· minster maneka gandhi’s proposal • the national council on nutrition (ncn) has unanimously...
Post on 12-Aug-2020
4 Views
Preview:
TRANSCRIPT
www.gradeup.com
2
Daily Current Affairs for UPSC IAS Preparation
01. 05. 2018
1. Fitch retains India rating at ‘BBB-
’ with stable outlook
• Global credit rating agency Fitch
affirmed India’s sovereign rating at
‘BBB-’ with ‘stable’ outlook, saying
that the country’s medium-term
growth potential is strong.
• ‘BBB-’ rating indicates lowest
investment grade.
• India’s rating balances a strong
medium-term growth outlook and
favourable external balances with
weak fiscal finances and some lagging
structural factors, including
governance standards and a still-
difficult, but improving, business
environment.
• Fitch had last upgraded the rating
from ‘BB+’ to ‘BBB-’ with stable
outlook on August 1, 2006.
• Later, it changed the outlook to
negative in 2012 and then again to
stable in the following year, though it
kept the rating unchanged at the
lowest investment grade.
Related Information
• In November 2017, US-based credit
rating agency Moody's had upgraded
India's sovereign credit rating by a
notch to 'Baa2' form Baa3 with a
stable outlook citing improved growth
prospects driven by economic and
institutional reforms.
• The 'Baa3' rating was the lowest
investment grade just a notch above
'junk' status.
Topic- GS-3-Indian Economy
Source- The Hindu Business Line
2. Nutrition council rejected WCD
Minster Maneka Gandhi’s
proposal
• The National Council on Nutrition
(NCN) has unanimously rejected
Union Minister for Women and Child
Development (WCD) Maneka Gandhi’s
proposal to replace ready-to-eat food
as take-home dry ration with energy-
dense nutrient packets which could be
mixed with food for anganwadi
beneficiaries.
• The National Council on India’s
Nutrition Challenges, headed by Vice-
Chairman of the NITI Aayog Rajiv
Kumar, was constituted in January to
provide policy directions to address
nutritional challenges in the country
and review programmes on a
quarterly basis.
• The Chairman [Nutrition Council]
drew attention to the PMO’s decision
in this regard and the need for
continuance of the existing practice
of-
(a) Hot cooked meals for children (3-
6 years) age group
(b) Take-home ration (THR) for
children (6 months-3 years) and
(c) Pregnant women and lactating
mothers as decided by the State
governments in conformity with the
National Foods Security Act, 2013,
and the Supplementary Nutrition
Rules, 2017.
Different views of WCD Minster Maneka
Gandhi and NITI Aayog
• WCD Minister Makeka Gandi is in the
favour of packaged nutrients and
• NITI Aayog want to substitute food
with cash given to beneficiaries
through direct benefit transfer.
Related Information
• As part of the Integrated Child
Development Scheme, anganwadi
beneficiaries between the age of six
months and three years as well as
pregnant women and lactating
mothers are entitled to take-home
rations, which includes wheat, soya
and sugar.
www.gradeup.com
3
Topic- GS-2- Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source- The Hindu
3. India joint 6th in list of doping
violations in WADA report
• India maintained their dubious record
of being among top 10 nations with
regards to doping violations being
joint sixth as World Anti-Doping
Agency (WADA) published its report
as per samples collected in 2016.
• However, India can take solace from
the fact that they have significantly
improved their position to sixth after
being third for three years in a row.
• For three years in a row from 2013-
15, India were ranked third in doping
violations.
• Italy topped the rankings of drug
cases in 2016, accounting for 147
ADRVs, followed by France (86),
United States (76), Australia (75),
Belgium (73).
Related information
WADA (World Anti-Doping Agency)
• WADA is a foundation initiated by the
International Olympic Committee
based in Canada to promote,
coordinate and monitor the fight
against drugs in sports.
• The agency's key activities include
scientific research, education,
development of anti-doping
capacities, and monitoring of the
World Anti-Doping Code, whose
provisions are enforced by the
UNESCO International Convention
against Doping in Sport.
• It is headquartered in Montreal,
Quebec, Canada.
National Anti-Doping Agency (NADA)
• NADA is the national organisation
responsible for promoting,
coordinating, and monitoring the
doping control program in sports in all
its forms in India.
• NADA deals with adopting and
implementing anti-doping rules and
policies which conform with the World
Anti-Doping agency, cooperates with
other anti-doping organisations and
promotes anti-doping research and
education.
• NADA is formed by the Union
Government under the societies
Registration Act.
• NADA includes scientists and
representatives from the Indian
Olympic Association (IOA).
• In September 2017, Drug pricing
regulator NPPA joined hands with
NADA to help athletes understand
medicines that could contain
prohibited substances in sports
through its app 'Pharma Jan
Samadhan'.
Topic- GS-2- Statutory, regulatory and
various quasi-judicial bodies
Source- Times of India
4. Procurement of NAG missile for
army and long-range guns for
Navy cleared
• The Defence Ministry approved
military procurement worth Rs 3,687
crore which included acquiring anti-
tank guided missile NAG for the Army
and long-range guns for the Navy.
• The capital acquisition proposals were
cleared at a meeting of the Defence
Acquisition Council (DAC) chaired by
Defence Minister Nirmala Sitharaman.
• The DAC approved procurement of
thirteen 127 mm calibre guns for the
Navy from BAE Systems of the United
States at a cost of over Rs 3,000
crore.
• The NAG missile has top attack
capabilities that can effectively
engage and destroy enemy tanks
during day and night.
Related Information
Nag Missile System
• It is a third generation "fire-and-
forget" anti-tank missile developed in
India.
www.gradeup.com
4
• It is one of five missile systems
developed by the Defence Research
and Development Organisation
(DRDO) under the Integrated Guided
Missile Development Program
(IGMDP).
NAMICA Version of the missile
• It is a 'lock-on before launch' system,
where the target is identified and
designated before the missile is
launched.
• As the targeting system is based on
visual identification, the range is
limited.
HELINA Version
• The HELINA version on the other hand
will use a 'lock-on after launch'
system extending its range to 7 km.
• In this scenario, the missile is
launched in the general direction of
the target.
• As it approaches the target, images of
the area ahead are sent back to the
operator who will be able to identify
enemy tanks.
Topic- GS-3-Defence
Source- The Hindu
5. Swachh Bharat Mission launched
GOBAR-DHAN scheme to promote
wealth and energy from waste
• Union Minister for Drinking Water and
Sanitation, Sushri Uma Bharti
launched the GOBAR (Galvanizing
Organic Bio-Agro Resources - DHAN
scheme at the National Dairy
Research Institute (NDRI)
Auditorium, Karnal in Haryana.
• The scheme aims to positively impact
village cleanliness and generate
wealth and energy from cattle and
organic waste.
• The scheme also aims at creating new
rural livelihood opportunities and
enhancing income for farmers and
other rural people.
• The scheme envisages the
implementation of 700 bio-gas units
in different states of the country in
2018-19.
• The Swachh Bharat Mission (Gramin)
comprises two main components for
creating clean villages – creating open
defecation free (ODF) villages and
managing solid and liquid waste in
villages.
Topic- GS-2-Welfare Schemes
GS-2- Governance
Source- PIB
02. 05. 2018
1. Government to introduce DNA
profiling Bill in Monsoon Session
• The government informed the
Supreme Court that it would introduce
a DNA profiling Bill in the Monsoon
Session of Parliament.
• The government was responding to a
PIL petition filed by NGO Lok Niti
Foundation in 2012 on the use of DNA
profiling for identifying unclaimed
bodies, especially to match them with
old cases of missing persons.
Law Commission report
• In 2017, the Law Commission of
India, in its 271st report, prepared the
draft Bill named The DNA Based
Technology (Use and Regulation) Bill,
2017 after examining various judicial
pronouncements and constitutional
provisions.
• The exercise was initiated by the
Commission after the Department of
Biotechnology forwarded its draft of
‘The Use and Regulation of DNA based
Technology in Civil and Criminal
Proceedings, Identification of Missing
Persons and Human Remains Bill,
2016’.
Related Information
DNA Profiling (DNA fingerprinting, DNA
testing, or DNA typing)
• DNA profiling is the process where a
specific DNA pattern, called a profile,
is obtained from a person or sample
of bodily tissue.
• Even though we are all unique, most
of our DNA is actually identical to
other people’s DNA.
www.gradeup.com
5
• However, specific regions vary highly
between people. These regions are
called polymorphic.
• Differences in these variable regions
between people are known as
polymorphisms.
• Each of us inherits a unique
combination of polymorphisms from
our parents.
• DNA polymorphisms can be analysed
to give a DNA profile.
Short tandem repeats method for DNA
Profiling
• One of the current techniques for DNA
profiling uses polymorphisms called
short tandem repeats.
• Short tandem repeats (or STRs) are
regions of non-coding DNA that
contain repeats of the same
nucleotide sequence.
• For example,
GATAGATAGATAGATAGATAGATA is
an STR where the nucleotide
sequence GATA is repeated six times.
• STRs are found at different places or
genetic loci in a person’s DNA.
• To produce a DNA profile, scientists
examine STRs at ten, or more, genetic
loci. These genetic loci are usually on
different chromosomes.
Application of DNA Profiling
• Identify the probable origin of a body
fluid sample associated with a crime
or crime scene
• Reveal family relationships
• Identify disaster victims
Topic- GS-3-Biotechnology
Source- The Hindu + Science Learn
2. 14 out of world’s 20 most
polluted cities in India: WHO
• Delhi and Varanasi are among the 14
Indian cities that figured in a list of 20
most polluted cities in the world in
terms of PM2.5 levels in 2016, data
released by the WHO showed.
• In terms of PM10 levels, 13 cities in
India figured among the 20 most-
polluted cities of the world in 2016.
• India accounts for 34% or 2.4 million
of the seven million premature deaths
caused by household and ambient air
pollution together globally every year.
• The PM2.5 includes pollutants like
sulfate, nitrate and black carbon,
which pose the greatest risk to human
health.
With respect to world
• WHO’s global urban air pollution
database measured the levels of fine
particulate matter (PM10 and PM2.5)
from more than 4,300 cities in 108
countries.
• The WHO data said that nine out of 10
people in the world breathe air
containing high levels of pollutants.
• WHO estimates that around 7 million
people die every year from exposure
to fine particles in polluted air that
penetrate deep into the lungs and
cardiovascular system, causing
diseases including stroke, heart
disease, lung cancer, chronic
obstructive pulmonary diseases and
respiratory infections, including
pneumonia.
• According to the report, more than
90% of air pollution-related deaths
occur in low- and middle-income
countries (including India), mainly in
Asia and Africa, followed by low- and
middle-income countries of the
Eastern Mediterranean region, Europe
and the Americas.
Major Source of Air Pollutant
• Inefficient use of energy by
households, industry, agriculture and
transport sectors, and coal-fired
power plants.
• In some regions, sand and desert
dust, waste burning and deforestation
are additional sources of air pollution.
