a Trem2-independent stage, marked by increased 56
expression of Tyrobp, Apoe, and B2m and decreased expression of homeostatic genes, followed 57
by a Trem2-dependent activation stage marked by induction of genes involved in lipid 58
metabolism and phagocytosis (Trem2, Spp1, Itgax, Axl, Lilrb4, Clec7a, Cts7, Ctsl, Lpl, Cd9, 59
Csf1, Ccl6, Cd68 and more). Sala et al. [15] described a microglia subpopulation that appears 60
in response to Aβ deposition in AppNL-G-F mice and shares gene expression changes with DAMs. 61
They identified mutually exclusive subtypes of activated response microglia (ARMs) 62
overlapping with DAMs and, in addition, an independent subtype of interferon response 63
microglia (IRMs). 64
Studies investigating human microglia subtypes are limited, probably due to the technical and 65
logistical difficulties of isolating pure, viable microglia from acute human brain tissue. Olah 66
and colleagues [16] investigated single human microglia from donors with a large variety of 67
neuropathological backgrounds. They observed 23 clusters of microglia, where 5 out of 23 68
clusters were enriched for DAM signature genes. However, the neuropathological background 69
of donors was too diverse to associate the observed changes to AD. Mathys and colleagues [17] 70
used single-nucleus sequencing and subclustered ~2400 microglia of 48 donors. This study was 71
focused on cell-type specific responses to AD development and around 50 microglia per donor 72
was insufficient to fully define microglia diversity in AD. 73
In this study, we aimed to identify transcriptomic changes in human microglia at the end-stage 74
of AD, by applying both bulk and single-cell sequencing of microglia acutely isolated from 75
acute post-mortem CNS tissue. We isolated and sequenced a pure population of microglia after 76
CD11B+CD45+-based FACS sorting and investigated effects of gender, brain region, tissue 77
dissociation methods and diagnosis. 78
79
Materials and methods 80
Human brain specimens 81
Autopsy brain specimens from the LPS, GFS and lateral temporal lobe were obtained from 25 82
donors of the Netherlands Brain Bank (NBB, https://www.brainbank.nl/) and 2 donors of the 83
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
4
NeuroBiobank of the Institute Born-Bunge (NBB-IBB, Wilrijk, Antwerp, Belgium, ID: 84
BB190113). Mechanical isolation of microglia and bulk microglia sequencing was performed 85
with 22 specimens (11 GFS, 11 LPS) of 15 donors (6 AD, 6 CTR+, 3 CTR). From nine donors 86
both regions were collected and from the other donors either GFS (2016-038, 2016-095, 2017-87
102) or LPS (2017-098, 2017-124). From three donors (2016-038, 2016-046, 2016-080), LPS 88
or GFS specimens were divided for mechanical as well as enzymatic dissociation. Single-cell 89
sequencing was performed with 16 specimens (15 LPS, 1 temporal) from 15 donors (6 AD, 5 90
CTR+, 4 CTR), from which 2 were overlapping with donors used in bulk analysis (2018-18, 91
2018-021). All donors have given informed consent for autopsy and use of their brain tissue for 92
research purposes. The performed procedures, information - and consent forms of the NBB 93
have been approved by the Medical Ethics Committee of the VU Medical Centre. On average, 94
the autopsies were performed within 6h after death. Detailed information about brain specimens 95
used for bulk and single-cell sequencing can be found in Table S1 and S2, respectively. 96
Microglia isolation and sorting 97
The mechanical isolation of microglia was performed as described previously [18,19] with 98
minor modifications. All procedures were performed on ice and all centrifugation steps were 99
performed at 4°C. The tissue was homogenized by mechanical dissociation in Medium A 100
(HBSS (Gibco, 14170-088) containing 15 mM HEPES (Lonza, BE17-737E) and 0.6% glucose 101
(Sigma-Aldrich, G8769) and was filtered through a 300 and 106 µm sieve. Cells were 102
centrifuged at 220g for 10 min and myelin and other lipids were removed through two percoll 103
gradient centrifugation steps. A 100% Percoll solution was prepared consisting of 90% Percoll 104
(GE Healthcare, UK) and 10% 10x HBSS (Gibco, 14180-046), from which the dilutions were 105
prepared. First, cells were resuspended in 24.5% (vol/vol) Percoll in Medium A. A layer of PBS 106
was added and the gradient was centrifuged at 950g for 20 min with reduced acceleration speed 107
and brakes off. After the supernatant was removed, cells were resuspended in 60% (vol/vol) 108
Percoll in 1x HBSS (Gibco, 14170-088) and a layer of 30% (vol/vol) Percoll in 1x HBSS 109
(Gibco,) and PBS, respectively, were added and centrifuged at 800g for 25 min (acc: 4, brake: 110
0). The cells in between the 30%/60% percoll layer were collected and washed in 1x HBSS 111
(Gibco, 14175-053) and centrifuged at 600g for 10 min. 112
To examine the effect of the isolation protocol on the microglia expression profile, for three 113
tissue samples (2016-038, 2016-046, 2016-080) mechanical and enzymatic dissociation on two 114
halves of the same tissue was performed. 1.5 gram of tissue was incubated for 80 minutes at 115
37°C continuously shaking in enzyme solution (1x Trypsin/EDTA (Gibco, A1217701), 0.1 mM 116
HEPES (Lonza, BE17-737E), 0.5 mg/ml DNase I (Roche, 10104159001) in 1x HBSS (Gibco, 117
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
5
14170-088)). Next, it was continued with the Percoll gradient centrifugation steps as described 118
above. 119
Cells were incubated with anti-human Fc receptor (0,005 µg/ml eBioscience, 14-9161-73) for 120
10 min in Medium A without phenol red (HBSS (Gibco, 14170-053) containing 15 mM HEPES 121
(Lonza, BE17-737E), 0.6% glucose (Sigma-Aldrich, G8769), 1mM EDTA (Invitrogen, 15575-122
038)), followed by the incubation with 5 µg/ml DAPI (Biolegend, 422801), eBioscience 123
DRAQ5 (Thermofisher Scientific, 63351), FITC anti-human CD45 (BioLegend, 304006) and 124
PE anti-human CD11B (BioLegend, 301306). Single, viable microglia defined as DAPI-, 125
DRAQ5+, CD45+ and CD11B+, were FACS sorted on a Beckman Coulter MoFlo XDP or 126
Astrios. 127
For bulk microglia RNA sequencing, microglia were sorted into low retention Eppendorf tubes 128
(Sigma, Z666548-250EA) containing 200 µl RNA later (Qiagen, 76104). Following, 129
centrifugation at 4°C and 5000g for 10 minutes, supernatant was carefully removed and 130
microglia were resuspended in 350 µl RLTplus lysis buffer (Qiagen, 1053393) and stored at -131
80°C. For barcoded 3’ single-cell sequencing, 15792 single microglia were collected in 384-132
well PCR plates containing cell lysis buffer (0,2% Triton (Sigma-Aldrich, T9284), 4 U RNAse 133
inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific, #R0193) and 10µM barcoded 134
oligo-dT primer) and were stored for maximally one month at -80°C until further processing. 135
For 10x Genomics Chromium single cell RNA sequencing, approximately 25000 single 136
microglia were sorted from two samples (2018-135, 2ß19-010) into low retention Eppendorf 137
tubes (Sigma, Z666548-250EA) containing 5 µl Medium A and were immediately processed 138
with the Single Cell 3’ Reagent Kit v2 (10x Genomics). FACS data was analyzed with FlowJo 139
(Becton, Dickinson & Company). 140
Bulk microglia RNA sequencing library preparation 141
Total RNA was extracted from the bulk sorted microglia samples using the RNeasy Plus Micro 142
kit (Qiagen, 74034) according to the manufacturer's protocol. RNA quality and quantity were 143
