identification of ppp1cc2 interacting proteins in the ... · deletion of the pp1 serine/threonine...
Post on 14-Jul-2020
3 Views
Preview:
TRANSCRIPT
Identification of PPP1CC2 Interacting Proteins in the Mouse
Testis
by
George Graham MacLeod
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Cell & Systems Biology
University of Toronto
© Copyright by George Graham MacLeod 2013
ii
Identification of PPP1CC2 Interacting Proteins in the Mouse Testis
George Graham MacLeod
Doctor of Philosophy
Department of Cell & Systems Biology
University of Toronto
2013
Abstract
Protein phosphorylation is a central regulatory mechanism in countless cellular
processes. Deletion of the PP1 serine/threonine phosphatase gene Ppp1cc in mice results in male
infertility due to a severe impairment in spermatogenesis. This disruption in spermatogenesis is
hypothesized to arise due to a deficiency of the testis specific Ppp1cc isoform PPP1CC2. To
learn more about the function of PPP1CC2 in spermatogenesis, we have employed several
proteomic approaches aimed at identifying both regulatory proteins and substrates that interact
with PPP1CC2 in the testis. First, we created transgenic mouse embryonic stem cell lines
expressing a tandem affinity tagged version of PPP1CC2. Tandem affinity purification using
these cell lines identified a number of known PP1 interacting proteins, and one novel interactor
DDOST (dolichyl-di-phosphooligosaccharide-protein glycotransferase) which we hypothesize
to have a role in spermatogenesis. In a second approach, we conducted GST pull down assays
from mouse testis lysates to identify PPP1CC2 interacting proteins. TSSK1 (testis-specific
serine kinase 1) was identified as a novel PPP1CC2 interacting protein. We then demonstrated
that TSSK1 interacts with PPP1CC2 in an indirect manner via a common interacting protein
TSKS (testis-specific serine kinase substrate). Binding of TSKS to PPP1CC2 is regulated via
iii
phosphorylation of a PP1 docking motif on the TSKS surface, and localization of TSSK1 and
TSKS in the testis is disrupted in Ppp1cc mutants. Finally, to identify candidate substrates of
PPP1CC2 in the testis, we conducted a comparative phosphoproteomic analysis and identified
33 different peptides that were hyperphosphorylated in the testis of 3 week old Ppp1cc knockout
mice. Amongst these candidate substrates are several proteins essential for mouse
spermatogenesis—HMGA1 (high mobility group AT-hook 1), HSPA4 (heat shock protein 4),
YBX2 (Y box protein 2) and SYCP2 (synaptonemal complex protein 2). Taken together, our
results suggest that PPP1CC2 interacts with a number of different proteins in the testis, and is
likely to play a role at several different stages of spermatogenesis, in both meiotic and post-
meiotic spermatogenic cells.
iv
Acknowledgments
I would like to first thank my supervisor, Dr. Sue Varmuza for her support and guidance
throughout my graduate studies. Dr. Varmuza has taught me a great deal about what it takes to be a
successful researcher, and her advice and encouragement were instrumental in the successful completion
of this work. Dr. Varmuza has always allowed me the independence to follow my own ideas, and for that
I feel I have become a much stronger researcher. I am also grateful for the advice and support of my
committee members Dr. Darrell Desveaux and Dr. Tim Westwood, who provided continual support and
helpful advice throughout the past several years; and Dr. Dinesh Christendat and Dr. Greg Moorhead for
serving on my thesis examination committee.
I would like to thank all of the current and past members of the Varmuza Lab, who have made
my stay in the lab thoroughly enjoyable. I would especially like to thank Hannah Henderson, who was
extremely helpful to me in getting started as a graduate student, and Kamelia Miri who has been an
excellent and helpful colleague throughout my time in the lab. I would also like to acknowledge the
contributions of all of the talented undergraduate students who supported my work, especially Richard
Cheng, Lucas Mastropaolo, Gregory Booth and Niloufar Manafpoursakha. In addition I would like to
thank all of the member of the Department of Cell & Systems Biology who helped me in this work,
especially Daniel Rivero for his assistance with maintaining our mouse colony, and Jacky Jhingree and
Dr. Pauline Wang for their help and advice in LC-MS/MS analysis procedures.
This work would not have been possible without the help of all of the researchers mentioned in
the coming chapters who generously provided technical advice and reagents used in my thesis research.
For this, I would particularly like to thank Peng Shang and Dr. J Anton Grootegoed for their
contributions to the study detailed in Chapter 3. I would like to emphasize my gratitude to Paul Taylor
for many hours of help and advice in the LC-MS/MS analysis of phosphopeptide samples, without which
this project would not have been possible.
Finally, I would like to thank all of my friends and family for their continuous encouragement
over the last few years. Particularly I would like to thank my parents for providing me with the
upbringing and education that made all of this possible; as well as my wife, Kristy, whose unwavering
support and patience was pivotal in allowing me to reach this goal.
v
TABLE OF CONTENTS
CHAPTER 1: INTRODUCTION 1
1.1 MAMMALIAN SPERMATOGENESIS .......................................................................................................... 1
1.1.1 Organization of the testis ............................................................................................................... 1
1.1.2 Spermatogenesis ............................................................................................................................ 2
1.1.3 The cycle of the seminiferous epithelium ........................................................................................ 7
1.1.4 Mouse models of male infertility .................................................................................................. 10
1.1.5 Male factor infertility .................................................................................................................. 10
1.2PROTEIN PHOSPHATASE PPP1CC2 ........................................................................................................ 11
1.2.1 Protein phosphatases ................................................................................................................... 11
1.2.2 The PP1 family of protein phosphatases ..................................................................................... 12
1.2.3 Regulation of PP1 catalytic subunits .......................................................................................... 14
1.2.4 The Ppp1cc knockout mouse ....................................................................................................... 22
1.2.5 PPP1CC2 protein – protein interactions in the testis ................................................................. 25
1.2.6 Identification of PPP1CC2 substrates in the testis ..................................................................... 27
1.3 HYPOTHESIS AND RESEARCH OBJECTIVE ............................................................................................. 28
CHAPTER 2: TANDEM AFFINITY PURIFICATION IN TRANSGENIC MOUSE EMBRYONIC STEM
CELLS IDENTIFIES DDOST AS A NOVEL PPP1CC2 INTERACTING PROTEIN 30
2.1 INTRODUCTION .................................................................................................................................... 31
2.2 MATERIALS AND METHODS ................................................................................................................. 32
2.3 RESULTS .............................................................................................................................................. 40
2.4 DISCUSSION ......................................................................................................................................... 63
CHAPTER 3: PPP1CC2 CAN FORM A KINASE/PHOSPHATASE COMPLEX WITH THE TESTIS
SPECIFIC PROTEINS TSSK1 AND TSKS DURING MOUSE SPERMIOGENESIS 69
3.1 INTRODUCTION .................................................................................................................................... 70
3.2 MATERIALS AND METHODS ................................................................................................................ 72
3.3 RESULTS .............................................................................................................................................. 77
3.4 DISCUSSION ......................................................................................................................................... 92
CHAPTER 4: PHOSPHOPROTEOMIC ANALYSIS OF THE PPP1CC MUTANT TESTES 102
4.1 INTRODUCTION .................................................................................................................................. 103
4.2 MATERIALS AND METHODS ............................................................................................................... 105
4.3 RESULTS ............................................................................................................................................ 113
4.4 DISCUSSION ....................................................................................................................................... 137
CHAPTER 5: CONCLUSION 147
5.1 THE APPLICATION OF PROTEOMIC APPROACHES TO THE STUDY OF MAMMALIAN SPERMATOGENESIS . 147
5.2 SIGNIFICANCE AND FUTURE DIRECTIONS ........................................................................................... 154
REFERENCES 158
APPENDIX A.1: MOUSE MUTATIONS RESULTING IN MALE INFERTILITY ................................................... 174
APPENDIX A.2: YEAST 3-HYBRID SCREEN FOR SUBSTRATES OF THE SH3GLB1T-PPP1CC2 HOLOENZYME
..................................................................................................................................................................... 191
APPENDIX A.3: THE EFFECT OF PPP1CC DELETION ON THE LOCALIZATION OF CANDIDATE SUBSTRATES HSPA2
AND SH3GLB1T IN THE MOUSE SPERMATOGENIC CELL NUCLEI ............................................................ 201
APPENDIX A.4: SUPPLEMENTAL MATERIAL ............................................................................................. 210
vi
List of Tables
Table 2.1: Protein-protein interactions detected via tandem affinity purification 52
Table 3.1: Testis proteins identified in an SDS-PAGE gel band after sedimentation by
GST-PPP1CC1 and GST-PPP1CC2 78
Table 3.2: Quantitative evaluation of TSKS and TSSK1 staining patterns in wild-type
and Ppp1cc mutant seminiferous tubules 95
Table 4.1: Primers used for qPCR analysis of PP1 isoform expression in the post-
natal mouse testis 107
Table 4.2: Candidate PPP1CC2 substrates 130
Table 4.3: GO biological processes and molecular functions enriched in
hyperphosphorylated testis proteins 138
vii
List of Figures
Figure 1.1 The organisation of the seminiferous epithelium 3
Figure 1.2 The mouse spermatogenic cycle 8
Figure 1.3 The PP1 structure and catalytic mechanism 15
Figure 1.4 Regulation of PP1 catalytic subunits via interaction with regulatory PIPs. 19
Figure 2.1 Strategy for the generation of SBP-3XFLAG-PPP1CC knock-in
embryonic stem cells 41
Figure 2.2 Cre-mediated excision of second loxP site in pGT0lxf gene-trap line
RRR804 44
Figure 2.3 Verification of Cre-mediated insertion of transgene into RRR804-SA ES
cell genome 46
Figure 2.4 Expression of the SBP-3XFLAG-PPP1CC1/2 transgenes in knock-in ES
cells at the cDNA and protein level 49
Figure 2.5 Validation of PPP1CC2-DDOST interaction in mouse testis lysate 56
Figure 2.6 Localization of DDOST in dissociated spermatogenic cells 58
Figure 3.1 PPP1CC2 interacts with both TSSK1 and TSKS in the testis 80
Figure 3.2 The interaction between PPP1CC2 and TSSK1 is not direct 83
Figure 3.3 The TSKS RVxF motif is required for interaction with PPP1CC2 87
Figure 3.4 TSKS localization is impaired, but not abolished in Ppp1cc mutant
seminiferous tubules 90
Figure 3.5 TSSK1 localization is impaired but not abolished in Ppp1cc mutant
seminiferous tubules 93
Figure 4.1 Expression of mouse Ppp1c isoforms in the testis during the first wave of
spermatogenesis 114
Figure 4.2 Phenotypic abnormalities are present in the seminiferous tubules of 3
week old Ppp1cc mutant mice 117
Figure 4.3 Reproducible phosphopeptide enrichment and identification in wild-type
and Ppp1cc mutant testis samples 120
viii
Figure 4.4 Strategy for quantitative analysis of wild-type and Ppp1cc mutant 3
week testis phosphoproteomes 124
Figure 4.5 Distribution of spectral counting and MS/MS peak XIC data for wild-
type and Ppp1cc mutant testis phosphopeptides 126
Figure 4.6 Example of Skyline MS1 filtering output 133
Figure 4.7 Quantitative comparison of XIC peak areas of hyperphosphorylated
phosphopeptides mapping to genes essential for spermatogenesis and
known/predicted PP1 interacting proteins 135
ix
List of Appendices
Appendix A.1 Mouse mutations causing male infertility 174
Appendix A.2 Yeast 3-hybrid screen for substrates of the SH3GLB1T-PPP1CC2
holoenzyme 191
Appendix A.3 The effect of Ppp1cc deletion on the localization of candidate
substrates HSPA2 and β-tubulin in mouse spermatogenic cell nuclei 201
Appendix A.4 Supplemental material 210
A.4.1 Proteins identified via tandem affinity purification 210
A.4.2 Peptides identified by LC-MS/MS of ~45 kDa gel slice 214
A.4.3 TSKS phosphopeptide site assignment data 217
A.4.4 TSKS testis phosphopeptide site assignment charge
tables/annotated spectra 218
A.4.5 3 week testis phosphoproteins of interest for quantitative analysis 221
A.4.6 DAVID GO enrichment analysis of 3 week testis phosphoproteins 223
A.4.7 Peptides identified via preliminary semi-quantitative analysis as
more abundant in Ppp1cc knockout testes 235
A4.8 Quantitative comparison of XIC peak areas of Ppp1cc
hyperphosphorylated peptides assigned to indicated proteins 238
Appendix References 239
x
List of Abbreviations
(E)GFP (enhanced) green fluorescent protein
2DE two-dimensional electrophoresis
AMPR ampicillin resistance gene
ANOVA analysis of variance
AP-MS affinity purification mass spectrometry
BCA bicinchoninic acid
BGH bovine growth hormone
bp base pair
cDNA complementary DNA
Cre cre-recombinase
DAPI 4' 6-diamidino-2-phenylindole
DMEM Dulbecco’s modified eagle medium
DRM detergent resistant membrane
ECMV encephalomyocarditis virus
En2 engrailed 2
ES embryonic stem
FACS fluorescence activated cell sorting
FBS fetal bovine serum
FRT Flp recombinase target
FTMS fourier transform mass spectrometry
GO gene ontology
GST Glutathione S-transferase
HA human influenza hemagglutinin
HRP horseradish peroxidase
IMAC immobilized metal ion affinity chromatography
IP immunoprecipitation
IRES internal ribosomal entry site
LC liquid chromatography
MS mass spectrometry
MS/MS tandem mass spectrometry
MS1 mass spectrometer analyzer 1
pA polyadenylation signal
PAGE polyacrylamide gel electrophoresis
PAS-H periodic acid schiff's-hematoxylin
PBS phosphate buffered saline
PCR polymerase chain reaction
PIPs PP1 interacting proteins
PMSF phenylmethanesulfonylfluoride
PP1 protein phosphatase 1
xi
PP1c protein phosphatase 1 catalytic subunit
PTM post-translational modification
qPCR quantitative polymerase chain reaction
RT reverse transcriptase
SBP streptavidin binding peptide
SDS sodium dodecyl-sulphate
SIMAC sequential elution form IMAC
TAP tandem affinity purification
TFA trifluoroacetic acid
XIC extracted ion chromatogram
1
Chapter 1: Introduction
1.1 Mammalian Spermatogenesis
Spermatogenesis is the process by which the male gamete, the spermatozoan, is generated. What
begins as a pluripotent germline stem cell (Guan et al. 2006) eventually differentiates into what is
perhaps the most specialized cell type known, through a process that involves the coordination between
hundreds, if not thousands, of genes. Being the cell responsible for the transmission of the paternal
genome, the spermatozoan is well characterized at the cellular level as is the spermatogenic processes.
The following sections will give a brief overview of spermatogenesis in mammals and highlight the
importance of related research to human health.
1.1.1 Organization of the Testis
The mammalian testis contains two structurally distinct compartments that are required for
spermatogenesis: the interstitium and the seminiferous tubules. The interstitial compartment is
permeated by both blood, and lymphatic vessels (Russell et al. 1990). The most frequently observed cell
type in the interstitium is the Leydig cell (Hess & de Franca. 2009). The primary function of the Leydig
cells is the production and secretion of testosterone, for which they are the principal source in the
systemic circulation of males (Ge et al. 2009). The interstitial compartment, although essential for
fertility, will not be a point of focus for this thesis. Instead, I will focus on the seminiferous tubules, the
site of spermatogenesis.
The seminiferous tubules are highly convoluted such that a cross section of the testis would
show a cross section of many individual tubules. The seminiferous tubules are bounded by myoid cells,
and a basal lamina which provide structural support for the most basal cells of the seminiferous
epithelium, and contractile forces for moving mature spermatozoa through the tubules (Russell et al.
1990). Within the seminiferous tubules, cells are arranged into an epithelial configuration, known as the
seminiferous epithelium.
2
The seminiferous epithelium has a stratified organization, with the germ cells traversing the
epithelium outward towards the central lumen as they mature (Figure 1.1). In addition to the developing
germ cells, there is also a somatic cell component to the seminiferous epithelium, the Sertoli cells. These
cells, which cease to divide during pubertal development (Griswold & McLean. 2006), serve to support
the developing germ cells through spermatogenesis. Sertoli cells are attached in a single layer to the basal
lamina and span the entire width of the seminiferous epithelium. Developing germ cells are found
tightly bound between adjacent Sertoli cells, with a single Sertoli cell forming cell-cell contacts with
numerous germ cells at various developmental stages. The Sertoli cells’ extensive cell-cell contacts serve
to maintain the integrity of the epithelium, and also to compartmentalize it, via the formation of the
blood-testis barrier (Kopera et al. 2010). During spermatogenesis, the Sertoli cells have a number of
critical functions, including regulation of the spermatogenic cycle via communicating junctions
(Griswold & McLean. 2006). Sertoli cells aid in the movement of germ cells through the seminiferous
epithelium, and provide them with nutrients needed to complete spermatogenesis (Russell et al. 1990,
Kopera et al. 2010). Additional roles of the Sertoli cells include, but are not limited to participation in
spermiation, and phagocytosis of residual bodies (Russell et al. 1990).
1.1.2 Spermatogenesis
Spermatogenesis is a complex differentiation processes in which cells that begin as pluripotent
stem cells undergo a series of cell divisions, genome reorganization, and dramatic morphological change
to become spermatozoa. Spermatogenesis can be divided into three key functional phases—proliferative,
meiotic, and spermiogenesis, all of which are occurring simultaneously in the adult testis.
The proliferative phase refers to the mitotic division of the spermatogonia, the most immature
germ cells found in adults. These cells are located along the basement membrane of the seminiferous
epithelium. Spermatogonia are responsible for both providing the large number of cells required to
support the production of upwards of millions of sperm per day, and maintaining a pool of stem cells to
3
Figure 1.1: The organization of the seminiferous epithelium. A diagram depicting the general
architecture of the mouse seminiferous epithelium (based on a diagram by Russell et al., 1990; not to
scale). Shown are the developing spermatogenic cells from the least mature spermatogonia, which are
localized in the basal region, to the elongate spermatids adjacent to the epithelial lumen. All stages of
spermatogenic cell development are associated with the somatic Sertoli Cells.
4
5
ensure that this production will endure for the sexual lifespan of the animal. There are three major types
of spermatogonia—stem cell, proliferative and differentiating, as well as several more sub-types (Russell
et al. 1990). The spermatogonial stem cells represent only an estimated 0.03% of the total germ cell
population (Tegelenbosch & de Rooij. 1993) and can undergo both self-renewal cell divisions and
differentiation cell divisions (into proliferative spermatogonia) (Huckins. 1971, Oakberg 1971, Phillips et
al. 2010). During proliferation, cytokinesis is incomplete, producing intercellular bridges between
adjacent cells, which subsequently undergo additional rounds of mitosis to produce large numbers of
spermatogonia. Eventually these cells will cease to divide and then undergo several stages of
differentiation (differentiating spermatogonia) into a number of spermatogonial subtypes; they ultimately
divide to form spermatocytes, which then enter into meiosis with a round of DNA replication (Russell et
al. 1990).
In the meiotic phase of spermatogenesis the spermatocytes undergo two successive meiotic cell
divisions to produce haploid spermatids. The most immature spermatocytes are the preleptotene cells,
which are the last spermatogenic cells to reside in the S-phase of the cell cycle, and are classified as
leptotene spermatocytes upon entry to prophase (Russell et al. 1990). In mammalian spermatogenesis,
prophase of the first meiotic division is of a particularly long duration, lasting almost two weeks in the
mouse (Hess & de Franca. 2009). Spermatocytes in prophase I go through successive morphological
changes from leptotene spermatocytes into zygotene, pachytene and finally diplotene spermatocytes.
During this time the nuclei greatly increase in size, the synaptonemal complex is formed, linking
homologous chromosomes, and genetic recombination occurs (Russell et al. 1990). After this
exceptionally long meiotic prophase, the first and second meiotic divisions are rapidly completed, with
the intermediate secondary spermatocytes only visible in the seminiferous epithelium for a brief period
(Russell et al. 1990). After the completion of the second meiotic division, the germ cells now contain a
haploid DNA complement and are known as spermatids.