Related Information
Classification of pollutants
• WHO classifies particulate matter into
two broad types, PM10 and PM2.5,
with the numbers indicating the
diameter of the particles in microns.
www.gradeup.com
6
• Chronic exposure to both PM10 and
PM2.5 can lead to the “risk of
developing cardiovascular and
respiratory diseases, as well as of lung
cancer.
Topic- GS-3-Environment
Source- The Hindu
3. ‘76% of Lake Victoria’s endemic
biodiversity is at risk of
extinction’ - IUCN
• IUCN has come out with a new report
in which it warns that 76 percent of
the biodiversity endemic to Africa’s
Lake Victoria is at the risk of becoming
extinct.
• It found that a full 20% of these
species were threatened with
extinction.
• Lake Victoria is the world’s second
largest freshwater lake by surface
area.
• Its catchment area includes parts of
Kenya, Tanzania, Uganda, Burundi
and Rwanda.
• Also referred to as “Darwin’s
Dreampond”, the lake is known for its
high levels of unique biodiversity.
• The report cited the example of the
African Lungfish (Protopterus
aethiopicus).
• The fish, the report said, was
declining in the lake basin largely due
to overfishing, poor fishing practices.
Major Problems
• The purple flowered Water Hyacinth
(Eichhornia crassipes) was
accidentally introduced to Lake
Victoria from South America in the
1980s, and at its peak covered close
to 10 percent of the lake surface.
• It reduces the oxygen and nutrient
availability in the water column, which
negatively affects native biodiversity.
Topic- GS-3- Environment
Source- Down to Earth
4. NASA twin Satellites “GRACE-FO”
mission Will Track Changes in
Earth's Water and Ice
• NASA is gearing up for the upcoming
launch of its Gravity Recovery and
Climate Experiment Follow-On
(GRACE-FO) mission, which will map
changes in water and ice around the
world by detecting variations in
Earth's gravity.
• The mission involves two identical
spacecrafts that will orbit the Earth in
tandem.
• The satellites are currently scheduled
to lift off from Vandenberg Air Force
Base in California atop a SpaceX
Falcon 9 rocket on May 19.
• As the name implies, GRACE-FO is a
follow-on mission to the original
GRACE mission, which mapped
Earth's gravity field from 2002 to
2017.
• Both missions are joint projects
between NASA and the GFZ German
Research Center for Geosciences in
Potsdam, Germany.
• After the first GRACE mission
operated well beyond its planned five-
year life span, the spacecraft's
batteries eventually succumbed to
their age, and the mission came to an
end.
How it works?
• As that ice melts- whether the water
becomes a part of the ocean or seeps
into the soil — it changes how mass is
distributed on our planet.
• And when Earth's mass distribution
changes, so does its gravity field.
• By measuring those changes, the
GRACE missions can track Earth's
water cycle and how climate change
affects oceans, glaciers, sea ice,
groundwater and even moisture in the
atmosphere.
Topic- GS-3-Science and Technology
Source- Space.com
5. Exercise “Vijay Prahar” of South
Western Command
www.gradeup.com
7
• About 20,000 troops of strike
formation of the Army's South
Western Command (SWC) are
carrying out 'Vijay Prahar' exercise
with cutting-edge equipment and
state-of-the-art force multipliers in
the Mahajan Field Firing Ranges close
to Suratgarh in Rajasthan.
• The exercise is aimed to orchestrate
wide spectrum of threats which are
planned to be tackled through high
tempo joint air and land operation
involving hundreds of aircrafts,
thousands of tanks and artillery pieces
supported by real time intelligence,
surveillance, reconnaissance and just
in time logistic support.
Topic- GS-3- Defence
Source- PIB
03.05.2018
1. Global military spending rises to
USD 1.739 trillion, India among
top 5 spenders
• According to the recent report of
SIPRI, India and China were among
the five biggest military spenders
which together accounted for 60
percent of the total global defence
expenditure of USD 1.739 trillion in
2017.
• India spent USD 63.9 billion on its
military in 2017, an increase of 5.5
per cent compared with 2016 and of
45 per cent since 2008.
• The five top military spenders in 2017
were the US, China, Saudi Arabia,
Russia and India.
• It said the total global military
spending rose to USD 1.739 trillion
which is an increase of 1.1 percent
compared to the expenditure in 2016.
• The total global military expenditure
accounted for 2.2 per cent of global
gross domestic product in 2017.
Related Information
Stockholm International Peace
Research Institute (SIPRI)
• SIPRI is an international institute,
dedicated to research into conflict,
armaments, arms control and
disarmament.
• It was established in 1966.
• It is based in Stockholm, Sweden.
• SIPRI provides data, analysis and
recommendations, based on open
sources, to policymakers,
researchers, media and the interested
public.
Topic- GS-2- Important International
institutions, agencies and fora- their
structure, mandate.
Source- Indian Express
2. Supreme Court asked high courts
to fast-track trial under POCSO
Act
• The SC directed all high courts to
ensure that the cases of sexual
assault of children to be fast-tracked
and decided by special courts.
• The apex court also asked the high
courts to instruct the trial courts not
to grant unnecessary adjournments
during trial of cases under the
Protection of Children from Sexual
Offences (POCSO) Act.
Related Information
Also in News
• The Union cabinet on April 21 cleared
the ordinance on POCSO act whereby
death penalty will be given to those
convicted of raping a child up to 12
years of age.
• Centre has cleared the criminal law
amendment ordinance and POCSO Act
is a part of this amendment.
• The Centre has increased minimum
punishment in case of rape of women
from 7 years to 10 years, extendable
to life imprisonment.
• It said that in case of gang rape of a
girl below 12 years, punishment will
be life imprisonment or death
sentence.
POCSO (The Protection of Children from
Sexual Offences) Act 2012
www.gradeup.com
8
• POCSO Act 2012 was established to
protect the children against offences
like sexual abuse, sexual harassment
and pornography.
• It was formed to provide a child-
friendly system for trial underneath
which the perpetrators could be
punished.
• The Act defines a child as any person
below eighteen years of age.
• It also makes provisions for avoiding
the re-victimisation of the child at the
hands of the judicial system.
• The Act defines different forms of
sexual abuse which includes
penetrative and non-penetrative
assault.
• It makes it the legal duty of a person
aware of the offence to report the
sexual abuse. In case he fails to do so,
the person can be punished with six
months’ imprisonment or fine.
• The Act further states that the
evidence of the child should be
recorded within a period of thirty
days.
• The Special Court taking cognizance
of the matter should be able to
complete the trial within the period of
one year from the date of taking
cognizance of the abuse.
Topic- GS-2-Indian Polity
Source- Times of India
3. Multi-sectoral Development
Programme for minorities is
renamed as Pradhan Mantri Jan
Vikas Karyakram
• The Cabinet Committee on Economic
Affairs renamed the Multi-sectoral
Development Programme (MsDP) as
Pradhan Mantri Jan Vikas Karyakram.
• The programme is aims at building
infrastructure in minority
concentration areas currently covers
196 districts.
• The restructured programme aims to
provide better socioeconomic
infrastructure facilities to the minority
communities, particularly in the field
of education, health and skill
development.
• The criteria for identification of
minority concentration towns and
clusters of villages has been
rationalised by lowering the
population percentage criteria from
50 percent to 25 per cent.
• This would result in a 57 percent rise
in area covered under the
programme.
Topic- GS-2-Welfare Schemes
Source- Indian Express
4. Cabinet approves continuation of
Umbrella Scheme ‘Green
Revolution- Krishonnati Yojana’
in Agriculture Sector
• The Cabinet Committee on Economic
Affairs has given its approval for the
Umbrella Scheme, "Green Revolution
– Krishonnati Yojana" in agriculture
sector beyond 12th Five Year Plan for
the period from 2017-18 to 2019-20.
• The Umbrella scheme comprises of 11
Schemes/Missions. These are-
Mission for Integrated
Development of Horticulture
(MIDH)
2. National Food Security Mission
(NFSM), including National
Mission on Oil Seeds and Oil Palm
(NMOOP)
3. National Mission for
Sustainable Agriculture (NMSA)
4. Submission on Agriculture
Extension (SMAE)- to strengthen
the ongoing extension mechanism of
State Governments, local bodies etc
5. Sub-Mission on Seeds and
Planting Material (SMSP)
6. Sub-Mission on Agricultural
Mechanisation (SMAM)- to
increase the reach of farm
mechanization to small and marginal
farmers
www.gradeup.com
9
7. Sub Mission on Plant Protection
and Plan Quarantine (SMPPQ)- to
minimize loss to quality and yield of
agricultural crops from the ravages of
insect pests etc.
8. Integrated Scheme on
Agriculture Census, Economics
and Statistics (ISACES)- to
undertake the agriculture census
9. Integrated Scheme on
Agricultural Cooperation
(ISAC)- to provide financial
assistance for improving the economic
conditions of cooperatives, remove
regional imbalances etc.
10. Integrated Scheme on
Agricultural Marketing (ISAM)- to
develop agricultural marketing
infrastructure
11. National e-Governance Plan
(NeGP-A) - to bring farmer centricity
& service orientation to the
programmes
Topic- GS-3-Agriculture
Source- PIB
5. Cabinet approved accession to the
Protocol under WHO
• The Union Cabinet has given approval
to accede to the Protocol under World
Health Organization (WHO)
Framework Convention on tobacco
control to eliminate illicit trade in
tobacco products.
• It will be applicable to both smoking
and chewing or smokeless tobacco
(SLT) forms as negotiated and
adopted under Article 15 of the World
Health Organization Framework
Convention on Tobacco Control (WHO
FCTC).
• India is a party to WHO FCTC.
Related Information
World Health Organization Framework
Convention on Tobacco Control (WHO
FCTC)
• The WHO Framework Convention on
Tobacco Control (WHO FCTC) is the
first international public health treaty
negotiated under the auspices of the
WHO.
• It is adopted by the 56th World Health
Assembly held in Geneva, Switzerland
on 21 May 2003.
• It became the first World Health
Organization treaty adopted under
article 19 of the WHO constitution.
• The treaty came into force on 27
February 2005.
• It had been signed by 168 countries
and is legally binding in 181 ratifying
countries.
• There are currently 15 United Nations
member states that are non-parties to
the treaty.
• One of the key tobacco supply
reduction strategies contained in
Article 15 of WHO FCTC envisages
elimination of all forms of illicit trade
and tobacco products, including
smuggling, illicit manufacturing and
counterfeiting.
• The protocol is divided into 10 parts
and contains 47 Articles.
Impact
• Elimination of illicit trade in tobacco
products through strengthened
regulation will help in-(a)
Strengthening comprehensive
tobacco control
• (b) Leading to reduction in tobacco
use
which in turn, will result in reduction in
disease burden and mortality associated with
tobacco use.
Topic- GS-2- Important International
institutions, agencies and fora- their
structure, mandate.
Source- PIB
04.05. 2018
1. How storms and lightning in North
India killed over a hundred people
• Over 100 people were killed in
duststorms, thunderstorms, and
lightning at many places in northern,
central and eastern India.
www.gradeup.com
10
How the storms built up?
