origins of diversity in the bacterioplankton theory, observations and evolutionary experiments...
Post on 20-Dec-2015
218 Views
Preview:
TRANSCRIPT
Origins of diversity in Origins of diversity in the bacterioplanktonthe bacterioplankton
Theory, observations and Theory, observations and evolutionary experimentsevolutionary experiments
7/24/077/24/07
Lecture OutlineLecture Outline Diversity -Diversity -
Classification and observing Classification and observing
Generation -Generation - vertical and horizontal mechanismsvertical and horizontal mechanisms
Persistence -Persistence - Neutral TheoryNeutral Theory Niche TheoryNiche Theory Ecological trends in pelagic systemsEcological trends in pelagic systems
BIODIVERSITY
A
Macro Micro
Marine AssemblageFluorescent microscopy
Diversity: Classification and observingDiversity: Classification and observing
Genetic diversityGenetic diversity
BacteriaArchaea
Eucarya
Kingdom Animalia
Nucleic Acids
Pace, 1997
Diversity: Classification and observingDiversity: Classification and observing
Ribosomal RNA-ubiquitous-conserved function-conserved+variable sequence
Image credit:NIH inside the cell
Areas in red and grey may vary in this molecule, and areas in violet and blue may not.
variable
fixed
VARIABLEVARIABLE
Quantitatively inferring relationships
Homo sapiens ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG...S. cereviceae ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAG...Zea maize ...GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAG... Escherichia coli ...GTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCG...Anacystis nidulans ...GTGCCAGCAGCCGCGGTAATACGGGAGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCG...Thermotoga maritima ...GTGCCAGCAGCCGCGGTAATACGTAGGGGGCAAGCGTTACCCGGATTTACTGGGCGTAAAGGG... Methanococcus vannielii ...GTGCCAGCAGCCGCGGTAATACCGACGGCCCGAGTGGTAGCCACTCTTATTGGGCCTAAAGCG... Thermococcus celer ...GTGGCAGCCGCCGCGGTAATACCGGCGGCCCGAGTGGTGGCCGCTATTATTGGGCCTAAAGCG... Sulfolobus sulfotaricus ...GTGTCAGCCGCCGCGGTAATACCAGCTCCGCGAGTGGTCGGGGTGATTACTGGGCCTAAAGCG...
“Alignment” of 16S/18S rRNA
Bacteria Archaea
Eucarya
Diversity: Classification and observingDiversity: Classification and observing
“Domain” Bacteria
1994 - 13 divisions (all cultured)
2004 - 80 divisions 26/54
BACTERIAL “PHYLA/CLASS” ~80-90% rRNA SIMILARITY
Diversity: Classification and observingDiversity: Classification and observing
RDP Global Census, 2003RDP Global Census, 2003
FIG. 3. Collector's curve of the Chao1 nonparametric richness estimator for sequences in the RDP-II. Accession numbers were used to determine the order in which sequences have been sampled. OTUs defined by a collection of identical sequences reached an estimate of 325,040 different OTUs.
Schloss and Handlesman, 2004Diversity: Classification and observingDiversity: Classification and observing
Strategy for exploringgenetic diversity
(Culture-independent)
estimates ofdiversity
Chao-1 non-parametric richness estimator
S = Sobs + (a2/2b)
Sobs total # observed species
a species observed once
b species observed twice
identification andremoval of artifacts
environment
clone, sequence and analyze
PCR amplified rRNA genes
Diversity: Classification and observingDiversity: Classification and observing
Estimating diversity in microbial Estimating diversity in microbial ecologyecology
Extrapolated diversity of a Extrapolated diversity of a sampled abundancesampled abundance Depend on several factors:Depend on several factors:
Underlying distributionUnderlying distribution Sample sizeSample size Sampling strategySampling strategy
0
50
100
150
200
250
300
350
400
450
0 1 2 3 4 5 6 7 9 11 13 14 16 21 27 32 43 45
abundance
Number of OTUs observed
Diversity: Classification and observingDiversity: Classification and observing
Two types of estimators for diversityTwo types of estimators for diversity Non-parametric estimators (Chao and lee, 1992)Non-parametric estimators (Chao and lee, 1992)
No abundance distribution model is assumed No abundance distribution model is assumed predict minimum number expected-> not total diversity!predict minimum number expected-> not total diversity!