6
The final phase of spermatogenesis is spermiogenesis, a phase of dramatic morphological
differentiation from a round cell to the characteristic shape of a spermatozoan and is carried out in the
absence of cell division. There are four key aspects to this transformation—formation of the flagellum,
formation of the acrosome, nuclear shaping/condensation and elimination of the cytoplasm—all of which
are simultaneously occurring in the seminiferous epithelium (Russell et al. 1990). The flagellum or
“tail” of the sperm is required for forward motility via transit through the female tract, and the acrosome
is an exocytotic vesicle that surrounds the sperm head and allows for penetration of the oocyte
(Guyonnet et al. 2012). The shaping and condensation of the nucleus observed in spermatogenesis from
a rounded to its characteristic falciform shape involves factors both interior and exterior to the nucleus.
The manchette is a transient cytoplasmic tubulin structure that envelopes the nucleus during
spermiogenesis and is thought to play a mechanical role in its shaping and condensation (reviewed in
Kierszenbaum 2002). Inside the nucleus a major remodelling of the chromatin occurs, allowing for a
large reduction in size. At the beginning of spermiogenesis, the chromatin is packaged in nucleosomes
by histones as in somatic tissues. During spermiogenesis nearly all of the histones are replaced by basic
proteins known as transition proteins (TPs) and subsequently by protamines resulting in a more compact
orientation (reviewed in Lewis et al. 2003) and transcriptional silencing. The elimination of cytoplasm
to ~25% of the original volume during spermiogenesis serves to make the spermatozoan more
streamlined for motility (Russell et al. 1990). This is accomplished by several different mechanisms
including the bulk removal of a large portion of cytoplasm containing RNA and organelles, termed the
residual body, which is phagocytosed by the Sertoli cells (Russell et al. 1990).
After the completion of spermiogenesis, spermatozoa are released from the seminiferous tubules
via a process termed spermiation. However, the spermatozoa are still not competent for fertilization and
require further development in the epididymis and female tract (capacitation) before they are able to
fertilize an oocyte.
7
1.1.3 The Cycle of the Seminiferous Epithelium
As mentioned above, the seminiferous epithelium has a stratified organization such that several
generations of spermatogenic cells are simultaneously present in any cross-section of the epithelium.
This organization is highly synchronous and tightly regulated, which is necessary to support the
continuous generation of spermatozoa (Hess & de Franca. 2009). Mammalian spermatogenesis can be
morphologically divided into a number of different “stages” based on the cellular associations present in
a given cross section. This system was first developed in the rat by Leblond and Clermont (1952), with
the first detailed classification in the mouse following later (Oakberg. 1956). Mouse spermatogenesis
was divided into 12 stages, and was classified in even further detail by Russell (1990), and represents the
staging scheme that will be used throughout this thesis (Figure 1.2). It should be noted, that while
staging seminiferous tubules is a very useful tool, the stages described represent artificial delineations in
a continuous process and intermediates between stages are commonly found in the seminiferous tubules.
Developing germ cells do not move laterally in the seminiferous tubule; thus, a given cross-sectional
plane in a seminiferous tubule would move temporally through each of the 12 stages before returning to
stage 1 and repeating the cycle. With the exception of the first wave of spermatogenesis in juvenile
mice, the spermatogenic cycle is not synchronized along the entire length of a seminiferous tubule.
Instead, the spermatogenic cycle presents a wave-like pattern of stages along the longitudinal axis such
that successive segments are found to be at sequential stages of the cycle, in descending order moving
distally from the rete testis (Russell et al. 1990). During the first wave of spermatogenesis, there is a
much higher degree of synchronization throughout the seminiferous tubules; however, this
synchronization is not absolute, as is frequently assumed to be the case (Varmuza &Ling 2003).
8
Figure 1.2: The mouse spermatogenic cycle. A diagram depicting the cell types present at each of the
12 stages of mouse spermatogenesis (based on diagram in Russell et al., 1990). Vertical columns depict
the cell types associated with each stage, numbered by Roman numerals. As cells progress through
spermatogenesis they move closer to the tubule lumen, which is indicated by vertical position in the
individual columns. Steps in spermatid development are indicated by Arabic numbers. Spermatogonia
and Spermatocytes are labelled as follows: mIn
= mitosis of Type A4 spermatogonia/ intermediate
spermatogonia, In
m = Intermediate spermatogonia/mitosis of intermediate spermatogonia, B = type B
spermatogonia, Bm =type B spermatogonia/mitosis of type B spermatogonia, Pl = preleptotene
spermatocyte, L = leptotene spermatocyte, Z = zygotene spermatocyte, P = pachytene spermatocyte, D =
diplotene spermatocyte, m20m = secondary spermatocyte.
9
10
1.1.4 Mouse Models of Male Infertility
Advances in mouse (Mus musculus) genetic manipulation techniques have provided a wealth of
information to male infertility research. The ability to directly alter specific genetic loci by targeted,
deletion, tissue/time specific deletions, knock-in, point mutation, etc. has led to the identification of at
least 459 genes involved in spermatogenesis (Matzuk & Lamb 2008, Kuzmin et al. 2009) (See complete
list in appendix A.1). In addition, the process of spermatogenesis is highly conserved between mice and
humans at the developmental, tissue organization, and molecular levels (Russell et al. 1990, Bonilla &
Xu 2008). Together, these factors make mouse models a very powerful tool in the study of mammalian
spermatogenesis.
1.1.5 Male factor infertility
Infertility is a prominent medical condition, seriously affecting quality of life for those afflicted.
Recent studies have shown that currently, infertility affects between 11-16% of Canadian couples
(Bushnik et al. 2012). Of these couples, the cause of infertility is equally shared between males and
females (Nieschlag et al., 2010). One common class of male factor infertility is azoospermia—the
complete absence of spermatozoa in the semen. There are two types of azoospermia: obstructive, and
nonobstructive. The absence of sperm in nonobstructive azoospermia is due to a failure of
spermatogenesis (also known as testicular failure), as opposed to a physical blocking of sperm
progression via factors such as the congenital bilateral absence or blockage of the vas deferens or
epididymis (Batruch et al., 2012). Nonobstructive azoospermia is prevalent in the human population and
is displayed in 10-15% of infertile men, or roughly 1% of the general population (Hu et al. 2012).
Despite its prevalence, male infertility is rarely treatable and is more often bypassed using
assisted reproductive technologies (ARTs) such as intercytoplasmic sperm injection (ICSI). While these
technologies often satisfy the ultimate goal of successful reproduction, their consequences to future
generations are an issue of considerable debate. A recent large scale study of over 300,000 cases
11
comparing children conceived naturally to children from assisted conception showed a significant
increase in the rate of birth defects in children conceived via ICSI (Davies et al. 2012). However, these
statistics do not necessarily indicate defects that are a product of the ICSI technique itself, but more
likely are reflective of genetic abnormalities that contributed to the initial infertility. Although a much
smaller amount of data is available, children conceived via ICSI from men exhibiting testicular failure
show no increased likelihood of birth defects or perinatal lethality when compared to children conceived
via ICSI from ejaculated spermatozoa; however there is a significant decrease in the chance of a
successful pregnancy being produced (Tournaye 2012). These studies suggest that bypassing male
infertility as opposed to treating it, results in the genetic causes of male infertility to be simply passed on,
which could negatively affect the fertility of future generations.
Presently a large proportion of male infertility cases are classified as idiopathic, and given a
description that classifies their infertility based on phenotype, but does not provide a specific cause for
the defect. Similarly, even if a genetic cause for male infertility can be diagnosed, there are very few
effective treatments available. It is clear from these facts that more basic research into the process of
spermatogenesis is needed. To date hundreds of genes that are required for fertility have been identified
(Matzuk & Lamb. 2008, Kuzmin et al. 2009), however in most cases their specific roles are poorly
defined. Furthering our understanding of the function of genes and gene networks in spermatogenesis is
the first step in improving the efficacy of diagnosing and treating infertility in males.
One gene that has been shown to be essential for spermatogenesis in mice is the protein
phosphatase Ppp1cc, which when deleted results in non-obstructive azoospermia (Varmuza et al. 1999).
By learning more about the function of this gene in spermatogenesis, we hope to better understand the
causes of idiopathic male infertility in humans.
1.2 Protein Phosphatase PPP1CC2
1.2.1 Protein phosphatases
12
Protein phosphorylation is an ancient mechanism of protein modification that plays a role in the
regulation of countless cellular processes. There is currently debate over the percentage of proteins that
are phosphorylated in at least some context, but estimates range from 33 % (Cohen 1999) to as high as
70 % (Olsen et al. 2010). The status of protein phosphorylation is regulated by the opposing activities of
protein kinases and protein phosphatases. This regulatory mechanism is so prevalent that kinases and
phosphatases constitute between 2-4% of all genes in a typical eukaryotic genome (Moorhead et al.
2009). Although proteins can be phosphorylated on nine different residues, serine, threonine and
tyrosine phosphorylation constitute the vast majority of these events, representing 86.4, 11.8 and 1.8% of
phosphorylation events respectively (Moorhead et al. 2009, Olsen et al. 2006). The human genome
encodes approximately 90 phosphatases that either act on Tyr residues exclusively (PTPs or protein
tyrosine phosphatases), or act on Tyr, as well as Ser and Thr resides (DSPs or dual specificity
phosphatases) (Brautigan 2012). Phosphatases that act only on Ser and Thr residues fall into three
different protein superfamilies—PPP, PPM and DxDxT phosphatases (Brautigan 2012) which together
number approximately 40 in a typical mammalian genome (Moorhead et al. 2007, Bollen et al. 2010).
The PPP (phosphoprotein phosphatase) superfamily includes 13 different genes in humans throughout
the PP1, PP2A, PP2B, PP4, PP5, PP6 and PP7 subclasses (Moorhead et al. 2009, Kerk et al. 2008), and
account for over 90% of eukaryotic Ser/Thr dephosphorylation reactions (Heroes et al. 2012).
1.2.2 The PP1 family of protein phosphatases
The PPP superfamily is defined by a structurally conserved ~280 amino acid catalytic domain
containing 3 signature motifs (-GDXHG-, -GDXDRG- and –GNHC-) (Moorhead et al. 2009). All
eukaryotic and most bacterial and archeal genomes surveyed to date contain at least one PPP member
(Moorhead et al. 2009). Within this superfamily, the type-1 protein phosphatase family (PP1) is defined
by its biochemical activity—its preferential dephosphorylation of the β subunit of phosphorylase kinase,
and its inhibition by two heat-stable proteins known as Inhibitor-1 and Inhibitor-2 (Ingebritsen & Cohen,
1983). PP1s are some of the most highly conserved eukaryotic proteins known (Ceulemans & Bollen.
13
2004) with mammalian catalytic domains being 76-88% identical to those of plants, and 90% identical to
those of fungi (Moorhead et al. 2009). In fact, the coding sequences for mouse PP1 isoforms Ppp1cc1
and Ppp1cc2 are capable of rescuing a cold-sensitivity phenotype found in a mutation of the S. pombe
homologue dis2 (Okano et al. 1997).
The mammalian genome contains three PP1 genes, Ppp1ca (PP1cα), Ppp1cb (PP1cβ) and
Ppp1cc (PP1cγ) the latter of which has two splice isoforms Ppp1cc1 (PP1cγ1) and Ppp1cc2 (PP1cγ2).
The Ppp1cc1 and Ppp1cc2 transcripts are identical until the final intron, which is retained in the Ppp1cc1
transcript, and contains a stop codon closely following the skipped splice junction (Okano et al. 1997).
All four mammalian PP1 isoforms are ubiquitously expressed with the exception of PPP1CC2 which is
testis-specific (Takizawa et al. 1994). Targeted deletion of mouse Ppp1cb results in preweaning lethality
(Lexicon Genetics. 2005); there is no published account of a Ppp1ca knockout phenotype, although one
paper has referred to unpublished data suggesting that Ppp1ca knockouts are viable (Cheng et al. 2009),
and personal communication from Shirish Shenolikar confirms this observation. Ppp1cc knockout mice,
which lack both the PPP1CC1 and PPP1CC2 isoforms, are phenotypically normal with the exception that
homozygous males are infertile (Varmuza et al. 1999). This mutant phenotype will be discussed in
greater detail in a later section.
Structurally, the PP1 catalytic subunits consist of a single, compact elliptical domain with a
central β sandwich from which the disordered C-terminus and extreme N-terminus emanate (Egloff et al.
1995, Ceulemans & Bollen 2004). The PP1 active site is located at the bifurcation point of a series of 3
shallow surface grooves in a Y-shaped conformation (Egloff et al. 1995, Goldberg et al. 1995). Each of
these 3 grooves has distinct amino acid side chain compositions and are termed the hydrophobic, acidic
and C-terminal grooves, the latter of which runs towards the C-terminus of the catalytic subunit
(Goldberg et al. 1995). At the active site two metal ions, Fe+2
and Zn+2
(Mn+2
when bacterially
expressed) are positioned and are utilized in a single-step metal-assisted catalysis mechanism for
substrate dephosphorylation (Egloff et al. 1995, Goldberg et al. 1995) (Figure 1.3). In this mechanism,
14
the positively charged metal ions stabilize the negative charges in the phosphate ester and make them
susceptible to nucleophilic attack by an activated water molecule, resulting in hydrolysis of the
phosphate group from the substrate (Egloff et al. 1995, Goldberg et al. 1995). Association of proteins and
phosphate analogues to the active site does not appear to significantly alter the structure of the PP1
catalytic subunits (Egloff et al. 1995, Hurley et al. 2007).
1.2.3 Regulation of PP1 catalytic subunits
Mammalian genomes encode a roughly equivalent number of tyrosine kinases and phosphatases
(approximately 100 each) (Ceulemans & Bollen 2004). Conversely, mammals have approximately 10
times as many Ser/Thr kinases as Ser/Thr phosphatases (Moorhead et al. 2007, Bollen et al. 2010). This
fact has prompted the question of how so few phosphatases oppose the activity of so many kinases.
Historically, it was thought that phosphatases were far less specific than kinases, and simply removed
phosphate groups from proteins indiscriminately, passively undoing the work of more specific kinases.
This view was due in large part to the fact that in vitro bacterially expressed protein phosphatases such as
PP1s exhibit very broad substrate specificity and can even dephosphorylate tyrosine residues (Egloff et
al. 1995). However, it is now accepted that Ser/Thr phosphatases like PP1 are actually subject to very
precise regulation via interaction with a large and diverse range of “regulatory subunits” (Hubbard &
Cohen. 1993). These regulatory subunits are generally unrelated in both origin and structure. To date
there are approximately 200 known PP1 interacting proteins (PIPs), many of which act as regulatory
subunits. This represents a very large pool of PP1 holoenzymes, each with its own target(s) and
regulatory properties (Heroes et al. 2012). Despite the large number of PIPs currently known, it is
hypothesized that there are significantly more that remain to be discovered, perhaps as many as 650 in
total (Bollen et al. 2010). When considering this holoenzyme view of PP1 diversity it is appreciated how
so few phosphatase catalytic subunits could oppose the activity of hundreds of kinases.
15
Figure 1.3: The PP1 structure and catalytic mechanism. (A) The structure of the PP1 catalytic subunit.
Circled is the active site. (B) A diagram depicting the PP1 active site with catalytically important amino
acids shown (function indicated by color on left). The phosphate group and leaving group are also
shown. Green circles labelled “M” indicate metal ions, and arrows indicate the course of the
nucleophillic attach mechanism. PPP1CC structure image modified from original version downloaded
from the RCSB PDB (www.pdb.org) of PDB208A (Hurley et al., 2007).
16
A
B
17
Almost 90% of known PIPs contain a short degenerate motif commonly referred to as the RVxF
motif (Bollen et al. 2010). One caveat to this statistic is that the presence of the RVxF motif has been
utilized successfully in several studies to bioinformatically search for novel PIPs (Meiselbach et al. 2006,
Hendrickx et al. 2009), and thus the current set of proteins may be biased in this respect. Regardless of
the exact number, many regulatory subunit-PP1 interactions are mediated by this motif. Several different
definitions of the RVxF motif have been offered, from the sensitive, but relatively non-specific [RK]-
X(0,1)-[VI]-{P}-[FW] (Wakula et al. 2003), to the less sensitive but more specific [ACHKMNQRSTV]-
[V]-[CHKNQRST]-[FW] (Meiselbach et al. 2006). Based on the most recently published catalog of
validated PIPs, the RVxF motif follows the consensus sequence [K55R34]-[K28R26]-[V94I6]-{FIMYDP}-
[F83W17] (subscripts represent % occurrence) (Heroes et al. 2012). The RVxF motif binding site is a
shallow hydrophobic groove on the surface of the PP1 catalytic subunit, remote from the active site
(Egloff et al. 1997). There are numerous examples of PIPs that do not contain RVxF motifs, and thus its
presence or absence is not deterministic of interaction with PP1. As is the case for substrates, interaction
with an RVxF motif does not result in any large conformational change to the catalytic subunit (Egloff et
al. 1997). However, when present the RVxF motif is thought to serve as an anchoring point for
interaction, allowing for weaker secondary interaction motifs to bind to the PP1 surface (Hendrickx et al.
2009). Several less common PP1 interaction motifs have been identified, including the G/SILK motif
(found in seven known PIPs) which is thought to function as an additional PP1 anchoring motif located
N-terminally to the RVxF motif, and the MyPhoNE motif (found in six known PIPs) which is thought to
play a role in substrate selection (Hendrickx et al. 2009, Heroes et al. 2012). One recent study
demonstrated that mutation of either the G/SILK motif or the adjacent RVxF motif in the S. Pombe PIP
Cut12 reduced binding efficiency to the PP1 catalytic subunit Dis2, while simultaneous mutation of both
docking motifs completely abolished interaction (Grallert et al. 2013). An emerging mechanism for the
regulation of the interaction between PP1 catalytic subunits and PIPs is the reversible phosphorylation of
the region in and around the RVxF motif, which a number of studies have demonstrated to decrease
18
binding between the two proteins (Beullens et al. 1999, McAvoy et al. 1999, Liu & Brautigan 2000,
Bollen 2001, Grallert et al.2013).
The RVxF motif is also thought to have played an instrumental role in the evolution of PP1
catalytic subunits (Moorhead et al. 2009). There exist key RVxF containing PP1c regulatory subunits
that are functionally conserved in other eukaryotic genomes. Therefore it is theorized that the existence
of these ancient regulatory subunits hindered further evolutionary change in the catalytic subunits and
thus instead of evolving new domains to specify new targets, PP1 catalytic subunits instead “exploited”
this short degenerate motif in new proteins.
PIPs in general fall into one of four categories: substrates, inhibitors, subcellular targeting
subunits, or substrate specifying subunits (Figure 1.4). Substrates of PP1 have traditionally been difficult
to identify, due to the generally transient nature of the enzyme-substrate interaction. Unlike PTPs, PPPs
do not form a stable intermediate with substrate proteins. Despite these difficulties a number of PP1
substrates such as PTK2 and SRSF10 have been identified (Bianchi et al. 2005, Shi & Manley 2007).
Inhibitory PIPs bind to the PP1c active site and prevent the binding of substrates. One well known
example of a PP1 inhibitor is PPP1R2 (Inhibitor-2) which interacts with PP1c at the acidic and
hydrophobic grooves of the active site, preventing the binding of other PP1 substrates. In addition,
PPP1R2 either prevents the binding or actively displaces metal ions from the PP1c active site, further
inactivating the phosphatase (Hurley et al. 2007). Subcellular targeting subunits direct PP1c to specific
subcellular locations or compartments bringing it into contact with specific pools of substrates. One
recently discovered example of this mode of regulation is Repo-man (CDCA2) which recruits PPP1CC1
onto mitotic chromatin during anaphase (Trinkle-Mulcahy et al. 2006). Substrate specifying PIPs direct
PP1c activity towards a specific substrate or set of substrates. As mentioned previously, binding of
regulatory subunits via the RVxF motif does not significantly alter the confirmation of the PP1 catalytic
subunit. Instead, the binding of the regulatory subunit changes the available surface area of PP1, which
can sterically exclude certain interactions, and/or extend the binding surface for others (Heroes et al.
