mpn_04.10
Post on 31-Mar-2016
212 Views
Preview:
DESCRIPTION
TRANSCRIPT
u V-Twin Expo Scoop u Circumnavigate Earth with Edelweiss u Dealer Expo Recapu V-Twin Expo Sccoop u Circuumnnnnaaaaaaavvvvvvvvigggggggaaaaaatttttttteeeeeee
Back to the FutureHow History Can Save Harley-Davidson
Tech TalkCommunication Systems Product Guide
A p r i l 2 0 1 0 V O L . 3 6 N O . 4 W W W . M P N M A G . C O M
Luggage & Apparelfor the Long Haul
TouringStarter Kit TouringStarter Kit
HHHHHHHHHHoooooowwwwww HHHHHHHiiiiiissssstttttttoooooorrrryyyyyyy CCCCCaaaaannnnn SSSSSSSSSaaaaavvvvveeeee HHHHHHHaaaaaarrrrrlllllleeeeeeyyyyyyyyyy--DDDDDDDaaaaaavvvvviiiiiiidddddddsssssooooonnnnnnnnyyyyyyyyyyeyyyyyyyyry oooooooooossssssdddddddddaaaaaaaaaaaaaeeeeeeeeeeeaaaaaaaaaaavvveeeeeeeeeeeveaaaaaaaaaSSSSSSSSSSaaaaaaaaaaaCCCCCCCooooooooooossssssoooooooooo nnnnid nvvvvvvvvvvvvDDDDDDDDDDDDDDDllrlrHHHHHHHvvvvvvvvvvvvnnnnnnntttttttistHHHHHHHHwwwwwwwwwwwowHHHHHHH yy- ii
eee eeeeCCCCCCCooooommmmmmmmmmuuuunnnnnniiiiiiiccccccaaaaaattttttiiiiiiooooonnnnnn SSSSSSSSSyyyyyyyyyyssssssttttttteeeeeemmmmmssssss PPPPPPrrrroooooodddddddddduuuuucccccttttt GGGGGGGuuuuuuiiiiiiidddddddeeeeeeeeeeooo aa oooo PPPP ooodddd dddyyySy eeeeeeeeeeeeeddddduGGGGGGGGGGGGGcccccudddddddrrroooooooooorossssssssseeeeeeeeeeeeeyyyysssssssysSSSSSSSSSSSSSSoooooooooooaaaaaaacaccccuooooooooooooCCCCCCCCCC ictrPPPPPPPPPPPmmmmmmstnnnnnni ni tnnnnnnmmmmmmmmmmmm iii
Luggage & Apparelfor the Long Haul
Cass City Par r .mar
1-800-999-3388
Boise, ID / Fresno, CA / Memphis, TN Elizabethtown, PA / www.wps-inc.com
GM44 FULL FACESTREET HELMET
$139.95-$149.95
PLATINUM SERIESPlatinum Series includes platinum tint shield
and deluxe helmet bag with shield pocket.
MAN’S BEST FRIENDThis is not a professional model. This is a real mechanic who
works at a real dealership. The point being is that every day we are reminded that money is tight and we need to make sure we are
getting the right amount of bang for our powersport’s buck.
At Moose Racing we understand. We are industry enthusiasts who don’t want to see you have to tear open your
wallet just because you want to tear open the throttle. That is why we are constantly striving to build quality hardparts at a fair price.
We do this for them just like we do this for you.
MOOSE RACING PRODUCTS ARE ONLY AVAILABLE THROUGH YOUR LOCAL AUTHORIZED PARTS UNLIMITED DEALER MOOSERACING.COM
4 April 2010 www.MPNmag.com
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
u V-Twin Expo Scoop u Circumnavigate Earth with Edelweiss u Dealer Expo Recap
Back to the FutureHow History Can Save Harley-Davidson
Tech TalkCommunication Systems Product Guide
A p r i l 2 0 1 0 V O L . 3 6 N O . 4 W W W . M P N M A G . C O M
Luggage & Apparelfor the Long Haul
TouringStarter Kit TouringStarter Kit Luggage & Apparelfor the Long Haul
MPN (ISSN 0164-8349) is published monthly and is distributed without
charge to qualifi ed motorcycle retail professionals by Athletic Business
Publications Inc., 4130 Lien Rd., Madison, WI 53704-3602. Change of
Address: In order to ensure uninterrupted delivery of MPN, notice
should be made at least fi ve weeks in advance. Direct all subscription
mail to MPN, PO Box 47705, Plymouth MN 55447, call 800-869-6882 or
fax 866-658-6156. For faster service, visit us online at mpnmag.com.
Single copy price is $8 (Buyers Guide–$50). Subscription price is $55 for
12 issues in the U.S.A./Canada/Mexico. International subscription via
air mail is $130. Periodicals postage paid at Madison, Wisconsin, and at
additional mailing offi ces. Postmaster: Send address changes to MPN,
PO Box 47705, Plymouth MN 55447. © Athletic Business Publications
Inc., 2010 ALL RIGHTS RESERVED. Reproduction in whole or part is
prohibited. MPN is a trademark of Athletic Business Publications Inc.
Canadian Publications Agreement No. PM40063731. Canadian Mail
Distribution Information: PB IMS, Station A, P.O. Box 54, Windsor,
ON N9A 6J5.
Departments
Shop Talk
22
The Road Ahead . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8Spare Parts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10Destination Dealership . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12San Diego H-D Fearlessly Moves Forward
BY MARILYN STEMP
Essentials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
V-Twin Product . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
Pit Pass . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Marketplace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
Ad Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
Back To The Future . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14How History Can Save Harley-DavidsonBY LEE KLANCHER
Tech Talk . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19Communication Systems Product GuideBY COLLEEN BROUSIL
Touring Starter Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22Luggage & Apparel for the Long HaulBY COLLEEN BROUSIL
How To Hackett . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32Celebrating The Sales Process
BY OTIS HACKETT
Best Operators Club . . . . . . . . . . . . . . . . . . . . . . . . . . 342009 BOC Dealer Performance
BY STEVE JONES
Peak Dealership Performance 36Evidence-Based Dealership Management
BY MARK RODGERS
Lessons Learned . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38Use Event Marketing To Score Spring Sales
BY ROD STUCKEY
Practice What You Preach . . . . . . . . . . . 40Rebuild It When They Come
BY WILLIAM DOUGLAS LITTLE
Web Savvy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42Communication is Key, Content is King
BY PEGGY OLSON
ON THE COVER – – – – – – – – –– – – – – – – – –
MPN contributor Lee Klancher takes a break from his writing duties to snap this
awesome alpine touring shot.
Contents April 2010
Volume 36 Number 4
www.mpnmag.com
– – – – – – – – – – – – – – – – –
TABLE OF
Shop Talkk
follow MPN on @MPNmag
14 Blast From H-D’s Past
er 4
om
– – –
k
Shoei helmets are covered under a limited warranty for five years from purchase date or seven years from the date of manufacture, whichever comes first. Shoei helmets are distributed exclusively in the U.S. by Helmet House.For more Shoei information go to shoei-helmets.com or see your local dealer. ©2010 Shoei Safety Helmet Corp.
Shoei proudly introduces two new helmets that define the future: the RF-1100 and X-Twelve.Both helmets boast aggressive, advanced aerodynamic shapes developed in our own wind tunnel, a new
Quick Release Self-Adjusting Base-Plate System for a new, larger CW-1 shield, plus Snell M2010 safety rating.
THE FUTURE LOOKS GREAT
FULLY DETACHABLEINTERIOR
NEW QUICK RELEASESELF-ADJUSTING
BASE-PLATE SYSTEM
VARIABLE VENTILATIONSYSTEM
The RF-1100 delivers enhanced venting capabilities using the negative pressure area on the shell and a next-generation dualliner system freely routes cooling air between the two layers. A new fully detachable interior provides superior comfort andreplaceable cheek pads come in six different sizes to yield a precise fit.
Shoei’s premier X-Twelve offers ventilation that is literally unmatched, courtesy of its five intake and 10 exhaust ports,including all-new side extractor vents for improved anti-fog performance. A fully detachable, 3-D Max-Dry liner deliverssuperior comfort and a firm hold, and the X-Twelve also features our Emergency Quick Release System to ease helmetremoval by emergency medical personnel.
With all this and more, the future looks great—from inside a Shoei helmet.See more at www.shoei-helmets.com
For more information see your representative or contact Helmet House at (800) 421-7247.
CHECK OUT OUR VIDEOS AT youtube.com/helmethouse
GRADED #1 DISTRIBUTOR2009 Dealernews Distributor Report Card
THE X-TWELVEOFFERS UNMATCHED
VENTILATION OPTIONS
INNOVATIVE AERO EDGE 2SPOILER TO REDUCE LIFT
FULLY DETACHABLE,3-D MAX-DRY LINER
8 April 2010 www.MPNmag.com
EDITORIAL
Editor
Colleen Brousil colleen@mpnmag.com
Assistant Editor
Doug Dalsingdoug@mpnmag.com
Columnists
Otis Hackett, Steve Jones, William Douglas Little, Mark Rodgers, Rod Stuckey
Contributors
Lee Klancher, Peggy Olson, Marilyn Stemp
ART
Electronic Production Manager/
Art Director
Marjorie Schultzmarj@mpnmag.com
Production Assistant
Scott Packel
ONLINE
Online Producers
Susan Bickler, Erika Reise
Web Programmer
Alex Malyutin
ADVERTISING SALES
Associate Publisher
Dean Kellydean@mpnmag.com (866) 616-1635 ext. 130
PUBLISHER
MPN/Athletic Business Publications Inc.4130 Lien Road, Madison, WI 53704
Phone: (866) 616-1635 • Fax: (608) 249-1153
CEO
Gretchen Kelsey Brown
President
Peter Brown
Group Publisher
Shawn Gahagan
Controller
Kara Clark
Administration Director
Sharon Siewert
Audience Development Director
Jennifer Boyd
Audience Development Coordinator
Colleen Wenos
Email Marketing Coordinator
Lisa Popke
CAUTIOUS OPTIMISMShows in Cinci and Indy point to a better future
to stick around until then?
Zilch. I suggest the shows end
on Sunday evening. Vendors
who are able and want to ship
out Sunday night can do so, and
this move won’t affect attendee
satisfaction one bit. In Cincinnati,
dealers are already watching the
Super Bowl coverage by then
anyway. By Monday dealers have
either rushed home to supervise
their shops, or they’re leisurely
making their way home without
even entering the expo hall a
last time.
In Indianapolis, I witnessed
mass confusion (and frustration)
as the primary and outside expo
halls were open at different
times. On Friday, dealers
arrived to stroll the outside
hall while the primary hall was
still closed. Sunday evening,
the outside hall vendors were
closing up shop while the
primary hall vendors were still
looking to do business.
All I’m hoping for is
consistency and common
sense; Monday is the
beginning of the dealer
principal’s work week. I’ve
worked at consumer trade
shows that end on Sunday —
everyone seemed so happy
with the arrangement. What’s
worse is that I can’t even
imagine what organizers in
Indianapolis were thinking
with the hall timeframes.
Bottom line: There are still
people who want to buy fun,
and there are still folks who
want to sell it to them, so there
was defi nitely a silver lining of
optimism at both shows. So,
ride on brothers and sisters;
take whatever you can out of
2010. It will only get better. t
Dean Kelly is associate publisher
for Motorcycle Product News.
Like many of you
readers, everyone at
the MPN offi ce is still
digesting news and
new products from the V-Twin
Expo and Dealer Expo. Some of
those products are detailed in
our Essentials Gear and P&A
sections this month, while
others will surely get coverage
down the road. With the spring
buying (and riding!) season
approaching, we thought
we’d present you the latest
in touring gear and luggage;
we also have a product focus
on communication systems.
After all, people in this buying
demographic of globetrotters
and weekend warriors like
gear and gadgets, so you need
to know the ins and outs of
the latest products to hit
the streets.
But, back to discussing
the big two trade shows,
which, this year, seemed to
closely resemble one another:
Organizers of both shows
dealt with poor weather in
the Midwest, and attendance
was obviously down at both
shows, but, fortunately, an
enthusiastic crop of dealers
showed in both cities.