Chao-1Chao-1
ACE (abundance-based coverage estimator of species ACE (abundance-based coverage estimator of species richness) estimates the diversity of rare and abundant taxa richness) estimates the diversity of rare and abundant taxa separatelyseparately
Parametric estimators (see discussion in Hong, PNAS, 2006)Parametric estimators (see discussion in Hong, PNAS, 2006) The abundance distribution is assumed to have a specific formThe abundance distribution is assumed to have a specific form Observed distribution is fit by maximum likelihood modelObserved distribution is fit by maximum likelihood model
Power-lawPower-law LognormalLognormal ParetoPareto GammaGamma
Large potential for error as we really don’t understand Large potential for error as we really don’t understand the natural distributions of biodiversity!the natural distributions of biodiversity!
€
CHAO1: S = Sobserved +S1
2
2S2
Diversity: Classification and observingDiversity: Classification and observing
EnvironmenEnvironmentt
UnitsUnits Richness Richness (model)(model) ReferenceReference
Meso and Deep Meso and Deep SeaSea
97% V6 (16S 97% V6 (16S variable region)variable region)
~10~104 4 (chao1 and (chao1 and ACE)ACE)
Sogin et al,Sogin et al,
PNAS 2006PNAS 2006
Sargasso Sargasso seawaterseawater-10103 3 LL- all samplesall samples
100%16S rRNA 100%16S rRNA
94% rpoA94% rpoA
100% 16S rRNA100% 16S rRNA
1,412 (observed)1,412 (observed)
~1000 (chao1) ~1000 (chao1)
10106 6 (chao1)(chao1)
Venter et al., Venter et al., Science 2004Science 2004
Plum Island Plum Island Sound seawaterSound seawater - 1L- 1L
100% 16S rRNA100% 16S rRNA
99% 16S rRNA99% 16S rRNA1633 (chao1)1633 (chao1)
520 (chao1)520 (chao1)Acinas and Acinas and Klepac-Ceraj et Klepac-Ceraj et al., Nature 2004al., Nature 2004
Hypersaline Hypersaline
microbial matmicrobial mat100% 16S rRNA100% 16S rRNA
99-100% 16S 99-100% 16S rRNArRNA
1,336 (observed)1,336 (observed)
>10>104 4 (chao1 and (chao1 and ACE)ACE)
Ley R. E. et al., Ley R. E. et al., AEM 2006AEM 2006
Salt marsh Salt marsh sedimentsediment - 5g - 5g
99% 16S rRNA99% 16S rRNA 2411 ± 542 2411 ± 542
(pareto distribution)(pareto distribution)Hong et al., Hong et al.,
PNAS 2006PNAS 2006
How many types coexist in marine microbial How many types coexist in marine microbial communities? - wide variation in estimatescommunities? - wide variation in estimates
Diversity: Classification and observingDiversity: Classification and observing
Why such variabilities in Why such variabilities in distribution? Rare Biospheredistribution? Rare Biosphere
Most diversity is rareMost diversity is rare New approach: Tag-New approach: Tag-
sequencing 16S allows high-sequencing 16S allows high-sample number = 118,000 sample number = 118,000 PCR amplicons ~120 bp hyper-PCR amplicons ~120 bp hyper-variable region of 16S rRNAvariable region of 16S rRNA
Non-parametric (chao1 and Non-parametric (chao1 and ACE) estimation of diversity at ACE) estimation of diversity at eight oceanic sites - meso- and eight oceanic sites - meso- and bathypelagic realms combined bathypelagic realms combined predict ~10predict ~104 4 coexisting types coexisting types per site (10-fold higher than per site (10-fold higher than other marine estimates)other marine estimates)
Relative abundance of OTUs Relative abundance of OTUs varies 1000-fold. Most of varies 1000-fold. Most of diversity is low-abundance diversity is low-abundance populationspopulationsSogin, PNAS 2006 Sogin, PNAS 2006
~25% ~25%
Diversity: Classification and observingDiversity: Classification and observing
Q: How is relatedness of 16S rRNA Q: How is relatedness of 16S rRNA correlated to genomic similarity?correlated to genomic similarity?