19
Figure 1.4: Regulation of PP1 catalytic subunits via interaction with regulatory PIPs. PIPs which can act
as substrate specifying subunits (A, D), inhibitors (B), or subcellular targeting subunits (C). Substrate
specification can occur via partial blocking of the active site, restricting access for specific substrates (D)
or by providing additional surfaces for interaction (A). “RVXF” indicates the location on the PP1c
surface to which the RVxF docking motifs bind, “A” indicates the location of the PP1c active site. Based
on a figure from Heroes et al., 2012.
20
21
2012). One well characterized example of a substrate specifying PIP is that of Spinophilin (PPP1R9b),
resolved by a crystal structure of this holoenzyme complex (Ragusa et al. 2010). An RVxF motif found
in Spinophilin interacts with PP1c, allowing for several secondary points of interaction, which obstruct
both the acidic and hydrophobic grooves of the PP1c active site. This steric hindrance prevents PP1c
from dephosphorylating phosphorylase a (a known substrate), but is permissive to dephosphorylation of
the Spinophilin-PP1c substrate GLUR1. Although PIPs typically fall into one of the four aforementioned
categories it should be noted that this is somewhat of a simplified view, and some PIPs could be
considered to fall into more than one category. As well, the functional nature of many PIP-PP1
interactions remains unknown.
Another aspect of the fine-tuning of PP1 activity lies in the isoform selectivity of some PIPs.
While most PIPs studied appear to be capable of interacting with all PP1c isoforms, a growing number
seem to interact preferentially with certain isoforms in vivo. This fact is not surprising considering that
although the PP1c isoforms are very similar, they do diverge significantly at their C-termini. For
example, Repo-man although capable of interacting with PPP1CA, preferentially recruits PPP1CC1 to
chromatin during mitosis (Trinkle-Mulcahy et al. 2006). Similarly, studies of Neurabin-1 (PPP1R9a)
have indicated a binding preference of PPP1CC1 over PPP1CA and only a weak interaction with
PPP1CB (Terry-Lorenzo et al. 2002). There are also examples of proteins that are completely isoform
specific such as SPZ1 and a testis-specific Endophilin B1 isoform (SH3GLB1) that can only interact
with the testis-specific isoform PPP1CC2 (Hrabchak & Varmuza. 2004, Hrabchak et al. 2007). The
isoform selectivity of MYPT1 (PPP1R12A) for PPP1CB was illustrated structurally by Terrak et al.,
(2004) when they showed that MYPT1 interacted with a specific region of the PPP1CB C-terminus.
Research in the last two decades has shifted our view of phosphatases as relatively few
indiscriminate phosphorylation “reset buttons” to a large number of specifically regulated holoenzyme
complexes. Now that we have a better understanding of how PP1s function, our attention shifts to the
functional roles of specific PP1c isoforms. Overwhelmingly, PP1c research has focused on the 3
22
isoforms expressed throughout somatic tissues: PPP1CA, PPP1CB and PPP1CC1. However, several labs
including ours have focused on the testis-specific PP1 isoform PPP1CC2.
1.2.4 Ppp1cc knockout mouse
Targeted deletion of the Ppp1cc gene (loss of PPP1CC1 and PPP1CC2) results in no observable
defects aside from infertility in homozygous male mice (Varmuza et al. 1999). These mice display a
prominent loss of germ cells, especially spermatids, from the seminiferous epithelium, indicating a
breakdown in spermatogenesis. The loss of cells appears to stem from both an increase in germ cell
apoptosis, and the premature sloughing of germ cells from the epithelium. Subsequently, Ppp1cc
knockout epididymides contain few germ cells, most of which are prematurely sloughed round and
elongating spermatids, and a small number of immotile and malformed spermatozoa. This phenotype
resembles a condition commonly found in humans, known as non-obstructive azoospermia, or testicular
failure.
Closer examination of the Ppp1cc knockout seminiferous epithelium shows a large number of
defects. The general architecture of the seminiferous epithelium is preserved and all stages of
spermatogenesis can be observed, which suggests no absolute block at any one developmental timepoint
(Varmuza et al. 1999). The first wave of spermatogenesis proceeds at a rate similar to that of wild-type,
but the first phenotypic effects become visible at 3 weeks of age, with the premature sloughing of germ
cells (late pachytene spermatocytes) first observed (Varmuza & Ling. 2003). As spermatogenesis
progresses in the adult testis, a general breakdown in the integrity of the spermatogenic cycle is
observed, with cell associations becoming asynchronous, making the staging of seminiferous tubules
challenging (Oppedisano-Wells & Varmuza. 2003). A quantitative analysis of seminiferous tubule
staging revealed a developmental bottleneck with an increased number of tubules found to be in stages
VII/VIII of spermatogenesis (corresponding to tubules containing mid-pachytene spermatocytes, see
Figure 1.2) and a reduced number of late stage tubules (Forgione et al. 2010). Further evidence of loss of
23
epithelial integrity is found in the displacement of Sertoli cell nuclei from the basement membrane, and
the presence of large vacuoles in the epithelium (Varmuza et al. 1999). As mice age, the breakdown of
spermatogenesis becomes increasingly severe, eventually to the point of a Sertoli cell only (SCO)
phenotype in older mice (Oppedisano-Wells & Varmuza. 2003). This loss of epithelial integrity does not
appear to be due to defective cell junctions, as they are normal at the ultrastructural level (Forgione et al.
2010).
Morphologic defects appear throughout the seminiferous epithelium in Ppp1cc knockout mice,
affecting all germ cell types, especially round and elongating spermatids. Evidence of depletion of
spermatogonia can be observed, increasingly in older mice (Forgione et al. 2010) but with no apparent
defect in the mitotic rate of these cells (Varmuza et al. 1999). In spermatocytes, electron microscopy
revealed subtle abnormalities in chromatin condensation with unusual dense inclusions found in the
nuclei (Forgione et al. 2010). Spermatocytes are also found at a lower frequency in Ppp1cc mutant testes
(Varmuza & Ling. 2003). Although there is no block in meiotic progression, this process does appear to
be affected by the Ppp1cc deletion as evidenced by the presence of cells with >2 spindle poles or
multiple nucleolus-like structures as well as multinucleated spermatids (Varmuza et al. 1999) and an
increased frequency of recombination (Varmuza & Ling. 2003).
The most severe phenotypic consequences of Ppp1cc deletion are found in spermatids. As
mentioned above, a severe reduction in the quantity of post-meiotic cells is found in mutant tubules, and
those that are present are frequently abnormal. The majority of these defects seem to relate to nuclear
shaping and chromatin condensation. Elongating spermatid nuclei rarely display the characteristic
“hook-like” shape found in wild-type testes, and instead display a number of different shapes ranging
from globular to oblong “bowling pin” like shapes, and feature frequent indentations and abnormal
dorsal angles (Varmuza et al. 1999, Chakrabarti et al. 2007a, Forgione et al. 2010). Chromatin
condensation in Ppp1cc mutant spermatids is non-uniform at the round and elongating phases (Forgione
et al. 2010). Several processes known to play a role in chromatin condensation and nuclear shaping are
24
disrupted in Ppp1cc knockout testes. Histones H1 and H3, which normally are largely replaced by
transition proteins, and later protamines during condensation of the spermatid nucleus, are retained in
Ppp1cc mutant spermatids, which offers a biochemical clue to the source of this phenotype (Varmuza et
al. 1999). As well, the manchette, which is thought to play a role in nuclear shaping, develops
abnormally in knockout spermatids, and is often ectopically positioned around the spermatid nucleus
(Forgione et al. 2010, Henderson et al. 2011). Unsurprisingly, given the morphological abnormalities
described above, there is an increase in DNA damage in round and elongating spermatids and their
improperly remodelled chromatin is more fragile, and thus unsuitable for fertilization even by in vitro
techniques such as ICSI (Jurisicova et al. 1999, Davies & Varmuza. 2003). Other key structures in the
spermatid are also abnormal upon deletion of Ppp1cc. The initiation of acrosome biogenesis is
unimpeded; however defects begin to appear in step 7 spermatids resulting in the presence of large or
multiple vacuoles around the nuclear surface (Forgione et al. 2010). Flagellar abnormalities such as
poorly developed mitochondrial sheaths and disorganized outer dense fibers (Chakrabarti et al. 2007b)
are present, which is consistent with the immotile nature of the few surviving epididymal spermatozoa
(Varmuza et al. 1999).
The numerous defects throughout the seminiferous epithelium in Ppp1cc knockout mice suggest
the possibility of a pleiotropic function for this gene in spermatogenesis. This is not surprising given the
functional diversity and multitude of protein-protein interactions typical of PP1s. In fact, there are
several known examples of proteins that play different roles in both meiotic and post-meiotic
spermatogenic cells, such as PARP2 and HSPA2 (Dantzer et al. 2006, Govin et al. 2006). Conversely, it
is possible that the loss of a single PPP1CC holoenzyme complex renders a single substrate
hyperphosphorylated in the mutant testis, producing a cascade of secondary effects. This scenario is not
unprecedented, as due to the highly regulated nature of the spermatogenic cycle, a single defect can
result in widespread germ cell degeneration throughout the testis as is seen in the mutation of
transcription factor CREM (Blendy et al. 1996, Yan. 2009).
25
The Ppp1cc deletion in this study results in a loss of both the ubiquitous PPP1CC1 and testis-
specific PPP1CC2, but the phenotype is restricted to the testis. Other PP1 isoforms, PPP1CA and
PPP1CB, are able to compensate for a loss of the Ppp1cc gene in every tissue except the testis, despite
being expressed in that tissue (Varmuza et al. 1999). This has led our laboratory to hypothesize that there
is an essential role(s) for the PPP1CC2 isoform in spermatogenesis. This fact is supported by the
conservation of this testis-specific isoform throughout mammals (Shima et al. 1993, Takizawa et al.
1994, Smith et al. 1996, Vijayaraghavan et al. 1996). Alternatively, there are two additional
possibilities—that both the PPP1CC1 and PPP1CC2 each have separate essential roles in
spermatogenesis, or that the Ppp1cc mutant phenotype is a result of a decreased total PP1 dosage in the
testis. The former can be ruled out, as recent data has shown that ectopically expressed PPP1CC2 can
rescue the infertility found in Ppp1cc mutant males (Sinha et al. 2012). Whether the mutant phenotype is
due to a dose dependent, or isoform specific mechanism remains to be determined, and will be discussed
in greater detail later.
1.2.5 PPP1CC2 protein-protein interactions in the testis
As mentioned in the preceding sections, PP1s primarily function as holoenzymes, being directed
towards specific substrates by a large and diverse array of regulatory subunits. Thus, if we wish to
understand the function of PPP1CC2 in spermatogenesis, we must characterize its interactome in the
testis. The Varmuza lab, as well as several others, has conducted a number of different studies over the
past several years to that aim. Yeast 2-hybrid analysis using mouse testis cDNA libraries has identified
two testis-specific proteins that interact with only the PPP1CC2 isoform—SPZ1 and a novel testis-
specific splice isoform of Endophilin B1 (SH3GLB1) (Hrabchak & Varmuza 2004, Hrabchak et al.
2007). While SH3GLB1 is not essential for male fertility (Takahashi et al. 2007), SPZ1, when
overexpressed, results in over-proliferation of germ cells which causes a breakdown in spermatogenesis
and subsequent male infertility (Hsu et al. 2001). To date, the biological implications of these
interactions remain unclear. A similar study using a human testis cDNA library identified a number of
26
candidate PPP1CC2 interacting proteins in the testis and confirmed an interaction with ANKRD42
(SARP2) via coimmunoprecipitation in human sperm extracts (Fardilha et al. 2011b). ANKRD42 had
been previously identified as a PIP in other tissues, and thus, interaction is not isoform specific (Browne
et al. 2007). The functional consequences of this interaction are still unknown, although ANKRD42 is a
DNA binding protein and may function to bring PP1 to that subcellular locale (Browne et al. 2007).
Another protein implicated in spermatogenesis, PPP1R42, otherwise known as TLRR (testis leucine-rich
repeat) was validated as a PPP1CC2 interactor via coimmunoprecipitation in mouse testis lysate (Wang
et al. 2010). PPP1R42 is a testis-specific protein that also interacts with the molecular motor kinesin 1B
(KIF1B) and β-tubulin in the testis (Wang et al. 2010). In early elongating spermatids, PPP1R42
localizes to the manchette and is later transported to the centrosome (Wang et al. 2010). PPP1CC2 forms
a complex with PPP1R42 that has active phosphatase activity, and is most abundant early in
spermiogenesis (likely round spermatids) prior to its association with the manchette (Wang & Sperry
2011). While the function of this holoenzyme remains unknown, the link between PPP1R42 and the
cytoskeleton suggest a role in the complex cytoskeletal rearrangements that occur throughout
spermiogenesis (Wang & Sperry 2011).
While the focus of this thesis is primarily the role of PPP1CC2 in spermatogenesis, there also
appears to be a prominent role for PPP1CC2 in the regulation of sperm motility. After release from the
seminiferous epithelium, spermatozoa enter the caput epididymis, at which point they are still immotile.
As spermatozoa transit to the caudal epididymis, known as epididymal maturation, they become motile.
Enzymatic PP1 activity in spermatozoa is associated with the inhibition of motility (Smith et al. 1996).
This facet of PPP1CC2 activity in no way explains the infertility phenotype found in Ppp1cc mutant
males, as the defects with the seminiferous epithelium occur long before the process of epididymal
maturation. Nevertheless, understanding sperm motility is an important aspect of reproductive biology,
and thus a number of groups have studied PPP1CC2 interactions during this process. When results from
a number of studies are considered together, a general mechanism of PPP1CC2 regulation in the
27
acquisition of sperm motility begins to emerge. PPP1CC2 has been shown to interact with a number of
classical PP1 regulators, which are well characterized PP1 inhibitors, such as PPP1R2, PPP1R7 and
PPP1R11 as a part of inactive complexes in motile caudal spermatozoa, but not (or to a lesser degree) in
immotile caput spermatozoa (Vijayaraghavan et al. 1996, Huang et al. 2002, Cheng et al. 2009). This
suggests that active PPP1CC2 complexes participate in one or more processes in spermatogenesis whilst
also serving to keep the developing spermatids from becoming prematurely motile prior to the
completion of development. Then, when the mature spermatozoa are “ready” for motility, strong PP1
inhibitors bind PPP1CC2 at various regions throughout the cell (Fardilha et al. 2011a), initiating sperm
motility. However, this is a somewhat simplified picture of PPP1CC2 regulation in spermatozoa, as each
individual complex will have its own regulatory mechanism. One recently described example is that of
the OAZ3-PPP1R16A (MYPT3)-PPP1CC2 complex. In Oaz3 knockout mice, male infertility is
produced due to the separation of sperm heads from tails despite both being ultrastructurally normal
(Tokuhiro et al. 2009). The headless tails of Oaz3 knockout sperm appear to display increased vigorous
flagellar beating (Ruan et al. 2011). Further analysis revealed that PPP1R16A binds directly to both
OAZ3 and PPP1CC2 (Ruan et al. 2011). When PPP1R16A and PPP1CC2 alone are in complex, there is
a lack of phosphatase activity; however, the presence of OAZ3 in the complex renders PPP1CC2 active
(Ruan et al. 2011). Therefore, a possible molecular explanation for the Oaz3 knockout phenotype is
premature and overly vigorous motility brought on by the ablation of PPP1CC2 activity (Ruan et al.
2011). Several other proteins have been implicated as PPP1CC2 interactors in spermatozoa such as
YWHAZ (14-3-3zeta) (Puri et al. 2008) and several A-kinase anchoring proteins (AKAPs) (Reinton et
al. 2000, Huang et al. 2005, Fardilha et al. 2011a) but their regulation and effect on sperm motility are
poorly understood.
1.2.6 Identification of PPP1CC2 Substrates in the testis
Substrates of Ser/Thr phosphatases such as PPP1CC2 have typically been more challenging to
identify than regulatory PIPs as their interaction with the PP1 catalytic subunit is frequently weak and/or
28
transient. Thus, as an alternate means of identifying candidate substrates of PPP1CC2 in the testis our
lab capitalized on the fact that substrates should be hyperphosphorylated when the Ppp1cc gene is
deleted (Henderson et al. 2011). In this experiment, testis lysates from adult wild-type and Ppp1cc
knockout mice were subjected to two-dimensional electrophoresis followed by ProQ phosphoprotein
staining. Comparative analysis of replicate gels identified 10 reproducible protein spots that indicated
increased phosphorylation in Ppp1cc mutant testis lysate, with no change in general protein abundance.
Protein content of the hyperphosphorylated spots was identified via mass spectrometry and amongst the
identified proteins were the testis specific heat shock protein HSPA2 and several isoforms of α and β
tubulin (Henderson et al. 2011). Both of these proteins were subsequently shown to interact with
PPP1CC2 in the testis. This work will be discussed further in chapter 4 and appendix A.3.
1.3 Hypothesis and Research Objective
The PP1 protein phosphatase gene Ppp1cc is essential for completion of spermatogenesis in
mice. Additional highly similar PP1c isoforms PPP1CA and PPP1CB are capable of compensating for
the loss of Ppp1cc in every tissue with the exception of the testis, despite their expression in that tissue.
This suggests that the predominant Ppp1cc isoform in the testis, PPP1CC2 has an isoform specific
function in spermatogenesis. As PP1s are known to be incorporated into multi-protein complexes to
dephosphorylate substrate proteins, my research objective is to identify novel PPP1CC2 interacting
proteins in the mouse testis to gain a better understanding of PPP1CC2’s regulation and function(s) in
spermatogenesis. This objective encompasses the identification of both PPP1CC2 regulatory proteins
and putative substrates.
To this end, I have used a number of proteomic and biochemical approaches the results of which
are detailed in the forthcoming sections. Each of these studies utilized LC-MS/MS analysis as a means
for protein identification. For the first approach, I have created a transgenic mouse embryonic stem cell
line expressing tandem affinity tagged versions of PPP1CC1 and PPP1CC2 which were used in tandem
29
affinity purification experiments to identify both previously characterized, and novel PIPs via LC-
MS/MS. In my second approach, I performed sedimentation assays using recombinant GST-PPP1CC1
and GST-PPP1CC2 as bait in mouse testis lysate to identify novel interacting proteins in the mouse testis.
Finally, in a third approach, I performed a phosphoproteomic analysis to identify proteins that were
hyperphosphorylated in Ppp1cc mutant testes, which represent candidate substrates of PPP1CC2.
30
Chapter 2: Tandem affinity purification in transgenic mouse embryonic stem cells identifies
DDOST as a novel PPP1CC2 interacting protein
Author’s note: A modified version of this chapter was published as: MacLeod G and Varmuza S (2012).
Tandem affinity purification in transgenic mouse embryonic stem cells identifies DDOST as a novel
PPP1CC2 interacting protein. Biochemistry, 51 (48), 9678–9688.
Experiments were designed and conceived by myself and S. Varmuza. I was responsible for performing
all experiments, as well as writing the paper with editing from S. Varmuza.
Abstract
The PP1 family of protein phosphatases achieve functional diversity through numerous and varied
protein-protein interactions. In mammals there are four PP1 isoforms, the ubiquitously expressed
PPP1CA, PPP1CB and PPP1CC1, and the testis specific splice isoform PPP1CC2. When the mouse
Ppp1cc gene is deleted, the only phenotypic consequence is a failure of spermatogenesis in homozygous
males. To elucidate the function of the Ppp1cc gene we sought to identify novel protein-protein
interactions. To this aim, we have created SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2
knock-in mouse embryonic stem cell lines using a gene trap based system. Tandem affinity purification
using our knock-in cell lines identified 11 significant protein-protein interactions, including 9 known PP1
interacting proteins and two additional proteins—ATP5C1 and DDOST. Reciprocal in vitro
sedimentation assays confirmed the interaction between PPP1CC2 and DDOST which may have
physiological implications in spermatogenesis. Immunolocalization studies revealed that DDOST
localized to the nuclear envelope in dissociated spermatogenic cells, and persists throughout
spermatogenesis. The knock-in system described in this paper is applicable for creating tandem affinity
tagged knock-in embryonic stem cell lines with any gene for which a compatible gene trap line is
available.