• Rainstorms and duststorms arise from
similar meteorological conditions.
• Such events take place due to a local
“instability” arising out of a deviation
from the normal temperature
difference between the upper and
lower atmosphere.
• Thunderstorms or hail occur when the
atmosphere has moisture; when it
doesn’t, duststorms take place.
Example
• Moist easterly winds from the Bay of
Bengal reached up to Himachal
Pradesh, which was also receiving dry
winds from the north-westerly
direction.
• The two systems destabilised the
equilibrium temperature difference
between the upper and lower layers of
atmosphere, leading to conducive
conditions for a thunderstorm.
Reasons for more number of deaths
• In most cases, storms do not kill by
themselves. Even lightning rarely
strikes people directly. But they
trigger incidents that result in deaths.
• Walls or homes collapse, and people
are electrocuted after power lines
snap, or after they are caught in fields
filled with water.
• People in the poorest, most densely
populated areas are the most
vulnerable.
Can such events be predicted?
• Meteorological predictions are for
broad geographical areas and
timeframes.
• It is not yet possible to predict a
thunderstorm or lightning at a precise
location.
• The exact times these events will hit
also cannot be predicted.
Topic- GS-1- Important Geophysical
phenomena such as earthquakes, Tsunami,
Volcanic activity, cyclone etc.
Source- Indian Express
2. Amazon River Dolphins face
extinction risk
• A recent study conducted by Brazilian
researchers has warned that
freshwater dolphins found in the
Amazon River Basin are “dying off
fast” and may face extinction unless
they are more vigorously protected
against fishing.
• The primary reason for the decrease
in numbers is the dolphins’ use of
flesh and blubber as bait for catfish,
which have become widely available
commercially.
• Killing the dolphins endangers their
survival, particularly since the
females bear a single calf on average
every four to five years.
• The International Union for
Conservation of Nature (IUCN)
currently lists these freshwater
dolphins’ status as "data deficient,"
meaning not enough is known about
their numbers in the wild to assess the
degree of threat to the population.
• But the study says that if the IUCN
Red List considered the latest
findings, species would be classified
as “Critically Endangered”.
Related Information
• Freshwater dolphins in other parts of
the world are also facing extreme
pressures.
• In the Indian Subcontinent,
the Gangetic or Indus River
Dolphin found in the Ganga and
Indus River Basins is
considered “Endangered” by the
IUCN.
• In China, the Yangtze River dolphin or
“baiji”, was declared functionally
extinct in 2006 due to human
activities like overfishing, dam
building, pollution and boat traffic.
Topic- GS-2-Biodiversity
Source- Down to Earth
www.gradeup.com
11
3. Pay 2% of capital investment for
green clearance: Environment
Ministry to Corporates
• The environment ministry has firmed
up guidelines that will require every
corporate, seeking green clearance,
to set aside up to 2% of its capital
investment for Corporate
Environment Responsibility (CER).
• The guidelines make it mandatory for
companies to set aside funds for CER
over and above what is required for
executing the environment
management plan in a project
affected area.
• While brownfield (expansion) projects
would be required to earmark 0.125%
to 1% of additional capital investment
for CER purposes, the slab for
greenfield projects ranges from
0.25% to 2% of the capital
investment.
• The exact quantum will be decided for
every project by the Expert Appraisal
Committee when it comes up for
green clearance.
• The ministry repeatedly insisting on
creating a separate category for CER
funds and projects, rather than
assuming it to be part of the
implementation of the environment
impact assessment plan.
Related Information
Corporate Environment Responsibility
(CER)
• Corporate Environmental
Responsibility (CER) refers to a
company's duties to abstain from
damaging natural environments. The
term derives from corporate social
responsibility (CSR).
• Corporate Environment Responsibility
(CER) activities will include measures
like pollution control, wildlife and
forest conservation, compensatory
afforestation and rehabilitation and
resettlement of displaced persons.
• Funds can be used for creating
drinking water supply infrastructure,
sanitation, health, education and skill
development, among others.
Issues with CSR
• At present, Section 135 of the
Companies Act lays down Corporate
Social Responsibility (CSR) for every
company with a net worth of Rs 500
crore or more, or turnover of Rs 1,000
crore or more, or net profit of Rs 5
crore in a financial year.
• But CSR does not necessarily cover all
projects.
Environment Impact Assessment (EIA)
• EIA is a tool to anticipate the likely
environmental impacts that may arise
out of the proposed developmental
activities and suggest mitigation
measures and strategies.
• EIA comes under Notification on
Environmental Impact Assessment
(EIA) of developmental projects 1994
under the provisions of Environment
(Protection) Act, 1986.
Topic- GS-3-Environment
Source- Economic Times
4. ‘Glow-in-the-dark algae may be
sign of global warming’
• The phenomenon of Mumbai’s
beaches glowing in the dark maybe a
consequence of global warming and
not industrial pollution, according to a
year-long investigation by Indian and
American scientists.
• The Noctiluca algae, commonly
known as sea tinkle, is a parasite
and occurs in patches or ‘blooms’ in
the Northern Arabian Sea.
• They glow at night due to
bioluminescence and have earned
them the nickname ‘sea sparkle’.
• However, these patches are a sign of
decline because they compete with
fish for food and choke their supply.
• Noctiluca devours one of the most
important planktonic organisms at the
base of the fish-food chain, namely
diatoms, and also excretes large
amounts of ammonia, which is linked
with massive fish mortalities.
www.gradeup.com
12
How Noctiluca algae affects the other
organism
• A warming ocean means greater
temperature differences among layers
of the sea water and this slows the
upward transport of nutrients like
silicate from the ocean bottom,
lowering its concentration at the
surface.
• Diatoms growing in surface water
need both sunlight and silicate to build
their glass skeletons and thus, will fail
to thrive when silicate becomes less
available.
• On the other hand, Noctiluca remains
unaffected by these changes and
additionally will prey on the remaining
diatoms.
• The waters in the study area were
observed to have sufficient oxygen
clearly opposing any linkage between
low oxygen and Noctiluca growth.
Related Information
Bioluminescence
• It is the production and emission of
light by a living organism as the result
of a chemical reaction during which
chemical energy is converted to light
energy.
• Bioluminescence occurs widely in
marine vertebrates and invertebrates,
as well as in some fungi,
microorganisms including some
bioluminescent bacteria and
terrestrial invertebrates such as
fireflies.
Topic- GS-3- Environment
Source- The Hindu
5. Indian and French Navy have
begun final phase of Bilateral
Exercise 'Varuna' near Reunion
Island
• The Varuna is an annual naval
exercise between the two navies.
• The Indian Navy and the French Navy
have conducted bilateral maritime
exercises since May 1993.
• Since 2001, the exercises have been
named VARUNA.
• The Indian and French navies are
conducting the last phase of the 2018
“Varuna” naval exercise, from 1st to
7th of May, in the vicinity of Reunion
Island.
Related Information
Reunion Island
• Réunion is an island and region
of France in the Indian Ocean, east
of Madagascar and 175 kilometres
(109 mi) southwest of Mauritius.
Topic- GS-3- Defence
GS-1- World Geography
Source- Business Standard
05. 05. 2018
1. NASA’s portable nuclear reactor
“KRUSTY” could power missions
to Mars
• NASA has said that it successfully
demonstrated a new nuclear reactor
power system that could enable
crewed missions to the Moon, Mars
and destinations beyond.
• NASA announced the results of the
demonstration, called the Kilopower
Reactor Using Stirling Technology
(KRUSTY) experiment at its Glenn
Research Center in Cleveland.
• The Kilopower experiment was
conducted at the US Department of
Energy’s National Nuclear Security
Administration’s Nevada National
Security Site from November 2017
through March.
How it will help?
• This pioneering space fission power
system could provide up to 10
kilowatts of electrical power – enough
to run two average households –
continuously for at least 10 years.
• When astronauts someday venture to
the Moon, Mars and other
destinations, one of the first and most
important resources they will need is
power.
www.gradeup.com
13
• The pioneering power system is ideal
for the Moon, where power generation
from sunlight is difficult because lunar
nights are equivalent to 14 days on
Earth.
• Passive sodium heat pipes transfer
reactor heat to high-efficiency Stirling
engines, which convert the heat to
electricity.
Topic- GS-3-Science and Technology
Source- Indian Express
2. New species of shieldtail snake
“Bhupathy’s shieldtail”
discovered in Western Ghats
• Scientists have discovered an entirely
new species of shieldtail snake from
the Western Ghats in Tamil Nadu.
• Scientists have named the newly
discovered species as Bhupathy’s
shieldtail snake in honor of Dr
Subramanian Bhupathy who was a
noted Indian herpetologist.
Related Information
• At present, there are 45 known
species of shieldtail snakes in the
world, of which 30 are endemic to
India and 15 to Sri Lanka.
• The name ‘shieldtail’ comes from their
heavily keeled tails that terminate in
disk-like shields or multiple spines in
most species.
• They are small sized snakes, typically
25 to 50 cm in length and live in loose
soil among plant roots or under
decaying vegetation.
• They are inoffensive, non-venomous,
and easy-to-handle owing to their
inability to bite because they have
short head and mouth.
• The snake species is known to occur
in a single small locality and there is
limited information about its natural
history, so it is categorised as ‘data
deficient’ in the IUCN Red list of
threatened species as of now.
• The news species faces threats from
road traffic, habitat loss, and a
possible fungal infection that leads to
deformed heads.
Topic- GS-3- Biodiversity
Source- Down to Earth
3. Kabul river’s famous “Sher Mahi”
fish in danger
• The Sher Mahi, an indigenous fish of
Khyber Pakhtunkhwa, is facing
serious threats to survival.
• It is found in river basins adjacent to
Afghanistan.
• Experts have observed a decrease in
the population of Sher Mahi in its main
habitat, the Kabul river.
What are the causes behind the
depletion of “Sher Mahi”
• Climatic changes: The rise in
temperature of the Kabul river due to
global warming has reduced oxygen
dissolution in water which has
affected the Sher Mahi.
• Water pollution
• Overfishing
Topic- GS-3-Biodiversity
Source- Down to Earth
4. National Resource Centres for
online refresher programmes for
Higher Education faculty through
SWAYAM
• The Ministry of Human Resource
Development has launched a major
and unique initiative of online
professional development of 1.5
million higher education faculty using
the MOOCs (Massive open online
courses) platform SWAYAM.
• In the first phase, 75 discipline-
specific National Resource Centres
have been identified which are tasked
to prepare online training material
with focus on latest developments in
the discipline.
• Faculty can benefit from this initiative
as it is highly flexible and can be done
at one’s own pace and time.
• The NRCs will revolutionize
professional development of faculty
by catering to massive numbers by
leveraging ICT and online technology
platform of SWAYAM.
www.gradeup.com
14
Related Information
SWAYAM (Study Webs of Active–
Learning for Young Aspiring Minds)
• SWAYAM is a programme initiated by
Government of India and designed to
achieve the three cardinal principles
of Education Policy viz., access, equity
and quality.