determined with the Experion RNA HighSens Analysis Kit (Bio-Rad, #7007105). All 25 RNA 144
samples, with RIN values varying between 5.7 and 9.9, were enriched for poly(A)+ messenger 145
RNA using NEXTflex Poly(A) Beads (BIOO Scientific, #NOVA-512980) according to the 146
protocol in the manual. Fourteen µL of this mRNA-enriched poly(A)-tailed RNA was used as 147
the input for the NEXTflex Rapid Directional qRNA-Seq kit (Bioo Scientific, #NOVA-5130-148
04). Library preparation was performed according to the manufacturers protocol. Quality and 149
concentration of libraries from individual samples were assessed using the High Sensitivity 150
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
6
dsDNA kit (Agilent, 067-4626) on a 2100 Bioanalyzer (Agilent) and a Qubit 2.0 Fluorometer 151
(Life Technologies). Subsequently, individual libraries were combined into 2 sequencing pools 152
of 13 samples each with equal molar input. 75bp paired-end sequencing was performed on an 153
Illumina NextSeq 500 system. PhiX was added at 5% to both pools as an internal control before 154
sequencing. 155
Single-cell RNA sequencing library preparation 156
The single-cell RNA library preparation method that was used here is based on the Smart-157
seq2 protocol by Picelli [20], with the modification of obtaining 3’ instead of full-length 158
RNA/cDNA libraries as in Uniken Venema [21]. After cell lysis and barcoded poly-dT primer 159
annealing (73°C, 3 min), RNA was reversed transcribed (RT) based on the template 160
switching oligo mechanism using 0.1 µM biotinylated barcoded template switching oligo 161
(BC-TSO, 5’-AAGCAGTGGTATCAACGCAGAGTACATrGrG+G-biotin-3’), 25 U 162
SmartScribe reverse transcriptase, first-strand buffer and 2mM DTT (Takara, 639538), 1 U 163
RNAse inhibitor (Takara, 2313A) and 1M betaine (Sigma-Aldrich, B0300-5VL) with the 164
following PCR program: 1) 42 °C 90 min, 2) 11 cycli of 50 °C 2 min, 42 °C 2 min, 3) 70 °C 165
15 min. To account for amplification bias and to allow multiplexing of cells and samples, the 166
barcoded poly-dT primer contains a cell-specific barcode and a unique molecular identifier 167
(UMI) and a known sequence that is used as a primer binding site during the first 168
amplification step. This same primer binding site is linked to the BC-TSO enabling the use of 169
one primer pair (custom primer) during the first amplification. After the RT reaction, primer-170
dimers and small fragments were removed by 0.5 U Exonuclease (GE Healthcare, E70073Z) 171
treatment for 1 h at 42 °C. cDNA libraries were amplified with KAPA Hifi HotStart 172
ReadyMix (KAPA Biosystems, KK2602) and custom PCR primer (5’-173
AAGCAGTGGTATCAACGCAGAGT-3’) with the following PCR program: 1) 98 °C 3 min, 174
25 cycles of 98 °C 20 s, 67 °C 15 s 72 C 6 min, 3) 72 C 5 min. cDNA libraries of 84 cells 175
were multiplexed and short fragments were eliminated by Agencourt Ampure XP beads 176
(Beckman Coulter, A63880, ratio of 0.8:1 beads to library volume). The quality of 177
multiplexed cDNA libraries was examined with a 2100 Bioanalyzer (Agilent) according to the 178
manufacturer’s protocol. cDNA libraries with an average size of 1.5- 2 kb were tagmented 179
and indexed during a second PCR amplification step with the Illumina Nextera XT DNA 180
preparation kit (Illumina, FC-131-1024). Tagmentation was performed according to the 181
manufacturer’s protocol with an input of 500 pg cDNA and amplicon tagment mix for 5 min 182
at 55 °C. The tagmentation reaction was stopped using NT buffer. Next, tagmented cDNA was 183
amplified with Nextera PCR master mix, the Nextera indices (12 pool-specific indices, 184
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
7
Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-185
AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA186
ACGCAGAGT*A*C-3’) with the following PCR program: 1) 72 °C 3 min, 2) 95 °C 30 s, 3) 187
10 cycles of 95 °C 10 s, 55 °C 30 s, 72 °C 30 s, 4) 72 °C 5 min). Tagmented cDNA libraries 188
were purified by 0.6:1 ratio of Agencourt Ampure XP beads (Beckman Coulter, A63880) to 189
library volume. The quality and concentration of tagmented cDNA libraries were determined 190
with a 2100 Bioanalyzer (Agilent). cDNA pools with an average size of 300-600 bp were 191
multiplexed using a balanced design with pools from 10 different donors (in total 840 cells) 192
per sequencing run. In other words, cells from each donor were distributed over several 193
sequencing runs to avoid potential batch effects. To eliminate short fragments, the final 194
superpool was gel-purified from 2% agarose gel (Invitrogen, 10135444) with the Zymoclean 195
Gel DNA Recovery kit (Zymo Research, D4007). The concentration was determined using a 196
2100 Bioanalyzer (Agilent) and Qubit 3.0 (ThermoFisher Scientific) according to the 197
manufacturers protocol. Pools were loaded on an Ilumina NextSeq at a final concentration of 198
2 pM with7% spike in of PhiX DNA. 0.3 µM BC read 1 primer (5’-199
GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC-3’) was used for the 200
sequencing run. The libraries were sequenced on an Illumina NextSeq 500 system with an 201
average sequencing depth of 17,391 UMIs per cell. 202
10x Genomics Chromium single cell 3’ library construction 203
The single-cell barcoded libraries were constructed according to the instructions of the Single 204
Cell 3’ Reagent Kits v2 (10x Genomics). Briefly, cells were loaded into a slot of a Chromium 205
chip and GEMs were incubated in a thermal cycler to generate barcoded cDNA. After 206
amplification, the cDNA was fragmented and processed for sequencing by ligating adapters and 207
sample indices. The libraries were sequenced on an Illumina NextSeq 500 system with a 208
sequencing depth up to 20,000 reads per cell. 209
Immunohistochemistry 210
Immunohistochemistry was performed as described previously [11]. Briefly, 16 μm sections of 211
PFA-fixed human brain tissue were vacuum-dried, post-fixated for 10 minutes with 4% PFA, 212
and washed with PBS. Heat-induced antigen retrieval was performed in sodium citrate solution 213
(pH 6.0) for 10 min in a microwave. Endogenous peroxidase was blocked by incubating the 214
slides in 0.3% H2O2 for 30 min. After three washing steps with PBS, primary antibodies against 215
IBA1 (WAKO, 019-19741, 1:1000), Phospho-TAU (ThermoFisher, MN1020, clone AT8, 216
1:750) and Beta-Amyloid (Dako, M0872, 1:100) were diluted in Bright Diluent (ImmunoLogic, 217
BD09-500) to prevent specific background staining and incubated overnight at 4°C. After three 218
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
8
washing steps in PBS, secondary biotinylated horse anti-mouse IgG antibody (0.000125 mg/ml 219
Vector BA-2001) was incubated for 1 hour at room temperature. The tissue sections were 220
washed three times in PBS. The signal was amplified by induction with avidin-biotin complexes 221
(Vectastain Elite ABC‐HRP (Vector, PK‐6100)) for 30 min at RT and visualized with 3,3′‐222
diaminobenzidine (Sigma, D-5637). Additionally, after the phospho-TAU staining we 223
performed a crystal violet counterstaining. The slides were dehydrated with an ethanol series 224
(50%, 70%, 80%, 90%, 2x 96% and 3x 100% ethanol) and air-dried for 30 min prior to 225
mounting a coverslip with DePeX (Serva, 18243). Imaging was performed with a Hamamatsu 226
Nanozoomer at a 40x magnification. 227
Preprocessing of RNA-sequencing data 228