31
2.1 Introduction
The current consensus is that the PP1 family of protein phosphatases achieve functional diversity
via interaction with a large number of regulatory proteins termed PP1 interacting proteins (PIPs). To
date, approximately 200 PIPs have been identified but emerging evidence suggests that there could be
many more, perhaps as many as 650 (Bollen et al. 2010). Therefore, to fully understand the role of a PP1
isoform, such as PPP1CC2 (Serine/threonine-protein phosphatase PP1-gamma catalytic subunit, isoform
2), it is important to determine to the fullest extent possible the interactome of that protein. This can be a
challenge for PIPs, as they are generally unrelated and difficult to identify based on sequence alone.
Previous attempts to identify PIPs computationally based on the presence of the RVxf motif that is
present in many known interactors have been moderately successful (Hendrickx et al. 2009); however
they cannot identify the complete interactome, as not all PIPs contain an RVxf motif.
The difficulty of identifying PIPs in silico means that to fully describe the interactome of PP1s,
experimental approaches are necessary. One powerful system of identifying protein-protein interactions
is Tandem Affinity Purification (TAP) (Rigaut et al. 1999). The use of two affinity purification steps
significantly reduces the amount of contaminating proteins in the final product making the technique
more sensitive in identification of legitimate interactors. The use of LC-MS/MS in protein identification
aids in this sensitivity allowing for the simultaneous identification of many interactors, even those in
relatively low stoichiometry. Additional advantages of TAP over other methods such as yeast 2-hybrid
include the ability to identify protein complexes that have more than two members, and the ability to
target expression of the bait protein to a variety of locations within the cell. Numerous TAP systems
have been developed that feature improved expression in mammalian systems, employing combinations
of affinity tags such as the FLAG-tag, and Streptavidin-binding peptide (SBP) (Angers et al. 2006, Chen
& Gingras 2007). In addition to being more readily expressed in mammalian cells, these tags are also
smaller in size, and thus less likely to interfere with the function of the tagged protein. TAP has now
been used in many studies, most frequently using cell-culture with transiently expressed TAP-tagged
32
proteins. Such techniques are able to give great insight into the interactomes of many proteins, but they
do have limitations based on the artificial nature of the system, including false-positive interactions
based on over/mis-expression of the bait protein. In addition, not all cell types/tissue can be modelled in
culture, and thus cell or tissue specific interactions may be missed. In an effort to combat these
limitations, some groups have begun to utilize TAP in transgenic mice. One such example utilized FLAG
and HA tandem affinity tagged Cyclin D1 knock-in mice to identify Cyclin D1 interacting proteins in
multiple mouse tissues, including brain and eyes (Bienvenu et al. 2010).
PPP1CC2 is a testis specific splice isoform of the PP1 family member Ppp1cc that is essential
for spermatogenesis (Varmuza et al. 1999). Deletion of Ppp1cc results in a wide range of morphological
abnormalities in the testis, most prominently a severe depletion of developing germ cells. However the
precise mechanism by which deletion of the Ppp1cc gene contributes to failure of spermatogenesis
remains unknown. In an effort to gain insight into the role of PPP1CC2 in spermatogenesis our aim is to
characterize its interactome. It is currently not possible to model the testis in cell culture due to its
complex architecture, and the fact that most of the relevant cells are post-meiotic. Therefore we have
sought to generate a system for performing PPP1CC2 TAP in transgenic mouse cells. In an effort to
recapitulate the wild-type expression pattern of the bait protein, and avoid artifacts associated with over-
expression, we have relied on gene-trap technology to ensure that expression is under the control of the
endogenous promoter. In addition to PPP1CC2, this system is amenable to any gene for which a gene-
trap ES cell line is available, making it a powerful tool for determining protein-protein interactions in a
transgenic setting.
2.2 Materials and Methods
Knock-in Vector Construction
The Streptavidin binding peptide (SBP)-3xFLAG knock-in vector (Figure 2.1A) was built using
pFloxin as a backbone (Singla et al. 2010). The pFloxin plasmid contains a beta-actin promoter sequence
33
followed by a lox66 site, and was generously provided by Dr. Bill Skarnes (Wellcome Trust Sanger
Institute). Cre-mediated recombination between the lox66 site in the knock-in vector and lox71 in the
pGT0lxf genetrap vector creates a double-mutant Lox site which shows a low affinity for Cre-
recombinase, and thus increases the efficiency of Cre-mediated insertion of the knock-in vector (Zhang
& Lutz 2002). The Engrailed2 (En2) splice-acceptor sequence was cloned from the pGT0lxf gene trap
line RRR804 (International Gene Trap Consortium) and inserted 3’ of the lox66 site. The internal
ribosomal entry site (IRES) of the encephalomyocarditis virus (ECMV) was cloned from the pGLUE
plasmid (Angers et al. 2006) which was generously provided by Dr. Stephane Angers (University of
Toronto, Faculty of Pharmacy). Immediately 3’ of the IRES, the SBP and 3xFLAG tandem affinity tags
were inserted, having been cloned from the pGLUE and pTFHW plasmids respectively. The SBP and
3xFLAG affinity tags were separated by a spacer sequence encoding the amino acids GGSPGGT.
Following the 3xFLAG affinity tag, an oligonucleotide sequence that included the coding region for the
spacer peptide sequence GGSPGG, as well as SphI and AflII restriction sites, was inserted. Finally, a
bovine growth hormone polyA signal fragment was cloned from the pGLUE plasmid and inserted 3’ of
the multiple cloning site.
The coding sequences for Ppp1cc1 and Ppp1cc2 were PCR amplified from pGEM7z vectors
containing their respective full-length cDNA sequences (Mann et al. 1995) to generate sticky-ended PCR
products according to the protocol of Walker et al. (Walker 2008). Primer sequences are as follows: for
Ppp1cc1, forward reaction 1, 5’-CATGGCGGATATCGACAAACTC-3’ (primer A); reverse reaction 1,
5’- TTAACTATTTCT TTGCTTGCTTTGTGATC-3’ (primer B), forward reaction 2, 5’-
GCGATATCGACAAACTCAAC-3’ (primer C); reverse reaction 2 5’-
CTATTTCTTTGCTTGCTTTGTGATC-3’ (primer D). For Ppp1cc2, forward reaction 1 primer A;
reverse reaction 1 5’-TTAATCGGTCACTCGTAAGGA-3’ (primer E); forward reaction 2 primer C;
reverse reaction 2 5’- TCGGTCCACTCGTATAGGA-3’ (primer F). The sticky-ended PCR products
34
were then ligated into the SphI (5’) and AflII (3’) sites of the Strep-3xFLAG knock-in vector. Vector
sequence was verified by sequencing.
Cell Culture
ES cells were cultured on 0.1% gelatin in high glucose DMEM supplemented with 15% FBS,
nonessential amino acids, 1 mM sodium pyruvate, 2 mM glutamine, penicillin-streptomycin, 10 µM β-
mercapto-ethanol, and 8 µg/mL leukemia inhibitory factor.
Cre-mediated Excision
RRR804 (Bay Genomics) ES cells were grown to ~70% confluence in a single well of a
gelatinized 24-well tissue culture dish and subsequently transfected with 800 ng pCMV-Cre-EGFP using
the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. The pCMV-Cre-
EGFP plasmid encodes a Cre-EGFP fusion protein and was a generous gift from Dr. Sabine Cordes
(Samuel Lunenfeld Research Institute). Successful transfection was verified by viewing EGFP
fluorescence. Proper cre-mediated excision eliminates expression of the β-geo reporter sequence,
resulting in G418 sensitivity. Thus to aid in the selection of cells that have undergone Cre-mediated
excision pCMV-Cre-EGFP treated RRR804 ES cells were sorted into GFP+ and GFP- fractions via
fluorescence activated cell sorting (FACS). Transfected cells were harvested and resuspended in 1 X
PBS, 5mM EDTA, 25mM HEPES and 1% FBS, followed by filtration through a 40µM nylon mesh cell
strainer. FACS was carried out using a FACS Aria machine at the University of Toronto, Faculty of
Medicine Flow Cytometry Facility. Sorted cells were collected in DMEM with 50% FBS, and GFP+
fraction was plated on 10cm tissue culture dishes at low density in standard culture media. Cells were
grown for approximately 6 days until ES colonies became visible, and were subsequently picked.
Cre-mediated Insertion
35
RRR804-SA ES cells were grown to approximately 70% confluence in 10cm tissue culture
plates and were then trypsinized, harvested and washed in PBS. After resuspension in PBS cells were
counted using a hemacytometer. Cell concentration was then adjusted to approximately 107 cells per 800
µL PBS. 107 RRR804-SA cells were added to a chilled electroporation cuvette along with 60 µg each of
pCX-nlsCre and either Ppp1cc1 or Ppp1cc2 knock-in vector. pCX-nlsCre expresses Cre-recombinase
with a nuclear localization signal, under the control of a β-actin promoter and was a generous gift from
Dr. Andras Nagy (University of Toronto, Samuel Lunenfeld Research Institute, Toronto). Cells were
electroporated at 240V, 500 µF using a BioRad GenePulser. After electroporation, cells were incubated
at room temperature for approximately 20 minutes and then plated evenly between six 10cm tissue
culture plates. G418 selection was started on the second day after electroporation, and was conducted at
a concentration of 300 µg/mL. Colonies were picked between days 8 and 12 of G418 selection.
RT-PCR
RNA extraction and cDNA synthesis were performed using standard protocols. Primer sequences
utilized are as follows: 1F 5’-CGCACAGTCTAGGTGGGTATTGC-3’; 1R 5’-
CTGCAAAGGGTCGCTACAGACG-3’; 2F 5’-ACGTGGTGGAGGGCCTGG-3’; 2R 5’-
GTGGTGTGACAGGTCTCGTG-3’; 3F 5’-GTTGCCTTTTATGGCTCGAGCGG-3’; 3R 5’-
TAACCGTGCATCTGCCAGTTTGAGG-3’; 4F 5’-TGAGAGGGACAGGCCACCAAGG-3’. IRES
forward primer 5’-GGACGTGGTTTTCCTTTGAA-3’; Ppp1cc coding sequence 3’ region 5’-
TGTGACAGGTCTCGTGGC-3’.
Western Blotting
SDS-PAGE and western blotting were performed using standard protocols. PPP1CC antibody
(N-19, Santa Cruz Biotechnology) was used at a concentration of 1:500, with Donkey anti-goat HRP
secondary (Santa Cruz Biotechnology) at a concentration of 1:5000. Anti-FLAG M2 antibody (Sigma)
36
was used at a concentration of 1:5000, with Goat anti-mouse HRP secondary (Zymed) at a concentration
of 1:5000.
Tandem Affinity Purification
TAP protocol was adapted from Chen and Gingras (2007) and Angers et al. (2006). SBP-
3xFLAG-PPP1CC knock-in ES cells were harvested by trypsinization and washed once with PBS. Cells
were pelleted and flash frozen in liquid nitrogen, and stored at -80°C until processed. Cells were thawed
and resuspended in approximately 9 volumes of TAP lysis buffer (10% glycerol, 50mM HEPES-NaOH
pH 8.0, 150 mM NaCl, 2 mM EDTA, 0.1% NP-40, 1mM DTT, 10mM NaF, 0.25 mM sodium
orthovanadate, 50 mM beta-glycerolphosphate, 1mM PMSF, 1X sigma protease inhibitor), and incubated
a 4°C for 15 minutes with rocking. Lysate was then frozen in liquid nitrogen, and thawed at 4°C,
followed by centrifugation for 10 minutes at 10,000 x g to remove insoluble material. Cleared lysate was
then added to washed (3 x with TAP lysis buffer) Anti-FLAG-M2 resin (Sigma) at a ratio of
approximately 2.5 µL of packed resin for each 10cm plate of ES cells harvested. FLAG pull-down was
incubated overnight at 4°C with rocking, and then washed 3 times with TAP lysis buffer. Protein was
eluted from Anti-FLAG-M2 resin using 3XFLAG Peptide (Sigma) at a concentration of 100 µg/mL in
400 µL of TAP lysis buffer for 30 minutes at 4 °C with rocking. This elution step was repeated one
additional time and eluates were pooled. FLAG elution was then added to 50 µL of packed Streptavidin-
Sepharose 4B (U. S. Biological), that had been washed 3 times in TAP lysis buffer, and incubated
overnight at 4°C with rocking. Streptavidin-Sepharose resin and bound proteins were washed 3 times
with TAP lysis buffer, and twice with Streptavidin Wash Buffer (10 mM β-mercaptoethanol, 50 mM
HEPES-NaOH pH 8.0, 150 mM NaCl, 1mM MgOAc, 1mM Imidazole, 0.1% NP-40, 2 mM CaCl2).
Bound proteins were eluted from Streptavidin-Sepharose using Streptavidin Wash Buffer supplemented
with 50 mM D-Biotin. Elution was performed with gentle vortex agitation at 4 °C, twice in 200 µL of
elution buffer and once in 100 µL with all elutions pooled. Eluted proteins were precipitated via
treatment with 30% trichloroacetic acid for 30 minutes on ice followed by centrifugation at ~16,000 x g
37
for 30 minutes at 4 °C. Protein pellet was then washed twice with 500 μL of ice-cold acetone. Protein
pellet was resuspended in 6M Urea, and then reduced with 10 mM DTT in a final volume of 100 µL of
50 mM ammonium bicarbonate for 45 minutes at 50°C. Next, to alkylate the sample iodoacetamide was
added to a concentration of 33.3 mM and incubated at room temperature for 1 hour in darkness. To
digest the sample 1.2 µg of proteomics grade trypsin (Sigma) was added, and incubation at 37°C was
performed overnight. Trypsin was inactivated with 1% formic acid, and the sample was lyophilized.
Chimera Production
SBP-3XFLAG-PPP1CC2 knock-in ES cell clones were submitted to the Transgenic Core
Facility at the Toronto Centre for Phenogenomics (http://www.phenogenomics.ca; TCP) for chimera
generation via blastocyst microinjection with C57BL/6 hosts. ES cells were tested for both ploidy and
presence of contaminating viruses and bacteria (mycoplasma) before submission to TCP. Chimeric mice
were identified via coat colour. Chimeric mice were bred with both C57BL6 and CD1 mice and offspring
were identified by coat colour.
LC-MS/MS Analysis and Database Searching of TAP experiments
Peptide mixtures were subjected to LC-MS/MS analysis using a nanoLC (Eksigent) attached to a
LTQ-Orbitrap mass spectrometer (ThermoFisher) which was performed by the Centre for the Analysis of
Genome Evolution and Function (University of Toronto, Toronto, ON). LC-MS/MS data files were
processed into peak lists using Mascot Daemon and submitted to Mascot (Matrix Science, London, UK;
version 2.3.02) for database searching. The SwissProt mouse protein database 57.15 (515203 entries)
was queried, using the following parameters: carboxymethyl (C) set as a fixed modification, and
oxidation (M) as a variable modification, fragment ion mas tolerance of 0.80 Da and a parent ion
tolerance of 7 ppm.
His-tag sedimentation assay
38
A recombinant His-tagged DDOST fragment (Abcam), corresponding to amino acids 144-360 of
human DDOST was bound to Ni-NTA resin. The His-DDOST resin was incubated with 1 mg of mouse
testis lysate in TAP lysis buffer for 2 hours at 4°C with rocking, followed by 3 washes with TAP-lysis
buffer. His-DDOST resin was boiled in 1X SDS-PAGE Sample loading buffer and submitted to SDS-
PAGE followed by western blotting.
Immunohistochemistry
Wild-type and Ppp1cc mutant testes were harvested and placed in dMEM after removal of the
tunica albuginea and homogenized using a razor blade to release germ cells from the seminiferous
tubules. To enhance germ cell release, tubules were squeezed repeatedly with square-tipped forceps. The
resultant homogenate was mixed and allowed to settle for several minutes. The developing germ cells
were then pelleted by centrifugation at 2,000 rpm for 2 minutes. Following removal of the supernatant
the germ cells were re-suspended in PBS and dropped onto poly-l-lysine coated slides and fixed in 4%
paraformaldehyde. Slides containing sections and dissociated cells were permeabilized with 0.01%
Triton-X in PBS, and blocked in 10% goat serum, 1% BSA, 0.01% Tween20, PBS solution, followed by
a second blocking step in 0.1 mg/mL AffiniPure F(ab’)2 fragment goat anti-mouse IgG (Jackson
ImmunoResearch). Primary antibody incubations were performed in antibody dilution buffer (5% goat
serum, 1% BSA, 0.01% Tween20, PBS) over night. Anti-DDOST (Santa Cruz Biotechnology, H-300)
was used at a concentration of 1:250 and Anti-MAb414 (Covance) was used at a concentration of 1:250.
Secondary antibody incubations were performed in antibody dilution buffer for 2 hours in darkness using
Cy3 conjugated secondary antibodies either AffiniPure Goat Anti-Rabbit IgG (DDOST, 1:2000) and/or
Dylight® 488 goat anti-mouse (Abcam). Slides were then stained with DAPI and mounted in 50%
glycerol for viewing with an Olympus BX60 microscope using the appropriate filters. Images were
captured using Cool Snap software and a CCD camera (RSPhotometrics). Images were merged using
ImagePro Plus version 4.1 and adjusted for brightness and contrast using Photoshop 6.0 (Adobe).
39
Phosphopeptide enrichment and identification
Adult mouse testes were decapsulated and lysed in 400μL of 7M Urea, 2M Thiourea, 4%
CHAPs, 40mM Tris, reduced with 20mM DTT for 1 hour at room temperature and alkylated with 40 mM
iodoacetaminde for 35 minutes at room temperature in darkness. Testis proteins were precipitated with
acetone and dried using a speedvac, followed by resuspension in a 1M urea, 50 mM ammonium
bicarbonate solution containing 10μg of proteomics grade trypsin. Digestion was carried out over night
at 37°C, and at completion the solution was acidified with 1% formic acid and centrifuged to remove
insoluble material. 500 μg of testis protein was used for phosphopeptide enrichment via sequential
elution from IMAC (SIMAC) using the protocol from Thingholm et al. (Thingholm et al. 2009), but with
50μL of TiO2 Mag Sepharose (GE Healthcare) substituted for TiO2 phosphopeptide enrichment steps.
LC-MS/MS analysis and phosphopeptide identification was performed by the Advanced Protein
Technology Centre (Toronto, ON, Canada). All MS/MS samples were analyzed using Sequest (Thermo
Fisher Scientific, San Jose, CA, USA; version 1.3.0.339) and X! Tandem (The GPM, thegpm.org;
version CYCLONE (2010.12.01.1)). Sequest was set up to search MOUSE-Uniprot-Sep-05-12.fasta
(55250 entries) assuming the digestion enzyme trypsin. X! Tandem was set up to search the MOUSE-
Uniprot-Sep-05-12 database (55270 entries) also assuming trypsin. Sequest and X! Tandem were
searched with a fragment ion mass tolerance of 0.60 Da and a parent ion tolerance of 10.0 PPM.
Iodoacetamide derivative of cysteine was specified in Sequest and X! Tandem as a fixed modification.
Oxidation of methionine and phosphorylation of serine, threonine and tyrosine were specified in Sequest
and X! Tandem as variable modifications. For protein identification Scaffold (version Scaffold_3.4.3,
Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein
identifications. Peptide identifications were accepted if they exceeded specific database search engine
thresholds. Sequest identifications required at least deltaCn scores of greater than 0.10 and XCorr scores
of greater than 1.8, 2.5, 3.5 and 3.5 for singly, doubly, triply and quadruply charged peptides. X! Tandem
identifications required at least -Log(Expect Scores) scores of greater than 2.0. Protein identifications
40
were accepted if they contained at least 1 identified peptide. Proteins that contained similar peptides and
could not be differentiated based on MS/MS analysis alone were grouped to satisfy the principles of
parsimony. Statistical analysis of phospho-site localizations were performed using ScaffoldPTM
(version 2.0.0, Proteome Software Inc., Portland, OR).