70% DNA-DNA re-association has been the “gold standard” for assigning culture-positive organisms to microbial species. - correlates to 97-100% rRNA identity. The reciprocal relationship does not hold.
A: Not that well…
Sediment actinobacteriaStackebrandt and Goebel, 1994
Diversity: Classification and observingDiversity: Classification and observing
e.g. three e.g. three E. coliE. coli strains have in common <40% of total protein genes strains have in common <40% of total protein genes
Welch et al. (2002)• strains from different environments
Core genome:- shared by all
(e.g., housekeeping)
Flexible genome:- strain specific
(e.g., pathogenicity islands, antibiotic resistance, integrons)
How are bacterial genomes differentiated?How are bacterial genomes differentiated?
Diversity: Classification and observingDiversity: Classification and observing
Size variation among bacterioplanktonic Size variation among bacterioplanktonic ““V. splendidusV. splendidus” genomes” genomes
phylogenetic relationshipsof Hsp60 alleles
Genome sizes (4.5 to 5.6 Mb)
Isolates paired by identical Hsp60 alleles and represent spectrum of observed diversity
Suggests some diversification is due to large-scale genome changes
Diversity: Classification and observingDiversity: Classification and observing
What drives genome diversification?What drives genome diversification?
Elements In Elements Out
DuplicationHorizontal gene transfer-homologous recombination-non-homologous recombination
Gene Loss
Dynamic genome contentDynamic genome content
GENOME
Diversity: GenerationDiversity: Generation
ConjugationConjugation: A bacterium attaches to another : A bacterium attaches to another bacterium and passes a fragment of its DNA bacterium and passes a fragment of its DNA (chromosomal or plasmid) to the recipient cell. (chromosomal or plasmid) to the recipient cell.
Foreign DNA uptake:
ConjugationTransformationTransduction
Mechanisms of Lateral Diversification
It is not known how many environmental bacterial exchange DNAthrough conjugation.(CAMERA query): What is the ratio of genes encoding sex pili to recA?
Diversity: GenerationDiversity: Generation
TransformationTransformation::Fragments of bacterial DNA are taken up by a cell from the environment. Fragments of bacterial DNA are taken up by a cell from the environment. These genetic fragments may recombine with the host chromosome, These genetic fragments may recombine with the host chromosome, permanently adding new genes.permanently adding new genes.
Foreign DNA uptake:
ConjugationTransformationTransduction
Mechanisms of Lateral Diversification
WH Freeman
Diversity: GenerationDiversity: Generation
Transduction:Transduction:Phage carry bacterial DNA from one bacterium to anotherPhage carry bacterial DNA from one bacterium to another
Foreign DNA uptake:
ConjugationTransformationTransduction
Mechanisms of Lateral Diversification
WH Freeman
Diversity: GenerationDiversity: Generation
What happens after DNA uptake?What happens after DNA uptake?
DestructionDestructionPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific RecombinationNon-homologous RecombinationNon-homologous Recombination
Diversity: GenerationDiversity: Generation
What happens after DNA uptake?What happens after DNA uptake?
DestructioDestructionnPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination
Foreign DNA recognized by foreign methylation patternsRestriction endonucleases cleave foreign DNA
* * *ATTGCCCGTAATATTACGTAACGGGCATTATAATGC
A AA
A
T
T TTG
G
C
C
G
C
Diversity: GenerationDiversity: Generation
DNA as Food?DNA as Food?
FIG. 3. Average growth yields of wild-type (WT) or com mutant cells in minimal medium supplemented with 0.1% ultrapure sonicated salmon sperm DNA as the sole source of carbon and energy. Growth yields (indicated above each bar) were determined by dividing the number of cells after 24 h of incubation by the number of cells at inoculation.