For bulk samples, the first preprocessing step was stripping the NEXTflex barcode (9 base pairs) 229
from the sequence. The barcode was saved in a separate file for further use. Next, microglia 230
bulk sequencing reads were aligned with HISAT2 (version 2.1.0) to the GRCh38.92 reference 231
genome with Ensembl annotation [22]. Further processing was done with samtools (version 1.9) 232
and Picard Tools (version 1.140). This included sorting, assigning reads to a read group, 233
verification of mate pair information and marking duplicates. After these processing steps, reads 234
were quantified using featureCounts (Subread version 1.6.2) [23]. Reads from bulk samples 235
were deduplicated using a bash script by BIOO Scientific (v2, date 11/1/14) , using the 236
NEXTflex barcode that was saved in the additional file. This allows proper elimination of PCR 237
duplicates taking advantage of stochastic labeling of UMIs. 238
Reads from bc-Smart-seq2 single cells were demultiplexed based on cell barcodes using UMI-239
tools (version 0.5.3) [24]. We created a whitelist of cell barcodes by applying the whitelist 240
function of UMI-tools. Next, the whitelist is compared to the true cell barcodes, and these 241
barcodes are saved as a cell barcode list that is used for downstream processing. The UMI-tools 242
extract function was used to extract the cell barcode and the UMI from each read and add this 243
information to the read name of the sequence. Reads were single-end aligned with HISAT2 244
(version 2.1.0) to the GRCh38.91 reference genome with Ensembl annotation using the default 245
parameters, followed by sorting and indexing of the BAM files. 246
Primary counts were quantified with the function featureCounts (Subread version 1.6.0) using 247
the flag –primary and -R BAM to save the BAM file. PCR duplicates were removed and unique 248
molecules were counted per gene and per cell using the function UMI-tools count [24]. 249
Seventeen pools with less than 10% of reads assigned to genes were excluded. 250
251
Reads from 10x Genomics Chromium single cells were demultiplexed and aligned to the 252
GRCh38 genome with Ensembl transcriptome annotation with Cell Ranger using default 253
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
9
parameters. The demultiplexed fastq files were used as input for the 10x Genomics pipeline 254
Cell ranger. Barcode filtering was performed with the R package DropletUtils with a threshold 255
of > 100 UMIs per barcode [25]. 256
Downstream analysis 257
For bulk samples, DAFS filtering was used to remove lowly expressed genes [26] and principal 258
component analysis was computed on rlog transformed counts using the DESeq2 R package 259
(v1.24.0). We applied upperquartile normalization to adjust for library size and used edgeR 260
(version 3.26.8) for differential gene expression analysis. Average library size after filtering 261
was 3.9M counts (± standard deviation 1.9M). To model gene expression levels we used a 262
negative binomial generalized log-linear model as implemented in edgeR, adjusting for gender, 263
analyzing different brain regions separate. Differences between groups were tested with 264
likelihood ratio tests. Thresholds were set at FDR > 0.05 and abs(logFC) > 1 to define DEGs. 265
For bc-Smart-seq2 single cells, approximately 25% of the cells were filtered out during 266
preprocessing. Downstream analysis started with 16 samples and 12,861 single cells with 267
detectable cell barcodes from 15 different donors. One donor (iB6399-BA7) contributed tissue 268
from both the temporal cortex and the superior parietal cortex. Cell library sizes before filtering 269
were quite different across donors; this is most likely due to differences in tissue quality. To 270
remove empty cells while respecting variation across donors, we set a threshold for each donor 271
individually, removing cells with library sizes exceeding median of log(total counts) ± 3 median 272
absolute deviation (mad) [27]. In addition, cells with more than 3000 unique genes were 273
considered doublets (genes per cell median 520; mad ±276) and cells with >10% mitochondrial 274
reads were excluded. We excluded ~10% of the cells (differs per donor) based on these criteria. 275
In total, this left 11,419 cells for analysis. Genes not detected in at least 3 cells were removed. 276
After filtering, we observed a median of 13,394 UMIs and median 520 genes per cell for bc-277
Smart-seq2 data. 278
For 10X data, similarly, low quality cells with >10% mitochondrial gene (MT) content were 279
removed in donor 2018-135. Donor 2019-010 had very high cell quality, so a >5% MT 280
threshold was applied. Duplicate cells were filtered by setting an upper UMI threshold that was 281
based on the multiplet rate as mentioned in the 10x Genomics user guide. We analyzed 3,077 282
single cells for MCI donor 2019-010 and 2,881 single cells for AD donor 2018-135. 283
Raw counts were normalized by total expression per cell, scaled by 10,000, and log-transformed 284
with the CRAN package Seurat (v3.0.0). We used the mean variability method to select highly 285
variable genes (HVGs). Briefly, this method identifies variable genes while controlling for the 286
strong relation between gene variability and gene average expression. We allowed lowly 287
expressed genes in the highly variable gene list, since some disease associated genes (e.g. 288
TREM2, TYROBP, CTSD) are biologically relevant but also lowly expressed. These extra 289
~632 lowly expressed HVGs did not change clustering results and were included in the final 290
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
10
clustering analysis. Unwanted sources of variation, such as number of detected genes, 291
ribosomal content, and mitochondrial content were regressed out. We used the first 20 principal 292
components for clustering analysis applying PCA-Louvain maximum modularity clustering as 293
implemented by Seurat. Cluster resolution was set at 0.5, since it formed the most stable plateau 294
in cluster number when considering resolutions from 0.1 to 2.0. 295
10X single cells were analyzed identically. Each donor was analyzed individually and cluster 296
resolution was adjusted due to higher cell numbers. For donor 2019-135 cluster resolution 0.6 297
and for donor 2019-010 cluster resolution 0.8 was set. Marker genes between clusters were 298
identified using MAST implemented in Seurat’s FindAllMarkers function with default 299
thresholds (logfc.threshold = 0.25, min.pct = 0.1). Gene ontology (GO) analysis on upregulated 300
marker genes was calculated using the ClusterProfiler (v3.12.0) [27] with p-value cut-off of 301
0.01 and q-value cut-off of 0.05. For FDR control we used the R package q-value (version 302
3.1.1). 303
304
Gene set analysis 305
Briefly, raw expression values were normalized to counts per million and log(cpm + 1) 306
transformed. The gene set score was an average over all genes in the set per cell. We compared 307
if, on average, cells in any one cluster showed a higher mean expression of the gene set than all 308
other cells by using multiple linear regression with gene set score as dependent variable and 309
cell library size, donor, and cluster as independent variables. Afterwards, p-values were 310
adjusted with a Bonferroni correction. Visualizations were made with the R package ‘ggplot2’. 311
312
Results 313
Isolation of pure microglia from acute post-mortem brain tissue 314