At the end of these shows,
I always make a few rounds
myself to get the inside scoop
on vendors’ thoughts on the
show. At both shows, vendors
said they had a lot of quality
time with interested dealers;
orders were taken and dealer
applications fi lled out. If a
dealer wasn’t spending quality
time on the show fl oor, he was
attending educational seminars.
Long story short, the lack of
party seekers — you know, the
type to have one beer in hand
and several in belly by 9 a.m.
— was apparent. (That’s not to
say Cincinnati’s Champ’s wasn’t
busy Saturday night or that the
Super Bowl crowd laid low —
far from it!)
Still, I picked up a few
common complaints along
my walk. The fact both shows
last until Monday came up
frequently. Attendance is always
very, very slow on Monday (or
nearly non-existent, as was the
case in Indianapolis this year).
With such low attendance,
what’s the value for a vendor
THERoadAHEAD
By Dean Kelly
Staff
BRINGING YOU THE BESTSERVICE, PRODUCT,
DELIVERY!
Washington
Oregon
Nevada
Idaho
California
Utah
Arizona
Wyoming
Montana
Colorado
New Mexico
Texas
Oklahoma
Kansas
Nebraska
South Dakota
North Dakota
Minnesota
Iowa
Missouri
Arkansas
Louisiana
Miss.
Alabama
Georgia
SouthCarolina
NorthCarolinaTennessee
Kentucky
IllinoisIndiana Ohio
WestVirginia
Virginia
Pennsylvania
Michigan
Wisconsin
UP Michigan
New York
Maine
VT
NH
Mass.
Conn.RI
MD
DEL
NJ
Florida
DC
Boise
Fresno
Memphis
Elizabethtown
Boise, ID / Fresno, CA / Memphis, TN Elizabethtown, PA / www.wps-inc.com
SEALED “NO HAZARD” FACTORY ACTIVATED BATTERY
SEALED FACTORY ACTIVATED BATTERY
1-800-999-3388
10 April 2010 www.MPNmag.com
What A Way to Turn 30Hey, if you’re not doing anything between Nov.
14, 2010, and July 20, 2011, take a chance
on Edelweiss’s Discover Our Earth tour, the
company’s 30th anniversary ride that will guide
riders through Europe, Africa, the Americas,
Australia and Asia. Oh, you’ve got a shop to run?
Well, pass the word along to your affl uent clientele
and convince them to go, and tell them you’re
their No. 1 source for outfi tting a motorcycle to
stand the rigors of global travel. The ride begins
at Edelweiss headquarters in Austria, goes to
France and then down to Dakar, Senegal. Riders
will hop ship to Argentina next and then ride north
to Los Angeles. Next comes a fl ight to and riding in
Australia. Then Beijing before a westward journey
back to Austria. Easy, right? t
Apocalyptic Bike PartsThe only things cooler
than the cars in all of the
Mad Max movies are the motorcycles! How can
one forget the swooping fairings sported by
Toecutter’s gang and Offi cer Jim Goose on their
Kawasakis? Mad Max Cars (MMC), a company
that specializes in recreating vehicles seen in
the Mad Max trilogy, recently bought Toecutterz.
com, the fi rst production company to offer the
fairings. Using the original moldings from which
the fi rst line was created in the late ‘70s, MMC
improved on production techniques — using
vacuum-bagged, resin-infusion lamination for a
strong and light fairing — and is taking advanced
orders for another run of “Toecutterz.” The
dealer price is $1,400, with an MSRP of $1,600. If
you have customers dying for retro parts that will
help their bikes stand out, look no further than
Toecutter fairings. For more info, visit
www.madmaxcars.com. t
10 April 2010 www MPNmag com
TWO NPA GIRLS ARE DEFINITELYBETTER THAN ONE!
PartsSPARE
the
ApocalyptBike Parts
BRINGING YOU THE BEST SERVICE, PRODUCT, DELIVERY!
1-800-999-3388
Washington
Oregon
Nevada
Idaho
California
Utah
Arizona
Wyoming
Montana
Colorado
New Mexico
Texas
Oklahoma
Kansas
Nebraska
South Dakota
North Dakota
Minnesota
Iowa
Missouri
Arkansas
Louisiana
Miss.
Alabama
Georgia
SouthCarolina
NorthCarolinaTennessee
Kentucky
IllinoisIndiana Ohio
WestVirginia
Virginia
Pennsylvania
Michigan
Wisconsin
UP Michigan
New York
Maine
VT
NH
Mass.
Conn.RI
MD
DEL
NJ
Florida
DC
Boise
Fresno
Memphis
Elizabethtown
Boise, ID / Fresno, CA / Memphis, TN Elizabethtown, PA / www.wps-inc.com
See Our Full Line of Tires at:WWW.SHINKOTIREUSA.COM
230 TOUR MASTER
12 April 2010 www.MPNmag.com
SAN-DIEGO HARLEY-DAVIDSONFearlessly moving forward
According to tradition,
bikers are rebels, bik-
ers on Harleys even
more so. That said,
it shouldn’t be surprising that
“New York” Myke Shelby, owner
of San Diego H-D, is an intrepid
individual who unequivocally
states his beliefs without regard
for conformity. But as a Harley-
Davidson dealer, one might
think Shelby would be stifl ed
by business dynamics. Not so.
And that’s more to the benefi t
of both his customers and the
corporate structure his shop
represents. “This,” says Shelby,
opening his arms to indicate the
dealership, “is what America
is all about. Be yourself and be
free.”
See, SD H-D has a colorful
history, so you could say
daring behavior is more than
appropriate here; it’s required.
When famed engine builder
and race tuner Leonard Andres
ran the dealership from the
‘40s to the ‘70s, the shop was
a standout gem in the H-D
crown. By all accounts, Andres
was an outgoing, personable
guy. Though some say the
dealership lost its pizzazz
when Leonard retired, there’s
no question that the spark
reignited when Shelby came
on the scene in 1993. For
proof, visit SD H-D’s website
and view some of Shelby’s
TV commercials. He insists
that it’s the American made
product — the Harley-Davidson
motorcycle — that riders
identify with, not a marketing
campaign or a corporate
structure. “Everything in life
comes down to freedom,” he
says. “It’s why we’re doing this,
it’s why we’re still here.” And
that’s the message that Shelby
is emphatic about and quite
good at delivering.
Shelby is an ardent activist
for motorcyclist’s rights, whose
patriotic fervor and intensity
for riding are impressive.
After more than 15 years at
the dealership’s helm, he
still works hard every day
to maintain SD H-D’s solid
reputation. His no-compromise
attitude trickles down to
everyone on the payroll, too.
A major benefi t of this high-
energy atmosphere is the
fresh thinking and innovation
that results when people are
inspired to hustle. There’s
pride of accomplishment and
competition even between
the three separate locations
that fall under the SD H-D
umbrella, including a shop at
Seaport Village in San Diego
Harbor, the main store on
Kearny Mesa Road, and the
downtown store in Little Italy
(above), near the franchise’s
original 1915 location.
Employees at the downtown
location are happy to point
out their building’s unique
architecture and singular
spaces, unmatched, they
say, by the other “modern”
facilities. This is also where
Rider’s Edge classes are held
and is the site of frequent
“Kettner Nights” street parties.
The Kearny Mesa store
is campus-like as it spills
into adjacent buildings in its
industrial park setting. To
keep the energy pumped up,
live bands are scheduled here
most every weekend, along
with charity gatherings that
benefi t such groups as Fallen
Offi cers and Special Operations
Warrior Foundation, which is
appropriate seeing Shelby is a
U.S. Air Force veteran. Intent
on maintaining their edge, both
the Kettner and Kearny Mesa
shops have undergone recent
refurbishment and expansion
projects. In fact, they were
both under construction when I
visited. “It’s not about surviving;
it’s about thriving,” Shelby says.
Shelby’s personal ride is a
stealthy, blacked-out V-Rod, but
his attitude is inclusive as far
as the H-D brand is concerned.
“They’re all great bikes, they’re
all American made,” he says.
Shelby deals on the level,
too — no price cutting,
no gouging. And he’s
unapologetic about running
his business with intent. “I
need to make a profi t to keep
my people employed and to
make sure we’re here when
you need us,” he says.
Thanks to the balmy San
Diego weather, barbeques are
held year round and family
events are scheduled on vari-
ous holidays. Monthly New Bike
Nights bring together new own-
ers for special events. Frequent
group rides are planned by
the dealership’s HOG chapter
to the Del Mar races or other
area events. Savvy marketing
partnerships expand the shop’s
reach, too (see sidebar).
“I’m never afraid of
competition,” says Shelby.
“What I’m concerned about is
government regulation.”
And that, friends, is the
deceptively simple philosophy of
an earnest and thoughtful man.
There’s something we can
all learn from that. t
Photos by Marilyn Stemp and compliments San Diego H-D
DESTINATIONDealershipStory by Marilyn Stemp
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
www.MPNmag.com April 2010 13
DOUBLE THE FUN
San Diego’s weather allows for year-
round riding, and one way SD H-D
recently capitalized on that fact was a
partnership with the Hard Rock Hotel
to develop the “Hard Rock and a Hog” package.
Originally planned as a temporary promo-
tion, the offer has been extended and includes
two nights’ accommodations, a one-day bike
rental, goodie bag, ride suggestions, meal
credit and VIP access to the Hard Rock’s night-
clubs. According to SD H-D’s event coordinator
Trisha Marshall, “The idea was to encourage
riders to enjoy our great weather and fi ne rid-
ing. Partnering with the Hard Rock just made
sense.” They’re two great things that are bet-
ter together, and make sense and sound like
fun, too. Learn more about the promotion at
www.sandiegoharley.com or
www.hardrockhotelsd.com/harley-davidson.
14 April 2010 www.MPNmag.com
www.MPNmag.com April 2010 15
“One faces the future
with one’s past.”
—Pearl S. Buck
“History is a guide
to navigation in
perilous times.”
—David McCollough
“We worked
every day, Sunday
included, until at
least ten o’clock at
night. I remember
it was an event
when we quit work
on Christmas night
at eight o’clock
to attend a
family reunion.”
—Walter Davidson
As family farms turned to dust and Wall Street bankers pancaked on concrete, Tom
Sifton was turning fast Harleys into black gold. The wunderkind tuner’s modifi ed
Harley engines were faster than the factory’s best in 1926, and he moved his shop
to San Jose, Calif., to transform it into a full-line dealership in 1933.
What Sifton lacked in timing he made up in resourcefulness. While most motorcycle dealers
were selling one or two bikes a year, he kept the doors open by servicing police motorcycles.
Sifton’s 1933 expansion was beyond bold. The motorcycle market virtually froze in
the 1930s, with Harley-Davidson production dropping by 81 percent between 1929 and
1933. A Fresno H-D dealer did not sell a single motorcycle in 1933, and the entire Harley
experimental department was consolidated from a large force to just one man.
Sifton’s moves paid off in the long run, and he went on to found a highly successful
motorcycle performance company, Sifton Motorcycle Products. Innovation in the face of long
odds worked for him, and his engineering genius overcame the times. The same can be said
for H-D during this time. Today, both H-D and its vendors face economic uncertainty, but
remembering lessons they have learned in the past can reveal paths to the future.
Harley-Davidson survived the 1930s with a mix of dedication, ruthless marketing of
clubs and racing, circus sideshow training programs, a fl ash of style, and engineering
prowess. As the times turned from bad to worse, the company worked hard to minimize
the impact on its employees, the company fostered a family atmosphere, and the leaders
took care of their own.
“Basically, Harley-Davidson spread the pain,” says motorsports author Jerry Hatfi eld.
“They cut everyone’s working hours and cut wages. They did both at least twice. In one
round they cut everybody’s pay 10 percent, except the top four, who took a 20 percent cut.”
The top four were, of course, Bill Harley Sr. and the three senior Davidsons.
Author Herbert Wagner chronicled the tale of Joseph Borgen, who was working in the
riveting department at H-D. Borgen would come in to work and, if he could scrounge up
parts, he could rivet components. If not, he was sent home. “My paychecks kept getting
smaller and smaller until fi nally it got down to 92 cents for two weeks’ work,” Borgen told
Wagner. “I’d have framed the check if I didn’t need the money so bad.”