DNA uptake mutants
Wild-type E. coli
Palchevskiy and Finkel, J. Bac, 2006
[DNA][DNA]marinemarine >100ug/L >100ug/L
[DNA][DNA]sedimentsediment >100ug/g >100ug/g
Diversity: GenerationDiversity: Generation
Mechanisms of Lateral Diversification
DestructionDestructionPlasmid replicationPlasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination
WH Freeman
Diversity: GenerationDiversity: Generation
What happens after DNA uptake?What happens after DNA uptake?
DestructionDestructionPlasmid replicationPlasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination
WH Freeman
Diversity: GenerationDiversity: Generation
Ratio: recombination to Ratio: recombination to mutationmutation
Guttman and Dykhuizen, Science 1994
In E. coli recombination is 50-fold more likely to change a nucleotide site than mutationIn E. coli recombination is 50-fold more likely to change a nucleotide site than mutation
Multiple locus sequence typing (MLST) -> Multiple locus sequence typing (MLST) -> Similar recombination rates in other pathogen populationsSimilar recombination rates in other pathogen populations
Identify recombination events as deviations from phylogenetic congruency Identify recombination events as deviations from phylogenetic congruency 12 strains of E. coli (method of Wilson et al 1977)12 strains of E. coli (method of Wilson et al 1977)
Diversity: GenerationDiversity: Generation
What happens after DNA uptake?What happens after DNA uptake?
DestructionDestructionPlasmid replication Plasmid replication Homologous RecombinationHomologous RecombinationSite-specific RecombinationSite-specific Recombination
~1% of Vibrio genomes are annotated as transposases or integrases.
V. vulnificus “super-integron” gene-capture system contains 188 attC sites and 202 orfs
Mobile genetic elements insert in genome:• Transposons (IS + transposase)• Integrons (attI site + integrase + gene cassette with attC site)
integrase
Diversity: GenerationDiversity: Generation
Point mutations
neutral (wobble)
nonsense/frameshift
Chromosomal mutations
Deletion
Duplication
Rearrangements
3.5 billion years in the making
Mechanisms of Vertical (clonal) Diversification
Vertical inheritance
Diversity: GenerationDiversity: Generation
How fast does the molecular clock How fast does the molecular clock tick?tick?
Neutral mutation rates:Neutral mutation rates:
E.coli lab cultures: 0.003 mutations per E.coli lab cultures: 0.003 mutations per genome division (Drake, 1991, 1993, 1998)genome division (Drake, 1991, 1993, 1998)
E.coli natural populations: 0.0001-0.0002 E.coli natural populations: 0.0001-0.0002 mutations per genome divisionmutations per genome division
Buchnera natural populations: 0.0001-Buchnera natural populations: 0.0001-0.0002 mutations per genome division0.0002 mutations per genome division
1-2% 16S rRNA divergence per 50 million 1-2% 16S rRNA divergence per 50 million years (Moran et al 1993) based on years (Moran et al 1993) based on BuchneraBuchnera
3.5 billion years of evolution!3.5 billion years of evolution!
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Co-evolution of thebuchnera-aphid symbiosisallows calibration ofmicrobial evolution rate.
Diversity: GenerationDiversity: Generation
Fitness differences: Fitness differences: Diversification by mutationDiversification by mutation
Evolution of Evolution of ggrowth rowth aadvantage in dvantage in sstationary tationary pphase: older hase: older cultures out-compete younger cultures.cultures out-compete younger cultures.
Mapped to mutations in rpoS (stress-response sigma Mapped to mutations in rpoS (stress-response sigma factor).factor).
Finkel, et al PNAS (1999)
Fig. 1. Consecutive generations of GASP mutants arise in the same culture. Progressively aged cultures were mixed. (A) One-day-old in the majority (solid line) vs. 10-day-old in the minority (broken line). (B) Ten-day-old in the majority (solid line) vs. 20-day-old in the minority (broken line). (C) Twenty-day-old in the majority (solid line) vs. 30-day-old in the minority (broken line). Asterisks indicate that cfu ml-1 were below the limit of detection (<102 cfu ml-1).