To investigate transcriptomic changes in microglia during AD, bulk and single-cell sequencing 315
were performed. Post-mortem tissue samples of the superior parietal lobe (LPS), superior 316
frontal gyrus (GFS) and lateral temporal lobe were obtained from 27 donors. The samples were 317
classified into 3 experimental groups based on a clinical diagnostic report provided by the 318
Netherlands Brain Bank/ NeuroBiobank Born-Bunge and immunohistochemical analysis of Aβ 319
and hyperphosphorylated tau (PHF-tau): CTR (no dementia, absence of Aβ plaques and PHF-320
tau), CTR with plaques (CTR+) (no dementia, presence of Aβ plaques and/or PHF-tau) and AD 321
(dementia, AD diagnosis, presence of Aβ plaques and/or PHF-tau). One donor diagnosed with 322
mild cognitive impairment (MCI) and presence of Aβ and PHF-tau plaques was included as 323
well. Representative images of Aβ and PHF-tau immunohistochemical stainings are available 324
in Figure S1. The goal of the stratification between CTR and CTR+ was to ensure that the CTR 325
group is free of undiagnosed AD donors. Microglia were isolated from enzymatically or 326
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
11
mechanically dissociated tissue and purified by fluorescence-activated cell sorting (FACS), 327
based on single, viable CD11B and CD45 positive cells. Twenty-five samples (12 LPS and 13 328
GFS; 22 mechanically and 3 enzymatically dissociated) from 14 donors were sorted and 329
sequenced as bulk samples and 16 samples (15 LPS, 1 temporal lobe) from 15 donors were 330
single-cell sorted and sequenced (bc-Smart-seq2 and 10x Genomics) (Fig 1A). Two donors 331
were included in both the single-cell and bulk cohort. The employed strategy resulted in a pure 332
microglia population, as confirmed by expression of known microglia genes, that were based 333
on previously published adult human microglia [19] and human CNS nuclei [28] gene 334
expression profiles (Fig 1B). 335
336
Figure 1 Microglia gene expression profiling of four groups of donors from acute post-337
mortem human brain tissue. 338
(A) Tissue samples from GFS and LPS were classified into four experimental groups (CTR, 339
CTR+, AD, MCI) based on Aß and Tau immunohistological stainings and the clinical report of 340
the donor. Microglia were mechanically or enzymatically isolated and collected by 341
CD11B+CD45+-based FACS sorting. Sorted microglia were used for bulk or single-cell 342
sequencing (barcoded Smartseq2 and 10x Genomics). Scale bar= 50µm. (B) Expression of top 343
25 previously published celltype-specific marker genes in bulk-sorted microglia [17, 18]. 344
Abbreviations Aß: amyloid beta, HPF-tau: hyperphosphorylated tau, AD: clinically diagnosed 345
Alzheimer’s Disease with Aβ plaques and/or hyperphosphorylated tau, CTR: Control, CTR+: 346
Control with Aβ plaques and/or hyperphosphorylated tau, GFS: superior frontal gyrus, LPS: 347
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
12
superior parietal lobe, MCI: mild cognitive impairment, NPC: Neural Progenitor Cells, OPC: 348
Oligodendrocyte Precursor Cells, SC: single cell. 349
350
No transcriptomic differences between CTR, CTR with plaques (CTR+) and AD donors 351
in acute post-mortem tissue by bulk RNA-sequencing 352
To investigate general transcriptional characteristics of microglia in AD, we analyzed bulk 353
sorted and sequenced microglia from CTR, CTR+ and AD samples. Principal component 354
analysis (PCA) showed no segregation between donor groups (Fig 2A). The second principle 355
component showed segregation of microglia samples on gender, but not on brain region or age 356
(Fig 2A). 357
To further examine the effect of gender, male and female GFS microglia samples were 358
compared. Here, 33 genes were differentially expressed with an absolute log fold change > 1, 359
FDR-value < 0.05. One third of these differentially expressed genes (DEGs) were X or Y-linked 360
genes (Table S3). 361
Differences between microglia from frontal and parietal brain regions were assessed. For 9 362
donors, microglia were isolated from both the LPS and GFS region, and a within-subject 363
comparison was applied. Only the expression of JAML and TREM1 was significantly higher in 364
LPS compared to GFS (Table S4). This indicates that the gene expression profiles of microglia 365
isolated from frontal and parietal brain regions were very similar. 366
The effect of the dissociation method on gene expression was determined by comparing the 367
bulk RNA-sequencing profiles of GFS microglia from enzymatically and mechanically 368
dissociated tissue of donors 2016-038 and 2016-080 (4 samples). 10 genes were significantly 369
higher expressed in microglia isolated using enzymatic dissociation: CXCL8, SOCS1, NR4A1, 370
ID1, FOSB, ATF3, NR4A2, EGR2, OSM and HSPA7 (Table S5). As the enzymatic dissociation 371
procedure induced expression of these 10 genes in the bulk samples of these 2 donors, only 372
mechanical dissociation was used for single-cell sequencing. 373
Bulk samples from AD and CTR donors were compared while correcting for the effect of 374
gender on gene expression. LPS- (n=11) and GFS-derived (n=11) microglia were analyzed 375
separately. In the analysis of microglia from both LPS and GFS regions no differentially 376
expressed genes from AD donors compared to CTR donors were found. 377
Lastly, expression levels of the top 50 genes upregulated in DAMs [8] were investigated in bulk 378
microglia. These mouse top DAM genes were not differentially expressed between AD-derived 379
compared to control microglia in LPS and GFS regions (Fig 2B). For several known DAM 380
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
13
genes, such as APOE, TREM2, ITGAX a small increase in expression in AD donors compared 381
to CTR can be recognized, albeit it is not statistically significantly (Fig 2C). 382
To summarize, in bulk transcriptomes of microglia from AD and CTR donors, no significant 383
gene expression differences were detected. 384
385
386
Figure 2 Transcriptomic analysis of microglia populations isolated from CTR, CTR+ and 387
AD donors. 388
(A) PCA of RNA-sequencing data from post-mortem isolated microglia illustrating the effect 389
of tissue dissociation method, donor (each sample is indicated with the donor label), donor 390
groups, gender, brain region, and age. 391
(B) Expression of disease-associated microglia genes in bulk microglia samples from three 392
donor groups (z scores). Donors are ordered based on age within their group. 393
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
14
(C) Selected examples of disease-associated microglia gene expression (log2(CPM)) in bulk 394
microglia samples. Abbreviations: AD: Alzheimer’s Disease, CPM: counts per million, CTR: 395
Control, CTR+: Control with Aβ plaques and/or hyperphosphorylated tau, F: female, M: male, 396
GFS: superior frontal gyrus, LPS: superior parietal lobe. 397
398
Single-cell gene expression profiling identifies 9 subsets of microglia but no AD-associated 399
subpopulation 400
As AD-associated changes possibly only occur in a small subpopulation of plaque-associated 401
microglia and thus might be masked by bulk RNA-sequencing, we next employed single-cell 402
sequencing to investigate microglia heterogeneity. A median of 753 microglia per donor from 403
4 CTR, 5 CTR+, a donor with mild cognitive impairment (MCI) and 5 AD donors were 404
analyzed. The read depth per cell for each donor was comparable, however the median number 405