2.3 Results
Generation of SBP-3XFLAG-PPP1CC1 and SBP-3XFLA-PPP1CC2 knock-in ES cell lines
In an effort to identify interactors of PPP1CC isoforms from transgenic mouse cells, we created
mouse embryonic stem (ES) cell lines carrying knock-in alleles of either PPP1CC1 or PPP1CC2 with N-
terminal Streptavidin-binding peptide (SBP) and 3XFLAG tandem affinity tags. A two-step strategy
based on that originally proposed by Hardouin and Nagy (2000) and also utilized by Singla et al. (2010)
was used (Figure 2.1B). The first step is the Cre-mediated excision of the additional loxP site in the
pGT0lxf based gene-trap line. pGT0lxf gene trap ES cell lines feature a gene-trap cassette containing an
En2 splice-acceptor sequence flanked by Lox71 (5’) and LoxP (3’) sites. Following the floxed splice-
acceptor is the coding sequence for the β-geo reporter gene. Recombination between the lox71 and loxP
sites results in the removal of the splice-acceptor sequence and should in theory restore the expression of
the endogenous Ppp1cc transcript(s).
The Ppp1cc gene trap ES cell line RRR804, obtained through the International Gene Trap
Consortium (Nord et al. 2006) and Mutant Mouse Regional Resource Centres, contains a gene trap
insertion at nucleotide 458 of intron 2, as verified by genomic DNA sequencing. RRR804 ES cells were
transiently transfected with pCMV-Cre-EGFP which expresses a Cre-recombinase-EGFP fusion protein.
Transfected cells were subjected to FACS, and the GFP positive fraction was isolated. To assay for
successful Cre-mediated excision, genomic DNA was isolated from GFP positive colonies, followed by
PCR using primers flanking the lox71-splice acceptor- loxP region. All GFP positive colonies screened
41
Figure 2.1: Strategy for the generation of SBP-3XFLAG-PPP1CC knock-in embryonic stem cells. (A)
Schematic diagram of the knock-in vector used in this study. Actb = β-actin promoter, pA = bovine
growth hormone polyadenylation signal, AmpR = ampicillin resistance gene, SBP= Streptavidin binding
peptide, SA = splice acceptor sequence, FRT = Flp recombinase site. (B) Two-step strategy for
integration of the knock-in plasmid into pGTl0xf gene-trap lines.
42
A
B
43
had successfully undergone Cre-mediated excision, as evidenced by the smaller PCR product in Figure
2.2. If the FACS step was omitted, the percentage of colonies that showed successful Cre-mediated
excision was 25%. RRR804 cell lines with an excised splice-acceptor region were designated RRR804-
SA.
The second step is the integration of the knock-in plasmid at the remaining lox71 site. This was
accomplished via Cre-mediated insertion resulting from recombination between the gene-trap lox71 site
and a lox66 site in our knock-in plasmid. The backbone for our knock-in vector is the pFloxin plasmid
which was used in the generation of similar constructs by Singla et al. (2010). To this backbone we
added an En2 splice-acceptor sequence, followed by an IRES. Immediately following the IRES the
coding sequences for a SBP, a 3XFLAG tag, and either PPP1CC1 or PPP1CC2, as well as a BGH poly-
adenylation signal (Figure 2.1A). Proper integration of the knock-in vector should lead to expression of
an N-terminal SBP-3XFLAG-tagged version of the relevant transgene, under the control of the natural
promoter for the gene-trap locus. This vector was designed such that a tandem affinity tagged version of
any transgene can be integrated into any pGT0lxf gene-trap line. RRR804-SA ES cells were
simultaneously electroporated with both a Cre-recombinase expressing plasmid (pCX-nls-Cre) and either
the PP1CC1 or PPP1CC2 SBP-3XFLAG knock-in vector. To select for knock-in positive ES cells,
transformants were grown in the presence of G418, as proper integration of the knock-in plasmid will
expose the β-geo reporter gene to a β-actin promoter. A total of 48 G418 resistant ES cell colonies were
isolated (19 PPP1CC1 and 29 PPP1CC2).
Verification of SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2 knock-in ES cell lines
To verify the presence of the knock-in allele, genomic DNA of 15 randomly selected G418 resistant
colonies was assayed via PCR using a series of primer pairs (Figure 2.3). All but one of the 15 assayed
G418 resistant ES cell colonies was positive for the presence of the knock-in construct. To verify the
expression of the SBP-3XFLAG-Ppp1cc transcripts, G418 resistant clones were subjected to
44
Figure2.2: Cre-mediated excision of second loxP site in pGT0lxf gene-trap line RRR804. Depicted is
genomic DNA PCR product amplified using primers flanking the Lox71 and LoxP sites in the gene-trap
cassette. –Cre/+Cre indicates samples prior to or after treatment with Cre-recombinase respectively; L
indicates DNA ladder. Expected size of the original genomic DNA fragment is 861 bp, while fragments
having undergone Cre-mediated excision are expected to be 570 bp.
45
46
Figure 2.3: Verification of Cre-mediated insertion of transgene into RRR804-SA ES cell genome. (A)
Schematic diagram depicting the genomic DNA sequence features of a transgene positive clone at the
locus of insertion. Sequence features are coloured as in Figure 2.1. Location and direction of forward
(F) and reverse (R) primers used in the following section are shown. (B) Genomic DNA PCR product of
four different PCR reactions using the primer pairs indicated on the left in RRR804 gene-trap ES cells,
and representative SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2 knock-in clones. Results
demonstrate the presence of the transgene in knock-in clones but not the original gene-trap cell line.
47
48
RT-PCR using a forward primer in the IRES sequence and a reverse primer in a 3’ region common to the
Ppp1cc1 and Ppp1cc2 transcripts (Figure 2.4A). Expression of the SBP-3XFLAG-Ppp1cc1 and SBP-
3XFLAG-Ppp1cc2 transgenes was detectable in respective knock-in ES cell lines at a size consistent
with the predicted sequence. Finally, to verify the effective translation of the knock-in constructs, ES
cell lysates were subjected to western blotting with an antibody against the FLAG epitope. As seen in
Figure 2.4B, both SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2 knock-in ES cell lines showed
a robust FLAG signal, while no signal was detected in lysate from the original gene-trap ES cell line.
Curiously, western blotting with anti-PPP1CC showed only the <40 kDa band of the endogenous
PPP1CC1 signal, and no band with the expected molecular weight shift corresponding to the TAP tag.
This could possibly be due to the fact that the PPP1CC antibody used is directed against the N-terminus,
which may be sterically hidden by the N-terminal TAP tag.
PPP1CC1 and PPP1CC2 Tandem Affinity Purification in ES cells
To verify the functionality of the TAP tag in our SBP-3XFLAG-PPP1CC knock-in ES cells, TAP
experiments were carried out in ES cell culture. Optimization of our ES cell TAP protocol resulted in a
recovery of approximately 30% of our bait protein. This recovery is comparable with other mammalian
TAP systems (Li et al. 2011b). One note of particular interest is that initial experiments which utilized
Streptavidin-Sepharose as the first affinity purification step yielded very little capture of the bait protein.
Conversely, binding efficiency of the bait protein to the Streptavidin-sepharose resin, after elution from
the anti-FLAG-M2 affinity resin was nearly 100%.
After optimization, TAP studies were performed on cell lysate from SBP-3XFLAG-PP1CC ES
cells, and the isolated proteins were digested with trypsin and subjected to LC-MS/MS. The resultant
mass spectra were searched against the SwissProt mouse protein database using the MASCOT search
tool, and unique peptides exceeding the threshold score calculated by MASCOT (p<0.05; absolute value
49
Figure 2.4: Expression of the SBP-3XFLAG-PPP1CC1/2 transgenes in knock-in ES cells at the cDNA
and protein level. (A) Product from RT-PCR reaction performed on ES cell RNA using a forward primer
which anneals to the IRES sequence and a reverse primer which anneals to a region in the Ppp1cc coding
sequence common to Ppp1cc1 and Ppp1cc2 demonstrates expression of the SBP-3XFLAG-PPP1CC1/2
transgenes. “Plasmid” indicates the use of the SBP-3XFLAG-PPP1CC knock-in plasmid as a template
for the PCR reaction, set to serve as a positive control. (B) Western blot of ES cell proteins using anti-
FLAG-M2 antibody (Sigma) shows expression of the SBP-3XFLAG-PPP1CC1/2 proteins.
50
A
B
51
calculated independently in each experiment) were recorded. In total, approximately sixty 10-cm tissue
culture dishes each of SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2 ES cells were subjected to
TAP throughout 3-5 replicate experiments. Additionally, 4 negative control experiments were conducted
using ES cells that did not express our knock-in construct. Lists of proteins identified in our TAP
experiments as potential PPP1CC interacting proteins were subjected to a number of filtering criteria,
designed to eliminate contaminants and identify bona-fide interactors. First, proteins that were identified
in our negative control experiments were discounted, as they were likely to be contaminants. Remaining
proteins were then compared to three lists of likely contaminant proteins generated by other labs; a list of
common background contaminants from FLAG IPs (Chen & Gingras 2007), a dataset from a series of
FLAG IPs conducted in HEK293T cells expressing the FLAG-tag (A.C. Gingras, unpublished data), and
a TAP dataset from experiments using the GS-tag (includes SBP) that identifies non-specific interactors
(Burckstummer et al. 2006).
The top protein hit in all runs was identified as PPP1CC (average MASCOT protein score =
807), indicating that our transgenic lines were in fact expressing the expected bait protein, despite the
lack of anti-PPP1CC signal in western blotting. After application of the above-mentioned filtering
parameters, significant unique peptides corresponding to 76 different proteins were identified (Appendix
A.4.1/Supplementary table S1). However, identification of a protein via a single unique peptide can
result in a high incidence of false-positive interactions. Eleven proteins in our dataset were identified by
at least two unique and non-overlapping peptides, representing a more confident set of PPP1CC
interacting proteins (See Table 2.1). Amongst the identified PPP1CC interacting proteins, 9 were known
PP1 interacting proteins, thus validating the correct folding of our SBP-3XFLAG-PPP1CC fusion
proteins in our knock-in system. Two of the known PP1 interacting proteins, WDR82 and LMTK2 had
previously not been shown to bind to the PPP1CC2 isoform.
52
Table 2.1: Protein-protein interactions detected via tandem affinity purification. “X”
indicates protein was identified in a tandem affinity purification experiment with the indicated bait
protein. * indicates a protein shown to interact indirectly with PP1, via an intermediate protein. +
indicates an interaction that did not meet our requirement of 2 unique peptide hits, but was included as it
is a known PPP1CC2 interacting protein in the testis.
53
Gene
symbol
Uniprot
Accession
Number
Known
PIP?
RVxF
motif?
SBP-
3XFLAG
PPP1CC1
TAP
SBP-
3XFLAG
PPP1CC2
TAP
Best
MASCOT
protein
score
Unique
Peptides
Spectra
l Count
%
Coverage
PPP1R7 Q3UM45 Yes No X X 681 17 126 61.5
PPP1R8 Q8R3G1 Yes Yes X X 110 8 20 37.9
PPP1R2 Q9DCL8 Yes Yes X X 151 5 35 24.3
WDR82* Q8BFQ4 Yes No X X 68 4 8 16.3
DDOST O54734 No Yes X 56 3 3 6.3
PPP1R10 Q80W00 Yes Yes X 43 3 5 6.1
PPP1R11 Q8K1L5 Yes Yes X X 75 2 11 39.7
RRP1B Q91YK2 Yes Yes X 29 3 8 6.9
ATP2A2 O55143 Yes Yes X 85 2 3 3.8
ATP5C1 Q91VR2 No No X 41 2 2 7.4
LMTK2 Q3TYD6 Yes Yes X X 48 2 13 4.6
PPP1R42+ Q8R1Z4 Yes Yes X 25 1 1 2
54
Aside from known PP1 interacting proteins we have identified two novel PPP1CC interactors in
our ES-cell TAP experiments. However, one of these proteins, ATP5C1, is a member of the ATP
synthase,
H+ transporting, mitochondrial F1 complex, to which 3 other proteins found in negative control
pull-down datasets belong, putting its assignment as a legitimate PPP1CC interacting protein into
question. The remaining putative PPP1CC interacting protein identified was Dolichyl-
diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit (DDOST). Examination of the
amino acid sequences of this protein revealed the presence of the classical PP1 binding RVxF. DDOST
contains the sequence RVIF at amino acids 239-242.
While identification of protein-protein interactions based on a single unique peptide is
challenging, and has a high rate of false positives, it is still possible to glean useful information from
these cases. This is particularly true of low abundance interactions which may be masked by the high
abundance of previously described PP1 interaction partners such as PPP1R7. In fact, one known
PPP1CC2 interacting protein PPP1R42 was found in our list of proteins identified by a single unique
peptide. One indication that there may be more legitimate PPP1CC interacting proteins amongst the low
confidence hit is the prevalence of the classical PP1 binding RVxF motif ([KR]-X(0,1)-[VI]-{P}-[FW]);
found in up to 25% of all proteins (Ceulemans &Bollen. 2006) but found in 38% (25 of 65) in our single
peptide list, a significant enrichment (p < 0.025 via χ2). One RVxF motif containing protein that stands
out as a candidate for PPP1CC2 interaction is BRWD1 (Bromodomain and WD repeat containing 1),
which when deleted, results in a male infertility phenotype very similar to that of the Ppp1cc knockout
(Philipps et al. 2008).
Validation of PPP1CC2-DDOST interaction in Testis
To validate DDOST as a PPP1CC2 interacting protein we conducted a sedimentation assay using
a recombinant his-tagged DDOST construct (Figure 2.5). The assay was conducted in mouse testis
55
lysate, as this is the only tissue in which both proteins are abundantly expressed. The His-DDOST
construct utilized corresponds to amino acids 144-360 of Human DDOST with an N-terminal His tag,
which contains the PP1 docking motif; this region is highly conserved between human and mouse, with
only 5 amino acid substitutions in 217 residues. His-DDOST, bound to Ni-NTA resin, was able to
precipitate PPP1CC2 from mouse testis lysate, while the Ni-NTA resin alone was not. This reciprocal
pull-down validates the interaction between DDOST and PPP1CC2.
Immunolocalization of DDOST in mouse spermatogenic cells
DDOST is a member of the ER membrane localized Oligosaccharyltransferase (OST) complex.
To our knowledge the distribution of DDOST throughout spermatogenesis has not been characterized.
Therefore immunolocalization studies on dissociated mouse spermatogenic cells were performed. Anti-
DDOST staining displayed a punctate pattern in a range of germ cell types (Figure 2.6) that was not
visible when omitting the primary antibody (Figure 2.6C). While DDOST puncta were visible
throughout the cytoplasm, the staining was primarily concentrated around the nucleus, most likely on the
nuclear envelope as puncta were visible just outside the chromatin stained region (Figure 2.6A, arrows).
The rough endoplasmic reticulum is known to be associated with the nuclear surface in spermatogenesis
(Chemes et al. 1978) which is consistent with the predicted ER localization of DDOST. This staining
pattern was especially prevalent in spermatocytes, whereas round spermatids displayed an increase in
cytoplasmic staining (Figure 2.6A). In elongating spermatids, nuclear envelope staining was reduced
significantly especially in the dorsal and apical regions (Figure 2.6A). In a small subset of elongating
spermatids a large degree of cytoplasmic accumulation of DDOST signal into a region distant from the
nucleus was observed, which likely corresponds to the residual body in which excess cytoplasm and
organelles are sequestered for elimination from the spermatid (Figure 2.6A, asterisk). The observed
DDOST staining pattern was preserved in Ppp1cc knockout spermatogenic cells, from spermatocytes
through to the small number of morphologically abnormal elongating spermatids present in these
mutants (Figure 2.6B). However, we did not observe the residual body-like staining pattern seen in a
56
Figure 2.5: Validation of PPP1CC2-DDOST interaction in mouse testis lysate. Western blot using anti-
PPP1CC probe on eluates from His-DDOST and mock pull-downs demonstrates that PPP1CC2 and
DDOST can interact in the testis. Input represents roughly 5% of total testis protein used.
57
58
Figure 2.6: Localization of DDOST in dissociated spermatogenic cells. Shown are spermatocytes (Sc),
round spermatids (RS) and elongating spermatids (ES) with DDOST signal localizing primarily to the
nuclear envelope region. Nuclei are indicated using DAPI. Anti-DDOST was visualized with goat anti-
rabbit Cy3 in wild-type (A) and Ppp1cc knockout (B) spermatogenic cells. Arrows indicate DDOST
puncta falling outside the nuclear stained region. Asterisk indicates cytoplasmic accumulation of DDOST
in residual body. (C) Localization of DDOST to the nuclear envelope, but not nuclear pore complexes in
wild-type spermatocytes, evidenced via comparison with a nuclear pore complex marker MAb414. +Ab
indicates inclusion of primary antibodies; -Ab indicates no primary antibody was used.
59
Figure
2.6A
60
Figure 2.6B
61
Figure 2.6C
62
small number of wild-type elongating spermatids, in any Ppp1cc spermatids. This is likely due to the
small number of these cells in present in the mutants, as the amount of DDOST present in later
spermatids appears similar to wild type cells (Figure 2.6A-B bottom rows). These results suggest that
PPP1CC2 is not required for proper DDOST localization in the testis. It should be noted that PPP1CC2 is
strongly expressed throughout the developing spermatogenic cells particularly in the cytoplasm of late
spermatocytes and spermatids (Hrabchack & Varmuza, 2007) to such a degree that co-localization
studies with DDOST would not be informative.
To confirm that DDOST localized to the nuclear envelope, spermatogenic cells were stained with
MAb414 which recognizes a family of nuclear pore complex (NPC) proteins on the nuclear envelope.
MAb414 and DDOST stained the same region of the cell around the nucleus confirming localization of
DDOST to the nuclear envelope region (Figure 2.6C). Closer examination of DDOST and MAb414
puncta shows DDOST puncta are next to, but not completely co-localized with MAb414 puncta (Figure
2.6C, inset) indicating that while localized to the nuclear envelope region, DDOST does not localize to
the NPC.
Phosphorylation of OST complex member STT3B in the mouse testis
DDOST localization in the testis does not appear to be dependent of PPP1CC2 activity. This fact
and the presence of the RVxF motif common to PP1 regulators suggests the possibility that DDOST
serves to recruit PPP1CC2 to its subcellular locale during spermatogenesis, allowing for the
dephosphorylation of similarly localized substrates. As DDOST is a member of the multi-protein OST
complex, we sought to determine if any of the other members of OST complex are Ser/Thr
phosphorylated in the testis, making them potential PPP1CC2 substrates. To test this, we performed a
phosphoproteomic analysis of the adult mouse testis, using sequential elution from IMAC (SIMAC)
phosphopeptide enrichment. Amongst the recovered peptides we identified two different overlapping
doubly phosphorylated peptides ENPPVEDpSpSDEDDKR and ENPPVEDpSpSDEDDKRNPGNLYDK
63
corresponding to the STT3B gene, a member of the OST complex. The phosphorylated serine residues
map to S495 and S496 of mouse STT3B. The localization probability of both phosphosites is 100%
according to the ScaffoldPTM software, with Ascores of 1,000 being assigned to each phospho-site. In
total, these two peptides were identified 13 times throughout 3 SIMAC fractions, further strengthening
confidence in the phospho-site localization (See supplemental data for complete statistical data,
annotated spectra and fragmentation tables).
Generation of SBP-3XFLAG-PPP1CC2 chimeric mice
The original aim of the experiment was to identify PPP1CC2 interactions in a more biologically
relevant setting – the testis - by creating SBP-3XFLAG-PPP1CC2 knock-in mice, using our engineered
ES cells. Chimera production was performed by the Toronto Centre for Phenogenomics, using blastocyst
microinjection into C57BL6 host embryos. Two male and 5 female chimeras, all with a weak
contribution from the knock-in cell lineage (evidenced by coat colour), were generated from two
different cell lines. One male chimera died before the commencement of breeding, and the second died
after producing several litters. Breeding of the male chimera resulted in the production of 11 offspring
derived from the ES cells, as judged by coat colour, indicating that the ES cells were able to populate the
germline; however all were wild type and none carried the SBP-3XFLAG-PPP1CC2 allele.