While wages today are clearly more generous than those paid in the ‘30s, the cuts are
no less painful. Roughly 850 people lost their jobs at the manufacturing plant in York, Pa.,
and more cuts are anticipated for 2010.
At the dealership level, similar cuts have been necessary. At the House of Harley in
Milwaukee, manager John Schaller faced just such a dilemma when he needed to cut
someone from his fi ve-person MotorClothes division. When he told his employees about
the dilemma, they came up with the idea to scale back to 32 hours so that all fi ve could
stay on. The numbers worked, Schaller agreed, and a job was saved. “Our people are the
key to our success,” Schaller said. “Unselfi sh is the best word I have to describe them.”
Another way that Harley-Davidson dealt with the Great Depression was with Knuth’s
Kollege, a heavily-promoted motorcycle maintenance training program. Ring-led
by “Hap” Jameson, a well-known writer for The Enthusiast and a popular emcee at
motorcycle events, the training was a mix of a sideshow circus and information riders
desperately needed.
Today’s crop of riders is more in need of ride training than how to fi x their bikes. While
H-D has not invested as much effort into new programs, the Rider’s Edge safety training
program is helping keep dealers profi table and riders’ rubber side down.
Before 1930, H-D’s international sales were huge; the domestic market simply didn’t
purchase very many motorcycles, particularly because Henry Ford’s cars cost less and
16 April 2010 www.MPNmag.com
were more practical. Overseas sales made up 55.5
percent of H-D sales in the mid-’20s. Harleys were
particularly popular in Australia and New Zealand where
the rugged machines were the preferred two-wheeled
mode of transportation.
In the early ‘30s, not only did The Motor Company’s
domestic sales tank, but several foreign countries imposed
import taxes as high as 50 percent. The result was a
double-whammy of sales contraction. Opening the domestic
market was paramount for H-D to fi ll the void. One of the
tactics the company used effectively to sell motorcycles into
the fl at 1930s market was to encourage clubs and amateur
competitions. The founders reasoned that if they could get
Americans involved in the sport, they would sell bikes as
well as parts. Clubs and amateur racing accomplished this
goal nicely. H-D ruffl ed a few feathers with the way they
strong-handed the American Motorcycle Association racing
rules to favor their company, but they also not only were
able to grow, they also steadily took market share from
arch-competitor Indian.
For Harley in the 1930s, the loss of overseas sales
meant opening the domestic market was key. In current
times, the domestic market is about as mature as
possible. The bikes are a cultural icon. While perhaps
not everyone who wants a Harley-Davidson owns one,
creating more demand is limited primarily to fi nding
ways to fi nance buyers.
Craig Kennison, an analyst at Milwaukee’s Robert W.
Baird & Co., watches H-D’s fortunes closely. He refl ected
on Harley-Davidson’s interest in increasing foreign sales
during our economic downturn..
“Harley is not interested in surviving the recession,”
Kennison says. “It plans to roll with the tough times and
come out stronger. That means cutting production to get
inventory in line, addressing its cost structure to compete
in a smaller market, and building on the worldwide appeal
of the Harley-Davidson brand.”
Curb appeal increases with style. The Motor Company
did just that in 1933 by dumping the line’s dark green paint
in favor of Art Deco colors and logos. Today, the company
has livened up the line with its dark line of machines.
Bikes like the Crossbones, Rocker, and the Forty-Eight
bring a look that appeals to the younger demographic the
company needs to attract for long-term survival.
These style-conscious changes were aimed at the do-
mestic market, but Kennison adds that stylish bikes will
need to be part of Harley-Davidson’s strategy overseas.
“Harley has a big opportunity in Europe, where its
share is close to 10 percent — but it has to get the
product right,” Kennison says. “The XR1200 it a step
in that direction. We expect faster growth in emerging
markets where Harley is an aspirational brand for
consumers accumulating new wealth. Brazil, South
Korea, and South Africa are hitting that infl ection
point. Over the next decade or more, Harley will expand
in China and India, but it has only a handful of dealers in
each market today.”
Author Dantar Oosterwal was the director of product
development at H-D from ‘97 to ‘06. The MIT-educated
engineer oversaw creation of several innovative new
products including the V-Rod. Oosterwal wrote The
Lean Machine, a book about his experience bringing a
management and manufacturing philosophy called “Lean
Product Development” to H-D.
“Tank graphics helped Harley-Davidson get through
the Great Depression,” Oosterwal says, “but new product
got people back into the dealerships.”
In 1930, H-D introduced the sidevalve-engined
VL as an intended corporate savior. The engine was
prone to failure. The company regrouped and, in 1936,
introduced the overhead-valve sixty-one, better known
as the Knucklehead, and it was this shining new piece of
technology which helped propel H-D out of the Depression.
“I fi rmly believe that what drives companies is new
product,” Oosterwal says. “The people at Harley are top-
notch, and I know they have products in place to ensure
their success.”
Oosterwal wouldn’t elaborate on the innovations
lurking in the engineering department, though.
Whatever new product cards Harley holds, the
turnaround in the market appears to be arriving, as
sales for 2010 are up from the dreadful 2009.
The company has thrived from the very beginning
by smart cultivation of hard-working folks selling their
products. “A major part of Harley-Davidson’s success [in
the ‘30s] was an outstanding dealer network,” Herbert
Wagner wrote in Harley-Davidson 1930–1941. The company
pressured dealers to sell only Harley-Davidson and then
supported them strongly.
Their dealer network was founded by guys like Frank
Ulicki, a barrel-chested weekend racer working for
a Harley dealership in Kenosha, Wis. When Frank’s
boss was presented with an opportunity to run another
dealership in Ohio, Ulicki was given the chance to
take over the helm. He agreed, but he had to meet
personally with Arthur Davidson before being allowed to
“When Harley-Davidson encouraged
competition, racers who participated in
fi eld events, hill climbs and TTs bent a lot
of parts. Parts sales provided a steady
income for Harley dealers and the factory
during the lean Great Depression years.”
— Herbert Wagner,
author of Harley-Davidson 1930–41
www.MPNmag.com April 2010 17
purchase the place. He passed the test, and
forked over about $250 to buy what is now
Uke’s Harley-Davidson.
Frank’s grand-daughter, Brenda Ulicki,
says the stories about the dealership’s
Depression-era survival are legend at her
dinner table. “His fi rst sale on his fi rst day
was a nut he sold for four cents,” she says.
“Times were tough, but he supported his
family with the dealership.”
Frank went on to become a successful race
promoter and owner of a likewise successful
dealership. He fed his family through the
economic crisis and beyond.
House of Harley-Davidson’s Schaller can
relate. He’s upbeat about his facility’s sales
growth in the past few months and says that
House of Harley continued to be profi table
throughout the past few years.
“Recession brings opportunity,” he says.
“You adapt or you fall behind.” His dealership
has worked hard to keep people coming in
the door, doing everything from selling parts
on Amazon and eBay to making sure that
customers who walk in the door are treated to
good cheer and fi rst-class service.
Schaller is proud of his group’s accomplish-
ments, and he appreciates that success in the
current environment is not a given.
“I truly say ‘thank you’ when I go to sleep each
night,” he says. “I can’t say I got to sleep quickly.”
Herbert Wagner believes that the Great
Depression helped H-D focus on its core
market and develop a great product. “For
all its agony, the Great Depression may
have been a blessing in disguise for Harley-
Davidson,” Wagner writes. “The years
of coasting on the export market while
neglecting the American enthusiast brought
the chickens home to roost.”
While the economics of The Motor
Company’s current situation are less dire
than those it experienced 70 years ago,
they are more complex. Financing, union
labor, and changing demographics are all
challenges the company will have to meet.
But it all comes down to product, and
innovation on that front requires more than
sexing up the line with fl at black paint and
crinkle-fi nish cases. Skin-deep improvement
got the company through the worst of the
Great Depression, but true innovation in the
form of the 61 OHV Knucklehead was required
to save the company in 1936. In order to stay
competitive, the brand that made Milwaukee
famous will need to take that hard-won history
lesson to heart. v
“The cumulative effect of Harley-Davidson’s
cuts in the 1930s was a 30 percent
reduction in offi ce salaries except for the
four offi cers who experienced a cumulative
cut of 50 percent.”
— Jerry Hatfi eld, author of Indian Motorcycles
and Flat Out: The Rollie Free Story
www.MPNmag.com April 2010 19
OO ffering so much more than helmet-
to-helmet communications, today’s
high-tech communication devices
integrate a multitude of sophistocated
systems, including cell phones, MP3 players,
GPS navigation and just about any Bluetooth
goodie today’s tech nerds can concoct. While
some may argue that the whole reason to
get out on your bike is to unplug from the
world around you, there may be nothing
more freeing for a rider than to be able
to make his 9 a.m. conference call
in the saddle instead of from some
boardroom. Kit out your selection
of communication aids with this
selection of six go-to gadgets.
20 April 2010 www.MPNmag.com
BikercomBikerCom wirelessly enables rider-to-
passenger communication and offers the
fl exibility to connect a mobile phone, two-way
radio, navigation device, radar detector and
audio player. This unique system uses innovative
Bluetooth technology and gives riders the
freedom to connect with wires or wirelessly. The
unit retails at $749, and while the company is still
looking for a U.S. distributor, you can stock up online.
www.bikercom.com
BT1Ever play biker charades? You know that game of pointing,
nodding and inaudibly shouting with your spouse on a ride?
The BT1 Rider to Passenger communication system makes
chatting simple, no pointing or prodding required. The
rider unit connects to a Bluetooth device or it can connect
to non-Bluetooth devices by auxiliary cable. The passenger
unit is intercom only, and the pair gives riders up to eight
hours of usage. The weather-resistant microphones are
noise cancelling while Automatic Gain Control speakers
round out the system, which retails at $289.95.
www.marshalldistributing.com
BlueAnt WirelessBlueAnt fi rst introduced the Interphone F4 in December.
Easily attached to either full-faced or open-faced helmets,
the fully weatherproof, water-resistant Interphone F4
incorporates stereo capability and differentiating voice
technology so bikers can enjoy wireless entertainment
and mobile phone communication on the road. The F4 will
pair with up to eight Bluetooth devices and multipoint
technology allows the F4 to connect to two phones
at once. Additionally, bikers can listen to turn-by-
turn directions from motorcycle-friendly Bluetooth
GPS devices and enjoy up to 10 hours talk-time
— answering calls with a simple “hello” — and
up to 700 hours of standby time. The Interphone F4
communication system is supported by BlueAnt’s committed
customer service program and a two-year warranty.
www.blueantwireless.com
-
the
wo-way
r and
innovativeinnovativ
the
lessly. The
pany is still
stock up online.
BlueBlueAn
Easily
the ful
incorpo
hno
mu
stom
www.b
me of pointing,
on a ride?
make
obile
pair with
technolog
at once
turn d
GPS
—
t
echnolo
o connect wit
ails at $749, and wh
ng for a U.S. distributor, yo
ww.bikercom.com
inc
techno
and mo
p
up
comm
cust
w
www.MPNmag.com April 2010 21
ChatterboxThe Motocam360 GPS Rear Vision
System paired with the XBi² allows a
rider to load his favorite MP3s on an SD
card used for mapping navigation. The
system will provide hours of musical
entertainment via the wireless Bluetooth
link from the GPS unit to the Xbi² helmet
receiver! The Bluetooth feature can
also be used for turn by turn directions
from the GPS navigation. A maximum of
three Xbi² can be set up on the same broadcasting
channel for rider-to-rider communications up to
500 meters away.
www.motocam360.com
VCANVCAN Sports has unleashed the fi rst ZERO model helmet,
the V600. The V600 is a full-face, DOT approved helmet,
including top and chin ventilation and an adjustable
face shield. It comes standard with the ZERO Bluetooth
module, which allows the rider to take and make
cell phone calls and to listen to music via A2DP MP3
technology, all for a very affordable $99.99.
www.vcansports.com
Cardo SystemsCardo Systems’ new Scala Rider G4 bike-to-bike Bluetooth headset offers
compatibility with any number of Bluetooth-enabled devices with its embedded
FM radio, mobile phone support and voice activation. The G4 is also the fi rst
Bluetooth headset to offer group intercom among up to three riders, as well
as communication among two riders and their two passengers on two bikes at
distances up to one mile. Encased in a rugged and fully redesigned form factor,
the G4 gives the user access to all of their compatible communications and
entertainment through one lightweight unit.
www.cardosystems.com
Ch tt b
der G4 bike-to-bike Bluetooth headset offers
er of Bluetooth-enabled devices with its
ort and voice activation. The G4
roup intercom among u
o riders and th
cased
ccess
one li
ers
th its embedded
he G4 is also the fi rst
ong up to three riders, as well
and their two passengers on two bikes at
ased in a rugged and fully redesigned form factor,
to all of their compatible communications and
ghtweight unit.
www.MPNmag.com April 2010 21
et,
22 April 2010 www.MPNmag.com
www.MPNmag.com April 2010 23
W here the interstate ends,
adventure begins, and
riders of all ages and
experience levels yearn to escape.