Diversity: GenerationDiversity: Generation
So far:So far:
There is vast (unknown) diversity of 16S rRNA There is vast (unknown) diversity of 16S rRNA ribotypesribotypes
There is even more genomic diversity There is even more genomic diversity associated with those ribotypesassociated with those ribotypes
There are many mechanisms for microbial There are many mechanisms for microbial diversification… diversification…
So, what drives the cohesion of populations So, what drives the cohesion of populations into the recognizable types we can observe?into the recognizable types we can observe?
Diversity: GenerationDiversity: Generation
Fraser, Science 2007
The frequency of recombination falls off The frequency of recombination falls off exponentially with the degree of genomic exponentially with the degree of genomic
DNA sequence divergence.DNA sequence divergence.
Bacillus, Staphylococcus and E. coli
Is homologous recombination more likely Is homologous recombination more likely within phylogenetic clusters?within phylogenetic clusters?
genetransfer amongclosely related strains
Microbial phylogenetic taxa may Microbial phylogenetic taxa may show some degree of biological show some degree of biological
isolationisolation(similar to Mayr 1942)(similar to Mayr 1942)
Zebra x Horse = HebraZebra x Horse = Hebra
HUMAN & DONKEY
~99% rRNA SIMILARITY
BACTERIAL “SPECIES” ~97% rRNA SIMILARITY
10
12
14
16
1463 1470 1477 1484
TIME
ABUNDANCE
X Y A B C
? %
A test:Do sequence clusters have coherent environmental dynamics?
Cohesive sequence clusters = ecotypes?
Population 2 Population 1
1
2
Units of BiologyUnits of Biology
Biological speciesBiological species PhylotypesPhylotypes
EcotypesEcotypes
PatternPatternPluralismPluralism
Reproductive Isolation
Ecological niche
Single lineage
Multiple models relevant
Operational TaxonomyOperational Taxonomy Phylotypes Phylotypes
Proxies for evolutionary speciesProxies for evolutionary species Single-lineage of ancestral populations/smallest Single-lineage of ancestral populations/smallest
diagnostable cluster of individualsdiagnostable cluster of individuals (Cracraft, 1983; Eldregde and Cracraft 1980)(Cracraft, 1983; Eldregde and Cracraft 1980)
Debatable assumption:Debatable assumption: The evolutionary history for the biomarker gene is a The evolutionary history for the biomarker gene is a
(good) proxy for the evolutionary history of the (good) proxy for the evolutionary history of the organism.organism.
ExamplesExamples 16S ribosomal RNA16S ribosomal RNA Housekeeping genesHousekeeping genes
Biological speciesBiological species PhylotypesPhylotypes
EcotypesEcotypes
PatternPatternPluralismPluralism
Operational TaxonomyOperational Taxonomy Biological SpeciesBiological Species
Earnst Mayr, 1942Earnst Mayr, 1942 Groups of organisms that can interbreedGroups of organisms that can interbreed Reproductive isolationReproductive isolation Homologous recombination in microbes may enable bio-Homologous recombination in microbes may enable bio-
species like evolutionspecies like evolution Observed in microbes through multi-locus sequence Observed in microbes through multi-locus sequence
typing (MLST) or whole-genome comparisonstyping (MLST) or whole-genome comparisons
Biological speciesBiological species PhylotypesPhylotypes
EcotypesEcotypes
PatternPatternPluralismPluralism
Operational TaxonomyOperational Taxonomy Ecological Species (Ecotype)Ecological Species (Ecotype)
Lineage that occupies an ecological niche (adaptive Lineage that occupies an ecological niche (adaptive zone)zone)
Definition allows for “hybridization” events if niche is Definition allows for “hybridization” events if niche is unchangedunchanged
Observed in microbes through population dynamicsObserved in microbes through population dynamics Van Valen, 1976Van Valen, 1976
Biological speciesBiological species PhylotypesPhylotypes
EcotypesEcotypes
PatternPatternPluralismPluralism
Operational TaxonomyOperational Taxonomy Pattern PluralismPattern Pluralism
Similarities and differences between organisms may be Similarities and differences between organisms may be accounted for by evolutionary mechanisms, however a accounted for by evolutionary mechanisms, however a single-tree like pattern (tree of life) is not the expected single-tree like pattern (tree of life) is not the expected outcome.outcome.