2.4 Discussion
To truly understand the function of a protein in a given tissue it is critical to define its
interactome—the full complement of protein-protein interactions. Due to the recent advancements in
proteomic technologies, high throughput studies are making great inroads into defining the interactomes
of many proteins. However, one major drawback of these studies is the fact that the vast majority are
conducted in cell-lines that may not be physiologically relevant to the question at hand and as such are
not directly translatable to a protein's interactome in a specific cell type or tissue. One example of such a
tissue is the testis, which is not possible to model in tissue culture due to its complex architecture and its
64
complement of post-meiotic cells. For this reason we undertook to produce a system that would be
useful in generating affinity tagged knock-in ES cells that could theoretically be used to generate
transgenic mice. The SBP-3XFLAG knock-in vector described in this paper, based on the floxin system,
will allow for the creation of transgenic tandem affinity tagged versions of any gene for which a pGT0lxf
gene trap line exists (over 24,000 different lines are currently available (Singla et al. 2010)).
The PP1 isoform PPP1CC2 is a testis-specific splice isoform that is essential in mouse
spermatogenesis (Varmuza et al. 1999). While approximately 200 PP1 interacting proteins have been
identified (Heroes et al. 2012), the interactome of PPP1CC2 in the testis requires further study. Previous
studies from our lab have sought to identify PPP1CC2 interacting proteins via approaches such as the
yeast 2-hybrid (Hrabchak & Varmuza 2004, Hrabchak et al. 2007). While these approaches allowed us
to identify several novel PPP1CC2 specific interacting proteins, to get a complete picture of the
PPP1CC2 interactome, we require a means of performing experiments directly in the testis. As shown
above, we were able to successfully produce mouse ES cell lines expressing functional tandem affinity
tagged versions of our genes of interest. The recombinant proteins expressed by our transgenic ES cell
lines not only expressed SBP-3XFLAG-PPP1CC1 and SBP-3XFLAG-PPP1CC2, but were able to
interact with a number of known PP1 interacting proteins. This demonstrates the utility of our system in
creating such modified ES cell lines, which can easily be extended to many other genes by varying only
a single cloning step. Our attempt to generate a line of transgenic mice expressing SBP-3XFLAG-
PPP1CC2 was foreshortened by the early demise of the founder male. However, the fact the chimera
sired 11 ES derived offspring (all wild type), based on coat colour, indicates that the ES line is capable of
populating the germline. Singla et al. (2010) utilized the same vector backbone and knock-in strategy,
and found that pluripotency was not affected by the process. Although the numbers are too low to draw
any definitive conclusions, the possibility that the TAP-tagged PPP1CC2 has dominant negative
properties cannot be ruled out.
65
In ES cell TAP experiments we have identified and validated a novel PP1 interacting protein,
DDOST. This protein contains the classical PP1 docking motif that is found in approximately 90% of all
identified PP1 binding proteins (Hendrickx et al. 2009). This study has demonstrated that DDOST can
bind to PPP1CC2; however its ability to bind to other PP1 isoforms has yet to be tested. DDOST is a
member of the oligosaccharyltransferase complex, and catalyzes the transfer of high-mannose
oligosaccharides to nascent polypeptide chains across the ER membrane (Yamagata et al. 1997). DDOST
plays a non-catalytic role, and is essential for assembly of the OST complex (Roboti & High. 2012). One
recent clinical study found that a patient’s congenital disorder of glycosylation, with symptoms including
severe dysfunction of multiple organs and cognitive impairment was found to be due to a 22 bp deletion
and missense mutation in DDOST (Jones et al. 2012). In the rat testis, DDOST has been shown to be
expressed throughout spermatogenesis, with its highest expression found at a time point corresponding to
the beginning of spermatid formation (Luk et al. 2003). Additionally, DDOST has recently been
identified in the detergent resistant membrane fraction of both human and mouse spermatozoa, and has a
putative role in sperm-oocyte interaction and/or cell adhesion (Asano et al. 2010, Nixon et al. 2011) as
are other members of the OST complex RPN1 and RPN2. Despite this expression data, whether or not
DDOST plays a critical role in spermatogenesis remains untested.
Our results show that DDOST is expressed in a range of spermatogenic cell types and shows a
prominent punctate localization to the nuclear envelope which is especially prevalent in spermatocytes.
This is consistent with the known rough endoplasmic reticulum (RER) localization of DDOST, as the
nuclear envelope is a specific domain of the ER (Lynes & Simmen 2011) and spermatocyte nuclei are
known to be covered with a mantle of RER that can cover up to 50% of the nuclear surface (Chemes et
al. 1978). Later in spermatogenesis, localization of DDOST to the nuclear envelope appears to be
reduced, with an accumulation in the cytoplasm evident, most likely corresponding to removal via the
residual body, along with other excess cytoplasmic organelles and components being shed by the
maturing spermatid. However, even in late elongating spermatids a significant amount of DDOST
66
remains present around the spermatid nucleus, and even in mature spermatozoa (Asano et al. 2010,
Nixon et al. 2011), suggesting a potential role in late spermatogenesis, or fertility.
The presence of a PP1 docking motif, its membrane bound status and the fact that its localization
is unaffected by loss of PPP1CC2 in the testis, suggests the possibility that DDOST functions as a
substrate targeting PIP. By sequestering a pool of PPP1CC2 to a specific region of the nuclear envelope,
DDOST may bring the phosphatase into regions of close contact with potential substrates. A number of
other PIPs with similar functions have been identified, including another ER protein PPP1R15A
(GADD34) (Brush et al. 2003), which has been shown to localize PP1 isoforms to the ER. If this is the
case, obvious candidate substrates for PPP1CC2 dephosphorylation are the other members of the OST
complex, such as STT3B which we showed to be phosphorylated in the testis, and has also been reported
by another study of testis phosphoproteins (Huttlin et al. 2010). However, at this stage the experiments
detailed in this study are preliminary in nature and further inquiry is necessary to determine if DDOST
plays an essential role in spermatogenesis, and to determine the biological nature of the PPP1CC2-
DDOST interaction.
In addition to the identification of DDOST as a novel PPP1CC2 interacting protein, our data
indicate a significant enrichment of the classical PP1 RVxF docking motif amongst proteins identified by
a single unique peptide in our TAP studies. While at least two unique and non-overlapping peptides are
generally required for confident identification of a protein in such datasets, the enrichment of the RVxF
motif suggests there are likely more legitimate PP1 interacting proteins within this dataset. However, as
a caveat this subset of proteins will contain a high rate of false-positives and any candidate interactors
require validation by other means. A total of 4 genes within this dataset are known to be required for
fertility in males—Brwd1, Fancl, Gapdhs, and Tial1. All of these proteins contain the classical PP1
docking RVxF motif. Brwd1 stands out as a particularly interesting candidate as its knockout phenotype
includes a decrease in post meiotic cell numbers, malformed sperm heads, acrosomal defects and
67
aberrant chromatin condensation, all of which are also seen in Ppp1cc mutants (Varmuza et al. 1999,
Philipps et al. 2008, Forgione et al. 2010).
The high number of proteins identified in our dataset by single-unique peptides could be a
reflection of several factors. First, many other affinity purification-mass spectrometry (AP-MS) studies
utilize vector based expression systems for affinity tagged genes which often results in a significant
overexpression of the bait protein and thus a larger number of interactions detected. Our system utilized
the Ppp1cc promoter coupled to an IRES which will result in a lower expression level of our bait
construct. However this should reflect a more endogenous expression pattern and interactions detected
are less likely to be due to ectopic gene expression. Another potential contributing factor is our
utilization of a tandem affinity purification strategy. The use of two purification steps results in less
contaminant proteins being identified, but at a cost of fewer legitimate interactors identified, as weaker
and lower abundance interactions may be lost during the additional purification step (Chen & Gingras
2007). A more physiological explanation could lie in the nature of ES cells. Being primed for
differentiation, ES cells are thought to express more proteins, but at a lower abundance than
differentiated cell types. This could highlight an interesting utility for ES cells in interactome study, and
comparison of the relative abundance of protein-protein interactions between different cell types, could
yield considerable insight into gene function.
Supporting Information Available Online:
Supplementary Table S1 - List of all proteins identified in this study by at least one significant peptide,
excluding contaminant proteins. Table includes summary results of LC-MS/MS data, as well as presence
of RVxF motif and known infertility KO phenotypes. Table S2 - Further data on single unique peptide
LC-MS/MS hits. Table S3 - Annotated MS/MS spectrum and fragment assignments of known PPP1CC2
interacting protein PPP1R42, which was identified by a single unique peptide. Table S4 – Annotated
MS/MS spectrum and fragment assignments of BRWD1 protein, which was identified by a single unique
68
peptide. Table S5 – ScaffoldPTM protein report displaying statistical information regarding STT3B
phosphosite localization. Supp File S6 – Annotated MS/MS spectra and representative fragment
assignments for STT3B phosphopeptides. This material is available free of charge via the Internet at
http://pubs.acs.org.
69
Chapter 3: PPP1CC2 can form a kinase/phosphatase complex with the testis specific proteins
TSSK1 and TSKS in the mouse testis.
Author’s note: A manuscript featuring a modified version of this chapter is currently in preparation as:
MacLeod G, Shang P, Booth GT, Mastropaolo LA, Manafpoursakha N and Varmuza S (2013). PPP1CC2
can form a kinase/phosphatase complex with the testis specific proteins TSSK1 and TSKS in the mouse
testis.
Experiments were designed and conceived by myself and S. Varmuza. LA Mastropaolo, and GT Booth
were responsible for cloning GST-TSKS, GST-TSSK1, and GST-TSSK6 constructs. Production of
bacterial expressed fusion proteins was performed by me, GT Booth and N Manafpoursakha. GST-
PPP1CC2 sedimentation assay with SDS-PAGE, silver staining, and in-gel digestion was conducted by
LA Mastropaolo and me. Replicates of GST-TSKS pull down with anti-PPP1CC western blotting were
performed by me and GT Booth. Replicates of GST-TSSK6 sedimentation assay with anti-PPP1CC
western blotting were conducted by GT Booth and N Manafpoursakha. Replicates of GST-PPP1CC2
sedimentation assay with anti-TSSK2 western blotting were conducted by GT Booth and N
Manafpoursakha. P Shang generated TSKS, TSSK1 and TSSK2 antibodies and provided technical
advice for immunohistochemistry experiments. I performed all remaining experiments and was
responsible for authorship of the manuscript and figure generation with editing by S. Varmuza.
Abstract:
The mouse protein phosphatase gene Ppp1cc is essential for male fertility, with mutants
displaying a failure in spermatogenesis including a widespread loss of post-meiotic germ cells. This
phenotype is hypothesized to be attributed to the loss of the testis specific isoform PPP1CC2. To identify
PPP1CC2 interacting proteins with a function in spermatogenesis, we performed GST pull down assays
in mouse testis lysate. Amongst the identified candidate interactors was the testis specific protein kinase
TSSK1, which is also essential for male fertility. Subsequent interaction experiments have confirmed the
70
capability of PPP1CC2 to form a complex with TSSK1 mediated by the kinase substrate protein TSKS.
Interaction between PPP1CC2 and TSKS is mediated through an RVxF docking motif on the TSKS
surface. Phosphoproteomic analysis of the mouse testis identified a novel serine phosphorylation site
within the TSKS RVxF motif that appears to regulate binding to PPP1CC2. Immunohistochemical
analysis of TSSK1 and TSKS in Ppp1cc mutant testis shows reduced accumulation to distinct
cytoplasmic foci and other abnormalities in their distribution consistent with the Ppp1cc mutant
phenotype. This data demonstrates a novel kinase/phosphatase complex in the testis that could play a
critical role in the completion of spermatogenesis.
3.1 Introduction
Protein phosphorylation is a key post-translational regulatory mechanism that plays a role in
countless cellular processes. Precise regulation of protein phosphorylation is carried out by the opposing
activities of protein kinases and protein phosphatases. While the mammalian genome encodes for
approximately 400 Ser/Thr kinases, it encodes only approximately 40 Ser/Thr phosphatases (Moorhead
et al. 2007, Bollen et al. 2010). Thus, many Ser/Thr phosphatases, including PP1s, obtain substrate
specificity by functioning as holoenzymes via interactions with a large and diverse array of regulatory
subunits (Hubbard &Cohen. 1993). To date almost 200 distinct PP1 interacting proteins have been
identified (Bollen et al. 2010), and it is hypothesized that many more exist.
Spermatogenesis is no exception to the importance of protein phosphorylation based regulatory
processes. By searching the Gene Ontology database, it is observed that 14 genes are linked to both the
Ser/Thr Protein Kinase molecular function (GO:0004674) and the spermatogenesis biological process
(GO:0007283), including all six members of the testis-specific Ser/Thr Kinase (TSSK) family. Using a
similar database search for Ser/Thr Protein Phosphatase molecular function (GO:0004722), no genes are
found to overlap with the spermatogenesis biological process; however, at least 3 Ser/Thr protein
phosphatase genes, Ppp1cc (Varmuza et al. 1999) Mtmr2 (Bolino et al., 2004) and Ppm1d (Choi et al.
71
2002), produce male infertility phenotypes when deleted, indicating that functional annotation in this
database is not complete.
Ppp1cc is a member of the PP1 family of protein phosphatases that encodes two splice isoforms,
the ubiquitous Ppp1cc1 and the testis-specific Ppp1cc2 (Okano et al. 1997). When Ppp1cc is deleted by
targeted mutagenesis, the only observable phenotypic consequence is homozygous male infertility, due to
a failure of spermatogenesis, reminiscent of the common human condition non-obstructive azoospermia
(Varmuza et al. 1999). Inside the seminiferous tubules a widespread loss of germ cells is evident, most
prominently in post-meiotic spermatids, leading to a breakdown of the spermatogenic cycle (Varmuza et
al. 1999, Forgione et al. 2010). The few surviving germ cells feature a range of morphological
abnormalities, including those involving meiosis, chromatin condensation, acrosome formation and
mitochondrial organization (Varmuza et al. 1999, Chakrabarti et al. 2007, Forgione et al. 2010). In the
mouse testis, a number of different proteins have been shown to interact with PPP1CC2. These include
both isoform specific interactions such as SPZ1 and Endophilin B1t (SH3GLB1, testis specific isoform)
(Hrabchak & Varmuza 2004, Hrabchak et al. 2007) and more numerously, proteins that have the ability
to interact with multiple PP1 isoforms, such as PPP1R11 (Cheng et al., 2009). In addition, another
testis-specific protein, Testis Specific Ser/Thr Kinase Substrate (TSKS) was bioinformatically predicted
to interact with PP1 based on the presence of a high affinity PP1 docking motif and in vitro experiments
confirmed that a TSKS fragment was capable of interacting with PPP1CA (Hendrickx et al. 2009). The
ability of full length TSKS to bind to other PP1 isoforms such as PPP1CC2 was not tested.
In a search for additional PPP1CC2 interacting proteins, we performed pull down assays in
mouse testis protein extracts using GST-PPP1CC1 and GST-PPP1CC2 as bait. Among the identified
proteins was the testis-specific Ser/Thr kinase TSSK1, which is essential for spermatogenesis in the
mouse (Xu et al. 2008, Shang et al. 2010). We describe experiments which demonstrate a clear link
between TSSK1, TSKS and PPP1CC2 in mouse testis.
72
3.2 Materials and Methods
Mouse Testis Protein Extract Preparation
Whole mouse testes were homogenized in cold protein extraction buffer (10% (v/v) glycerol,
50mM HEPES-NaOH pH 8.0, 150 mM NaCl, 2 mM EDTA, 0.1% (v/v) NP-40, 1 mM dithioreitol, 10
mM NaF, 0.25 mM sodium orthovanadate, 50 mM beta-glycerol phosphate) supplemented with Sigma
protease inhibitor cocktail) using a Dounce homogenizer. After homogenization, samples were incubated
on ice for 10 minutes, followed by centrifugation at a speed of 10,000 x g for 10 minutes at 4°C to
remove non-soluble material. All animal protocols were approved by the Canadian Council on Animal
Care.
GST and His-tag Pull Down Assays
The PPP1CC1 coding sequence was PCR amplified from the pGEM7zf plasmid using the
forward primer 5’-GGCGGATCCGCGATGGC`-3’ and the reverse primer 5’-
GCTATGTTAGAATTCCCAACCAGGC-3’ and ligated into the BamHI and EcoRI sites of the pGEX-
6P-2 plasmid (Amersham). GST-PPP1CC2, and GST containing plasmids were cloned previously and
fusion proteins produced as previously described (Hrabchak & Varmuza 2004, Hrabchak et al. 2007).
500 μg mouse testis lysates were incubated with approximately 2 μg GST-fusion proteins for 2-4 hours at
4° C with gentle rocking. Samples were centrifuged at 1,500 x g for 2 minutes at 4° C, and GST-fusion
protein beads were washed 3 times with 500 μL lysis buffer, after centrifugation steps. For pull down
experiments with LC-MS/MS analysis, testis lysate was initially pre-cleared via incubation with
glutathione agarose beads, and recombinant proteins were subjected to additional washes, both before
and after incubation with testis lysate. Recombinant human His-TSSK1 (Millipore cat. number 14-670)
was bound to Ni-NTA resin and incubated with mouse testis lysates using the same protocol as for GST-
fusions. In vitro, lysate-free pull down assays were based on a previously a described protocol (DeWever
et al. 2012), where 500 ng of unbound His-TSSK1 was incubated with GST, GST-PPP1CC2 or GST-
73
TSKS bound to glutathione agarose beads in 250 μL binding buffer (25 mM Tris pH 7.5, 5% glycerol
(v/v), 150 mM NaCl, 0.5% NP-40 (v/v) and 10 mM imidazole) for 2 hours at 4°C with rocking. Beads
were then spun down at 1,500 x g for 1 min at 4°C and washed 3 times with 1 mL of binding buffer. For
all experiments, bound proteins were eluted by boiling in SDS-PAGE sample buffer (50mM Tris, 2%
(w/v) SDS, 0.1% (w/v) bromophenol blue, 10% (v/v) glycerol, 25mM β-mercaptoethanol), and analyzed
by SDS-PAGE followed by silver staining (FOCUS-FASTsilver™, G Biosciences) or western blotting
using standard protocols.
In-gel digestion of silver stained gel slices
Gel slices were excised from silver stained gel washed with HPLC grade water. 200 μL of
acetonitrile was added to each gel slice and incubated at room temperature for 15 minutes with mixing.
Slices were then reduced with 10 mM dithioreitol in 100 mM ammonium bicarbonate for 30 minutes at
50°C, followed by removal of the reduction solution and wash with acetonitrile. Alkylation was
performed using 55 mM iodoacetic acid in 100 mM ammonium bicarbonate for 20 minutes in darkness
at room temperature. Alkylation solution was removed and gel slices washed in ammonium bicarbonate
and dried. Gel slices were then incubated with proteomics grade trypsin (Sigma-Aldrich, T6567) in 50
mM ammonium bicarbonate, 5 mM CaCl2 on ice for 45 minutes, then overnight at 37°C. After
deactivating trypsin with trifluoroacetic acid the supernatant was collected and 100 μL of 60% (v/v)
acetonitrile added to the gel slices and incubated with rocking for 10 minutes. The supernatant was then
collected and combined with that of the previous step and dried in a speed vac.