• The objective of this effort is to take
the best teaching learning resources
to all, including the most
disadvantaged.
Topic- GS-2- Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source- PIB
5. Scientists say Chinese-backed
dam risks “orangutan” habitat
• Scientists are calling for cancellation
of a Chinese-backed hydroelectric
dam in Indonesia that threatens the
habitat of a newly discovered
“orangutan” species numbering only
800 animals.
• The experts say the 510-megawatt
dam in Sumatra will flood or otherwise
alter part of the habitat and likely
make it impossible to take a crucial
step toward ensuring the species
survives reconnecting fragmented
forests the primates are spread
across.
Related Information
Orangutan
• The orangutans are three extant
species of great apes native to
Indonesia and Malaysia.
• Three Extant species are-
(a) Bornean orangutan
(b) Sumatran orangutan
(c) Tapanuli orangutan
• Orangutans currently inhabit lowland
forests on Borneo, an island shared by
Indonesia, Malaysia and Brunei, and
Indonesia's island of Sumatra.
Topic- GS-3- Biodiversity
Source- The Hindu
6. 'Go to Village' mission launched in
Manipur
• Manipur Chief Minister N. Biren Singh
launched 'Go to Village' mission
throughout the state.
• The mission was launched in 60
villages of all the 60 Assembly
constituencies.
• The mission is aimed at identifying the
eligible and deserving beneficiaries in
every corner of the state and
delivering government services at
their doorstep.
Topic- Important for PCS Exams
Source- Business Standard
7. Dakota aircraft
• A restored Dakota aircraft has joined
the Indian Air Force more than four
decades after the fleet was phased out
following an illustrious service record.
• The aircraft was flown back to India
from UK by a joint crew of IAF and
Reflight Airworks.
Background
• The Dakota popularly known as
the Gooney Bird was the first major
transport aircraft inducted in the
fledgling Indian Air Force.
• It was at the forefront of operations
from 1947 to 1971.
• The aircraft played a crucial role in
Kashmir operations in 1947 war and
Bangladesh war.
• After 1971, the Dakota was replaced
by Avro HS-748.
Topic- Important for PCS Exams
Source- AIR
07.05.2018
1. Govt to set up marine observation
system, buy polar research
vehicle- Ministry of Earth Science
• India will establish a Marine
Observation System Along the Indian
Coast (Mosaic).
• At least six observatories – three
along the east coast and an equal
number along with the west coast –
will be established.
www.gradeup.com
15
• The project, to be launched later this
year is intended to carry out
monitoring, especially the marine
coastal pollution.
• The Hyderabad-based INCOIS will be
the implementing agency.
Polar research vehicle
• The Ministry, which has five ships to
conduct research, exploration and
surveys, is firming up plans to buy its
first polar research vehicle (PRV).
• The polar research vehicle is
important to undertake intensive
studies in the Antarctica and Arctic
regions as well as to carry out a range
of ocean studies.
• The Goa-based National Centre for
Antarctic and Ocean Research
(NCAOR), which is focused on
research in the Antarctic region, will
play an important role in the purchase
of the vessel.
• The Ministry, which has been
conducting Antarctica expeditions
from the early 1980s, has been
contracting vessels for the purpose.
Related Information
Research Stations in the Arctic
• Himadri
Research Stations in Antarctica
• Maitri
• Bharati
Note- Dakshin Gangotri Antarctic research
base superseded by the Maitri base from
1990.
Topic- GS-3- Science and Technology
Source- The Hindu Business Line
2. NASA launched its latest mission
“InSight” to Mars
• NASA has launched its latest Mars
lander, InSight, designed to perch on
the surface and listen for
"Marsquakes" ahead of eventual
human missions to explore the Red
Planet.
• Its name, InSight, is short for Interior
Exploration using Seismic
Investigations, Geodesy and Heat
Transport.
• It was launched from a United Launch
Alliance (ULA) Atlas V rocket in
California on May 6.
• The lander should settle on the Red
Planet on November 26.
• The project aims to expand human
knowledge of interior conditions on
Mars, inform efforts to send human
explorers there, and reveal how rocky
planets like the Earth formed billions
of years ago.
How will it help?
• InSight will study the deep interior of
Mars to learn how all rocky planets
formed, including Earth and its Moon.
• The lander's instruments include a
seismometer to detect marsquakes,
and a probe that will monitor the flow
of heat from the planet's interior.
• After the lander settles on the Martian
surface, a robotic arm is supposed to
emerge and place the seismometer
directly on the ground.
Topic- GS-3- Science and Technology
Source- DD News
3. GravityRAT, a malware that spies
on computers
• GravityRAT, a malware allegedly
designed by Pakistani hackers, has
recently been updated further and
equipped with anti-malware evasion
capabilities.
• It is designed to infiltrate computers
and steal the data of users and relay
the stolen data to Command and
Control centres in other countries.
• The RAT was first detected by Indian
Computer Emergency Response
Team, CERT-In, on various computers
in 2017.
• The ‘RAT’ in its name stands
for Remote Access Trojan, which is
a program capable of being controlled
remotely and thus difficult to trace.
How will it work?
• It lies hidden in the system that it
takes over and keeps penetrating
deeper.
www.gradeup.com
16
• The latest update to the program by
its developers is part of GravityRAT’s
function as an Advanced Persistent
Threat (APT), which, once it infiltrates
a system, silently evolves and does
long-term damage.
How did it enter into the system?
• GravityRAT infiltrates a system in the
form of an innocuous-looking email
attachment, which can be in any
format, including MS Word, MS Excel,
MS Powerpoint, Adobe Acrobat or
even audio and video files.
How is it different from other malware?
• Generally, malware activity is
detected by the ‘noise’ it causes inside
the Central Processing Unit, but
GravityRAT is able to work silently.
• It can also gauge the temperature of
the CPU and ascertain if the device is
carrying out high-intensity activity,
like a malware search, and act to
evade detection.
How can we escape from this?
• One such technique is ‘sandboxing’, to
isolate malware from critical
programs on infected devices and
provide an extra layer of security.
Note- A sandbox is a security mechanism for
separating running programs, usually in an
effort to mitigate system failures or software
vulnerabilities from spreading.
• The problem, however, is that
malware needs to be detected before
it can be sandboxed.
Topic- GS-3- Science and Technology
Source- The Hindu
4. Govt launched National Water
Informatics Centre to maintain
data on water resources
• The government has set up a central
body - National Water Informatics
Centre (NWIC) - to maintain a
comprehensive water resources data.
• The NWIC will work under the Union
water resources ministry as its
subordinate office.
• It’ll be headed by a joint secretary
level officer.
• It will be a single window source of
updated data on water resources in
India.
• The NWIC will also collaborate with
leading national and international
research institutes to provide
technical support to central and state
organisations dealing with water
emergency response of hydrological
extremes.
Why do we need it?
• Since scientific data is needed to take
any decision, the Union cabinet had
recently approved setting up such a
body which can provide value-added
products and services to all
stakeholders for management and
sustainable development of water
resources in the country.
• It will help by updating regularly a
comprehensive ‘Water Resources
Information System’ (WRIS) in public
domain for awareness and
involvement of all concerned for
effective integrated water resources
management.
Topic-GS-2- Statutory, regulatory and
various quasi-judicial bodies
Source- Times of India
5. Cochlear Implant Programme
• Cochlear Implant is a modern
technology to help young children
who have severe to profound
deafness in both ears.
• Because of hearing impairment, they
are not able to speak.
• Cochlear Implant provides such
children to hear normally in one ear
and with post-surgical rehabilitation,
they are able to speak also.
• The government has introduced
Cochlear Implant programme under
revised Scheme of Assistance to
Disabled Persons for Purchase/Fitting
of Aids and Appliances (ADIP) for the
poor and needy young children.
Topic-GS-2- Welfare Schemes
Source-PIB
www.gradeup.com
17
6. Sujalam Sufalam Jal Abhiyan
biggest water conservation drive
of India- Gujarat CM
• Gujarat CM Vijay Rupani claimed that
the ongoing Sujalam Sufalam Jal
Abhiyan was the biggest water
conservation drive of the country and
that it will help tackle shortage of
water for irrigation and drinking
purposes in Gujarat.
Background
• The Sujalam Sufalam Jal Abhiyan
started on May 1 will continue
throughout this month.
• During the month-long drive, the
government targets to remove 1,100
crore cubic metre of silt from beds of
water bodies.
• It will significantly augment storage
capacity of these reservoirs and help
make the shortage of drinking and
irrigation water a thing of the past in
the state.
Topic-GS-2- Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source- Indian Express
08.05.2018
1. Indian teen’s satellite “Anitha-
SAT” soars in Mexico sky
• Anitha-SAT, a lightweight satellite
developed by Villet Oviya, a 17-year-
old student of Tiruchi, to measure the
effects of air pollution and global
warming, was launched from Aztra
Labs in Mexico City.
• The satellite weight is around 500
grams.
• It is fitted with global positioning
system and a camera, the satellite
was pushed into troposphere, to a
height of 15 km, in a helium balloon.
• Thereafter, the balloon exploded and
the capsule began its descent towards
the sea, measuring the temperature,
air quality and concentration of gases
in the strata of the atmosphere.
Topic- GS-3- Science and Technology
Source- The Hindu
2. First record of invasive “aphid” in
Kashmir Valley
• The brown peach aphid – an insect
that attacks temperate fruit trees –
has been recorded in Kashmir Valley
for the first time.
• The spread of the aphid could affect
the local economy which is dependent
on fruit trees to a large extent.
• Aphids feed on the saps of plants,
attacking plant tissues that transport
food to all different plant parts.
• The brown peach aphid
"Pterochloroides perscae" is a
notorious pest of peach and almond
trees in the Mediterranean regions.
• In India, the aphid was recorded for
the first time in the 1970s from
Himachal Pradesh and Punjab.
• Though they were most ‘prolific’
between 20 and 22 degrees Celsius,
write the scientists, the brown-and-
white patched insects were active in
temperatures as low as 3 degrees C.
• Peach trees were the preferred plants.
How can we control?
• Several combinations and
concentrations of natural chemicals
including neem plant extracts and
lavender oil can help control aphid
numbers.
• The scientists also note that while the
blood-red ant extracted honeydew
from the aphid for food, wasps and
several other parasites also preyed on
the aphids.
Topic- GS-3- Biodiversity
Source- The Hindu
3. The carbon footprint of tourism
revealed
• The carbon footprint of tourism is
about four times larger than
previously thought, according to a
world-first study published in Nature
Climate Change.
www.gradeup.com
18
• This includes transportation,
accommodation, food and beverages,
souvenirs, clothing, cosmetics and
other goods.
• Put together, global tourism produces
about 8% of global greenhouse gas
emissions, much more than previous
estimates.
• Tourism is a trillion-dollar industry
and is growing faster than
international trade.
• By combining a detailed international
trade database with accounts tracking
what goods and services tourists
bought, we identified carbon flows
between 160 countries from 2009 to
2013.