““Different evolutionary models and representations of Different evolutionary models and representations of relationships will be appropriate, and true, for different relationships will be appropriate, and true, for different taxa or at different scales or for different purposes”taxa or at different scales or for different purposes”
Doolittle and Bapteste, PNAS 2007Doolittle and Bapteste, PNAS 2007
Biological speciesBiological species PhylotypesPhylotypes
EcotypesEcotypes
PatternPatternPluralismPluralism
““Pattern Pluralism” in Chimeric ThermotogaPattern Pluralism” in Chimeric Thermotoga
Nesbo, Dlutek and Doolittle, 2006
“Different parts of a genome may belong to different biological Species if our species concept is based on the ability to share Information by homologous recombination.”
Diversity Metrics*Diversity Metrics*
MetricMetric UnitUnit Pro’sPro’s Con’sCon’sRibotype (16S rRNA)Ribotype (16S rRNA) phylotypephylotype universal,universal,
Culture-independentCulture-independent
High associated genomic variabilityHigh associated genomic variability
Single-locus Single-locus Housekeeping geneHousekeeping gene
phylotypephylotype Higher phylogenetic resolution, Higher phylogenetic resolution,
Culture-independentCulture-independent
Not universal,Not universal,
High associated genomic variabilityHigh associated genomic variability
Multi-locus sequence Multi-locus sequence types (MLST)types (MLST)
phylotypephylotype
Biospecies?Biospecies?
Can determine recombination Can determine recombination rates and clonality of population rates and clonality of population structurestructure
Not universal, Not universal,
Need cultured isolates*Need cultured isolates*
Environmental Environmental
Gene clustersGene clusters
ecotypeecotype
phylotypephylotype
Culture-independent and Culture-independent and suggests ecological significancesuggests ecological significance
Must link to environmental data set, Must link to environmental data set, within cluster genomic variation is within cluster genomic variation is unknown.unknown.
Metagenome Metagenome fragmentsfragments
ecotypesecotypes
phylotypesphylotypes
Biospecies?Biospecies?
Environmental detection, Environmental detection, presents total genetic diversitypresents total genetic diversity
Challenges associated with linking Challenges associated with linking phylogetically-informative genes to phylogetically-informative genes to genetic diversitygenetic diversity
Whole GenomesWhole Genomes ecotypesecotypes
phylotypesphylotypes
Biospecies?Biospecies?
Most accurateMost accurate Large sequencing effort, Need Large sequencing effort, Need cultured isolates*cultured isolates*
*Conclusions subject to debate!
Lecture OutlineLecture Outline Diversity -Diversity -
definitions and measurement definitions and measurement
Generation -Generation - vertical and horizontal mechanismsvertical and horizontal mechanisms
Persistence -Persistence - Neutral TheoryNeutral Theory Niche TheoryNiche Theory Ecological trends in pelagic systemsEcological trends in pelagic systems
Paradox of the planktonParadox of the plankton
1961 G. E. Hutchinson (Am. Nat. 95:137-145)1961 G. E. Hutchinson (Am. Nat. 95:137-145)““The problem that is presented by the phytoplankton The problem that is presented by the phytoplankton is essentially how is it possible for a number of is essentially how is it possible for a number of species to co-exist in a relatively isotropic or species to co-exist in a relatively isotropic or unstructured environment all competing for the same unstructured environment all competing for the same sorts of materials?”sorts of materials?”
Persistence of DiversityPersistence of Diversity Neutral TheoryNeutral Theory
stochastic interactions and dispersalstochastic interactions and dispersal
Niche TheoryNiche Theory SpecializationSpecialization Environmental heterogeneityEnvironmental heterogeneity
Neutral TheoriesNeutral Theories Unified Neutral Theory of Biodiversity (Hubble, Unified Neutral Theory of Biodiversity (Hubble,
2001)2001) Seek to explain community level patterns without Seek to explain community level patterns without
(before) invoking specialization of species.(before) invoking specialization of species. Highly similar (ecologically-equivalent or functionally-Highly similar (ecologically-equivalent or functionally-
redundant) species co-exist by stochastic mechanisms.redundant) species co-exist by stochastic mechanisms. Diversity is a balance of immigration and local Diversity is a balance of immigration and local
extinctionextinction
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
How strong is How strong is “purifying selection” “purifying selection” over the scale of ocean over the scale of ocean mixing?mixing?