LC-MS/MS analysis and protein/peptide identification
LC-MS/MS analysis was performed by the Advanced Protein Technology Centre (Toronto, ON,
Canada http://www.sickkids.ca/Research/APTC/index.html). Peptides were loaded onto a 150 μm ID
pre-column (Magic C18, Michrom Biosciences) at 4 μL/min and separated over a 75 μm ID analytical
column packed into an emitter tip containing the same packing material. The peptides were eluted over
74
60 min. at 300 nl/min using a 0 to 40% (v/v) acetonitrile gradient in 0.1% (v/v) formic acid using an
EASY n-LC nano-chromatography pump (Proxeon Biosystems, Odense Denmark). The peptides were
eluted into a LTQ-Orbitrap hybrid mass spectrometer (Thermo-Fisher, Bremen, Germany) operated in a
data dependant mode. MS was acquired at 60,000 FWHM resolution in the FTMS and MS/MS was
carried out in the linear ion trap. 6 MS/MS scans were obtained per MS cycle. The Raw data was
searched using Mascot (Matrix Sciences, London UK). Tandem mass spectra were extracted, charge state
deconvoluted and deisotoped by BioWorks version 3.3. All MS/MS samples were analyzed using Mascot
(Matrix Science, London, UK; version Mascot). Mascot was set up to search the NCBInr_20110515
database for gel slices peptide samples and NCBInr_20110813 database for phosphopeptide samples
(both selected for Mus musculus) for trypsin digestion. Mascot was searched with a fragment ion mass
tolerance of 0.40 Da and a parent ion tolerance of 20 PPM for phosphopeptide samples, and a fragment
ion mass tolerance of 0.50 Da and 3.0 Da peptide tolerance for gel slice peptide samples. Iodoacetamide
derivative of cysteine was specified as a fixed modification, with the following variable modifications:
Pyro-glu from E of the N-terminus, s-carbamoylmethylcysteine cyclization of the N-terminus,
deamidation of asparagine and glutamine, oxidation of methionine, acetylation of the n-terminus for gel
slice peptide samples with phosphorylation of serine, threonine and tyrosine were as additional variable
modifications in phosphopeptide samples. Scaffold (version Scaffold_3.1.2, Proteome Software Inc.,
Portland, OR) was used to validate MS/MS based peptide and protein identifications. Peptide
identifications were accepted if they could be established at greater than 95.0% probability as specified
by the Peptide Prophet algorithm (Keller et al. 2002). Protein identifications were accepted if they could
be established at greater than 95.0% probability and contained at least 2 identified peptides (or 1 for
phosphopeptide samples). Protein probabilities were assigned by the Protein Prophet algorithm
(Nesvizhskii et al. 2003). Proteins that contained similar peptides and could not be differentiated based
on MS/MS analysis alone were grouped to satisfy the principles of parsimony.
PCR Mutagenesis
75
For generation of RVXF motif mutants, PCR mutagenesis was performed using primers
complementary to the relevant region of the TSKS coding sequence with the exception of required non-
synonymous base pair substitutions. Primer sequences were as follows: for the KAASA mutation
forward primer: 5’-CGAAAAAAAAGAAGGCTGCGTCCGCCCATGGGTGGAGCCCCG-3’ and
reverse primer: 5’-CGGGGCTCCACCCCTAGGGCGGACGCAGCCTTCTTTTTTTTCG-3’, for the
KAVEF mutation forward primer: 5’-
CGAAAAAAAAGAAGGCTGTGGAGTTCCATGGGGTGGAGCCCCG-3’ and reverse primer: 5’-
CGGGGCTCCACCCCATGGAACTCCACAGCCTTCTTTTTTTTCG-3’. Primers were used in PCR
amplification of the pGEX-TSKS plasmid with PFU polymerase (BioBasic) and resulting reaction
product was purified and digested with DpnI restriction enzyme to digest template plasmid. Digested
DNA was transformed into DH5α for selection, and the presence of mutations was verified via plasmid
sequencing. Plasmids containing TSKS coding sequences with mutated RVxF motifs were then used to
produce GST-fusion proteins as outlined above.
Antibodies
Goat anti-PPP1CC (N-19, Santa Cruz Biotechnology), which recognises both PPP1CC1 and
PPP1CC2 was used at a dilution of 1:500 for western blotting, with donkey anti-goat HRP secondary
(Santa Cruz Biotechnology) at a 1:5000 dilution. Guinea pig anti-TSKS and TSSK1 antibodies (Shang
et al. 2010) were used at dilutions of 1:500 for western blotting in cell lysate samples, and 1:5000 using
purified fusion proteins, with goat anti-guinea pig HRP secondary (Jackson Immunoreagents) at a
dilution of 1:5000. For immunohistochemistry, the same anti-TSKS and TSSK1 primary antibodies were
used at a 1:500 dilution, with Cy3 conjugated AffiniPure goat anti-guinea pig IgG (Jackson
Immunoreagents) at a 1:5000 dilution. Guinea pig anti-TSSK2 (Shang et al. 2010) was used at a dilution
of 1:2000 for western blotting with the same secondary antibody conditions as other Guinea pig
antibodies listed.
76
Phosphopeptide Enrichment
Adult mouse testes were decapsulated and germ cell suspensions were produced as previously
described (Henderson et al. 2011, MacLeod & Varmuza 2012). Germ cells were lysed in 400μL of 7M
Urea, 2M Thiourea, 4% CHAPs (w/v), 40mM Tris, reduced with 20mM dithioreitol for 1 hour at room
temperature and alkylated with 40 mM iodoacetic acid for 35 minutes at room temperature in darkness.
Germ cell proteins were precipitated with acetone and dried using a speed vac, followed by resuspension
in a 1M urea, 50 mM ammonium bicarbonate solution containing 10μg of proteomics grade trypsin.
Digestion was carried out over night at 37°C, and at completion the solution was acidified with 1% (v/v)
formic acid and centrifuged to remove insoluble material. One quarter of the sample was used for
phosphopeptide enrichment via sequential elution from IMAC (SIMAC) using the protocol from
Thingholm et al. (2009), but with 50μL of TiO2 Mag Sepharose (GE Healthcare) substituted for TiO2
phosphopeptide enrichment steps. Phosphopeptide enriched samples were then analyzed by LC-MS/MS
(see above).
Immunohistochemistry
After removal of the tunica albuginea, wild-type and Ppp1cc mutant testes were fixed in 4%
(w/v) paraformaldehyde overnight at 4°C and dehydrated using a graded series of ethanol solutions and
embedded in paraffin. 7μm sections were dewaxed, hydrated and subjected to antigen retrieval by
heating in 10 mM Sodium Citrate, 0.05% (v/v) Tween20, 1XPBS. Sections were permeabilized with
0.01% (v/v) Triton-X in PBS, and blocked in 10% (w/v) goat serum, 1% BSA (w/v), 0.01% (v/v)
Tween20, PBS solution. Primary antibody incubations were performed in antibody dilution buffer (5%
(w/v) goat serum, 1% (w/v) BSA, 0.01% (v/v) Tween20, PBS) overnight at using the conditions
indicated above. Secondary antibody incubations were performed in antibody dilution buffer for 2 hours
in the dark. Nuclei were then stained with DAPI and sections were mounted in 50% (v/v) glycerol for
viewing with an Olympus BX60 microscope. Images were captured using Cool Snap software and a
77
CCD camera (RSPhotometrics). Images were adjusted for brightness and contrast using Photoshop 6.0
(Adobe) and then merged using ImagePro 4.1.
3.3 Results
Testis-specific Ser/Thr kinase TSSK1 interacts with GST-PP1CC1 and GST-PPP1CC2 in mouse testis
lysate.
In exploratory assays designed to identify PPP1CC interacting proteins in the mouse testis,
recombinant GST-PPP1CC1 and GST-PPP1CC2 were purified and used in pull down assays with mouse
testis protein lysates. Proteins were then subjected to SDS-PAGE, followed by silver staining. Selected
gel slices were excised from both the GST-PPP1CC1 and GST-PPP1CC2 lanes. In one such experiment,
a band of approximately 45 kDa containing several visible bands was excised. After trypsin digestion,
proteins present in the gel slices were identified via LC-MS/MS with MASCOT database searching.
Common LC-MS/MS contaminant proteins such as keratins, actins, and tubulins were removed from the
list of candidate interactors. Remaining proteins for which ≥ 2 unique peptides were identified are shown
in Table 3.1 (Appendix A.4.2). All four of the remaining proteins, UQCRC2, FADS2, SCCPDH and
TSSK1, have been shown to be expressed in the mouse testis (Kueng et al. 1997, Stoffel et al. 2008, Guo
et al. 2011) and deletions of Fads2 and Tssk1/Tssk2 have been shown to disrupt spermatogenesis (Stoffel
et al. 2008, Xu et al. 2008, Shang et al. 2010). FADS2 was the only protein that appeared in only the
GST-PPP1CC2 gel band, however fewer peptides were assigned to this protein compared to the other
identified proteins. Experiments to determine if FADS2 is a legitimate PPP1CC2 interacting protein in
the testis remain at a preliminary stage. Tssk1 is a testis-specific kinase gene that plays a role in
spermatogenesis, and thus stood out to us as a particularly interesting candidate PPP1CC2 interactor in
the testis. To test if TSSK1 actually bound specifically to the GST-PPP1CC2, the pull down assay in
testis lysate was repeated, this time followed by western blotting for TSSK1. The results of this
experiment confirmed the initial pull-down, with the GST-PPP1CC2 bait, but not GST alone, being able
78
Table 3.1: Testis proteins identified in a SDS-PAGE gel band after sedimentation by GST-
PPP1CC1 and GST-PPP1CC2. Only proteins identified by at least 2 significant unique peptides are
included. Common contaminant proteins i.e. keratin and tubulin were removed from the list. Protein IDs
are from UniProtKB/Swiss-Prot. Sequence coverage combines all unique peptides from GST-PPP1CC1
and GST-PPP1CC2 pull downs.
79
Unique Peptides
Gene
Symbol Name
Protein
ID
GST-
PPP1CC1
GST-
PPP1CC2
Sequence
Coverage
Uqcrc2 Cytochrome b-c1 complex subunit 2, mitochondrial Q9DB77 12 10 35.30%
Tssk1 Testis-specific serine/threonine-protein kinase 1 Q61241 10 2 25%
Sccpdh Saccharopine dehydrogenase-like oxidoreductase Q8R127 7 5 16%
Fads2 Fatty acid desaturase 2 Q9Z0R9 0 2 5%
80
Figure 3.1: PPP1CC2 interacts with both TSSK1 and TSKS in the testis. GST and His-tag pull down
assays followed by SDS-PAGE and western blotting using the indicated antibodies. (A) Recombinant
mouse GST-PPP1CC2 successfully precipitates TSSK1 from mouse testis protein extract, while GST
alone does not. (B) Ni-NTA bound 6His-tagged human TSSK1 successfully precipitates PPP1CC2 from
mouse testis protein extract, while Ni-NTA resin alone does not. (C) Ni-NTA bound 6His-tagged human
TSSK1 precipitates its substrate TSKS from mouse testis protein extract, while Ni-NTA resin alone does
not. (D) Recombinant mouse GST-PPP1CC2 successfully precipitates full length TSKS from mouse
testis protein extract, while GST alone does not. (E) Recombinant mouse GST-TSKS successfully
precipitates PPP1CC2 from mouse testis protein extract, while GST alone does not.
81
82
to pull down TSSK1 (Figure 3.1a). Reciprocal pull down experiments were performed using His-TSSK1
bait, which successfully precipitated PPP1CC2 from mouse testis lysate (Figure 3.1b). Additionally a
known substrate of TSSK1, testis-specific kinase substrate (TSKS) was successfully
precipitated by His-TSSK1, verifying the functionality of the fusion protein (Figure 3.1c).
Testis-specific kinase substrate, TSKS interacts with PPP1CC2 via an RVxF docking motif
In a previously published study, the TSSK1 substrate TSKS was bioinformatically predicted to
be a PP1 interacting protein, and subsequent in vitro experiments showed that a TSKS fragment was
capable of interacting with PPP1CA (Hendrickx et al. 2009), the only PP1 isoform assayed. This
prediction was based on the presence of a PP1 docking motif, known as an RVxF motif, in the TSKS
amino acid sequence. In the mouse, this motif has the sequence KAVSF in amino acid positions 51-55.
This suggests that PPP1CC2 and TSSK1 could potentially share a common interactor in the testis, which
may mediate their association. To test whether the PPP1CC2 isoform could interact with the full-length
native TSKS in the testis, proteins pulled down by GST-PPP1CC2 were subjected to western blotting for
TSKS. The results of this experiment indicate that the PPP1CC2 isoform can bind to full-length TSKS
in the testis (Figure 3.1d). The anti-TSKS signal observed via western blot showed a doublet which is
consistent with previously published data (Shang et al. 2010). Furthermore, a reciprocal pull down assay
showed that GST-TSKS was able to bind native PPP1CC2 in mouse testis lysate (Figure 3.1e),
confirming the interaction between these two testis proteins. The GST tag on its own was unable to
precipitate either PPP1CC2 or TSKS (Figure 3.1d-e). To verify that interaction with PPP1CC2 was
dependent upon the RVxF motif on the TSKS surface, we produced fusion proteins containing TSKS
with a mutated RVxF motif, changing the sequence from KAVSF to KAASA (GST-KAASA). When
GST-KAASA was incubated with mouse testis lysate, it was unable to precipitate a detectable quantity of
PPP1CC2 as compared to unaltered GST-TSKS (Figure 3.2). Furthermore, GST-KAASA was still able
to precipitate the known TSKS interactor TSSK2, indicating that the general structure of the TSKS
protein was not affected by the RVxF motif mutation (Figure 3.2). A second mutation KAVEF, gave
83
Figure 3.2: The TSKS RVxF motif is required for interaction with PPP1CC2. GST-fusion proteins
corresponding to unaltered TSKS protein, RVxF mutant KAASA and RVxF phosphoserine mimic
KAVEF were incubated with mouse testis lysate and assayed via western blotting for interaction with
PPP1CC2 (top) and TSSK2 (bottom). Unaltered TSKS interacts with PPP1CC2 in the testis, while
KAASA and KAVEF constructs do not. All TSKS constructs interact with TSSK2, demonstrating no
major change in protein architecture in mutant constructs.
84
85
similar results, which will be discussed further below. This experiment confirms that TSKS and
PPP1CC2 interact through the RVxF docking motif. To date, attempts at detecting an interaction between
PPP1CC2 and two additional TSSK isoforms, TSSK2 and TSSK6 via similar pull down assays have
been unsuccessful (data not shown), indicating that possibility that PPP1CC2 may only interact with the
TSSK1 isoform.
TSKS is phosphorylated on at least two different serine residues in the mouse testis including the PP1
docking motif
Previous experiments have shown TSKS to be phosphorylated on the serine 281 residue in the
mouse testis (Xu et al. 2008) which is hypothesized to be the target site of TSSK1 phosphorylation. In
an experiment aimed at identifying novel phosphorylation sites in the mouse testis, we performed
sequential elution from IMAC (Thingholm et al. 2008) (SIMAC) phosphopeptide enrichment followed
by LC-MS/MS on proteins extracted from adult germ cell suspensions (see Appendix A.4.3 and A.4.4 for
further data on site assignment). MASCOT database searching of the resultant tandem mass spectra was
used to map phosphorylation sites. Amongst the identified phosphopeptides were two unique peptides
that mapped to TSKS with greater than 95% confidence. The first peptide, which was identified in both
the IMAC and TiO2 fractions was the previously known TSKS phosphopeptide
HGLSPATPIQGcSGPPGS*PEEPPR which was phosphorylated on the serine 281 residue (best
Mascot delta score = 26.6, Ascore = 94.9). The second phosphopeptide mapped to TSKS was
AVS*FHGVEPR, which represents a novel TSKS testis phosphorylation site at the serine 54 residue
(Mascot delta score = 30.9, Ascore = 1,000). This novel phosphopeptide was identified in the IMAC
fraction only. According to the Phosphosite plus database (Hornbeck et al. 2012), this phosphopeptide
has previously been identified in human Jurkat cell, T cell leukemia model, but not in the mouse, or
specifically the testis. Interestingly, this phosphorylated serine residue is found within the PP1 docking
motif KAVSF.
86
Phosphorylation of the PP1 docking motif in TSKS likely inhibits interaction with PPP1CC2
Previous research with other PP1 interacting proteins has indicated that phosphorylation within
and next to the RVxF docking motif can inhibit interaction with the PP1 catalytic subunit (Beullens et al.
1999, McAvoy et al. 1999, Liu & Brautigan 2000, Bollen 2001, Grallert et al. 2013). To test whether
this was the case for TSKS we produced a GST fusion protein in which the serine residue of the RVxF
docking motif (KAVSF) was mutated to glutamate (KAVEF) to mimic serine phosphorylation. When
this phospho-mimic fusion protein (GST-KAVEF) was incubated with mouse testis lysate, no pull down
of PPP1CC2 was observed, although there was no reduction in binding to TSSK2, indicating
preservation of protein structure (Figure 3.2). This experiment indicates that phosphorylation of the
RVxF motif in TSKS likely inhibits interaction with PPP1CC2 in the testis.
The interaction between PPP1CC2 and TSSK1 is not direct
In vitro experiments have previously demonstrated direct interactions between TSKS and PP1
fragments, as well as between TSKS and TSSK1 (Kueng et al. 1997, Hendrickx et al. 2009). Thus, we
sought to determine if there was also a direct interaction between PPP1CC2 and TSSK1. To do this
purified His-TSSK1 was incubated with GST-PPP1CC2 coupled to glutathione agarose in an in vitro
setting without the presence of any cell lysate (Figure 3.3). GST-PPP1CC2 was not able to precipitate
His-TSSK1 in our experiment, nor was GST alone. Conversely, a direct interaction was detected
between GST-TSKS and His-TSSK1. This experiment indicates that the interaction between PPP1CC2
and TSSK1 is not direct, and is therefore likely mediated by another factor, such as TSKS which directly
interacts with both.
TSKS and TSSK1 localization is impaired in Ppp1cc mutant seminiferous tubules
In the seminiferous epithelium both TSSK1 and TSKS are expressed in the cytoplasm of
elongating spermatids, with prominent accumulation of both at distinct cytoplasmic foci (Shang et al.
87
Figure 3.3: The interaction between PPP1CC2 and TSSK1 is not direct. In vitro pull-down assay
wherein recombinant GST, GST-PPP1CC2 or GST-TSKS bound to glutathione Sepharose was incubated
in the presence (+) or absence (-) of purified His-TSSK1 followed by sedimentation, SDS-PAGE and
western blotting with a polyclonal antibody directed against TSSK1. Only GST-TSKS successfully
precipitated His-TSSK1 demonstrating no direct interaction between PPP1CC2 and TSSK1.
88
89
2010). In response to targeted deletion of Tssk1 and Tssk2, the level of TSKS expression remains similar
in the cytoplasm of elongating spermatids, but its accumulation in distinct foci is lost (Shang et al. 2010)
suggesting regulation by TSSK1 (and/or TSSK2) is required for this punctate expression pattern. To test
whether PPP1CC2 also plays a role in regulating TSKS localization, as well as TSSK1 localization, we
performed immunohistochemistry on testis sections from wild-type and Ppp1cc knockout mice. Mouse
spermatogenesis can be divided into twelve different stages that arise in a cyclical fashion in the
seminiferous tubules. It should be noted that the loss of Ppp1cc results in a bottleneck in
spermatogenesis, as well as a prominent loss of spermatids, making precise staging of seminiferous
tubules challenging. In wild-type seminiferous tubules, the previously described punctate expression
pattern was observed for TSKS (Figure 3.4a-d). This punctate expression pattern is stage specific, as the
level of accumulation into distinct foci varies between seminiferous tubules. Strong TSKS expression
throughout the cytoplasm begins in stage IX (Figure 3.4d), with emergence of foci amongst the
cytoplasmic staining by stage I (Figure 3.4a). By stage IV, only distinct cytoplasmic foci are evident
(Figure 3.4b), which are no longer visible by stage VII (Figure 3.4c). In Ppp1cc mutant seminiferous
tubules all of these localization patterns can be found; however there are statistically significant
differences in their frequencies (Figure 3.4e-h, Table 3.2). In our analysis, wild-type tubules exhibited
punctate staining with limited general cytoplasmic staining (Figure 3.4b) 39% of the time and an absence
of staining 24% of the time (n=100; Figure 3.4c). In contrast only 9% of Ppp1cc mutant tubules
displayed the punctate staining pattern (Figure 3.4f) and 51% displayed an absence of TSKS signal,
which represent statistically significant differences from wild-type (p < 0.001; Figure 3.4g). In addition
to the quantitative differences, there were several qualitative changes in TSKS localization commonly
observed in Ppp1cc mutant tubules. These defects included isolated elongating spermatids showing
strong staining throughout the cytoplasm in tubules that otherwise contained a punctate expression
pattern (Figure 3.4f, inset), as well as tubules showing a large number of cytoplasmic foci instead of
diffuse staining seen in wild-type counterparts (Figure 3.4a, e, inset).