• The study shows that tourism-related
emissions increased by around 15%
over that period, from 3.9 giga tonnes
(Gt) of carbon-dioxide equivalent
(CO₂-e) to 4.5Gt.
• The growing appetite for travel and a
business-as-usual scenario would
increase carbon emissions from global
tourism to about 6.5Gt by 2025.
• This increase is largely driven by
rising incomes, making tourism highly
income-elastic and carbon-intensive.
Related Information
Carbon Footprint
• Total emission of Greenhouse
emissions over a period of time by any
individual, group, organization etc.
Topic- GS-3- Environment
Source- Down to Earth
4. ISRO Develops Atomic Clock for
Indigenous Navigation Satellites
• ISRO has developed an atomic clock
that will be used in navigation
satellites to measure precise location
data.
• The space agency currently imports
atomic clocks from European
aerospace manufacturer Astrium for
its navigation satellites.
• Ahmedabad-based Space Applications
Centre (SAC) of ISRO has developed
an indigenous atomic clock and this
clock is currently undergoing a series
of qualification tests.
• With the development of the desi
atomic clock, ISRO has become one of
the few space organisations in the
world which have gained the
capability to develop this highly
sophisticated technology.
• All seven navigation satellites
launched earlier as part of Indian
Regional Navigation Satellite System
(IRNSS) or NaVIC have three
imported Rubidium atomic clocks
each.
• The time difference between the
atomic clocks of different satellites
positioned at different orbits are used
to measure the accurate positioning of
a navigation receiver or an object on
the Earth.
• Besides atomic clocks, a navigation
satellite also has crystal clocks but
they are not accurate as atomic
clocks.
Topic- GS-3- Science and Technology
Source- Times of India
5. What is the reason behind the fall
in water reserves?
What is it?
• According to a sample assessment in
2011, groundwater in 19 of India’s 71
districts were exploited, meaning that
nearly as much or more water was
being pulled out than their reservoirs’
natural rechargeability.
• Groundwater is exploited unequally.
The maximum overdraft is in the
northwestern States of Rajasthan,
Punjab and Haryana.
• The latter two are key wheat
granaries and, despite developed
canal-networks, rely extensively on
groundwater.
www.gradeup.com
19
• The overall contribution of rainfall to
the country’s annual groundwater
resource is 68%, and the share of
other resources, such as canal
seepage, return flow from irrigation,
recharge from tanks, ponds and water
conservation structures, taken
together is 32%.
• Moreover, the population increase has
meant that the national per capita
annual availability of water has
reduced from 1,816 cubic meters in
2001 to 1,544 cubic metre in 2011, a
15% reduction.
How has this come about?
• Over the last two decades, an overall
decline in the quantum of pre-
monsoon rainfall has increased
dependence on groundwater.
• The immediate signs of deficit are
visible in water storage.
• According to figures from the Central
Water Commission, India’s key
reservoirs are, as of this week, 10%
short of their decadal average for this
time of the year.
Why does this matter?
• Other than groundwater being a
reserve to be used judiciously, over-
exploitation poses health risks.
• West Bengal, Odisha, Uttar Pradesh,
Bihar and Jharkhand face severe
problems of arsenic contamination,
and one of the causes is drawing
water from increasingly greater
depths.
• Punjab and Haryana have for years
reported a spike in cancer cases owing
to chemical fertilisers leaching into
the soil.
What lies ahead?
• There have been several attempts to
get the States to use groundwater
more responsibly.
• The Centre has a ‘model’ groundwater
Bill that is not binding on the States.
• However, 11 States and four Union
Territories have adopted it.
• But the legislation has had limited
impact on groundwater exploitation.
• Currently, the owner of a piece of land
is deemed the owner of the
groundwater below it.
• This Bill attempts to put the State as
the custodian of the groundwater.
Topic- GS-1- Distribution of key natural
resources
Source- The Hindu
6. First organised census for Indus
dolphins to be carried out in India
• For the conservation of Indus dolphins
- one of the world’s rarest mammals -
the Punjab government along with
WWF-India are conducting the first
organised census on their population.
• It is found only in India and Pakistan,
the Indus dolphins are confined to
only a 185 km stretch between
Talwara and Harike Barrage in India’s
Beas river in Punjab.
• The most flourishing population of the
Indus dolphin, platanista gangetica
minor, is found across.
• In India, a tiny population survives in
this small stretch of the Beas river.
• Dolphins are a key indicator of river
health.
• A blind species that communicates
through echo like bats do, Indus
dolphins are one of the seven
freshwater dolphins found across the
world.
• It is categorized as Endangered in
RED data list of IUCN.
Topic- GS-3-Biodiversity
Source- Hindustan Times
09.05.2018
1. India ranked 4th in Asia-Pacific
on power index
• India has ranked 4th out of 25 nations
in the Asia-Pacific region on power
index.
• The index is measured by The Lowy
Institute, an Australian think tank.
www.gradeup.com
20
• A country’s overall power is its
weighted average across eight
measures of power - economic
resources, military capability,
resilience, future trends, diplomatic
influence, economic relationships,
defence networks and cultural
influence.
What overall report says?
• Japan and India share major power
status.
• The United States remains the pre-
eminent power in Asia, while China,
the emerging superpower, is rapidly
closing in on the United States.
• Three of the world’s four largest
economies are in Asia, and the fourth,
the United States, is a Pacific power.
What report says specifically about
India?
• India is ranked fourth on the
parameters economic resources,
military capability, diplomatic
influence and fifth on resilience.
• It scores well on the parameters of
cultural influence and future trends,
ranking third in both.
• India ranks third for its aggregate
resources score and is set to become
the fastest-growing economy in the
region, predicted to grow 169 percent
between 2016 and 2030.
• However, it scores low on the
measure of economic relationships,
ranking 7th and in defence networks,
ranking 10th.
Topic- GS-3- Economic Development
Source- Economic Times
2. 'One Stop Centres (OSCs)' for
women in 100 more districts
• Ministry of Women and Child
Development approved 100 additional
One Stop Centres for the states of
Haryana, Himachal Pradesh, Madhya
Pradesh, Maharashtra, Mizoram,
Nagaland, Odisha, Tamil Nadu and
Uttar Pradesh.
• The objectives of the Scheme are:
(i) To provide integrated support and
assistance to women affected by
violence, both in private and public
spaces under one roof.
(ii) To facilitate immediate,
emergency and non-emergency
access to a range of services including
medical, legal, psychological and
counselling support under one roof to
fight against any forms of violence
against women.
• The scheme is implementing through
States through the Nirbhaya Fund.
• The Central Government provide
100% financial assistance.
• The Ministry is implementing Scheme
for setting up One Stop Centre since
1st April 2015.
Topic- GS-3- Welfare Schemes
Source-PIB
3. China launched new satellite
“Gaofen-5” to monitor air
pollution
• China successfully launched a
hyperspectral imaging satellite for
comprehensive observation of the
atmosphere, including air pollution
which is one of the country's major
problems.
• The Gaofen-5 satellite was launched
from a March 4C rocket from the
Taiyuan Satellite Launch Center in
northern Shanxi Province.
• The satellite can be used for
comprehensive environmental
monitoring.
• Gaofen-5 is able to obtain spectral
information from ultraviolet to long-
wave infrared radiation.
• It is the world's first full-spectrum
hyperspectral satellite for
comprehensive observation of the
atmosphere and land.
Topic- GS-3- Science and Technology
Source- DD News
www.gradeup.com
21
4. Government signed the $200mn
loan agreement with World Bank
for POSHAN Abhiyaan
• The government signed loan deal
worth 200 million dollars with World
Bank for the National Nutrition Mission
POSHAN Abhiyaan.
• The loan will help in achieving its goal
of reducing stunting in children up to
6 years of age from 38.4 percent to
25 percent by 2022.
Related Information
POSHAN (PM’s Overarching Scheme for
Holistic Nourishment) scheme
• POSHAN Abhiyaan was launched by
the Prime Minister in Jhunjhunu on
8th March 2018.
• It is a scheme under Ministry of
Women and Child Development.
• The Executive Committee is the Apex
body under the POSHAN Abhiyaan.
• National Council on India’s nutritional
challenges under, NITI Aayog, also
has been set up under the POSHAN
Abhiyaan.
• The scheme aims to ensure holistic
development and adequate nutrition
for pregnant women, mothers and
children.
• It also targets to reduce the level of
stunting, under-nutrition, anaemia
and low birth rate.
• The following nutrition strategies and
interventions include under Abhiyaan-
(a) Supplementary nutrition
(b) Adolescent nutrition
(c) IYCF (Infant and Young Child
Feeding) immunisation
(d) Maternal health etc.
Topic- GS-2- Welfare Schemes
Source- DD News
5. NABH (Nextgen Airports for
Bharat) Nirman initiative
• Shri Suresh Prabhu, Minister for Civil
Aviation said that the government is
committed to the building of airport
capacity as part of NABH (NextGen
Airports for Bharat) Nirman initiative.
• The three key aspects of NABH
Nirman are-
(1) Fair and equitable land acquisition
(2) Long-term master plan for the
airport and regional development and
(3) Balanced economics for all
stakeholders.
• Other objectives are-Improving
passenger amenities, promoting
cargo handling facilities and early
operationalisation of 56 new airports
under UDAN scheme.
Topic- GS-2- Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source-PIB
6. Rajasthan Institute comes up
with new sheep insemination
technique
• Scientists at the Central Sheep and
Wool Research Institute (CSWRI),
Avikanagar, have come up with a new
laparoscopic-assisted insemination
technique for sheep.
• The new technique has resolved the
difficulties involved in the freezing of
semen and inability to transit the
tortuous reproductive tract of the
ruminant mammals kept as livestock.
• The minor invasive laparoscopic
technique involves passing a rigid
fibre-optic laparoscope into the
abdomen through a small incision.
• The new technique would help achieve
up to 60% survival in the birth of
lambs and would have an immense
potential for rapid multiplication of
elite germplasm.
Related Information
Central Sheep and Wool Research
Institute
• The Central Sheep and Wool Research
Institute is a premier institute of
Indian Council of Agricultural
Research engaged in research,
training and extension activities on
sheep and rabbits.
www.gradeup.com
22
• It is located in Avikanagar in district
Tonk of Rajasthan.
Important ICAR institutions
Indian Agricultural
Research Institute New Delhi
Indian Veterinary
Research Institute
Bareilly, Uttar
Pradesh
National Dairy Research
Institute Karnal, Haryana
Central Institute of
Fisheries Education
Mumbai,
Maharashtra
Central Institute for
Research on Buffaloes Hissar, Haryana
Central Institute of Cotton
Research
Nagpur,
Maharashtra
Central Sheep and Wool
Research Institute
Avikanagar,
Rajasthan
Indian Institute of
Horticultural Research
Bengaluru,
Karnataka
Indian Institute of Spices
Research Calicut, Kerala
Indian Institute of
Sugarcane Research
Lucknow, Uttar
Pradesh
Insemination
• It is the deliberate introduction of
sperm into a female animal or plant
for the purpose of impregnating or
fertilizing the female for sexual
reproduction.