Create gear checklists for all types
of touring, and share them with
every adventurer that walks in your
door. If he's heading for a 200-mile
weekender, his needs will be vastly
different from the rider embarking on a
transcontinental trek. Stock the goods
to outfit every traveller and you'll
reap some serious coin this touring
season. Start your stocking list with
this collection of luggage and apparel.
Round it out with MPN's online Buyers
Guide at www.mpnmag.com.
24 April 2010 www.MPNmag.com
FlywThe Fly Racing Milepost sport touring boot is loaded with comfort and
protection at an affordable price. Premium features include a waterproof
membrane, breathable Airweave interior, comfortable leather construction,
removable/replaceable comfort insoles and E-Z Walk soles. The $109.95
boot has built-in ankle, shin and toe protection, along with shifter wear
protection and refl ective safety striping on the rear. The result is a
waterproof and breathable sport-touring boot for all riding conditions.
www.fl yracing.com
vJoe RocketJoe Rocket’s tried and true Ballistic series evolves yet again
with the 8.0, which the company brands as “the ultimate
environmental control system for your ride!” The 100
percent waterproof jacket features a resistant Rock Tex
600 outer shell; CE-rated armor in shoulders and elbows;
removable spine pad with pocket for optional CE spine
protector; and a removable insulated full sleeve liner.
Perhaps the most impressive feature is the patent-pending
BigAir Waterproof ventilation system — A 20-inch-by-4-inch
FreeAir mesh panel integrated into the main zipper.
www.joerocket.com
vFirstgearThe Kenya boasts an outer shell made of Hypertex
waterproof and breathable, high-density, 600
denier polyester for abrasion resistance. It keeps
the rain out, but allows humidity to escape.
Protection includes CE-rated armor in the
shoulders and elbows, plus an EVA foam back
pad. The $249.95 jacket gets a whopping eight
exhaust options, and the main front, two-way
YKK zipper is shielded from moisture by a
double storm fl ap with rain gutter held in place
by hook-and-loop closures. For a custom fi t,
adjustments can be made to the waist, sleeve
cuff and collar with hook-and-loop closures.
www.fi rstgear-usa.com
d w
inc
le l
k s
g w
The
rid
with comfort and
clude a waterproof
leather construction,
oles. The $109.95
with shifter wear
e result is a
ding conditions.
24 April 2010 www.MPNmag.com
www.MPNmag.com April 2010 25
CortechwCortech’s Super 18-liter Tank Bag boasts a 1680 denier ballistic
polyester construction; protective non-slip, non-scratch base;
expandable main compartment; top fl ap internal organizer; soft
tricot lining; hideaway backpack strap set-up; and an internal
removable shield tote. The features don’t stop there as the bag
also gives riders a Clear-Vu removable map pocket; easy access,
external eyeglass case; Media Center personal media pocket;
and a built-in sip tube and headphone exit ports. The laundry list
is topped off with an integrated stowaway rain cover.
www.cortechperformance.com
vCorbinCorbin's Beetle Bags are designed
for specifi c bike models, so they
emulate the visuals of the bike
and integrate perfectly. Lines and
details of the OEM bodywork are
incorporated into the shape of the
bags to create a very balanced look
and disguise the generous storage
capacity. Corbin's saddlebags are
specially engineered for each motorcycle so they fi t the
profi le of the bike, and this enables the bags to carry the
weight of the contents closer to the centerline of the bike and
maintain balance. This also provides a smaller overall width
for less wind resistance.
www.corbin.com
tGIVIThe new GIVI monochrome Tech series is designed to offer
the functionality and style of a large top trunk without
detracting from a bike's styling. Supplied with smoked
lenses and dark trim, the Tech series has produced a truly
integrated top trunk solution. Both the V46 and E55 Monokey
series cases are capable of taking two full face helmets
and have an available back rest, top rack, brake light and
inner bag option. The V46NT retails for $273, and the E55NT
version retails for $340.
www.giviusa.com
u FirstgearThe $169.95 Laguna saddlebags expand from
1,805 to 2,166 cubic inches. Non-abrasive, non-slip
material on the exterior inward-facing sidewall
protects your customer's ride, and a heat-resistant
base helps protect the bag from contact with
exhausts. Double pull, top access zippers provide
easy access to contents without gear falling out,
and a light colored inside liner makes fi nding
items easier. The sidewall and base are reinforced
for strength and shape retention, and plenty of
external pockets make organization a snap.
www.fi rstgear-usa.com
www MPNmag com April 2010 25
26 April 2010 www.MPNmag.com
OlympiawWhether touring, dual sport riding or daily commuting, Olympia
Moto Sports four season X Moto jacket is ready for any challenge. Its
Mega Vent Panel System allows the X Moto to transition from solid
body to adjustable airfl ow construction in seconds, as its front, back
and underarm vent panels zip down and fold neatly into self storage
pockets. A zip-off integrated back pack with hydration bladder and
expandable zip-off luggage system offer major versatility. An authentic
cordura shell with 2000 denier cordura reinforcement ensures
maximum abrasion resistance. The X Moto is also equipped with a
sporty, waterproof/breathable, two-stage, Thermolite insulated liner
to deliver multi-season, all-weather riding comfort at $429.99.
www.olympiamotosports.com
vPower TripThe 100 percent waterproof Dakota II not only
features removable CE-rated armor, but it also has
what the company boasts as the most aggressive
ventilation in the industry: the patent pending BigAir
system. An 80-square-inch FreeAir mesh pane is
integrated into the main zipper. Once open, the
SureFit adjustment system keeps the outer zipper
panels snug to prevent fl apping when riding. Seen
here in its women's iteration, the Dakota II also
comes in a men's cut; both retail for $169.99.
www.power-trip.com
vNelson RiggDon't let your customer embark on his journey
without the proper rain protection. The VTL-700
Volante two-piece rain suit is made using a 100
percent wind/waterproof, trimax nylon/PVC that
makes this all-season suit waterproof even in the
harshest conditions. The jacket features adjustable
zippered ventilation, elasticized belt and cuffs for a
perfect fi t, and refl ective safety striping. The pants
sport adjustable suspenders, heat-resistant leg
panels and large 17-inch zipper gussets with stirrups
for easy boot entry. There are also two large outer
pockets and one inner zippered pocket for convenient
storage. Sized small to 4XL, the $89.95 suit has a “no
hassle” 24-month warranty.
www.nelsonrigg.com
26 April 2010 www.MPNmag.com
www.MPNmag.com April 2010 27
Joe RocketwAn industry leader in motorcycle apparel, Joe Rocket also knows
a thing or six about luggage; the company has six sportbike-
specifi c luggage selections, to be exact. In each luggage
model, expect the same innovative designs for which
Joe Rocket apparel is known, from the versatile
Space Pak 2.0, which can hold a spare helmet,
to the minimalist, stylish and sleek Manta
XL Tank seen here.
www.joerocket.com
tMustangMustang’s new line of Nostalgic Luggage is durably constructed
and completely covered in high quality, expanded black vinyl to
complement Mustang seats. Mustang’s Journey Bag offers a
classic look with surprising capacity, handling extended trips
with ease. The total storage capacity, including the three side
compartments, is 3,744 cubic inches. Whether mounted on the
passenger seat or a luggage rack, the combination of the semi-
rigid construction and the integrated adjustable backrest provide
ample lumbar support. Mustang’s Journey Bag with chrome
studs is $199; without studs it runs for $189. The Journey Bags
include a free rain cover for added protection.
www.mustangdealer.com
uMarshallTwo-wheel travel isn't limited to massive
touring units. The scooter crowd has been
known to hit the open road, and this Scooter
Travel Trunk adds the extra storage space
necessary for overnight jaunts. Constructed of
strong ABS plastic, Marshall's Scooter Travel
Trunk's top lifts open from a hinged rear. The
lock will help keep valuables safe, and the
package comes complete with all mounting
hardware, lock and two keys.
www.marshalldistributing.com
v Nelson-RiggThe Triple Threat Mounting system is new for 2010, and it now
comes standard on all Nelson-Rigg bags. With the purchase
of any three additional but inexpensive mounting kits (starting
at $12.95), riders can convert each bag to mount in a number
of different ways. Any of the bags in this line can convert to be
used as a strap-, magnet-, or suction cup-mounted tank bag,
or the same bag can be used as a tail pack. All mounting kits
are quick release and fully interchangeable. With this versatile
systems, riders don't need to own an arsenal of different
luggage to suit their changing needs.
www.nelsonrigg.com
g
uMarshallllllll
28 April 2010 www.MPNmag.com
River RoadwRiver Road says its waterproof,
breathable, 3⁄4-length, heavy-duty nylon
Taos jacket knows no boundaries. It
gets a two-way front zipper covered by a snap-down external
storm fl ap. Venting comes from two front shoulder intakes
and two rear vertical exhausts protected with high quality
waterproof zippers. Its removable, insulated, fully-sleeved
liner has a built-in pocket for most mobile devices, and high
quality and fl exible CE-approved armor is used on shoulders
and elbows for protection. Two chest storage pockets, protected
by waterproof zippers, and two lower front pockets with snap
closure offer plenty of storage space.
www.riverroadgear.com
ShifttWhen the going gets tough what rider would think of
turning around? Shift says its Trooper Storm series textile
jacket is up to any challenge with its 600 denier polyester
fabric construction, articulated design for superior comfort
in the saddle and removable CE-approved shoulder
and elbow armor for impact protection. Its waterproof,
seam-sealed mid-liner keeps riders dry in wet riding
conditions, while waterproof zippered front shoulder and
rear exhaust vents allow riders to control airfl ow based on
riding conditions. This $229.95 jacket comes in black camo
(pictured), desert camo and orange.
www.shiftstreet.com
uRoadkromeThe new Roadkrome Defender Textile Jacket is
constructed of a durable 600 denier cordura and
168 denier nylon balistic mix. Inside, riders will
fi nd CE-approved shoulder and elbow protection,
as well as a breathable and waterproof liner and
a removable thermic liner. Available in sizes
medium to 5XL and retailing at $179.99, the
Defender is a sure seller this touring season.
www.nhjpowersports.com
www.shiftstreet.com
www.MPNmag.com April 2010 29
SaddlemenwSaddlemen’s BR1800 Dresser Back Seat or Sissy Bar Bag can either be
used as a sissybar bag or as a back seat bag, set between the rider and
tour back on dresser style motorcycles. The bag includes two mounting
systems: a seat harness or an adjustable sissy bar strap system that
easily attaches the bag to a motorcycle's seat, luggage rack or sissy bar.
Detachable backpack straps make for easy off-the-bike jaunts, and its
spacious top-loading main compartment is large enough to hold one 3⁄4-helmet and other cargo.
www.saddlemen.com
River RoadwRiver Road's Rigid Zip-Off Saddlebags with Security
Lock offer riders a new two-number combination lock
for added security. Its synthetic leather looks so real
you’ll look twice, and it's UV protected to prevent wear.