Neutral TheoriesNeutral Theories
Island biogeography (MacArthur and Wilson, Island biogeography (MacArthur and Wilson, 1967)1967)
Number of species on a island is determined by effect of Number of species on a island is determined by effect of distance from mainland and the island size.distance from mainland and the island size.
Many types of “islands”: habitat surrounded by an Many types of “islands”: habitat surrounded by an inhabitable environment (fish, marine snow…)inhabitable environment (fish, marine snow…)
New species are created by isolation of gene pools and New species are created by isolation of gene pools and drift (allopatric speciation)drift (allopatric speciation)
Specialization: Niche TheorySpecialization: Niche Theory
pO2
Temperature
Niche#1
Niche #2
Fundamental Niches(Hutchinson, 1958)
pO2
Temperature
Niche#1
Competition = Niche Overlap
Fundamental NicheRealized Niche
Niche#3
Specialization: Niche TheorySpecialization: Niche Theory
pO2
Temperature
Niche#1
Specialization = Co-existence
e.g. Carbon Source
Specialization: Niche TheorySpecialization: Niche Theory
On Competitive On Competitive ExclusionExclusion
Complete competitors cannot coexist (Hardin, Complete competitors cannot coexist (Hardin, 1960)1960)
BUTBUT “…“…there are innumerable dimensions in which there are innumerable dimensions in which
differences could be found” (Valiela, 1995)differences could be found” (Valiela, 1995)
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Sinking Detritus (Marine Snow):Sinking Detritus (Marine Snow):Ephemeral Microenvironments Ephemeral Microenvironments
(Niches)(Niches)
F. Azam, Nature 2001
Phytoplankton Niche AxesPhytoplankton Niche Axes
Fig. 3. Optimum temperature and light intensity for growth, (Topt) and (Iopt), of all initialized Prochlorococcus analogs (all circles) from the ensemble of 10 model integrations. Large circles indicate the analogs that exceeded a total biomass of 106 mol P along AMT13 in the 10th year. Colors indicate classification into model ecotypes. Bold diamonds indicate real-world Prochlorococcus ecotypes.
Follows, et al Science 2007
Emergent biogeography parallels Emergent biogeography parallels observationsobservations
Figure 1. Annual mean biomass and biogeography from single integration. (A) Total phytoplankton biomass (µM P, 0 to 50 m average). (B) Emergent biogeography: Modeled photo-autotrophs were categorized into four functional groups; color coding is according to group locally dominating annual mean biomass. Green, analogs of Prochlorococcus; orange, other small photo-autotrophs; red, diatoms; and yellow, other large phytoplankton. (C) Total biomass of Prochlorococcus analogs (µM P, 0 to 50 m average). Black line indicates the track of AMT13.
Follows, et al Science 2007
Units of selection are Light and Temperature optima - not taxa
……a study of biogeography on the basis of the global a study of biogeography on the basis of the global distribution of genes and their alleles and their distribution of genes and their alleles and their patterns of divergence and dispersal. This should patterns of divergence and dispersal. This should be a central guiding principle for the new be a central guiding principle for the new science of metagenomics….science of metagenomics….
Nesbo, Dlutek and Doolittle, 2006
……a study of biogeography on the basis of the global a study of biogeography on the basis of the global distribution of genes and their alleles and their distribution of genes and their alleles and their patterns of divergence and dispersal. This should patterns of divergence and dispersal. This should be a central guiding principle for the new be a central guiding principle for the new science of metagenomics….science of metagenomics….