of detected genes for each donor varied (Fig S2A,B). Clustering analysis identified 9 microglial 406
subsets, indicating heterogeneity in microglia transcriptomes (Fig 3A). Sequencing depth, 407
uniquely detected genes and detected mitochondrial genes across clusters are visualized in Fig 408
S2. The expression of cell type-specific markers across all clusters showed that all analyzed 409
cells were microglia, and that this population was free from neuronal, erythrocyte, and other 410
glial cell contaminations (Fig 3B). Figure 3C depicts the percentage of cells from a certain 411
donor that contribute to each cluster. Except for cluster 3, all clusters exhibited roughly equal 412
donor contributions. Cluster 3 has a high contribution from AD donor 2018-077 and cells from 413
this donor had a relatively low fraction of mitochondrial genes (Fig S2C) compared to other 414
cells. Gene expression in cluster 3 will strongly depend on this particular donor. Therefore, 415
cluster 3 (9.2% of the cells) was excluded from further analysis. 416
417
Differential gene expression analysis identified marker genes that were significantly enriched 418
in each cluster compared to all other clusters. However, marker genes significantly enriched in 419
a cluster (Table S6) and the biological annotation of those genes (Fig S3) did not point towards 420
clear biological functions of identified clusters. Expression of homeostatic genes such as 421
CSF1R, ITGAM, TMEM119 and CX3CR1 was quite variable between cells in a cluster (Fig 422
3D). These genes were not identified as marker genes in any of the clusters (Table S6). Many 423
microglial genes previously associated with antigen presentation (HLA genes), the complement 424
system (C1QA), neurodegenerative diseases (TREM2, TYROBP, B2M), lysosomal proteases 425
(CTSB) and phagocytosis (CD14, AXL) were generally expressed at higher levels than 426
homeostatic genes and were found to be marker genes of cluster 2 (Fig 3D). 427
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
15
Unexpectedly, cluster 2 was not enriched by AD-derived microglia and overall no AD-428
associated microglia cluster was detected. APOE expression is associated with AD and was 429
elevated but not significantly enriched in cluster 2 according to differential expression analysis 430
(Fig3D, Table S6). The majority of AD-derived microglia contributed to cluster 0. Cluster 0 431
was comprised of 58% AD and 42% CTR/CTR+ microglia (Fig 3C). 432
The small clusters 4-8 contain relatively few cells (0.8-1.8%), they showed increased 433
expression of genes involved in protein degradation such as PSMD11, PSMB2, PSMB3, 434
EDEM3, FOXN2, UBQLN1 and DERL2. Possibly, the small microglia clusters 4-8 reflect cell 435
states with increased stress responses. 436
In 5XFAD mice, disease-associated microglia (DAMs) were characterized by expression 437
changes in set of genes [8]. To investigate if the increased gene expression in DAMs was also 438
present in one of the identified clusters, the average DAM gene set expression per microglia 439
was calculated. The average DAM gene expression level per cluster was compared with all 440
other clusters. Clusters 0 and 7 showed significantly lower average DAM gene expression levels 441
and microglia in cluster 2 showed significantly higher average DAM gene expression levels (S 442
Table 7), p < 0.001. Although statistically significant, these changes are likely too small to be 443
biologically relevant. These observations were confirmed in a different gene set from a meta-444
analysis of multiple amyloid mouse models [14]. Again, microglia in cluster 0 showed a 445
significant decrease in neurodegenerative-related gene expression levels. To summarize, only 446
the decrease in gene expression in cluster 0 was consistent and no cluster was associated with 447
increased neurodegeneration-related gene expression (Fig 3E). 448
Taken together, single-cell analysis of approximately 11,419 microglia which were 449
CD11B+CD45+-based FACS sorted and profiled with bc-Smart-seq2, identified microglial 450
heterogeneity, but no AD-specific microglia subpopulation. 451
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
16
452
Figure 3 Single-cell expression profiling of microglia identified 9 subsets of microglia but 453
no AD-associated cluster using bc-Smart-seq2. 454
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
17
(A) UMAP visualization and unsupervised clustering of microglia derived from AD (n=5), MCI 455
(n=1), CTR+ (n=5) and CTR (n=4) donors. Each dot represents a cell, colors represent cluster 456
identity. (B) Expression of cell type-specific markers for neurons (RBFOX3), oligodendrocytes 457
(MOG), astrocytes (GFAP), infiltrating immune cells as monocytes (CCR2), erythrocytes 458
(HBA1) and microglia (ITGAX). (C) Cluster contribution normalized to donor. Bar height 459
indicates the percentage of cells from a donor that contributed to the clusters. (D) Violin plots 460
show the probability density distribution of normalized gene expression across clusters for 461
selected genes. (E) The average mouse DAM gene set expression in each cell across clusters 462
(left). The average human myeloid neurodegenerative-related gene set expression in each cell 463
(right). Abbreviations: AD: Alzheimer’s Disease, CPM: counts per million, CTR: Control, 464
CTR+: Control with Aβ plaques and/or hyperphosphorylated tau, DAM: disease-associated 465
microglia, UMAP: uniform manifold approximation and projection 466
467
Microglia diversity but no DAM-like cluster in an individual MCI and AD donor with 468
high microglial cell numbers 469
The proportion of DAM-like microglia in human AD brain might be relatively low and could 470
potentially be missed by bc-Smart-seq2 expression profiling. Therefore, two donors with ~3000 471
microglia each were investigated using the 10X Genomics platform. First, 2881 cells were 472
analyzed from post-mortem LPS tissue of a female AD donor, 81 years old, with high Aβ 473
burden and modest but visible PHF-tau protein (2018-135) (Fig S1). Second, 3077 single cells 474
from an MCI donor (2019-010), 77 years old, with moderate Aβ pathology and high levels of 475
PHF-tau protein in the LPS were analyzed (Fig S1). We applied an identical clustering 476
procedure as for bc-Smart-seq2 libraries, now analyzing each donor individually, only adjusting 477
the clustering resolution for higher cell numbers. Per donor, three clusters were identified (Fig 478
4A, B). As clustering is performed within one sample, the identified clusters are not confounded 479
by post-mortem delay, gender, tissue quality or other donor-associated factors. Despite testing 480
multiple cluster resolutions, a DAM-like cluster could not be detected. 481
As described for figure 3, the average gene expression levels were calculated for each cluster 482
and compared to all other clusters. The gene expression averages per cluster were calculated 483
for the mouse DAM gene set [8] and for the neurodegenerative-related gene set [14] (Fig 4B, 484
C, E, F). A significant increase of the DAM gene set and the neurodegenerative gene set was 485
observed in microglia in cluster 0 in the MCI donor (Fig 4 E,F), but not in the AD donor (Fig 4 486
B,C). In short, no cluster with DAM-like microglia was detected in either donor, although a 487
high number of microglia was analyzed (~3000 cells/donor). 488
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
18
489