The zip-off bags feature a quick-release and handles for
easy carrying. Rigid side walls and bases give the bags
strength and shape retention. The classic iteration retails
at $139.95, while studded bags ring in at $149.95.
www.riverroadgear.com
v RapidTransitThe Division Tail Frame Bag features a wind- and
water-resistant 1000 denier nylon shell and an
integrated tail frame/sissy bar mounting system.
It also has multiple expandable compartments,
a waterproof garment bag, and roll pack — it's
even backpack convertible. Riders can score this
loaded bag for $169.99.
www.rapid-transit.com
v RoadkromeThe Roadkrome Nashville Removable Saddlebag is made of Tek leather,
giving a black synthetic texture that looks like the real thing. Designed
with the rider in mind, the Nashville is a great choice for riders looking
for traditional style and lasting quality. All conchos, studs and buckles
are nickel chrome, and the back panels and sidewalls are reinforced. The
Nashville measures 19 inches long by 14 inches high by 6 inches wide and
retails at $269.99, plus an additional $249.99 for the chrome mounting kit.
www.nhjpowersports.com
30 April 2010 www.MPNmag.com
TyphoonwTyphoon cycle gloves
are constructed from
a deluxe washable
and waterproof
leather that stays
soft even after
repeated soakings.
Hands stay dry thanks
to the Aquatex waterproof,
breathable and windproof
insert. The Typhoon gets boxed
fi ngers and sidewalls for a relaxed
and comfortable fi t, and its longer
length fi ts snugly into a jacket
cuff. Adjustable velcro straps and a
reinforced palm round out this $49.95
glove's list of bells and whistles.
www.marshalldistributing.com
v Tour MasterThe Tour Master Centurion One-Piece Suit has
a 600 denier Carbolex shell with 1680 denier
ballistic polyester panels in the shoulders,
forearms and knees. It features an Aqua-Barrier
under-the-helmet hood to eliminate seepage
in the collar area. A waterproof and breathable
rainguard barrier allows rain protection without
perspiration buildup, and Carbolex accordion
stretch material increases fl exibility. Waterproof,
zippered three-position shoulder vents combine
with chest vents, adjustable under-sleeve vents,
thigh vents, rear exhaust vents and the Pipeline
Ventilation System for fl ow-through ventilation.
www.tourmaster.com
vScorpionPart of the extensive XDR (Xtreme Distance Rider) technical riding gear
series, the Fury jackets starts with a high-density 600 denier outer shell. The
full-sleeve EverHeat thermal liner keeps riders toasty in adverse conditions,
while the removable storm collar and waterproof/windproof inner shell pops
right out when conditions are less extreme. As riding conditions heat up, a
lightweight perforated nylon lining offers maximum airfl ow over the body’s
core. A connector zipper across the lower back ensures the matching
Hellina pant stays secure.
www.ScorpionUSA.com
u WildRiderWildRider Leathers black
leather chaps have an adjustable
front belt buckle and 2⁄3-length
zippers with snaps. The legs are
unhemmed, which makes it easy
to trim and hem as necessary.
Plain chaps retail at $101.02
while the fringed have a slightly
higher pricetag at $124.46.
www.wildrider.com
www.MPNmag.com April 2010 31
v SumaxSumax offers a wide variety of hard composite
fi berglass saddlebags. They are offered in stock width
and a 2.5-inch wider width with a choice of stock
or extended length. Models for '93 and newer Road
Glide, Electra Glide, Street Glide and Road King, along
with all-year Softail models, are available. Installed
LED lighting options plug into the rear harness. All
saddlebags have a fi nished rich charcoal trunk lining.
Brackets and mounting hardware are also available.
www.sumax.com
u WildriderLarge and jumbo size Wildrider Express Saddlebags
are universal, over-the-fender, slanted style
saddlebags and allow clearance for most turn
signals. Both sizes feature composite construction
and come standard with lockable roller buckles.
The $129.15 large gives riders more than 736
square inches of space, while the jumbo rings in at
$179.24 and offers a whopping 1,100 square inches
of storage. It also includes composite construction
with lockable roller buckles, and riders can opt for
decorative chrome studs on the face top cover.
www.wildrider.com
Tour MasterwThe Nylon Cruiser III Sissybar Bag offers riders heavy-duty, weather-
resistant 840 denier and 1000 denier nylon construction. The universal
mounting system expands from 6 to 14 inches and fits most styles of
backrests. A removable neoprene layer is included to protect the motorcycle,
and a hinged lid provides storage space and easy access to the main
compartment and zippered retractable floor. Dark colored reflective piping
and Tour Master’s reflective triangle provide nighttime visibility. Internal
support panels hold the shape of the bag when empty or full, and an
integrated rain/dust cover deploys from a small pocket on the top of the bag.
www.tourmaster.com
t Willie & MaxThe Revolution Series features an even wider range
of contemporary, fresh and edgy allure with the
recent addition of the Grommeted, Swooped and
Studded designs. All three are available in either
hard-mount or throwover styles. The exclusive hard-
mount system fits most cruisers on the market. The
hard-mount bags feature injection-molded backs
contoured to fit the mounting system, and rock-solid
adjustable brackets and hardware. Revolution’s
throwover style bags have reinforced backs to
provide superior stability, as well as reinforced yokes
for secure universal mounting above or below the
seat. Zip-off yokes and carry handles make removal
and transporting a breeze. MSRP starts at $179.99
for the throwover versions and runs up to $319.99 for
the hard mount versions.
www.willieandmax.com
32 April 2010 www.MPNmag.com
WHAT ARE WE HIDING?Celebrating the sales process
The encounter I’m
going to relate showed
some very strong ele-
ments of a great sales
process. I saw a well executed
sales procedure, evidence
of good sales training, good
salesmanship and good sales
management systems.
I think the thing that hit me
the hardest was the fact that
the people in this company
were so open and honest
about their sales procedure,
as though they had nothing to
hide. This openness allowed
me to let my guard down as
a customer. I knew they were
trying to make a sale, and I was
perfectly okay with it.
Allow me to set the scene:
One of our clients has a rather
disjointed cashiering system; I
am also aware that an unnamed
chain of music stores has an
excellent system, so I went
into one of their stores near
my house to check it out. The
following is an account of what
I experienced when I walked
through their door. Remember, I
arrived to simply observe.
Within a matter of seconds,
I was greeted by half a dozen
smiling faces, all equipped
with a warm, friendly, natural
sounding but uncannily similar
greeting. I was asked by one
particular employee if I had
come in to look at anything
specifi c, and when I responded
that I hadn’t, he announced
that he would help me get my
bearings by giving me a quick
tour of the place. We ended up
in the pro audio room where
they keep all the big sound
reinforcement systems. The
salesperson again announced
his intentions and sort of set the
agenda for what was next by
saying, “Let me give you a few
minutes to look around, and I’ll
be right back to help you with
any questions.”
I thought his whole approach
was really very cool. He simply
told me through his words and
actions that he knew what I was
there to do, that it was his job to
help me do it and that he fully
intended to do so. This guy was
so comfortable with his sales
procedure that he was not only
not hiding it from me, he was
letting me in on it.
When he came back, he
asked me questions, he
listened to my answers, he
showed me a few things he
thought I might like based on
those answers, starting with
the lower priced stuff in the
category and then moving up
in price until the point when
I asked, “How much?” Then
he gave me a comprehensive
presentation of the system he
thought I liked the most and
calmly and unobtrusively asked
me to buy it. When I hesitated,
he simply asked me some
more questions, listened some
more and then formulated a
“Magic Question” (If I could,
would ya?) based on my
objections and asked me to buy
again by using that question.
He was operating so naturally, I
was blown away. I wanted one;
he wanted me to have one; he
made no bones about it.
When I looked to Mrs. Hackett
for approval and got none, (you
married guys know the look!)
I told him that we would have
to wait until I got home from
my next road trip before I could
fi t it in the budget. He then
announced that he would like to
put me into his follow-up system
so that he could get in touch with
me when I returned.
Again, he had absolutely
nothing to hide from me.
He even took me behind the
counter and explained how their
follow-up system worked as
he entered my information into
the computer. It was designed
much like our day planner
system in that the manager
would help determine the next
action to be taken, hold daily
meetings with each salesperson
to help them plan how to best
complete those actions and
get reports as to how each
customer was treated, how far
they got through the buying
process and what the fi nal
results were. Now, the coolest
part: He did all of this before
he knew that I was in sales
training; once he found that
out, he made absolutely no
changes in his approach. He
was so confi dent with his sales
procedure, that he was okay
with me knowing that he was
working a sales procedure.
I think the reason I could
see what was happening was
because he had no reason to
hide what was happening. He
was trying to help me get the
sound system I wanted, so
what’s to hide? By showing me
his follow-up system, he was
telling me that he wanted me to
have one when I’m ready, and
when I am, he wants me to buy
it from him. And it was working!
My wife and I wandered
around the showroom for a
few minutes trying to fi gure
out a way to shuffl e some
money around to make this
thing happen. I know this
doesn’t sound like anything too
remarkable, but let me remind
you of something: I went in the
place to observe a cashiering
system, and suddenly I was
trying to buy a sound system.
As salespeople, all too often
we try to hide the fact that we
want the customers to buy
something from us. What these
guys did so amazingly well was
what I try to preach all the time:
He wants one and I want him to
have one. So why do we try to
hide the fact that we want our
customers to have one and that
we have a process for helping
them get one? Is it just me? t
Otis Hackett is the founder of Otis
Hackett Group. OHG provides
general management services for
powersports dealers across the
U.S. The OHG team brings real-
world experience, having all been
motorcycle dealership employees
working on the front lines of
the industry every day. Click on
www.otishackett.com or e-mail
otis@otishackett.com. Join us on
Facebook or follow us on Twitter!
w
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
HackettHOW TO
BY OTIS HACKETT
Washington
Oregon
Nevada
Idaho
California
Utah
Arizona
Wyoming
Montana
Colorado
New Mexico
Texas
Oklahoma
Kansas
Nebraska
South Dakota
North Dakota
Minnesota
Iowa
Missouri
Arkansas
Louisiana
Miss.
Alabama
Georgia
SouthCarolina
NorthCarolinaTennessee
Kentucky
IllinoisIndiana Ohio
WestVirginia
Virginia
Pennsylvania
Michigan
Wisconsin
UP Michigan
New York
Maine
VT
NH
Mass.
Conn.RI
MD
DEL
NJ
Florida
DC
Boise
Fresno
Memphis
Elizabethtown
Boise, ID / Fresno, CA / Memphis, TN Elizabethtown, PA / www.wps-inc.com
34 April 2010 www.MPNmag.com
Chart 3 reveals P&A gross
profi t per vehicle sold is very
strong. This is due to reduced
unit sales and the focus on
maximizing P&A sales. I hope
this effort won’t be lost when
the market returns. Surveys
prove that customers who
purchase more P&A at the
time of the vehicle sale return
higher CSI scores.
The service end of the
business remains strong.
Dealers are learning to
concentrate on maximizing
technician work time and
eliminating non-producers.
As a result, the gross profit
is up.
F&I is weak due to poor
fi nance approvals and credit
limitations. Yet, this is an
importance profi t center; be
sure you have the strongest
performer you can fi nd in this
position — look for them now.
As you can see, it is not all
“gloom and doom” out there.
Last month we
looked at the 2009
year-end national
norm numbers. This
month, we’ll explore the year-
end numbers for the TBOC.
In chart 1 you can see that
these dealers were getting
close to 25% gross profi t and
actually showed over 2% net
for the year. This is primarily
due to the huge effort they
have made to get expenses in
line with benchmarks.
Chart 2 shows the effects
of reducing new motorcycle
inventory. Flooring expense
was still high. Advertising
was coming down as dealers
focused on shows and events.
ATVs and pre-owned sales
were areas of profi tability.
I’ve been extolling the virtues
of pre-owned in this column
for some time, and these
numbers show why it is
important to grow this area of
your business.