Topic- GS-3- Agriculture
Source- The Hindu
10.05.2018
1. Bogibeel, India's longest road-rail
bridge
• In a major boost to defence logistics
along the border with China, India's
longest road and railway
bridge connecting Dibrugarh in
Assam to Pasighat in Arunachal
Pradesh is likely to be inaugurated
later this year by Prime Minister
Narendra Modi.
• The bridge will be the second longest
in Asia.
• It will be the longest combined rail
and road bridge in India and second
longest bridge over the Brahmaputra
after Dhola-Sadiya Bridge which is a
road bridge of length 9.15 km.
• The bridge is 32 metres above the
water level of the Brahmaputra.
Related Information
• India and China share a nearly 4,000
km border, with almost 75 percent in
Arunachal Pradesh.
• As of now, the rail and road link to
Arunachal is through three Assam
bridges -- Jogighopa in Bongaigaon
district, Saraighat near Guwahati, and
Kolia-Bhomora between Sonitpur and
Nagaon.
• The other alternative is crossing by
ferry, but it is not suitable for heavy
cargo.
• Bogibeel is part of infrastructure
projects planned by India to improve
logistics along the border in Arunachal
Pradesh.
Topic- GS-3- Infrastructure: Energy, Ports,
Roads, Airports, Railways etc.
Source- Economic Times
2. What Donald Trump’s pull-out
from Iran deal means for India?
• Recently, President Donald Trump
announced US withdrawal from the
2015 landmark nuclear deal with Iran.
What is the nuclear deal from which
President Donald Trump on Tuesday
pulled the United States?
• It is officially called the Joint
Comprehensive Plan of Action
(JCPOA), and informally the ‘Iran
nuclear deal’.
• It was signed between Iran and the P5
(the five permanent members of the
United Nations Security Council — US,
China, France, Russia, and the UK),
plus Germany and the European
Union, in Vienna on July 14, 2015.
www.gradeup.com
23
• The deal, aimed at preventing Iran
from building a nuclear weapon,
involved lifting of international
sanctions in return for Tehran curbing
its nuclear programme.
Why the US withdraw from the deal?
• The Trump administration says the
deal did not target-
(a) Iran’s ballistic missile programme
(b) Its nuclear activities beyond 2025
and
(c) Its role in conflicts in Yemen and
Syria.
Why is India concerned?
• Iran is India’s third-largest oil supplier
after Iraq and Saudi Arabia.
• India is developing Chabahar as the
beginning of a route to strife-torn,
landlocked Afghanistan that bypasses
Pakistan, and as a gateway to Central
Asia. It is both a financial and a
strategic investment.
• Destabilise the region where over 8
million Indian migrants live and work.
Topic-GS-2- Effect of policies and politics of
developed and developing countries on
India’s interests, Indian diaspora.
Source- Indian Express
3. Uttar Pradesh plans to raise Rs
12,000 crore for India’s longest
expressway
• The UP govt is looking to raise Rs
12,000 crore to fund the construction
cost of the country’s longest
expressway, the upcoming 341-
km Poorvanchal Expressway from
Lucknow to Ghazipur.
• It is one of the most expensive
expressways in the country, pegged
at a total of Rs 23,349 crore with
construction cost alone estimated at
Rs 11,718 crore.
• The expressway will connect nine
agriculturally predominant districts to
the state capital, is expected to be
completed in 2021.
Topic- GS-3- Infrastructure: Energy, Ports,
Roads, Airports, Railways etc.
Source- Economic Times
4. Madhya Pradesh launched India's
First Smart Cities Control Centre
• The Madhya Pradesh government
launched the country's first
Integrated Control and Command
Centre (ICCC) for all seven smart
cities of the state in Bhopal.
• The ICCC would enable the authorities
to monitor the status of various smart
civic amenities in real-time through
the sensors connected to it.
• Bhopal, Indore, Ujjain, Gwalior,
Jabalpur, Satna, and Sagar are the
seven smart cities under SCM (Smart
Cities Mission) in Madhya Pradesh.
• Ninety cities of the country have been
selected under the SCM.
Related Information
Integrated Control and Command Centre
(ICCC)
• ICCC is a cloud-based Universal
Internet of Things (UIoT) platform
developed by Hewlett Packard
Enterprise (HPE).
Smart City Mission
• Smart Cities Mission is an urban
renewal and retrofitting program by
the Government of India with the
mission to develop 100 cities across
the country making them citizen
friendly and sustainable.
• The Union Ministry of Urban
Development is responsible for
implementing the mission in
collaboration with the state
governments of the respective cities.
• Ninety cities of the country have been
selected under the SCM.
• The objective is to promote cities that
provide core infrastructure and give a
decent quality of life to its citizens, a
clean and sustainable environment
and application of ‘Smart’ Solutions.
Topic- GS-3- E-governance
Source- NDTV
5. MeitY launched internship scheme
‘Digital India Internship Scheme’
for Tech students
www.gradeup.com
24
• Ministry of Electronics and
Information technology (MeitY) has
launched ‘Digital India Internship
Scheme’ portal in which a token of
₹10,000 will also be offered to interns
as remuneration per month.
• The portal will facilitate students to
apply online for internship and its aim
is to provide an opportunity to secure
first hand and practical work
experience under the guidance of a
mentor.
• The internship scheme will enable the
young students to learn closely about
working of the transformative
initiative of Digital India.
• It will also give exposure to the
students about technology policy and
decision making of the government of
India.
Topic- GS-2- Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source- The Hindu Business line
6. A whale of a conservation effort
• The whale shark, the largest living
species of fish, comes under the
category ‘endangered’ in The
International Union for Conservation
of Nature (IUCN) Red List.
• In India, the migratory species is
listed in Schedule I (Part IIA) of the
Indian Wildlife (Protection) Act, 1972,
which is the highest protection status
for any living species in the country.
• But the fishing community in Kerala
seems to have no clue about these
facts, their unregulated practices
causing a significant decline in the
whale shark population.
• They will be educated on how to save
the fish from regional extinction as
part of a campaign jointly launched by
the Wildlife Trust of India (WTI) and
Cochin Shipyard Limited (CSL).
Topic- GS-3- Biodiversity
Source- The Hindu
11.05.2018
1. Creation of Directorate General of
Trade Remedies (DGTR) in
Department of Commerce
• The Government of India carried out
an Amendment to the Government of
India (Allocation of Business) Rules,
1961 on May 7, 2018, substituting
“DGTR” in place of “DGAD” in
Department of Commerce.
• This has paved way for the creation of
an integrated single umbrella National
Authority to be called the Directorate
General of Trade Remedies (DGTR)
for providing comprehensive and swift
trade defence mechanism in India.
• The amendment of Allocation of
Business Rules has also mandated
Department of Commerce with work
pertaining to the recommendation of
Safeguard measures.
What is the current scenario?
• Presently, the trade defence
mechanism in India lacks optimality
and takes more than a year to
complete proceedings in cases
pertaining to unfair trade practices.
• Currently-
(a) The Directorate General of Anti-
dumping and Allied Duties (DGAD)
deals with anti-dumping and CVD
cases
(b) Directorate General of Safeguards
(DGS) deals with safeguard measures
and DGFT deals with quantitative
restriction (QR) safeguards.
How will it improve the system?
• The DGTR will bring DGAD, DGS and
Safeguards (QR) functions of DGFT
into its fold by merging them into one
single national entity.
• DGTR will deal with Anti-dumping,
CVD and Safeguard measures.
• It will also provide trade defence
support to our domestic industry and
exporters in dealing with increasing
instances of trade remedy
investigations instituted against them
by other countries.
www.gradeup.com
25
• The creation of DGTR will provide a
level playing field for the domestic
industry.
How will it work?
• The DGTR will function as an attached
office of Department of Commerce.
• The recommendation of DGTR for the
imposition of Anti-dumping,
countervailing & Safeguard duties
would be considered by the
Department of Revenue.
• The DGTR will be a professionally
integrated organisation with multi-
spectrum skill sets emanating from
officers drawn from different services
and specialisations.
Topic- GS-3- Indian Economy
Source-PIB
2. India all set for a deep dive into
the ocean
• India’s ambitions to send humans into
the deep sea and explore resources in
the depths is gathering momentum.
• A ‘Manned Submersible’, which can
take a three-member scientific crew
down below, is taking shape.
• The project is part of the overall, long-
term “Deep Sea Mission” and efforts
to tap into the blue ocean economics.
• The Union Ministry of Earth Sciences,
which has embarked on this project,
expects to have an operational vehicle
ready in 2-3 years.
• The design for making the
submersible from titanium material
that will have two hemispheres
welded together in the form of a
spaceship has been made by the
ESSO-National Institute of Ocean
Technology (NIOT), Chennai.
Current Initiative
• The Department has been conducting
surveys for polymetallic nodules and
hydrothermal sulphides in volcanic
plumes in designated areas of the
Indian Ocean with the International
Seabed Authority.
• The Oceanographic Ship,
‘SagarKanya’, has been operating for
several years now in the explorations.
• The targeted depth to be reached is 5-
6 km into the sea, where the resource
availability, living organisms,
environmental conditions, etc, are to
be studied. and understood.
• The development of the Submersible
with the capacity to carry one pilot
and two scientists will be taken up
with a joint venture partner. Initially,
the Submersible will reach up to a km
for preliminary studies.
Scope for India
• With 95 percent of the deep sea
remaining unexplored, the venture is
promising and India can have an
early-mover advantage.
• At present, a few countries, such as
the US, Russia, China and Japan are
said to possess the technology and
submersible.
• They have also undertaken some
expeditions.
Topic-GS-1- Distribution of key natural
resources across the world (including South
Asia and the Indian subcontinent)
Source- The Hindu Business Line
3. Bonn climate meet ends amid
concern over lack of urgency in
accelerating negotiations
• Government representatives from
over 190 countries, including India
met in Bonn, Germany for next round
of UN climate change negotiations, to
develop guidelines for implementing
the 2015 Paris Agreement post-2020.
What are the outcomes of Bonn Climate
meet?
• The main agenda of the recently
concluded talks was to put together
the contents of a negotiating text that
would be presented for political
discussions at the 24th session of the
Conference of Parties in December
2018 Katowicze, Poland.
www.gradeup.com
26
• With respect to the agenda, the
outcome at the end of the two weeks
has been a lukewarm one.
• While progress has been made
regarding the ‘rule book’ or
implementation guidelines, much
remains to be done.
Related Information
UNFCC (United Nations Framework
Convention on Climate Change)
• The United Nations Framework
Convention on Climate Change
(UNFCCC) is an international
environmental treaty adopted on May
9, 1992 and opened for signature at
the Earth Summit in Rio de Janeiro
from 3 to 14 June 1992.
• The UNFCCC objective is to "stabilize
greenhouse gas concentrations in the
atmosphere at a level that would
prevent dangerous anthropogenic
interference with the climate system".
• The parties to the convention have
met annually from 1995
in Conferences of the Parties
(COP) to assess progress in dealing
with climate change.