Figure 4 Single-cell expression profiling of microglia from individual donors with high 490
cell numbers using 10X Genomics. 491
(A,B) Unsupervised clustering identified 3 subsets of microglia in AD donor 2018-135 (A) and 492
in MCI donor 2019-010 (D). The average DAM gene set expression per cell and the myeloid 493
neurodegenerative-related gene set per cell across clusters for AD donor 2018-135 (B, C) and 494
for MCI donor 2019-010 (C, F). Abbreviations: AD: Alzheimer’s Disease, CPM: counts per 495
million, CTR: Control, CTR+: Control with Aβ plaques and/or hyperphosphorylated tau, DAM: 496
disease-associated microglia, UMAP: uniform manifold approximation and projection 497
498
Discussion 499
In this study we aimed to identify transcriptomic changes in human microglia at the end-stage 500
of AD by applying both bulk and single-cell RNA sequencing of microglia isolated from acute 501
post-mortem CNS tissue. In acute parietal and frontal cortex, we analyzed microglia as bulk 502
samples allowing the most sensitive detection of small gene expression changes. Here, 503
transcriptomic differences between AD and CTR were not detected and disease-associated 504
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
19
genes identified in AD mouse models were not enriched in AD microglia. Single cell 505
sequencing analysis was applied to detect microglial subtype populations, possibly consisting 506
of low cell numbers, that might be unnoticed in the average transcriptome obtained by bulk 507
analysis. Also in single microglia transcriptomes, the relative contribution to microglia clusters 508
did not differ between AD and control donors, when using the bc-Smart-seq2 protocol on 509
CD11B and CD45 sorted cells. 510
Expression of the average neurodegenerative-related gene sets were not significantly increased 511
in any cluster. The neurodegenerative disease-associated microglial subtype originally 512
described by Krasemann et al. [9] and Keren-Shaul et al. [8] represented a relatively small 513
fraction of the total microglia population. To rule out that the lack of a DAM-like cluster in our 514
data was due to the analysis of too low cell numbers, a higher number of microglia from two 515
donors were single-cell sequenced using the 10X Genomics platform. Clustering was 516
performed per individual donor to avoid donor variation which might mask a potential DAM 517
cluster. Concordant to the bc-Smart-seq2 data, the top DAM genes were expressed to a similar 518
extent in all clusters. In conclusion, microglial transcriptomes between AD and CTR donors 519
did not differ and a DAM-like microglial subtype was absent in AD donors. 520
When comparing the clustering results of the 10X Genomics and bc-Smart-seq2 single-cell 521
RNA sequencing techniques, differences were observed. Clusters 0-2 in the bc-Smart-seq2 data 522
contain the vast majority of microglia and are most similar to the three clusters identified per 523
donor in the 10X Genomics data set. The smaller clusters in the bc-Smart-seq2 data (4-8) were 524
not identified in the microglia profiled by 10X Genomics and are possibly associated with the 525
plate-based protocol as we observed similar small clusters in a different bc-Smart-seq2 dataset 526
as well (unpublished results). 527
There are multiple possible explanations for the absence of AD-associated changes in acute 528
bulk and single cell microglia. The lack of detectable AD-associated changes could be due to 529
limited sample size and donor variation. Another explanation for the lack of AD-related 530
transcripts in bulk and single cell microglia could be that the relevant microglia associated with 531
AD plaques are more vulnerable to the isolation procedure. This would imply that, using 532
conventional isolation and sorting of microglia would enrich a population of cells that are not 533
related to AD pathology. Streit and colleagues first introduced the concept of dystrophic 534
microglia that occur around neuronal structures positive for hyperphosphorylated tau protein 535
[29,30] and that can occur around Aβ plaques as well [31]. Possibly, dystrophic microglia and 536
microglia embedded inside the Aβ plaque are more vulnerable and therefore preferentially lost 537
during FACS gating of live, single cells. 538
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
20
When comparing AD mouse models to human AD, the distinction between parenchymal and 539
plaque-associated microglia might be more pronounced for amyloid mouse models than for 540
human end-stage AD samples. In transgenic amyloid mouse models, especially 5xFAD mice, 541
Aβ is over-expressed in a non-physiological manner, resulting in very fast Aβ plaque formation. 542
Transgenic mouse models lack regional brain atrophy and show less widespread 543
neurodegeneration than human AD cases [32]. Possibly, the parenchymal microglia and the rest 544
of the CNS are less affected in amyloid mouse models. Furthermore, quantifying the cortical 545
dense-core plaque burden in 5XFAD and APPswePS1ΔE9 mouse models showed that in mice, 546
the plaque burden eventually reaches 10 times higher levels than in human AD brain tissue [33]. 547
Additionally, inter-individual variation will influence human microglia transcriptomes more 548
than mouse microglia transcriptomes. Together these observations might lead to a more 549
pronounced change between parenchymal and plaque-associated microglia in amyloid mouse 550
models than in human AD samples. For this reason, single human microglia studies will most 551
likely require much larger cell numbers to capture sufficient plaque-associated microglia than 552
studies using AD mouse models. 553
DAMs were not only associated with neurodegenerative diseases, but also with natural ageing 554
[8,9]. This was confirmed by Sala and colleagues investigating an AppNL-G-F-associated 555
microglia subpopulation, ARMs, which overlap with DAMs. ARMs already comprised a few 556
percent of microglia in the brains of wild-type mice at young age and evolve naturally with 557
ageing [15]. Furthermore, a consensus gene expression network module co-occurring both 558
during ageing and neurodegeneration was detected. The described module included DAM 559
signature genes such as Csf1, Spp1, Apoe, Axl, B2m, Ctsz, Cd9, Cstb, and Cst7. Biological 560
annotation of module-specific genes included phagosome and lysosomal pathways [34]; 561
functions previously associated with DAMs [8]. Taken together, this suggests the presence of 562
DAM-like microglia could be expected, albeit at low levels, in aged controls as well as AD 563
donor-derived microglia. 564
It is still an unresolved question whether a subpopulation resembling DAMs exist among human 565
microglia. Three other studies previously addressed this question. Olah et al. [16] observed 23 566
clusters of human microglia, where 5 out of 23 clusters were enriched for DAM signature genes. 567
Three of the 15 donors suffered from AD pathology, making it difficult to connect their 568
microglia subpopulations with AD-induced gene expression changes. Srinivasan et al. [35] 569
investigated frozen myeloid cells from AD brain tissue and observed that from the 100 DAM 570
genes, only expression of APOE did indeed change in myeloid cells from AD donors compared 571
to controls. Mathys and colleagues used single-nuclei sequencing and subclustered ~2400 572
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
21