2009 BEST OPERATOR CLUB PERFORMANCE
Chart 1
Total Store Benchmark TBOC
Total store gross profi t 25% 24%
Total store net operating profi t 7% 2.1%
Total store selling expense as a percent
of total gross profi t25% 27.6%
Total store personnel expense as a
percent of total gross profi t36% 35%
Total store admin as a percent
of total gross profi t12% 13.3%
Total store facility expense as a percent
of total gross profi t15% 14.9%
Revenue change n/a -19%
Chart 2
New Sales Benchmark TBOC
New motorcycle gross profi t 17% 10.8%
New ATV gross profi t 16% 16.3%
New UTV gross profi t 14% 9.2%
New PWC gross profi t 15% 11.9%
Preowned Sales
Pre-owned motorcycle gross profi t 18% 21.3%
Pre-owned ATV gross profi t 15% 24.7%
Pre-owned UTV gross profi t 15% 22.8%
Pre-Owned PWC gross profi t 15% 11.9%
Sales Dept. Overall
Sales department’s personnel expense
per vehicle soldn/a 515
Flooring expense per vehicle sold 75 196
Total advertising and marketing
per vehicle sold75 91
Table 3
Parts Benchmark TBOC
Total parts and accessory gross profi t
per vehicle sold$525 $930
Parts margin 39% 35.6%
Accessory margin 34% 30.6%
Table 4
Service Benchmark TBOC
Service department labor margin 70% 74.5%
Parts sold to labor ratio 1 0.90
Table 5
Finance & Insurance Benchmark TBOC
Finance gross profi t per vehicle sold $500 $321
Finance net operating profi t
per vehicle soldn/a $131
Deals fi nanced 70% 38.1%
Service contract penetration 50% 22.6%
Pre-Paid maintenance penetration 30% 9.7%
Security system penetration 20% 7.9%
Financed deals with GAP protection 30% 11.6%
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY STEVE JONES
OperatorsCLUB
BEST
Note: TBOC: Top of the BOC is the average of top fi ve BOC members (based on store gross profi t)
www.MPNmag.com April 2010 35
dealer 20-groups. The TBOC data
comes from the groups that are
in the a real-time, web-based
data reporting system. National
Norms are compiled from the
groups that report in the former-
RPM data system.
Steve Jones, general manager
of GSA, outlines dealership best
business practices to boost
margins, increase profi tability
and retain employees. His
monthly column recaps critical
measurements used by the
leading 20-group dealers. GSA is
recognized as the industry’s #1
authority on dealer profi tability.
Dealers are making money
by controlling expenses and
hiring top quality employees.
As I have said before, there
is no reason to have “B”
and “C” players when there
are “A” performers looking
for jobs.
Track your numbers, keep
your inventory under control,
hire the right people and
provide exceptional customer
service. These are still the
keys to success. t
At GSA we track benchmarks
through our involvement with
Note: The Voyager 4 data reporting and analysis system
is available for any dealership to use for a very nominal
fee. For more information on GSA’s data reporting
system, dealer 20-groups, on-site consulting or training,
drop Steve an email at steve@gartsutton.com or visit
www.gartsutton.com.
Introducing the Cardoscala rider®
G4™
The bike-to-bike, longest distance, best sounding, talk to more friends at once scala rider
motorcycle headset yet!Features include:
FOUR RIDERSgers), THREE RIDERSbikes) or TWO RIDERS (bike to bike
STEREO music
com line of scala rider headsets**
Enjoy sharing
other riders on your Cardo
scala rider G4
* Results may vary according to terrain ** Reduced operational range when connected
with older scala rider models
C data
t are
ed
onal
he
rmer-
nager
best
ity
ical
SA is
s #1
ility.
m
al
ng,
www.mpnmag.com/resource
center
See page 50 for more
information about this
issue’s featured suppliers.
Check theOnline ResourceCenter
36 April 2010 www.MPNmag.com
EVIDENCE-BASED DEALERSHIP MANAGEMENT Use data wisely to increase your bottom line
If you didn’t read last
month’s feature,
“Motorcycle Business
Myths,” hop onto
www.mpnmag.com and
catch up — go ahead, I’ll wait.
This month’s column is part
two, and it’s time to discuss
customer intelligence.
Customer intelligence is
information about customers
and their purchases that helps
us understand and guide
consumer behavior, increasing
their interaction and loyalty
to our dealership. Following
are the “Five Ws of Customer
Intelligence.”
Who bought?
• Demographics: age, gender,
residence
• Psychographics: key
motivators
• Bike-o-graphics: what they
ride, how they ride, where
they ride
• How can we stay in touch
with them: cell phone
number and e-mail address
What products did they buy?
• Motorcycles: make, model,
year, color
• Accessories: show, go or
touring
• Riding gear: what and what
sizes
• Services: rewards program,
maintenance program, other
• Events attended: corporate-,
dealer-sponsored
When did they buy?
• Time of year: fall, winter,
spring, summer
• Seasonal event or holiday:
bike blessing, Christmas, etc.
• Weekend versus weekday
• Personal event or holiday:
birthday, graduation, tax return
Where?
• Online
• Telephone
• In store
Why did they buy?
• Need
• Want
• Whim
us to run reports giving us a
percentage breakdown of size
and gender, so that we have a
scientifi c approach to ordering
product for inventory.” Now,
that’s smart retailing.
Crucial to becoming a peak
performing dealership is
knowing who your customers
are, when, where and what
they buy. Understanding why
and how they buy just might
put you in the stratosphere of
high performing dealerships.
For many, the mind reels
when debating the endless
marketing and business
opportunities for the customer
intelligence suggested.
The challenge, of course, is
knowing how to obtain and
organize this information?
Really progressive retailers
use reward programs to
capture this information and
as profi t centers.
Evidence-Based Dealership
Management
To improve, you should be
using better, deeper logic and
employing facts to the extent
possible to permit leaders
to do their job better. Based
on the belief that facing hard
facts about what works and
what doesn’t will help your
dealership perform better now
and in the future.
Is this really a new
idea? Aren’t we already
practicing evidence-based
management? Unfortunately,
in most instances, the answer
to that question is no. People
do what they’ve always done.
When we believe something is
true, we look for information
to support it. And when you
don’t believe something,
almost no amount of evidence
can get you to change your
mind. That’s what makes
How did they buy?
• Cash
• Check
• Credit card
There are important and
obvious (and not-so-obvious)
insights that can be made from
this customer intelligence.
Obvious examples include:
• Service labor dollars are
down, target 4K mileage
customers for 5K service.
• Notice luggage rack
purchasers who didn’t
purchase luggage
• Track event participants for
next event
Less obvious observations
include:
• Realizing customers of a
given age display certain
buying habits
• Realizing people in a given
zip code have certain buying
tendencies
• Realizing people of a given
age in a particular zip
code have certain buying
tendencies
“For us, gear sizes are a key
component of our customer
information,” a dealer I
recently spoke with said.
“We capture size specifi cs
for pants, shirts, jackets and
shoes. Then we identify slow
and non-moving inventory and
e-mail special opportunities
to customers whose sizes
are in stock. This appeals
to them specifi cally, and, as
opposed to sending a mass
mailing to all of our customers,
it protects us from being
seen as a spammer. It also
protects us from disappointing
customers for whom we don’t
have a particular size in stock.
A side benefi t of capturing
both gender and size allows
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY MARK RODGERS
DealershipPERFORMANCE
PEAK
www.MPNmag.com April 2010 37
the execution of this idea so
daunting and not for the weak
at heart. In an interview from
CIO Insight, Robert Sutton,
one of the authors of the book
Hard Facts, talks about why
managers don’t often look for
contrary information.
Sutton writes, “There’s
a whole term for it called
‘escalating commitment to
a failing course of action.’
If you look at the conditions
under which it happens, a
lot of times managers make
a public commitment to a
course of action and spend a
lot of resources. They mobilize
a whole base of support
around it, and their medium-
term fi nancial well-being is
dependent on it.
“At that point it’s very
hard to pull the plug and to
convince others they should do
so. The thing to do is to build
in organizational checks and
balances so you’re allowed to
question things and allowed to
fi ght such projects.”
You can probably name
several examples of an
“escalating commitment to a
failing course of action” within
your dealership. So how do
we develop our thinking and
subsequently make decisions?
Where do we come up
with notions like “racing is a
great promotional tool,” or
“commissions are the only way
to drive salespeople”?
Sometimes we get an idea
from a book or an article
that we’ve read, or we hear
someone in our dealer
association or our 20-group
suggest it. Occasionally
we take the advice of a
consultant. Sometimes we
take actions based largely
on fear (we have to discount;
if not customers won’t buy) or
from the actions of our peers
(everyone is discounting; we
should too). Still, on other
occasions we let hope rule the
day; we hire a superstar and
cross our fi ngers they will get
us out of a jam. Or we develop
an opinion based on perceived
expertise (we have a couple of
car guys in our 20-group, and
they say …).
I’m not saying these are
not great places to develop
ideas for various performance
interventions. I’m simply
proposing you don’t accept
them as gospel until you
have tested your execution or
interpretation of an idea for a
policy or program.
In next month’s column,
we’ll tackle those tests and
move one step closer to
debunking the motorcycle
business myths that are killing
dealers across the country. t
An award-winning author, top-
rated trainer and founder of
Peak Dealership Performance,
Mark Rodgers holds a master’s
degree in adult education and the
National Speakers Association
Certifi ed Speaking Professional
designation — only 500 people
in the world have this coveted
recognition. Contact Mark@
PeakDealershipPerformance.com
to improve your performance.
Mark RodgersPeak Dealership Performance® Newsletter
Sometimes funny. Sometimes irreverent.Always insightful.
Sign up today!
www.PeakDealershipPerformance.com
38 April 2010 www.MPNmag.com
have been into your dealership
before are clearly the most
likely to visit you again. Studies
repeatedly show that it costs
signifi cantly more money to
get a new customer in the door
opposed to those who’ve already
shopped with you before. This
database style marketing will
get you more bang for your buck
than anything else in terms of
promoting your upcoming open
house event. Perhaps a multi-
step e-mail, direct mail, and
telemarketing campaign is all
you need to do to drive traffi c to
your store. If time or budget is a
concern, you could always drop
the direct mail and just do a two-
step drip e-mail campaign with
a follow up phone campaign.
Once you’ve determined your
external media, it’s time to look
at all of the hidden marketing
assets within your dealership
that you can leverage to make
your event a success. Internal
signage in the restrooms and at
the parts and service counters,
event fl yers stuffed in every
merchandise bag, personal
invitations from your staff to
each and every customer, an
updated website and updated
on-hold message are all
important here.
The more poles you have in
the water, the more fi sh you’re
going to catch.
So maybe you aren’t
looking to celebrate national
plumbers day this April, but
maybe a Countdown To Spring
celebration will work just fi ne?
One thing’s for sure: The selling
season is short, and in this retail
environment, it’s time to walk
fast and take big steps! t
Having owned and operated four
dealerships in the Atlanta market,
Rod Stuckey knows fi rsthand how
hard it can be to get targeted
dealer information, so he founded
Dealership University. His
monthly column gives dealers the
lessons they need to learn to be
more successful.
been working on it during the
middle of February, right?
Well, maybe — it depends
on which media methods you
choose to promote your event.
If you prescribe to relationship
style marketing rather than
transaction style marketing you
may be able to pull something
together sooner than later.
I’m personally a big believer
in open house style events,
as they are great customer
affi nity builders. Plus, when
you drive traffi c to the store to
celebrate an event, it creates
excitement and sales begin to
happen as a by product of all
of the enthusiasm in the air.
With that in mind, it’s time to
look at the calendar and see
what upcoming weekend you
can fi nd in the next two to six
weeks to throw a nice size
shin dig. Once you’ve identifi ed
something on the calendar,
you can consider how your
event theme will tie into the
big day.
Next, check your ad budget
and see what you have available
to promote your event. This will
allow you to consider which
promotional media you’ll use.
Ask yourself if you are using the
most effective media to get your
message to the direct target
audience? Just to be clear,
when I say media method, I’m
referring to the overwhelming
range of choices you have to
deliver your marketing message,
including everything from mass
media TV and radio to new age
media like web banners, e-mail
and texting.
Here’s something to consider.