• Example- COP 23- 23rd session of the
Conference of Parties (COP)
Aims of Paris Climate Accord (COP 21)
• Global temperature rises this century
well below 2 degrees Celsius above
the pre-industrial level.
• Pursue efforts to limit the
temperature upsurge even further
to 5 degrees Celsius.
• Strengthen the ability of countries
to deal with the impacts of climate
change.
India’s target in Nationally Determined
Contributions (INDCs)
• India had promised to reduce its
emissions intensity- greenhouse
gas emissions per unit of GDP- by
33 to 35 percent below 2005
levels by the year 2030.
• It had also promised to ensure that at
least 40 percent of its energy in
2030 would be generated from
non-fossil fuel sources, like solar,
wind or biofuels.
• In addition, it had said it would
rapidly increase its forest cover so
that an additional carbon sink
equivalent to 2.5 to 3 billion
tonnes of carbon dioxide is
created by the year 2030.
Topic- GS-3- Environment
Source- Down to Earth
4. National Technology Day- May 11
• National Technology Day is celebrated
every year on May 11.
• On this day in 1998, India successfully
tested its nuclear bombs in Pokhran,
Rajasthan.
• India conducted five underground
nuclear tests at Pokhran test range in
Rajasthan, on 11th and 13th of May in
1998.
• The tests were conducted under the
leadership of Former President Dr A.
P. J. Abdul Kalam, who was then
DRDO Chief, and Dr R Chidambaran,
then Chairman of Atomic Energy
Commission.
Topic- GS-3- Technology
Source- AIR
5. Telangana CM launches
investment support scheme
“'Rythu Bandhu” for farmers
• Telangana govt. launched an
investment support scheme for
farmers, claimed to be the first such
initiative in the country.
• Under the scheme 'Rythu Bandhu'
(friend of farmers), Rs 8,000 per acre
per year will be given to all farmers
who own land.
• The scheme shall not be extended to
tenant farmers.
Topic- GS-2- Welfare Schemes
Source- Business Standards
www.gradeup.com
27
12.05.2018
1. India diverted 10 million hectares
of productive agri-lands, replaces
them with barren lands for
cultivation
• In the reports of the Committee on
Doubling farmers’ Income, the
Committee has found a systemic
change in land use that has been
hurting farmers’ income.
• According to this report, India has
been diverting large tracts of
productive agricultural lands for other
purposes like making way for new
townships and to accommodate
expanding settlements besides being
given for industrial purposes.
• More and more barren and
uncultivable lands are being brought
under farming.
• This has impacted the farmers’
productivity, income security and also
the viability of cultivation.
Important Facts
• Since 1970-71, the area under non-
agriculture has increased by 10
million hectares (mha).
• On the other hand, during the same
period (1971-2011-12), lands under
the barren and uncultivated category
have declined from 28.16 mha to
17.23 mha.
• The report argues that given India’s
net-cultivated area remaining the
same, this indicates farmers are now
more dependent on barren and
uncultivable lands for survival.
Related Information
Land put to Non-agricultural Uses
• Land under settlements (rural and
urban), infrastructure (roads, canals
etc.), industries, shops, etc. are
included in this category.
• An expansion in the secondary and
tertiary activities would lead to an
increase in this category of land-use.
Barren and Wastelands
• The land which may be classified as a
wasteland such as barren hilly
terrains, desert lands, ravines, etc.
normally cannot be brought under
cultivation with the available
technology.
Area under Permanent Pastures and
Grazing Lands
• Most of this type of land is owned by
the village ‘Panchayat’ or the
Government.
• Only a small proportion of this land is
privately owned.
• The land owned by the village
panchayat comes under ‘Common
Property Resources’.
Culturable Waste-Land
• Any land which is left fallow
(uncultivated) for more than five
years is included in this category.
• It can be brought under cultivation
after improving it through reclamation
practices.
Current Fallow
• This is the land which is left without
cultivation for one or less than one
agricultural year.
• Fallowing is a cultural practice
adopted for giving the land rest.
• The land recoups the lost fertility
through natural processes.
Fallow other than Current Fallow
• This is also a cultivable land which is
left uncultivated for more than a year
but less than five years.
• If the land is left uncultivated for more
than five years, it would be
categorised as culturable wasteland.
Net Area Sown
• The physical extent of land on which
crops are sown and harvested is
known as net
sown area.
Topic- GS-3- Agriculture
Source- Down To Earth + NCERT
2. Govt. approves green licence
plates for e-vehicles
www.gradeup.com
28
• To promote electric vehicles in India,
the government has approved green
licence plates bearing numbers in
white fonts for private e-vehicles and
yellow for taxis.
• The government also plans to allow
youth in the age bracket of 16-18
years to drive electric scooters,
besides mandating taxi aggregators
to have a certain percentage of the e-
vehicle fleet.
• The measure is aimed at promoting e-
vehicle’s use and the government is
considering the exemption from
permits for such vehicles.
• The purpose behind distinctive
number plates is their easy
identification for preferential
treatment in parking, free entry in
congested zones besides other
proposed benefits like the
concessional toll.
Related Information
• India, currently, has four kinds of
number plates-
(a) White licence plates with numbers
on the black font for private cars
(b) Yellow plates with fonts in black
for commercial vehicles
(c) Black plates with yellow font
letters for self-driven rental vehicles
and
(d) Blue plates with white font letters
for Embassies and High Commissions.
• Army vehicles, on the other hand,
follow a different registration system
given by the Defence Ministry, while
vehicles of the President and
governors have red licence plates with
the national emblem.
Topic- GS-2-Government policies and
interventions for development in various
sectors
Source- The Hindu
3. NFR submits studies to extend rail
connectivity to Bhutan
• The Northeast Frontier Railway has
submitted feasibility studies to the
Ministry of External Affairs to extend
rail connectivity to Bhutan.
• At present, there is no rail link
between the two countries.
• As part of the Centre’s Act East policy
to boost ties with South Asian
neighbours through North Eastern
region, the Indian Railways has
completed groundwork for extending
rail connectivity to Nepal, Bhutan,
Bangladesh and Myanmar.
Topic- GS-3-Bilateral, regional and global
groupings and agreements involving India
and/or affecting India’s interests
Source- The Hindu Business Line
4. Exiled asteroid discovered in
outer reaches of solar system
• Scientists have found a carbon-rich
asteroid that was flung into the outer
reaches of the solar system and may
provide new insights into the
formation of the Sun and its planets.
• Astronomers used European Southern
Observatory (ESO) telescopes to
investigate Kuiper Belt Object 2004
EW95 – the first of its kind asteroid to
be confirmed in the cold outer reaches
of the solar system.
• The object likely formed in the
asteroid belt between Mars and
Jupiter and has been flung billions of
kilometres from its origin to its
current home in the Kuiper Belt.
• These models suggest that the Kuiper
Belt – a cold region beyond the orbit
of Neptune – should contain a small
fraction of rocky bodies from the inner
Solar System, such as carbon-rich
asteroids, referred to as
carbonaceous asteroids.
• The study found evidence for the first
reliably-observed carbonaceous
asteroid in the Kuiper Belt, providing
strong support for these theoretical
models of our Solar System’s troubled
youth.
Topic- GS-3- Science and Technology
Source- Indian Express
www.gradeup.com
29
14.05.2018
1. India’s global poverty rank
improves
• India’s Multidimensional Poverty
(MDP) has dropped significantly,
largely as a result of the performance
of five key southern States (Kerala,
Tamil Nadu, Karnataka, Telangana
and Andhra Pradesh.)
• Between 2005-06 to 2015-16,
poverty level came down from 55% to
21%, improving the country’s MDP
ranking.
• Following the drop-in poverty levels,
India moved to the 26th rank from its
earlier 54, in a decade, among 102
developing countries with MDP.
Important Facts
• While the national average is 21%, in
the five southern States (Kerala,
Tamil Nadu, Karnataka, Telangana
and Andhra Pradesh) the average
MDP is 9%. However, poverty levels
have dropped in all States.
• Kerala has an MDP of 1%, Tamil Nadu
(6%), Karnataka (11%), Telangana
(14%) and Andhra Pradesh (13%) are
also significantly low.
• Bihar is the poorest State with 43%
incidence of poverty.
• Jharkhand (36%), Uttar Pradesh
(31%), Rajasthan (31%) and Odisha
(29%) are also above the national
average (21%),
• Of 640 districts, 31 districts — all in
eastern or central India — have over
50% MDP.
• The top five districts with the largest
prevalence of MDP are in Shravasti,
Baharaich and Balrampur in Uttar
Pradesh, and Alirajpur and Jhabua in
Madhya Pradesh.
• Chhattisgarh, which is affected by Left
Wing insurgency, has done well,
bringing down its poverty level from
71% to 22%.
Multidimensional Poverty (MDP)
• MDP is “an international measure of
acute poverty” based on three key
categories-
(a) Health
(b) Education and
(c) Living standards
Related Information
Global Multidimensional Poverty Index
(MPI)
• MPI was developed in 2010 by the
Oxford Poverty & Human
Development Initiative (OPHI) and
the United Nations Development
Programme.
• It replaced the previous Human
Poverty Index.
• The global MPI is released annually by
OPHI and the results published on its
website.
• The index uses the same three
dimensions as the Human
Development Index: health,
education, and standard of living.
Topic- GS-2- Issues relating to poverty and
hunger.
Source- The Hindu
2. UNDP to set up Skill development
centre in Hyderabad
• The United Nations Development
Programme (UNDP) will soon set up a
skill development centre at 'Bharosa'
an integrated support centre for
distressed women and children here.
• The Skill development centre aimed at
empowering vulnerable and
marginalised women by imparting
skills training,
• The agreement extends support to
enable these women to learn
marketable skills and connect with
income opportunities.
• 'Bharosa' provides under one roof,
24X7 services related to police,
medical, legal, prosecution, psycho-
therapeutic counselling and relief and
rehabilitation services in completely
private counselling rooms to maintain
confidentiality and privacy.
www.gradeup.com
30
Related Information
• Last year, the Hyderabad Police had
signed an agreement with UNDP
under the 'Disha' project to build
capacities and skills of women
affected by violence to help make
them economically self-sufficient.
Topic- GS-2- Government policies and
interventions for development in various
sectors
Source- Deccan Herald
3. Nepal to host BIMSTEC 2018
• Nepal's Prime Minister KP Sharma Oli
announced to host the 2018 Bay of
Bengal Initiative for Multi-Sectoral
Technical and Economic Cooperation
(BIMSTEC) summit.
Related Information
BIMSTEC-
• The Bay of Bengal Initiative for Multi-
Sectoral Technical and Economic
Cooperation (BIMSTEC) is an
international organisation involving a
group of countries in South Asia and
South-East Asia.
• These 7 countries are Bangladesh,
India, Myanmar, Sri Lanka, Thailand,
Bhutan and Nepal.
• The BIMSTEC states are among the
countries dependent on the Bay of
Bengal.
• Its secretariat is located in Dhaka,
Bangladesh.
• BIMSTEC uses the alphabetical order
for the Chairmanship.