microglia of 48 donors into 4 subpopulations. They highlighted the Mic1 cluster as AD-573
pathology-associated human microglia [17]. From the 257 DAM genes investigated, only 28 574
were overlapping with marker genes for the Mic1 cluster and 16 of these 28 overlapping marker 575
genes were ribosomal genes. A larger-scale investigation of microglia nuclei will be needed to 576
reveal AD-associated microglia subpopulations in humans. 577
Single nucleus gene expression faithfully recapitulates cellular gene expression profiles [36,37]. 578
Therefore, single-nucleus sequencing offers an alternative to single-cell sequencing that is 579
especially useful in tissues from which recovering intact cells is difficult [36–38]. An important 580
advantage of single-nucleus sequencing is the possibility to use frozen samples from brain 581
banks containing large, well-characterized donor cohorts. For example, an improved donor 582
cohort to differentiate the effects of natural ageing and AD pathology would be possible by 583
comparing aged-matched (young) control donors to early-onset familial AD cases. In future, 584
single-nucleus sequencing of microglia and including tissues of early, pre-symptomatic stages 585
of AD will be most promising to potentially identifying (early) microglia biomarkers for AD. 586
587
Conflict of Interest 588
MW, AW, SX, TM and KB were full time employees of Abbvie during the time of the studies. The remaining 589 authors declare that the research was conducted in the absence of any commercial or financial relationships that 590 could be construed as a potential conflict of interest. 591
592
Author Contributions 593
EB, BE and SK were responsible for the overall conception of the project and provided supervision. QJ, AA, LK, 594 conducted the experimental work, and/or analyzed the data, prepared the figures and wrote the manuscript. EG 595 assisted with sample processing, data discussion and conducted all immunohistochemistry. NB, AM, MD, MW, 596 AW, SX, KB, TM, YH, and TO assisted with maintenance of availability of reagents, sample processing, data 597 discussion, optimization issues and/or data analysis. All authors contributed to the editing of the paper. 598
599
Funding 600
MW, SX, AW, TM and KB are employed by AbbVie, Inc., which has subsidized the study. BE acquired funding 601 from the foundation Alzheimer Nederland. AA, EG are funded by Abbvie. AA was supported by the Jan Kornelis 602 de Cock- Hadders foundation. QJ was funded by the Li Ka-shing Foundation at Shantou University Medical 603 College, China, the Abel Tasman Talent Program, University Medical Center Groningen/ University of Groningen, 604 The Netherlands, and the Graduate School of Medical Sciences (GSMS), University of Groningen, the Netherlands. 605 LK holds a scholarship from the GSMS, University of Groningen, the Netherlands. 606
607
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
22
Acknowledgments 608
We thank the Netherlands Brain Bank and the NeuroBiobank of the Institute Born-Bunge, Belgium. We thank 609 Ortiz, T. Oshima, M. Wijering, S. Eskandar, R. van der Pijl, E. Wesseling, C. Grit and C.B. Haas for assistant 610 and/or maintenance of sample processing and bulk and/or single cell isolations. We are grateful to W. Abdulahad, 611 G. Mesander, T. Bijma and J. Teunis from The Central Flowcytometry Unit of the University of Groningen, 612 University Medical Center Groningen (UMCG), for technical assistance on FACS sorting. We thank P. van der 613 Vlies, D. Brandenburg, N. Festen and W. Uniken Venema for their assistance setting up the bc-SmartSeq2. We 614 thank M. Meijer for ICT-related support. We appreciate sequencing-related advices provided by D. Spierings, K. 615 Hoekstra-Wakker, J. Beenen and N. Halsema. 616
617
Data availability 618
The data supporting the conclusions of this manuscript will be made available on Gene Expression Omnibus upon 619 publication. 620
621 References 622
1. Hyman BT, Trojanowski JQ. Consensus recommendations for the postmortem diagnosis of Alzheimer 623 disease from the National Institute on Aging and the Reagan Institute Working Group on diagnostic 624 criteria for the neuropathological assessment of Alzheimer disease. Journal of neuropathology and 625 experimental neurology. England; 1997. pp. 1095–1097. doi:10.1097/00005072-199710000-00002 626
2. Zhang B, Gaiteri C, Bodea L-G, Wang Z, McElwee J, Podtelezhnikov AA, et al. Integrated systems 627 approach identifies genetic nodes and networks in late-onset Alzheimer’s disease. Cell. 2013;153: 707–628 720. doi:10.1016/j.cell.2013.03.030 629
3. Mhatre SD, Tsai CA, Rubin AJ, James ML, Andreasson KI. Microglial malfunction: the third rail in the 630 development of Alzheimer’s disease. Trends Neurosci. 2015;38: 621–636. 631 doi:10.1016/j.tins.2015.08.006 632
4. Nott A, Holtman IR, Coufal NG, Schlachetzki JCM, Yu M, Hu R, et al. Brain cell type-specific 633 enhancer-promoter interactome maps and disease-risk association. Available: 634 http://science.sciencemag.org/ 635
5. Ulrich JD, Finn MB, Wang Y, Shen A, Mahan TE, Jiang H, et al. Altered microglial response to Abeta 636 plaques in APPPS1-21 mice heterozygous for TREM2. Mol Neurodegener. 2014;9: 20. 637 doi:10.1186/1750-1326-9-20 638
6. Sarlus H, Heneka MT. Microglia in Alzheimer’s disease. J Clin Invest. 2017;127: 3240–3249. 639 doi:10.1172/JCI90606 640
7. Kamphuis W, Kooijman L, Schetters S, Orre M, Hol EM. Transcriptional profiling of CD11c-positive 641 microglia accumulating around amyloid plaques in a mouse model for Alzheimer’s disease. Biochim 642 Biophys Acta. 2016;1862: 1847–1860. doi:10.1016/j.bbadis.2016.07.007 643
8. Keren-Shaul H, Spinrad A, Weiner A, Matcovitch-Natan O, Dvir-Szternfeld R, Ulland TK, et al. A 644 Unique Microglia Type Associated with Restricting Development of Alzheimer’s Disease. Cell. 645 2017;169: 1276-1290.e17. doi:10.1016/j.cell.2017.05.018 646
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
23
9. Krasemann S, Madore C, Cialic R, Baufeld C, Calcagno N, El Fatimy R, et al. The TREM2-APOE 647 Pathway Drives the Transcriptional Phenotype of Dysfunctional Microglia in Neurodegenerative 648 Diseases. Immunity. 2017;47: 566-581.e9. doi:10.1016/j.immuni.2017.08.008 649
10. Venegas C, Kumar S, Franklin BS, Dierkes T, Brinkschulte R, Tejera D, et al. Microglia-derived ASC 650 specks cross-seed amyloid-beta in Alzheimer’s disease. Nature. 2017;552: 355–361. 651 doi:10.1038/nature25158 652
11. Yin Z, Raj D, Saiepour N, Van Dam D, Brouwer N, Holtman IR, et al. Immune hyperreactivity of Abeta 653 plaque-associated microglia in Alzheimer’s disease. Neurobiol Aging. 2017;55: 115–122. 654 doi:10.1016/j.neurobiolaging.2017.03.021 655
12. Rogers J, Lue LF. Microglial chemotaxis, activation, and phagocytosis of amyloid beta-peptide as linked 656 phenomena in Alzheimer’s disease. Neurochem Int. 2001;39: 333–340. doi:10.1016/s0197-657 0186(01)00040-7 658
13. Spangenberg E, Severson PL, Hohsfield LA, Crapser J, Zhang J, Burton EA, et al. Sustained microglial 659 depletion with CSF1R inhibitor impairs parenchymal plaque development in an Alzheimer’s disease 660 model. Nat Commun. 2019;10: 3758. doi:10.1038/s41467-019-11674-z 661
14. Friedman BA, Srinivasan K, Ayalon G, Meilandt WJ, Lin H, Huntley MA, et al. Diverse Brain Myeloid 662 Expression Profiles Reveal Distinct Microglial Activation States and Aspects of Alzheimer’s Disease 663 Not Evident in Mouse Models. Cell Rep. 2018;22: 832–847. doi:10.1016/J.CELREP.2017.12.066 664