If only 3% of households own a
motorcycle and you’re looking to
target that 3%, then you should
fi rst consider the media methods
that will allow you to hit that
niche directly. Obviously, if you
also prescribe to relationship
style marketing, the fi rst
place to look is your customer
database. Hopefully you have
a good one, as the people who
CELEBRATE SPRINGUse event marketing to score spring sales
What do April
Fool’s Day,
National Peanut
Butter and
Jelly Day, Good Friday, Easter,
National Reading a Roadmap
Day, World Health Day,
National Cheese Fondue Day,
Rubber Eraser Day, National
Cheese Ball Day, Earth Day
and Plumbers Day all have
in common? If you guessed
nothing, you’re almost right.
However, the one small
thing they do have in common
is being recognized by some
culture or sub-culture during
the month of April. So what
does this have to do with the
price of tea in China? We’re
talking about marketing
opportunities here.
The famous, late ad man
Robert Collier recognized value
in what he called “tapping
into the conversation already
going on in the head of your
customers.” The above list of
April events is just a sampling
of the number of events each
and every month of the year.
The Collier concept is about
substantiating your marketing
campaigns by explaining
why rather than doing it just
because. Any kind of holiday or
theme — whether related or
unrelated to our industry — is
a great excuse to reach out
to your customers. It’s also
a great way to make your ad
copy interesting and personal.
Unfortunately, too many times
dealers’ marketing message
are as plain as white toast.
On the other hand, new and
relevant information related to
the current time of year injected
with a little personality and an
attractive offer is much more
appealing to your prospects.
You’ve gotta make hay while
the sun shines, and the prime
selling season is here! What
better way to jump start your
season than by planning a solid
marketing campaign with the
right message, to the right target
audience, via the right media,
right now? However, here’s
the challenge: If you want your
campaign to launch immediately
and drive showroom traffi c this
coming Saturday, you should‘ve
y
W
w
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY ROD STUCKEY
LessonsLEARNED
www.MPNmag.com April 2010 39
Keep rocking with MPN enews.
Get in the know, and stay there with weekly updates.
It’s fast, it’s free, it’s digital.
Log onto mpnmag.com today and register.
Oh yeah…
and rock on!
RockOn
Get a FREE Test Ride
. COM
40 April 2010 www.MPNmag.com
IF THEY COME, THEN YOU CAN BUILD IT
for a minute and decided that
it had to indicate that more
people were working.
“What about credit turn-
downs? Have you seen an
increase?” I asked. The
answer was yes. This seemed
to justify my suspicions. “Think
about it,” I said. “I’m not sure
how excited we can be about
the increase in commuter
lot usage. You said that the
volume was really low a
year ago. Of course, with the
Chrysler plant closing, the GM
plant laying off and the vast
decrease in home building,
that makes sense. But, that’s
an awful lot of union-wage
jobs that were lost.
“First off,” I continued,
“those people spent a lot of
time out of work. That means
that they maxed-out their credit
cards and probably barely
stayed afl oat during the time
that they were unemployed.
I’m sure a great deal of them
ruined their credit. Second,
even though they’re back to
work now, they probably had
to take much lesser-paying
to spend money on. A guy
will purchase a new car if he
needs it. He’ll purchase a new
refrigerator or washer and
dryer if the old ones die — his
wife will make sure of that. If
the water heater or furnace go
on the fritz, you can bet that
he’ll write that check. But a
new ATV? Not so much.
So, while it’s not what
anyone wants to hear, I have
to remain skeptical about the
market growth in this season.
Yes, people are fi nding new
jobs here and there, but the
federal economic recovery
programs have been a huge
failure. High-paying jobs have
been replaced by low-paying
jobs, and, for those of us in
the powersports industry,
you can expect the “have-
to-have” industries to grow
sooner than ours will.
Of course, I’d love to be
proven wrong. But for now,
you may want to wait to regrow
your business until you notice
that you can’t handle the
increased volume, no matter
how many cars are stacked up
in commuter parking. t
Columnist William Douglas
Little writes from experience,
having built a multi-line
dealership from the ground up.
His store, Unique Powersports,
has earned accolades for
excellence in retail sales,
community involvement and
customer satisfaction. Little’s
debut book, Mexican Bowl
Fishing, was released in 2008
and is available at
www.WilliamDouglasLittle.com.
jobs. So, while they again have
money coming in, they probably
don’t have anything that’s
expendable. Sorry to be a buzz-
kill. What else do you have?”
I really didn’t want to
ruin Larry’s outlook on the
future, but, as you know,
in business we have to be
realistic. We can’t hire another
salesperson or stock up on
product in anticipation of
a traffi c increase that may
never happen. Hopefully most
of us have learned recently
that it pays to be proactive in
reductions and reactionary in
growth. Unlike Kevin Costner,
we must build it after they
come, not before.
In the past several months,
we’ve looked at all kinds
of indicators in search of
potential market rebounds.
Fluctuations in classifi ed “Help
Wanted” ads, the number
of homes that have sold in
the area, credit-worthiness
percentages, local car dealer
sales volumes, new business
openings and old business
closings — you name it, we’ve
tracked it. Unfortunately,
traffi c and sales numbers
have continued to be cyclic, no
matter what else seems to be
happening around us.
As I’ve told every
salesperson I’ve ever
hired, “There is absolutely
nothing that we sell in this
dealership that someone has
to have.” Let’s face it, we’re
in the business of fun. When
someone is coming out of a
hard fi nancial time, there are
certain things that they have
‘I’ve been watching,”
said Larry Davis, the
general manager of
my dealership. “The
commuter parking lots are
full again. Last January, the
lots were a third full at most.
Now, the lots are at least
two-thirds full. I’d say that’s a
promising sign.”
Larry and I try to meet up at
least once per week. I’ve been
busy with our other companies
and, to be honest, there hasn’t
been a fl ood of overwhelming
traffi c at the dealership, so
I’m pretty comfortable with
my trusted friend running the
show in my absence right now.
However, our weekly meetings
are a great way for me to
review the numbers with him,
discuss marketing strategies,
defi ne ineffi ciencies within the
company and identify areas of
missed revenue. This particular
meeting’s focus was primarily
to identify any trends that may
point toward the future.
Larry’s idea of watching the
commuter parking lots was
a good one. I thought about it
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY ROD STUCKEY
LessonsLEARNED
jjj
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY ROD STUCKEY– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
BY WILLIAM DOUGLAS LITTLE
PracticeWHAT YOU PREACH
42 April 2010 www.MPNmag.com
Spring riding season
will be in full swing this
month, and for many
powersport enthusiasts
the excitement of riding outdoors
and planning their adventures
is just one click away from
your website. Customers are
thinking about new apparel,
service, accessories, vehicles,
spring/summer events and so
much more. I’ve worked with
hundreds of dealers throughout
my years, and when spring
riding season arrives, there’s
a sense of excitement within
the dealership and within
customers that enter the store.
That excitement starts with your
website! You will see an increase
in visitors to your website in
the spring because customers
have a need or a want, and your
website should provide your
customers with information
that gets them excited to come
to your dealership for all their
powersport needs.
The job of your website is to
provide your customers with rich
content and current information,
so the call of action is the
customer wanting more. Just
sentence, I recommend “Spring
Apparel” as a link to a specifi c
catalog or section of your site
so customers can browse to
see the new product you have
at the store and online. Add
links where it’s appropriate,
and just remember never to
make your customers work to
fi nd additional information that
you’re promoting.
Proofread: Always proofread
your text for spelling and
grammatical errors. A customer
could interpret these errors as
your store’s lack of attention
to detail, and these errors are
simply unprofessional.
It can be a challenge to
add fresh content to the
site every month. However,
I recommend you get your
department managers involved.
I understand they already
have a lot on their plate, but if
they can spend fi ve minutes
every month putting together
a list of their announcements,
specials, department news,
tips and more, it can make
a huge difference. In your
monthly or weekly meetings
one of the topics should always
be the website, especially if
you’re discussing your monthly
marketing strategies. The more
people that are involved with the
site, the more you’ll get out of
the site. Everyone’s input at the
dealership helps create fresh
new content for the site! Just
remember the basics mentioned
above and keep it simple. Give
your customers what they want:
updated content about what’s
going on at your dealership.
Follow these tips and your site
will be a success. t
Peggy Olson is the president/
owner of Duo Web Solutions. She
has over eight years of experience
helping powersports and marine
dealers get more out of their
websites. Learn more about Olson
and Duo Web Solutions at
www.duowebsupport.com.
type faces are recommended
with titles or to highlight
something of importance within
your text, but that’s it. Keep it
simple. If you can easily read
the text and if your eye is drawn
to a section that’s highlighted in
a different color, that’s a great
setup. Keep it professional
looking and easy to read.
Keep focused and concise:
Always try to put the most
important information fi rst. If the
title states “What’s New at ABC
Dealership for Spring,” make
sure you start it off with one of
the main focuses to your title
to draw the customer in. Think
about the order of importance
when writing your text. Also,
remember to keep your content
concise and to the point,
especially if it’s content for the
homepage. Use keywords like
“Just In,” “What’s New” or “A
Must See” to help engage your
customers to read your text. If
there’s additional information
for a customer to read, add this
information to another page and
provide a “Read More” link.
Repeat without copying:
Repeating information in different
sections of the site is benefi cial,
however, try not to copy and paste
the exact same phrasing. Every
page should have some fresh
content, and if you do have the
same content on different pages
throughout the site, try changing
the title or intro text to vary your
content. This technique is also
good for the search engines.
Links within your content:
Linking to other sections of the
site is a great way to keep visitors
on your site browsing for more.
If you’re talking about a service,
vehicle, event or anything within
the site where you can access
additional information, create
a link within your content using
specifi c keywords. For example:
“New Spring Apparel Now
Available Online.” Within this
remember that your website acts
as a virtual customer service
and sales representative for your
dealership, and I guarantee the
majority of your customers are
coming to your website before
stepping foot in your store. I can’t
stress enough the importance
of having a website that not only
engages the customer but also
provides content of value.
Every month your site
should have a stream of new
and relevant content. Don’t
over-think this process; your
content can be simple.
Here are a few recommenda-
tions and tips to make sure your
content is web ready.
Content setup as a visual aid:
Visually you want your content
to be legible and easy to read.
The content throughout the
site should have a consistent
font size, color and style. When
highlighting text, bold the
words or use a different font
color, but don’t incorporate
the colors of the rainbow all
over your site. Another no-no
is using a large type face within
the whole paragraph. Larger
COMMUNICATION IS KEYContent is king
w
y
A
w
– – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – – –
WebSAVVY
BY PEGGY OLSON
EXPERIENCE LEGENDARY BUSHTEC PERFORMANCE
All dealers of Bushtec Performance Sport Trailers™ enjoy:
• Strong margins on the best trailer made.
• Hassle-free communications with a company that has an excellent reputation forservice and quality.
• Peace of mind knowing you are selling customers one of the safest, best-handlingtrailers on the road.
No other motorcycle trailer offers the total package of rider benefits for your customers.
• Exclusive air ride adjustable suspension means no bouncing or swaying.
• Lighter weight wheels and “run flat” motorcycle tires deliver better handling.
• Superior fit and finish insures longevity and higher resale value.
• Customer-first service backed by a 3 year warranty and a “not happy until you’re happy” Bushtec team.
• Inspired designs with customized options to create a trailer to meet most travel and cargo needs.
DEALERS WANTED
Visit www.bushtec.com or call 423-562-9900 for more details about joining the Bushtec Dealer Network.
Six great models & over65 accessories available.
“Manufacturing the best performingtrailers on the road will alwaysbe our goal. Our new model,Entourage™, demonstrates that.For 27 years, the Bushtecteam has delivered the bestproducts and service. Andin the future, I promisethat will continue.”
Andrew Preston, General Manager
44 April 2010 www.MPNmag.com
Leather Road Racing SuitScorpion Sports Inc.Designed for serious street riding and days at the track, the
one-piece “Hurricane” made its debut at Dealer Expo 2010
and will be available to dealers May 1.