Nesbo, Dlutek and Doolittle, 2006
Recent studies suggest gene-ecologies may circumvent much of the confusion around trying to link the activities of microbial communities to their phylogenetic structure
After all - functional genes, not ribosomes drive niche-partitioning
Persistence of DiversityPersistence of Diversity Neutral TheoryNeutral Theory
stochastic interactions and dispersalstochastic interactions and dispersal
Niche TheoryNiche Theory SpecializationSpecialization Environmental heterogeneityEnvironmental heterogeneity
Ecological trends in pelagic systemsEcological trends in pelagic systems Environmental gradientsEnvironmental gradients BiogeographyBiogeography
Do genes track environmental Do genes track environmental gradients?gradients?
Hawaii Ocean Time seriesHawaii Ocean Time series Depth variability of gene distributions Depth variability of gene distributions
examined by end-sequencing ~5000 fosmids examined by end-sequencing ~5000 fosmids from each depthfrom each depth
Look for specific genes and metabolic traits Look for specific genes and metabolic traits that were differentially distributed in the that were differentially distributed in the water column.water column.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Fig. 1. Temperature versus salinity (T-S) relations for the North Pacific Subtropical Gyre at station ALOHA (22°45'N, 158°W). The blue circles indicate the positions, in T-S "hydrospace" of the seven water samples analyzed in this study. The data envelope shows the temperature and salinity conditions observed during the period October 1988 to December 2004 emphasizing both the temporal variability of near-surface waters and the relative constancy of deep waters.
Habitat-enriched gene groupsHabitat-enriched gene groups
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
DeLong, et al Science 2006
Fig. 4. Cluster analyses of COG annotated photic zone and deep water sequence bins versus depth. Yellow shading is proportional to the percentage of categorized sequences in each category.
Photic Zone:Light-driven processes (KEGG)Motility (KEGG)Iron-transport
Deep sea:Transposases and integrasesPilus synthesis (KEGG)Antibiotic synthesis
Clusters of orthologous groups
Gene-based biogeographyGene-based biogeography
Global Ocean Survey:Global Ocean Survey: 7.6 million random sequence reads (Venter et 7.6 million random sequence reads (Venter et
al 2007)al 2007)
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
GOS transect map(Yutin, EM 2007)
Gene-based biogeographyGene-based biogeography
Global Ocean SurveyGlobal Ocean Survey PufM: subunit of anoxygenic photosynthetic reaction PufM: subunit of anoxygenic photosynthetic reaction
center.center.
(Yutin, EM 2007)
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Fig. 4. Anoxygenic photosynthetic population compositions along the GOS transect. Colours used to represent different types of environments … colours representing the eight major phylogroups …Note that samples 5, 6 and 7 are different size fractions from the same station.
PufM-type Different types associated with different environments
Cosmopolitan: G Oligotrophic: A,B Coastal: E,K Offshore: C,D
SummarySummary How do we assess microbial diversity?How do we assess microbial diversity?
Classification and ObservationsClassification and Observations Contributions of 16S ribotyping to understanding the Contributions of 16S ribotyping to understanding the
potential scale of global microbial diversitypotential scale of global microbial diversity Use of statistical estimators to attempt total diversity Use of statistical estimators to attempt total diversity
estimatesestimates Microbial species concepts - can we define a unit of Microbial species concepts - can we define a unit of
selection?selection?
How is this diversity generated?How is this diversity generated? horizontal and vertical mechanismshorizontal and vertical mechanisms
3.5 million years of vertical evolution3.5 million years of vertical evolution Mobile genetic elements and LGT Mobile genetic elements and LGT Homologous recombination as a population-cohesive Homologous recombination as a population-cohesive
forceforce
SummarySummary
How is this diversity maintained in the oceans?How is this diversity maintained in the oceans?
Neutral TheoryNeutral Theory: Diversity can partially be explained by : Diversity can partially be explained by stochastic environmental interactions that drive stochastic environmental interactions that drive immigration and local extinctionsimmigration and local extinctions
Niche Theory: Diversity is explained by the Niche Theory: Diversity is explained by the specialization of co-existing typesspecialization of co-existing types
Linking structure (co-existing diversity) to function Linking structure (co-existing diversity) to function (e.g. global biogeochemical processes) can be (e.g. global biogeochemical processes) can be approached in a taxa-independent manner that relies approached in a taxa-independent manner that relies on the ecologies of genetic systems.on the ecologies of genetic systems.
The last slide
top related