15. Sala Frigerio C, Wolfs L, Fattorelli N, Thrupp N, Voytyuk I, Schmidt I, et al. The Major Risk Factors for 665 Alzheimer’s Disease: Age, Sex, and Genes Modulate the Microglia Response to Abeta Plaques. Cell 666 Rep. 2019;27: 1293-1306.e6. doi:10.1016/j.celrep.2019.03.099 667
16. Olah M, Menon V, Habib N, Taga M, Yung C, Cimpean M, et al. A single cell-based atlas of human 668 microglial states reveals associations with neurological disorders and histopathological features of the 669 aging brain. 2018; 1–42. doi:10.1101/343780 670
17. Mathys H, Davila-Velderrain J, Peng Z, Gao F, Mohammadi S, Young JZ, et al. Single-cell 671 transcriptomic analysis of Alzheimer’s disease. Nature. 2019;570: 332–337. doi:10.1038/s41586-019-672 1195-2 673
18. Galatro TF, Vainchtein ID, Brouwer N, Boddeke EWGM, Eggen BJL. Isolation of Microglia and 674 Immune Infiltrates from Mouse and Primate Central Nervous System. Methods Mol Biol. 2017;1559: 675 333–342. doi:10.1007/978-1-4939-6786-5_23 676
19. Galatro TF, Holtman IR, Lerario AM, Vainchtein ID, Brouwer N, Sola PR, et al. Transcriptomic analysis 677 of purified human cortical microglia reveals age-associated changes. Nat Neurosci. 2017;20: 1162–1171. 678 doi:10.1038/nn.4597 679
20. Picelli S, Faridani OR, Bjorklund AK, Winberg G, Sagasser S, Sandberg R. Full-length RNA-seq from 680 single cells using Smart-seq2. Nat Protoc. 2014;9: 171–181. doi:10.1038/nprot.2014.006 681
21. Uniken Venema WT, Voskuil MD, Vila AV, van der Vries G, Jansen BH, Jabri B, et al. Single-Cell 682 RNA Sequencing of Blood and Ileal T Cells From Patients With Crohn’s Disease Reveals Tissue-683 Specific Characteristics and Drug Targets. Gastroenterology. 2019;156: 812-815.e22. 684 doi:10.1053/j.gastro.2018.10.046 685
22. Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat 686 Methods. 2015;12: 357–360. doi:10.1038/nmeth.3317.HISAT 687
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
24
23. Liao Y, Smyth GK, Shi W. FeatureCounts: An efficient general purpose program for assigning sequence 688 reads to genomic features. Bioinformatics. 2014;30: 923–930. doi:10.1093/bioinformatics/btt656 689
24. Smith T, Heger A, Sudbery I. UMI-tools: modelling sequencing error in Unique Molecular Identifiers to 690 improve quantification. Cold Spring Harb Lab Press. 2017; 491–499. doi:10.1101/gr.209601.116 691
25. Griffiths JA, Richard AC, Bach K, Lun ATL, Marioni JC. Detection and removal of barcode swapping 692 in single-cell RNA-seq data. Nat Commun. 2018;9. doi:10.1038/s41467-018-05083-x 693
26. George NI, Chang C-W. DAFS: a data-adaptive flag method for RNA-sequencing data to differentiate 694 genes with low and high expression. BMC Bioinformatics. 2014;15: 92. doi:10.1186/1471-2105-15-92 695
27. Yu G, Wang L-G, Han Y, He Q-Y. clusterProfiler: an R package for comparing biological themes 696 among gene clusters. OMICS. 2012;16: 284–287. doi:10.1089/omi.2011.0118 697
28. Lake B, Shen R, Ronaghi M, Fan J, Wang W, Zhang K. Neuronal subtypes and diverstiy revealed by 698 single-nucleus RNA sequencing of human brain. 2016;35: 1586–90. 699
29. Streit WJ, Sammons NW, Kuhns AJ, Sparks DL. Dystrophic microglia in the aging human brain. Glia. 700 2004;45: 208–212. doi:10.1002/glia.10319 701
30. Streit WJ, Braak H, Xue Q-S, Bechmann I. Dystrophic (senescent) rather than activated microglial cells 702 are associated with tau pathology and likely precede neurodegeneration in Alzheimer’s disease. Acta 703 Neuropathol. 2009;118: 475–485. doi:10.1007/s00401-009-0556-6 704
31. Streit WJ, Braak H, Del Tredici K, Leyh J, Lier J, Khoshbouei H, et al. Microglial activation occurs late 705 during preclinical Alzheimer’s disease. Glia. 2018;66: 2550–2562. doi:10.1002/glia.23510 706
32. Drummond E, Wisniewski T. Alzheimer’s disease: experimental models and reality. Acta Neuropathol. 707 2017;133: 155–175. doi:10.1007/s00401-016-1662-x 708
33. Liu P, Reichl JH, Rao ER, McNellis BM, Huang ES, Hemmy LS, et al. Quantitative Comparison of 709 Dense-Core Amyloid Plaque Accumulation in Amyloid-beta Protein Precursor Transgenic Mice. J 710 Alzheimers Dis. 2017;56: 743–761. doi:10.3233/JAD-161027 711
34. Holtman IR, Raj DD, Miller JA, Schaafsma W, Yin Z, Brouwer N, et al. Induction of a common 712 microglia gene expression signature by aging and neurodegenerative conditions: a co-expression meta-713 analysis. Acta Neuropathol Commun. 2015;3: 31. doi:10.1186/s40478-015-0203-5 714
35. Srinivasan K, Friedman BA, Etxeberria A, Huntley MA, van der Brug MP, Foreman O, et al. 715 Alzheimer’s patient brain myeloid cells exhibit enhanced aging and unique transcriptional activation. 716 bioRxiv. 2019; 610345. doi:10.1101/610345 717
36. Gerrits E, Heng Y, Boddeke HWGM, Eggen BJL. Transcriptional profiling of microglia; current state of 718 the art and future perspectives. Glia. 2019. doi:10.1002/glia.23767 719
37. Lake BB, Codeluppi S, Yung YC, Gao D, Chun J, Kharchenko P V, et al. A comparative strategy for 720 single-nucleus and single-cell transcriptomes confirms accuracy in predicted cell-type expression from 721 nuclear RNA. Sci Rep. 2017;7. doi:10.1038/s41598-017-04426-w 722
38. Grindberg R V, Yee-Greenbaum JL, McConnell MJ, Novotny M, O’Shaughnessy AL, Lambert GM, et 723 al. RNA-sequencing from single nuclei. Proc Natl Acad Sci U S A. 2013;110: 19802–19807. 724 doi:10.1073/pnas.1319700110 725
726
Supplementary materials 727
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
25
Figure S1 Donor classification based on immunohistochemistry 728
(A,B) Representative immunohistochemical images of Aß and PHF-tau staining for the LPS (A) 729
and GFS (B) of the four groups (CTR, CTR+, AD, MCI). Scale bar= 100µm. AD: clinically 730
diagnosed Alzheimer’s Disease with Aβ plaques and/or hyperphosphorylated tau, CTR: Control, 731
CTR+: Control with Aβ plaques and/or hyperphosphorylated tau, MCI: clinically diagnosed 732
mild cognitive impairment with Aβ plaques and hyperphosphorylated tau. 733
Figure S2 bc-Smart-seq2 single cell RNA sequencing quality of donors and clusters 734
Boxplots displaying the number of detected UMIs, unique genes and mitochondrial genes per 735
donor (A,B,D) and per cluster (D,E,F). 736
Figure S3 Biological annotation of marker genes for each cluster 737
Dotplots displaying the gene ratio per gene ontology term for each cluster identified in bc-738
Smart-seq2 analysis. 739
Supplementary tables 740
Table S1 Detailed donor information of bulk sequenced samples. 741
Table S2 Detailed donor information of single-cell sequenced samples. 742
Table S3 Differential gene expression analysis of male vs. female bulk microglia GFS samples. 743
Table S4 Differential gene expression analysis of LPS vs. GFS bulk microglia samples. 744
Table S5 Differential gene expression analysis of enzymatic vs. mechanical dissociated bulk 745
microglia samples. 746
Table S6 Cluster markers of the identified 9 clusters with bc-Smart-seq2 single cell RNA 747
sequencing. 748
Table S7 Statistics of the average gene set expression changes in the clusters identified. 749
Table S8 Cluster markers of the identified 3 clusters of donor 2018-135 with 10X Genomics 750
single cell RNA sequencing. 751
Table S9 Cluster markers of the identified 3 clusters of donor 2019-10 with 10X Genomics 752
single cell RNA sequencing. 753
754
755
756
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
26
757
(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted March 19, 2020. ; https://doi.org/10.1101/2020.03.18.995332doi: bioRxiv preprint
top related