interdisciplinary approaches to metadata
Post on 11-Jan-2017
59 Views
Preview:
TRANSCRIPT
Interdisciplinary Approaches To Metadata
Tom Lombardi
Interdisciplinary Metadata Analysis Washington & Jefferson College Computational Science Understanding computing cultures Bioinformatics and art history
Black Death and its Effect on Iconography
Andrea Orcagna. (1354-1357). Strozzi Altarpiece. Tempera on Wood.
“Certainly there have been plenty of skillful painters, and they have painted in a manner that is impossible for human hand to equal; but this art has grown and continues to grow worse day by day.” ~ Franco Sacchetti (c. 1390) attributed to Taddeo Gaddi
Possible effects of the Black Death New conservatism in technique New workshop practices New markets
Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.
Possible computational approaches Compute vanishing points Connect colors to material culture Measure brushstroke
Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.
Pietro Lorenzetti. (1335-1342). Nativity of the Virgin.
New approach: Focus on art-historical metadata Analyze art historians’ metadata Index of Christian Art William R. Cook. (1996). Images of St. Francis of Assisi in Painting, Stone and Glass from the Earliest Images to Ca. 1320 in Italy. A Catalogue.
Test Case 1: Networks and Iconography
Christ
Mary John
Giotto. (1290-1300). Crucifixion. Tempera on wood.
Clare: 1255
Legenda Maior: 1263
Louis: 1317
Test Case 2: Metadata from the Index of Christian Art
Black Death as a Natural Experiment
1300 - 1349 1350 – 1399 Sailko/CC-BY-SA-3.0
Bioinformatics, Annotations, Ontologies GCATTAATGGCATACGTGGCCCCA
GCAUUAAUGGCAUACGUGGCCCCA
ALALEUMETALATYRVALALAPRO
DNA to RNA (Transcription)
RNA to Amino Acid (Translation)
AA to Protein (Folding)
Differential Expression in Bioinformatics Compare Wild Type and Mutant Plot expression levels in a heat map Label genes with annotations
Differential Expression in Iconography Symbol 1300-1349 1350-1399
Virgin Mary and Christ Child 168 93
Madonna of Humility 2 25
Lawrence of Rome, Deacon 4 25
Fra Angelico. (c. 1430). Madonna of Humility.
Differential Expression in Iconography Symbol 1300-1349 1350-1399 Anthony the Great 7 63
top related