– – – – – – – – – – – – – – – – – – – – – – – – – – –
Sure Sellers:• Constructed of race-spec 1.2-1.4mm full grain leather
• Feature’s exclusive ExoTec CE-approved armor at the elbows, shoulders, knees and hips
• Double-leather panels at all high impact areas
– – – – – – – – – – – – – – – – – – – – – – – – – – –
Retail Price: $899.95
Adventure Rally PantKlim USA
This pant is for serious riders
and Klim guarantees it will
keep them dry. It sports a
laundry list of features, so
check Klim’s site for the
full run-down. An equally
impressive jacket is also
available.
– – – – – – – – – – – – – –
Sure Sellers:• Extreme-durability gortex
fabrics
• Articulated, leg and seat, and YKK zippers throughout
• d3o armor is lax while riding but locks together on impact for protection
• Polyester moisture-whicking liner
– – – – – – – – – – – – – –
Retail Price: $849.99
– – – – – – – – – – – – – –
For More Info:Klim USA3753 E. County Line RoadRigby, ID 83442(208) 552-7433www.klimusa.com
Bluetooth-Ready Modular HelmetHJC HelmetsFeaturing an integrated recess for ChatterBox’s XBi2-H system,
HJC’s IS-Max BT modular helmet is just asking for some sweet,
sweet Bluetooth connectivity.
– – – – – – – – – – – – – –
Sure Sellers:• Built-in internal recesses for speakers
• DOT-approved advanced polycarbonate composite shell with adjustable polycarbonate chinbar
• Easy-to-operate, three-stage, integrated and adjustable SunShield
– – – – – – – – – – – – – –
Retail Price: $199.99
– – – – – – – – – – – –
For More Info:HJC Helmets16918 Edwards RoadCerritos, CA 90703(888) 452-2269www.hjchelmets.com
For More Info:Scorpion Sports Inc.25921 Atlantic Ocean DriveLake Forest, CA 92630(888) 672-6774www.scorpionusa.com
EssentialsGear
Klim USATh
an
ke
la
c
f
i
a
–
S•
•
• dri
•
–
R
–
www.MPNmag.com April 2010 45
Performance Sport TrailerBushtec Bushtec unveiled its 22-cubic-feet Entourage trailer — the
company’s fi rst new model in 10 years — at Dealer Expo 2010.
Also, Bushtec is endeavoring its fi rst dealer-direct business
model after 27 years of customer-direct dealings.
– – – – – – – – – – – – – –
Sure-Sellers:• Air adjustable suspension with anti-sway bar
• Fully carpeted interior and heavy duty run-fl at tires
• Limited lifetime chassis warranty
– – – – – – – – – – – – – –
Retail Price: $3,495 (standard)
– – – – – – – – – – – –
For More Info:Bushtec180 Mt. Paran Road, P.O. Box 459Jacksboro, TN 37757(423) 562-9900www.bushtec.com
Carburetor Kit for Triumph Bonneville & ThruxtonSudco InternationalSudco is keeping in mind contemporary café racer bikes with its
Keihn FCR 39mm Performance Carburetor Kit.
– – – – – – – – – – – – – –
Sure Sellers:• Fits ‘01-present Bonnevilles and Thruxtons
• A pair of Keihin FCR 39mm carburetors are racked together with the correct throttle/cable location and pre-jetted
• Includes Open Velocity Stacks for full track performance, as well as K&N Air fi lters and adapters for street use
– – – – – – – – – – – – – –
For More Info:Sudco international3014 Tanager Ave.Commerce, CA 90040 (323) 728-5407www.sudco.com
Racing Street TiresPirelliThe Diablo Rosso Corsa is the newest model in Pirelli’s Diablo family,
and Pirelli is proud to boast of its WSBK-caliber technology.
– – – – – – – – – –
Sure Sellers:• Enhanced Patch Technology optimizes contact patch area at all
lean angles on road or track
• Aggressive tread design for quick warm-ups and consistent water drainage
• Optimized for long mileage
– – – – – – – – – – – – – –
Retail Price: $205 to $326 each
– – – – – – – – – –
For More Info:Pirelli Motorcycle Tire Division
100 Pirelli DriveRome, GA 30161-7000
(706) 368-5426
EssentialsP&A
ealings.
y bar
un-fl at
Racing Street Tires
46 April 2010 www.MPNmag.com
Tricked out BootsWesco aims to provide the high degree of customization bikers love. The Boss (pictured), is just one of the company’s fi ve pull-on boot styles.
Sure Sellers:
• Sweat-resistant full-leather insole• Non-corrosive, ribbed, slightly arched
steel shank• Rolled-leather top facing and full-
leather midsole
Retail Price: as shown w/ double midsole, $488
For More Info: Wesco, 52828 NW Shoe Factory Lane, PO Box 607, Scappoose, OR 97056-0607; (800) 326-2711, ext. 200www.westcoastshoe.com/wesco
Head TurnerPerformance Machine is at it
again, releasing wheels worth drooling over. New for 2010 is
the Element.
Sure Sellers:
• Five spokes with deeply engraved lines originate at the hub and reach to the rim lip
• Offered with matching discs and sprockets• Pictured Contrast Cut Platinum is black ano against stock
chrome fi nish
For More Info: Performance Machine, 6892 Marlin Circle, La Palma, CA 90623; (714) 523-3000www.performancemachine.com
Low Ridin’ LadiesIf you’re sick of hearing the “I’m too short to ride a motorcycle” excuse from ladies (or guys), fi re back with details on Legend Air Suspension’s D1 kit. It fi ts a wide range of H-D, Lehman, and Boss Hoss bikes and trikes.
Sure Sellers:
• Handlebar control gives instant ability to lower seat up to three inches, or to raise the height for highway or heavy-gear riding
• Exclusive Gates Kevlar Air Spring technology and defl ective disc damping eliminates annoying pogo effect
• Parts bolt-on in stock shock location so modifi cations are unnecessary
Retail Price: $1,600 to $1,800
For More Info: Legend Air Suspensions, 3461 Whitewood Road, Sturgis, SD 57785; (605) 720-4202 www.legendsuspensions.com
HeaPerforman
again, releasidrooling over. Ne
the Element.
Sure Sellers:
e. he
ehed
W po2
sc
0m
For More Info: Wesco, 52828 NWFactory Lane, PO Box 607, Scapp97056-0607; (800) 326-2711, ext. www.westcoastshoe.com/wes
e
e g
www.MPNmag.com April 2010 47
Super SeatMustang’s Super touring seat provides both riders and passengers of ‘08-’10 FL models with “the most comfortable seat possible.”
Sure Sellers:
•Deep, 19-inch-wide seat is moved 13⁄4 inches back from stock• Seat sits lower than stock so feet can go fi rmly on ground•Two fl avors: plain or with studs
Retail Price: Driver seat & backrest, $719
For More Info: Mustang Motorcycle Products Inc., 278 Town Hill Road, Terryville, CT 06786-0029; (800) 243-1392; www.mustangdealer.com
Satin SlashersTAB Performance is one of the few companies to offer aftermarket pipes for the hulking V-Rod Muscle. Just one of its 17 styles for the V-Rod family from TAB, these pipes maintain the Muscle’s dual side exhaust look.
Sure Sellers:
• Aggressive slash and 21⁄2-inch baffl e• Factory-matched satin nickel coating• Pipes up the ante for sound, looks and power
For More Info: TAB Performance, 1232 Volunteer Parkway, Bristol, TN 37620; (888) 822-0070www.tabperformance.com
Renegade’s RacineContinuing with the aftermarket trend of releasing more affordable products, Renegade’s R2 Series carries a price tage “we can all live with.” Pictured is the Racine model.
Sure Sellers:
• Available in 16- to 26-inch diameter, and 2.15- to a massive 14-inch width
• Standard chrome fi nish• Special fi nishes available include Ebony Chrome, Black
Powder-Coat or Renegade’s new Phantom Cut
Retail Price: starting at $899
For More Info: Renegade Wheels, 2180 North Batavia, Orange, CA 92865; (714) 998-7241www.renegadewheels.com
www.MPNmag.com April 2010 47
re e
Renegade’s Racine
48 April 2010 www.MPNmag.com
ph
otos
by
Dea
n K
elly
The annual V-Twin Expo in Cincinnati took place Feb. 6-8. Like last
year, we chopper and bobber faithful were plagued with snow,
but dealers showed up. They didn’t show up in numbers we were
accustomed to, but, given the weather and cutbacks at their shops
this year, attendance was good. Nevertheless, dealers came to do
business, and exhibitors enjoyed the interaction. Custom bikes again
adorned the hall, while Motion Pro and loads of other exhibitors
displayed outstanding and creative bikes; at the bottom of the page,
you’ll see Ron Finch’s “Outsider” sidecar rig, which was a big draw.
The Rebel Girls warmed visitors to their booth, while and industry
insiders like John from Vee Rubber, Jamie from Cardo and Greg from
Continental were all busy educating dealers about their new product
offerings. In fact, almost all the exhibitors I spoke with enjoyed quality
time with dealers and felt it was a productive show. If you missed it,
you may want to add it back on your calendar for 2011. There is no
substitute for one-on-one visits with manufacturers and suppliers.
—Dean Kelly
Next week at Dealer Expo, more snow…
go fi gure, it must have been following me!
Exhibitors and dealers were obviously scaling back
on expenditures, but like V-Twin Expo, dealers who
did attend were there for a reason, and it wasn’t
for the parties. Booths like K&L Supply, Helmet
House, National Powersport Auctions, Western
Powersports Inc. , Rick’s Motorsport Electrics,
Marshall’s, Tucker Rocky, Parts Unlimited, NHJ
and too many more to list here were actively
interacting with dealers (and Ben Spies showed
up at the HJC booth to sign autographs!), while
manufacturers were not only busy with the same
people but also spending quality time training
reps. My take on this is that everyone came away
with a world of product knowledge. The show may
have been smaller, but quality time spent with key
people makes a huge difference down the road to
recovery and success. Face-to-face meetings are
always more meaningful, thus the value of shows
like this. On a side note, I tried to convince the Cycle
Country snowmobile/plow rep to make a few bucks
clearing sidewalks outside, but, somehow the Idea
didn’t fl y!
—Dean Kelly
www.MPNmag.com April 2010 49
50 April 2010 www.MPNmag.com
t
Find out more about advertisers in this issue
online atwww.mpnmag.com/resourcecenter
Quickly locate an advertiser in
this issue with the list below:
A&J Cycle Salvage ................................ 50
Bushtec Manufacturing & Sales Inc. .... 43
Cardo Systems Inc. ............................... 35
Chatterbox U.S.A. .................................. 18
Clarke Manufacturing Co. ..................... 50
Dealership University............................ 39
Exceed International/Hot Products ...... 50
Helmet House Inc. .............................. 6-7
J&D Walter Distributors Inc. ................ 50
K&L Supply Co. ..................................... 51
McCarthy Distributors LLC ................... 37
Mustang Motorcycle Products Inc. ....... 50
Parts Unlimited ....................................... 3
Peak Performance Group ..................... 37
Powerlet ................................................ 50
Sudco International Corp. ..................... 52
Tucker Rocky ........................................... 5
Unique Powersports ............................. 41
Western Power Sports Inc. ..................... 2
Western Power Sports Inc. ..................... 9
Western Power Sports Inc. ................... 11
Western Power Sports Inc. ................... 33
Yuasa Battery Inc. ................................. 17
Z1 Enterprises, Inc ................................ 50
AdINDEX– – – – – – – – – – – – – - - - - - - - – – –
FREEFREEONLINE RESOURCE CENTER
MarketPlace follow MPN on @MPNmag
New & Used Parts for Japanese Streetbikes
A & J CYCLE SALVAGE10 INDUSTRIAL HIGHWAY,
LESTER, PA 19113(610) 521-6700
FAX (610) 521-6868www.ajcyclesalvage.com
UPS SHIPMENTS DAILY
WWW.HOTPRODUCTSUSA.COM
Dealer Sales Only!Call for our FREE 216 page catalog!
(858) 453-4454
WORLDWIDE WATERCRAFTPARTS DISTRIBUTOR
877-752-7835 powerlet.net
SEEKINGDEALERS
Get the same powersports product and market coverage in our printed version each month, delivered to your inbox FREE.
Now available....
mpnmag.com/site/digitalissue
top related