Topic- GS-2- Important International
institutions
Source- Indian Express
4. India largest remittance-
receiving country in the world
• The report 'RemitSCOPE - Remittance
markets and opportunities - Asia and
the Pacific' said India (USD 69 billion),
China (USD 64 billion) and the
Philippines (USD 33 billion) are the
three largest remittance- receiving
countries in the world in 2017.
• The report said remittances to the
Asia-Pacific region amounted to USD
256 billion last year.
• About 70 percent of remittances sent
to Asia and the Pacific come from
outside the region and in particular
from the Gulf States (32 percent),
North America (26 percent) and
Europe (12 percent).
• Remittances are particularly crucial in
rural areas where poverty is the
highest.
• The report is released by the
International Fund for Agricultural
Development (IFAD).
Related Information
International Fund for Agricultural
Development (IFAD)
• It is an international financial
institution and a specialised agency of
the United Nations dedicated to
eradicating poverty and hunger in
rural areas of developing countries.
• It was established as an international
financial institution in 1977 as one of
the major outcomes of the 1974
World Food Conference.
• Its headquarters is in Rome, Italy, and
is a member of the United Nations
Development Group.
• Through loans and grants, IFAD works
with governments to develop and
finance programmes and projects that
enable rural poor people to overcome
poverty themselves.
• Membership in IFAD is open to all
member states of the United Nations
or its specialised agencies or the
International Atomic Energy Agency.
• The Governing Council is IFAD's
highest decision-making authority,
with the Member States each
represented by a governor and
alternate governor.
Topic- GS-3- Economic Development
Source- Economic Times
www.gradeup.com
31
5. Make India observer in the forum
of Islamic nations: Bangladesh
• Bangladesh has called for reforms in
the Organisation of Islamic
Cooperation that can pave the way for
countries like India, which are not
Muslim majority, to get an observer
seat in the OIC.
• Though Pakistan is unlikely to
welcome the proposal as it uses the
forum to regularly target India.
• China has also put forward the
“inclusion” argument to say that large
Muslim populations should not be
denied a say at the OIC.
• Muslims in India constitute 10% of the
global adherents of the faith.
• In terms of Muslims as a percentage
of the global population, India ranks
third after Indonesia and Pakistan.
Related Information
Organisation of Islamic Cooperation
(OIC)
• It is an international organization
founded in 1969, consisting of 57-
member states, with a collective
population of over 1.6 billion as of
2008.
• The organisation states that it is "the
collective voice of the Muslim world"
and works to "safeguard and protect
the interests of the Muslim world in
the spirit of promoting international
peace and harmony".
• The OIC has permanent delegations
to the United Nations and the
European Union.
• The official languages of the OIC are
Arabic, English, and French.
• Its headquarter is in Jeddah, Saudi
Arabia.
Topic- GS-2- Important International
institutions, agencies and fora- their
structure, mandate.
Source- Times of India
6. ISRO making green propellant
• Scientists at the Indian Space
Research Organisation (ISRO) have
reported progress in the development
of an environment-friendly propellant
to power satellites and spacecraft.
• The effort is to replace
the conventional hydrazine rocket
fuel, a highly toxic and carcinogenic
chemical, with a greener propellant
for future missions.
• Initial tests by a research team at the
Liquid Propulsion Systems Centre
(LPSC) have shown promising results
in the formulation and associated
tests of a propellant blend based
on hydroxylammonium nitrate
(HAN).
• Due to its high-performance
characteristics, hydrazine has
dominated the space industry as the
choice of propellant for over six
decades, despite its environmental
and health hazards and the challenges
faced in its manufacturing, storage,
ground handling and transportation.
• The LPSC team formulated the HAN-
based monopropellant and carried out
a variety of tests to investigate its
characteristics, like thermal and
catalytic decomposition and
compatibility with different materials.
Other facts
• The in-house formulation consists of
HAN, ammonium nitrate, methanol
and water.
• While methanol was added to reduce
combustion instability, the choice of
HAN was dictated by its capacity to
control the burn rate and lower the
freezing point of the propellant.
Related Information
Monopropellant
• It is a chemical propulsion fuel which
does not require a separate oxidizer.
• It is used extensively in satellite
thrusters for orbital correction and
orientation control.
Topic- GS-3- Science and Technology
Source- The Hindu
www.gradeup.com
32
15.05.2018
1. WHO launched plan 'REPLACE' to
eliminate trans fat in foods by
2023
• The World Health Organization (WHO)
has launched a comprehensive plan to
eliminate industrially-produced
artificial trans fats from the global
food supply by 2023.
• The UN body has released a step by
step guide for the industry to
eliminate trans fats from the food.
• The guide, called REPLACE, has six
actions, which include-
(a) REview of dietary sources of trans
fats
(b) Promoting replacement with
healthier fats
(c) Setting up a regulatory framework
(d) Assessing and monitoring trans
fats content in food
(e) Creating awareness and enforcing
the regulation
(f) Enforce compliance with policies
and regulations.
What are the issues with trans fat?
• For long, industrially-produced trans
fats in food have been linked to health
problems.
• Consumption of trans fats increases
the level of bad LDL-cholesterol which
is an accepted biomarker of
cardiovascular diseases.
• The World Health Organization (WHO)
estimates that trans fats lead to more
than 500,000 deaths due to
cardiovascular disease.
• It has been seen that diets high in
trans fat can increase the risk of heart
disease by 21 percent and deaths by
28 percent.
Why is the industry produced trans fat
are more harmful?
• Though natural trans fats from dairy
products are also part of the
diet, maximum consumption is in
the form of industrially-produced
trans fats.
• Industrially-produced trans fats are
contained in hardened vegetable fats
such as margarine and ghee and are
often present in snack, baked, and
fried foods.
• Manufacturers often use them as they
have a longer shelf life than other
fats.
Related Information
Trans Fats
• There are two broad types of trans
fats found in foods: naturally-
occurring and artificial trans fats.
• Naturally-occurring trans fats are
produced in the gut of some animals
and foods made from these animals
(e.g., milk and meat products) may
contain small quantities of these fats.
• Artificial trans fats (or trans fatty
acids) are created in an industrial
process that adds hydrogen to liquid
vegetable oils to make them more
solid.
Topic- GS-2- Issues relating to development
and management of Social Sector/Services
relating to Health, Education, Human
Resources.
Source- DD News + Down to Earth
2. ‘Samarth’- Scheme for Capacity
Building in Textile Sector
• A meeting of stakeholders on Samarth
– Scheme for Capacity Building in
Textile Sector under the Skill India
Mission was held in New Delhi to
familiarize the stakeholders about the
scheme and its guidelines.
Related Information
Samarth Scheme
• Cabinet Committee on Economic
Affairs approved the scheme on
December 20, 2017.
• The scheme is intended to provide
demand-driven, placement oriented
National Skills Qualifications
Framework (NSQF) compliant skilling
programmes to incentivize and
supplement the efforts of the industry
in creating jobs in the textiles sectors.
www.gradeup.com
33
• The broad objective of the new
scheme is to skill the youth for gainful
and sustainable employment in the
textile sector covering the entire value
chain of textiles, excluding spinning
and weaving.
Topic- GS-2-Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source-PIB
3. Government announces national
wind-solar hybrid policy
• The government announced a
national wind-solar hybrid policy,
which seeks to promote new projects
as well as hybridisation of the existing
ones.
• The government has set an ambitious
target of achieving 175 gigawatts
(gw) of installed capacity from
renewable energy sources by 2022,
which includes 100 gw of solar and 60
gw of wind power capacity.
• The policy provides a comprehensive
framework to promote large grid-
connected wind-solar photovoltaic
(PV) hybrid system for optional and
efficient utilisation of transmission
infrastructure and land.
• The policy will help in reducing the
variability in renewable power
generation and achieving better grid
stability.
• The policy provides for the
procurement of power from a hybrid
project on the tariff-based
transparent bidding process for which
government entities may invite bids.
• Under the policy which is first, the
government will extend all fiscal and
financial incentives available to wind
and solar power projects to hybrid
projects.
Topic- GS-2-Government policies and
interventions for development in various
sectors and issues arising out of their design
and implementation.
Source- Economic Times
4. Indo-Pacific infrastructure forum
launched to tap private sector in
India, US, Japan
• An Indo-Pacific trilateral
infrastructure forum has been
launched to find new, creative and
efficient ways of leveraging the power
of the private sector in India, the US
and Japan to fill the massive gap in
infrastructure and connectivity in the
region.
• It is launched by the US Chamber of
Commerce's US-India Business
Council (USIBC) along with US-Japan
Business Council, the Indo-Pacific
Infrastructure Trilateral Forum.
• It is a private sector platform that is
seeking to partner with some
government initiatives.
Topic- GS-2- Bilateral, regional and global
groupings and agreements involving India
and/or affecting India’s interests
Source- Economic Times
5. Wildlife network “SAWEN” of
South Asian countries
• The South Asia Wildlife Enforcement
Network (SAWEN), an inter-
governmental wildlife law
enforcement agency, in its first-ever
meeting in India, adopted many
resolutions to curb wildlife crime in
the region.
• During the meet, six proposals,
including tracking of wildlife
smuggling route, review of existing
laws and a structure for the
organisation were tabled.
Related Information
South Asia Wildlife Enforcement
Network (SAWEN)
• South Asia Wildlife Enforcement
Network (SAWEN) is an inter-
governmental wildlife law
enforcement support body of South
Asian countries namely - Afghanistan,
Bangladesh, Bhutan, India, Maldives,
Nepal, Pakistan and Sri Lanka.
www.gradeup.com
34
• SAWEN was launched in Bhutan in
2011 and in 2016 the Union Cabinet
gave permission to adopt the statute
of SAWEN.
• It focuses on policy harmonization;
institutional capacity strengthening
through knowledge and intelligence
sharing, and collaboration with
regional and international partners to
enhance wildlife law enforcement in
the member countries.
• Its Secretariat is located in
Kathmandu, Nepal.
Topic- GS-3- Environment
Source- The Hindu
6. Indian Army Women Officers’
Mountaineering Expedition to Mt.
Bhagirathi-II
• Indian Army Women Officers’
Mountaineering Expedition to Mt.
Bhagirathi-II (6512 metres)
consisting of nine women officers, was
flagged off by Director General of
Military Training on 14 May 2018.
• The expedition aims at encouraging
women in the field of adventure where
dauntless courage, will-power and
determination is put to test. The
Indian Army women officers are
exploring their maximum potential in
the field of adventure sports.
Related Information
• Bhagirathi-II is located in the Garhwal
Himalayas in Gangotri National Park
(Uttarakhand).
Garhwal Himalayas
• The Garhwal Himalayas are mountain
ranges located in the state of
Uttarakhand, India.
• The mountain ranges cross two
regions: Garhwal division and
Kumaon division.
• This range is also a part of Himalaya
Shivalik Hills, the outer most hills of
the Himalaya located in Himachal
Pradesh and Uttarakhand.
Topic- GS-1-Indian Geography
Source-PIB
***
top related