90
Figure 3.4: TSKS localization is impaired, but not abolished in Ppp1cc mutant seminiferous
tubules. Immunohistochemical analysis was performed on wild-type (A-D) and Ppp1cc mutant (E-H)
testes using a polyclonal antibody for TSKS (red) and nuclear staining using DAPI (blue). Shown are
representative seminiferous tubules at four different approximate time points of the spermatogenic cycle.
For wild-type tubules approximate stages depicted are: (A) stage I, (B) stage IV, (C) stage VII, (D) stage
IX. Degeneration of seminiferous tubules in Ppp1cc mutant tubules makes staging challenging but
depicted mutant tubules were matched as closely as possible to wild-type counterparts. Numbers in the
bottom right corner of each panel indicate the percentage of tubules that exhibit the depicted staining
pattern. Asterisks indicates values significantly different than wild-type (p < 0.05). Arrow indicates
paired TSKS puncta in wild-type spermatids that are abnormal in Ppp1cc mutant samples.
91
92
As was previously reported, the expression pattern for TSSK1 in the wild-type testis is very similar to
that of TSKS (Shang et al. 2010) (Figure 3.5a-d). We observed strong cytoplasmic staining beginning in
stage VIII (step 8 spermatids; Figure 3.5c), one stage before the onset of TSKS expression. Foci were
evident amongst the cytoplasmic staining by stage X (Figure 3.5d), with only cytoplasmic foci visible by
stage II (Figure 3.5a). TSSK1 staining was not visible in wild-type spermatids at stage VII (Figure 3.5b).
Again, similar to TSKS we observed all of these staining patterns in Ppp1cc mutant seminiferous tubules
(Figure 3.5e-h, Table 3.2), but frequencies differed with the fully developed punctate staining pattern
observed in only 11% of mutant tubules (44% in wild-type, p<0.001; Figure 3.5a, e) and 41% of tubules
lacked TSSK1 signal (14% in wild-type, p<0.001; Figure 3.5b, f). There was also a statistically
significant increase in the proportion of tubules displaying TSSK1 foci with accompanying signal
throughout the cytoplasm with this pattern being visible in 33% of Ppp1cc mutant tubules compared to
16% in wild-type (p<0.01; Figure 3.5d,h). Qualitative abnormalities in TSSK1 staining pattern similar to
those described for TSKS were also observed in Ppp1cc mutant seminiferous tubules. Clouds of
cytoplasmic staining were evident alongside developed foci (Figure 3.5e, inset), and aggregates of
numerous foci (Figure 3.5h, inset) as opposed to pairs of foci observed in wild-type tubules (Figure 3.5d,
inset). The results of this experiment indicate that both TSKS and TSSK1 are able to achieve correct
localization in the absence of PPP1CC isoforms; however they do so at a lower frequency and with
several observable defects. As was mentioned in the previous chapter, anti-PPP1CC staining in the testis
is very strong and found throughout the cytoplasm (Hrabchack et al., 2007) to the extent that
examination of PPP1CC2 localization with TSSK1 and TSKS would not be informative.
3.4 Discussion
The necessity of the protein phosphatase gene Ppp1cc for completion of spermatogenesis in mice
is well established (Varmuza et al. 1999). However, the precise role in this process, particularly that of
the testis specific isoform PPP1CC2, remains unknown. The multitude of defects within the Ppp1cc
93
Figure 3.5: TSSK1 localization is impaired but not abolished in Ppp1cc mutant seminiferous
tubules. Immunohistochemical analysis was performed on wild-type (A-D) and Ppp1cc mutant (E-H)
testes using a polyclonal antibody for TSSK1 (red) and nuclear staining using DAPI (blue). Shown are
representative seminiferous tubules at four different approximate time points of the spermatogenic cycle.
For wild-type tubules approximate stages depicted are: (A) stage II, (B) stage VII, (C) stage VIII, (D)
stage X. Degeneration of seminiferous tubules in Ppp1cc mutant tubules makes staging challenging but
depicted mutant tubules were matched as closely as possible to wild-type counterparts. Numbers in the
bottom right corner of each panel indicate the percentage of tubules that exhibit the depicted staining
pattern. Asterisks indicates values significantly different than wild-type (p < 0.05). Arrow indicates
paired TSSK1 puncta in wild-type spermatids that are abnormal in Ppp1cc mutants.
94
95
Table 3.2 Quantitative evaluation of TSKS and TSSK1 staining patterns in wild-type and Ppp1cc
mutant seminiferous tubules. One hundred randomly selected seminiferous tubules were classified into
one of four staining patterns for both wild-type and Ppp1cc mutant testis samples. Asterisk indicates
values significantly different (p ≤ 0.05) from wild-type.
96
TSKS Staining Pattern
Genotype Blank Cytoplasmic Cytoplasmic + Puncta Puncta
Wild-type 24 21 16 39
Ppp1cc KO *51 18 22 *9
TSSK1 Staining Pattern
Genotype Blank Cytoplasmic Cytoplasmic + Puncta Puncta
Wild-type 14 26 16 44
Ppp1cc KO *41 15 *33 *11
97
mutant seminiferous epithelium suggests the possibility of pleiotropic functions, with defects in both
meiotic and post-meiotic germ cells being evident (Varmuza et al. 1999, Forgione et al. 2010). In an
effort to learn more about the function(s) of PPP1CC2 in spermatogenesis we performed GST pull down
assays to identify PPP1CC2 interacting proteins in the testis. Amongst the identified proteins was the
testis-specific kinase TSSK1, which is also required for male fertility, although with a phenotype quite
different from that of the Ppp1cc deletion (Xu et al. 2008, Shang et al. 2010). While loss of Ppp1cc
results in a severe impairment in spermatogenesis including the widespread loss of post-meiotic germ
cells and a bottleneck in the spermatogenic cycle (Varmuza et al. 1999, Forgione et al. 2010), the loss of
the Tssk1 and Tssk2 genes results in a much milder phenotype with little/no loss of spermatogenic cells
(Shang et al. 2010). This difference in phenotypic severity is consistent with a requirement for Ppp1cc
earlier in spermatogenesis than Tssk1/2, which is reflected by the expression patterns of these genes in
the developing spermatogenic cells. The PPP1CC2 is expressed throughout spermatogenesis and at a
high level from the meiotic pachytene spermatocyte stage onward (Hrabchak &Varmuza. 2004).
Conversely TSSK1 and TSSK2 are only expressed in post-meiotic spermatids (Li et al. 2011). Despite
these differences, the time point of peak PPP1CC2 expression levels in the testis overlap with that of
TSSK1/2 and there are several key similarities between the knockout phenotypes. Both mutants exhibit
a significant reduction in the number and motility of epididymal spermatozoa as well as prominent
defects in the organization of the mitochondrial sheaths (Varmuza et al. 1999, Chakrabarti et al. 2007,
Shang et al. 2010). The mitochondrial sheath is a tight helical bundle of mitochondria that surrounds the
sperm flagellum providing energy for motility (Fawcett, 1975). In Tssk1/2 knockout spermatids,
assembly of the mitochondrial sheath is impaired with the mitochondria forming clusters in the proximal
region of the sperm tail, and failing to form a compact, elongated sheath (Shang et al., 2010). In the few
remaining Ppp1cc knockout spermatozoa similar defects are visible; mitochondrial sheaths generally fail
to form a compact helical structure and often do not extend to the distal region of the sperm tail
(Chakrabarti et al., 2007b, Soler et al., 2009). Ppp1cc2 knock-in mice with low levels of transgene
expression (>50% of heterozygous level) are able to rescue the loss of post-meiotic germ cells found in
98
Ppp1cc knockouts, but are still infertile and mitochondrial sheath abnormalities are still visible (Soler et
al., 2009, Sinha et al., 2012). Taken together all of this evidence points to a functional link between
PPP1CC2 and TSSK1 late in spermiogenesis, after the time point where PPP1CC2 is first required, and
suggests that PPP1CC2 does play a role in multiple events in spermatogenesis. This pleiotropic function
is not out of character for a protein like PPP1CC2, as the PP1 family of protein phosphatases are
involved in numerous cellular functions and interact with a multitude of different proteins.
The results of this study demonstrate that the interaction between PPP1CC2 and TSSK1 in the
testis is indirect, and likely mediated by a common interactor, TSKS. This multiprotein complex thus
contains both a protein kinase and phosphatase, and all three proteins are known to be phosphorylated in
the testis (Kueng et al. 1997, Huang & Vijayaraghavan 2004, Jaleel et al. 2005). We have shown
conclusively that interaction with PPP1CC2 is dependent on the presence of a PP1 docking RVxF motif
in the N-terminal region of TSKS (amino acids 51-55), which was not surprising given that TSKS was
bioinformatically predicted to be a PP1 interacting protein due to the presence of this motif (Hendrickx et
al. 2009). Previous studies have demonstrated that the N-terminal region of TSKS is also required for
interaction with TSSK proteins (Xu et al. 2008), indicating that both proteins are likely in close contact
while bound to their common interactor. Future studies will be needed to determine enzyme/substrate
relationships between any of these proteins aside from the known phosphorylation of TSKS by TSSK1.
Currently our laboratory is conducting an intensive phosphoproteomic analysis of the wild-type and
Ppp1cc knockout testes in a search for candidate PPP1CC2 substrates, which may shed some light on
this question.
Kinase activity of TSSK1 towards TSKS has been demonstrated previously, and is thought to
occur on the serine 281 residue (Kueng et al. 1997, Xu et al. 2008). During the course of this study, we
identified a second phosphorylated residue, serine 54, which interestingly lies within the PP1 docking
RVxF motif. Previous studies have shown phosphorylation in and around RVxF motifs to inhibit
interaction with PP1 isoforms (Beullens et al. 1999, McAvoy et al. 1999, Liu & Brautigan 2000, Bollen.
99
2001), which our experiments confirmed for TSKS. These data suggest that within the testis, there exists
a pool of TSKS that is incapable of interacting with PPP1CC2 (phosphorylated S54), while another
portion is permissive to interaction (unphosphorylated S54), given our ability to demonstrate this
interaction in the testis. Precisely how this is regulated remains an open question. PPP1CC2 itself is
unlikely to dephosphorylate this residue as the RVxF binding surface is distant from the active site on the
surface of the phosphatase (Egloff et al. 1997). Moreover, phosphorylation of the RVxF motif inhibits
binding of PPP1CC2. This indicates the involvement of another protein phosphatase in the regulation of
this interaction, the identity of which remains unknown, although a number of other non-type 1 protein
phosphatases are known to be expressed in the testis (Fardilha et al. 2011). Similarly, the kinase
responsible for this phosphorylation remains in question. It is tempting to suggest that TSSK1
phosphorylates S54 of TSKS as opposed to, or in addition to S281. However, if this were the case it is
difficult to envision how TSSK1 and PPP1CC2 could simultaneously exist in the same complex, even in
a transient manner, as occupancy of the RVxF motif by either protein would make it inaccessible to the
other. Therefore, there may be another kinase involved in regulation of this interaction as well, adding a
further layer of complexity. The kinase prediction tools Scansite (Obenauer et al. 2003) and KinasePhos
(Huang et al. 2005) both suggest PKC kinases as the top candidate based on the sequence surrounding
the phosphorylation site; however this would require further testing before any definitive conclusions are
drawn.
Our immunohistochemical analysis of TSKS and TSSK1 expression in the Ppp1cc knockout
testis shows reduced localization of both proteins to distinct puncta as well as a number of qualitative
defects. The puncta correspond to previously described structures proposed to originate in the
chromatoid body; a ring-shaped structure and a satellite (Shang et al. 2010). These abnormalities are
consistent with the phenotype of the Ppp1cc knockout as the TSKS/TSSK1 expressing elongating
spermatids are frequently missing in mutants, resulting in tubules lacking any observable staining for
these proteins. As well, loss of Ppp1cc causes in a bottleneck in the spermatogenic cycle, resulting in an
100
increased number of tubules in stages VII/VIII (stages that are for the most part devoid of staining) and a
disorganization of the seminiferous epithelium resulting in tubules displaying a seeming mixture of
stages (Forgione et al. 2010). Taken together this suggests that the abnormalities in TSKS/TSSK1
staining are secondary to the initial effects of the Ppp1cc mutation early in spermatogenesis, but places
these proteins upstream of PPP1CC2 in a biochemical pathway later in spermatogenesis. A previous
analysis of TSKS expression in Tssk1/Tssk2 mutant tubules has shown that TSSK1 or TSSK2 or both are
required for the formation of chromatoid body derived ring and satellite structures as well as the correct
localization of TSKS to these structures during spermiogenesis (Shang et al. 2010). As well, as recent
analysis of the evolutionary history of the Tssk1 and Tssk2 genes in primates suggests that the two genes
may have not completely overlapping functions (Shang et al. 2013). One can thus envision a scenario
where TSSK1 binds and phosphorylates TSKS resulting in localization to specific puncta in the
developing elongating spermatid, whereupon it binds to PPP1CC2, forming at least transiently, a trimeric
(or higher oligomer) complex. The biological consequences of this interaction have yet to be uncovered,
but a critical role in spermiogenesis seems likely. TSSK1 and TSKS play a role in the formation and/or
function of chromatoid body derived structures in elongating spermatids (Shang et al. 2010). The
chromatoid body is a centre of RNA processing in developing round spermatids, but this may not be the
only role for this structure (Meikar et al. 2011). The role of the structures derived from the chromatoid
body in further developed elongating spermatids is less clearly defined, but it has been hypothesized that
it may have a role in assembly of the mitochondrial sheath, a compact helix of mitochondria that wrap
around the midpiece and connecting piece of the sperm flagellum (Shang et al. 2010). The fact that the
mitochondrial sheath is abnormal in Ppp1cc mutant spermatids as well leaves open the possibility that
PPP1CC2 is important for post-translational regulation of proteins during these processes. Another
known PPP1CC2 interactor in the testis, PPP1R42 (TLRR) has been shown to have a remarkably similar
localization to TSKS in elongating spermatids, with distinct PPP1R42 puncta located adjacent to the
centrosome, near the site of the chromatoid body (Shang et al. 2010, Wang et al. 2010). At other time
101
points, PPP1R42 localization shows little similarity to that of TSKS/TSSK1; however this period of
overlap further suggests that PPP1CC2 may have some local concentration at this site.
In conclusion, the results of this study have shown interaction between the testis-specific Ser/Thr
phosphatase PPP1CC2, and two additional testis-specific proteins TSKS and the testis-specific Ser/Thr
kinase TSSK1. Furthermore, we have shown that the interaction between TSSK1 and PPP1CC2 is
indirect and likely mediated by TSKS, which binds to PPP1CC2 via the classical PP1 docking RVxF
motif. The RVxF motif on the TSKS surface can be phosphorylated in the testis, which is inhibitory to
PPP1CC2 interaction. The biological function of this interaction is unknown, but our data suggests that
TSKS and TSSK1 function upstream of PPP1CC2, and that regulation of this complex may include
several other proteins. Future experiments will seek to both identify these proteins, and determine the
precise regulatory mechanisms involved. It should also be noted that the results described in this chapter
arise from LC-MS/MS analysis of a single gel slice from GST-PPP1CC2 pull downs in the testis, and is
by no means an exhaustive survey of PPP1CC2 interactors in the testis. Analysis of additional bands can
reasonably be expected to identify more PPP1CC2 interacting proteins in the testis, some of which may
play a role in spermatogenesis.
102
Chapter 4: Comparative phosphoproteomic analysis of the mouse testis reveals candidate
substrates of PPP1CC2
Author’s Note: A manuscript based containing a modified version of this chapter is currently in
preparation as: MacLeod G, Taylor P, Mastropaolo LA and Varmuza S. Comparative phosphoproteomic
analysis of the mouse testis reveals candidate substrates of PPP1CC2 (2013).
Except where indicated, all experiments were designed and conceived by myself and S. Varmuza. LA
Mastropaolo performed 50% of replicates for β-actin, Ppp1ca, Ppp1cc1 and Ppp1cc2 qPCR
experiments. P. Taylor designed and conducted all LC-MS/MS analysis of phosphopeptide samples,
conducted database searches and produced output files for analysis. P. Taylor also advised on
quantitative analysis strategy and writing the materials and methods for the LC-MS/MS analysis. I
performed all remaining experiments and was responsible for authorship of the manuscript and figure
generation, with editing by S. Varmuza.
Abstract
Deletion of the serine/threonine phosphatase gene Ppp1cc in the mouse results in male infertility
due to a failure of spermatogenesis. Ppp1cc is a member of the PP1 family of protein phosphatases, and
encodes two splice isoforms: the ubiquitous Ppp1cc1 and the testis-specific Ppp1cc2. As Ppp1cc mutant
mice are deficient for a protein phosphatase gene, we hypothesize that substrates of PPP1CC2 will be
hyperphosphorylated in mutant testes. Thus, we conducted a comparative phosphoproteomic analysis of
the Ppp1cc mutant testis. To limit the influence of secondary effects, we identified the time point in
spermatogenesis where PPP1CC2 is first required. Quantitative reverse-transcriptase PCR analysis of all
PP1 isoforms identified specific upregulation of Ppp1cc2 beginning at 3 weeks post-natal in the testis.
Histological analysis of the Ppp1cc mutant testis at this age confirmed the presence of morphological
abnormalities. Phosphopeptides were enriched using IMAC and TiO2 chromatography and compared
using both spectral counting and extracted ion chromatogram quantitation. Our data identified 755
different proteins phosphorylated in the 3 week mouse testis, and confidently assigned 1,026 unique
103
phosphorylation sites. 33 different peptides corresponding to 32 different proteins were found to be more
abundant in Ppp1cc mutant samples than in wild-type, making these proteins candidate substrates of
PPP1CC2 in the testis. Amongst these proteins were several known to be essential for
spermatogenesis—HSPA4, HMGA1, YBX2 and SYCP2. In conclusion, our study identified a large pool
of testis phosphoproteins including a number of candidate PPP1CC2 substrates which will form the basis
of future studies on the role of PPP1CC2 in spermatogenesis.
4.1 Introduction
Protein phosphorylation is a critical intracellular signalling mechanism that plays a role in the
regulation of countless cellular processes. Spermatogenesis is no exception; in fact, next to the brain, the
testis contains more tissue specific phosphorylation sites than any other tissue studied (Huttlin et al.
2010, Lundby et al. 2012b). There exist examples of both kinases (such as TSSK1/TSSK2 (Xu et al.
2008, Shang et al. 2010), TSSK6 (Spiridonov et al. 2005), LMTK2 (Kawa et al. 2006)) and
phosphatases (PPP1CC2 (Varmuza et al. 1999), MTMR2 (Bolino et al. 2004), PPM1D (Choi et al. 2002)
which are indispensable to spermatogenesis. Thus, in the case of the Ppp1cc knockout mouse, it is
hypothesized that a loss of phosphatase activity towards a specific substrate or substrates causes failure
of spermatogenesis. Targeted deletion of Ppp1cc in mice results in the widespread loss of developing
germ cells most prominently from the round spermatid stage onwards (Varmuza et al. 1999). Ppp1cc
mutant seminiferous tubules appear to display a bottleneck in spermatogenesis that results in a
disorganised seminiferous epithelium (Forgione et al. 2010). Surviving germ cells display a wide range
of abnormalities including defects in chromatin condensation and acrosomal biogenesis (Varmuza et al.
1999, Forgione et al. 2010). Ppp1cc is a member of the PP1 family of Ser/Thr protein phosphatases,
which includes three different genes in mammals, Ppp1ca, Ppp1cb and Ppp1cc. The Ppp1cc knockout
mouse lacks the expression of two different splice isoforms, the ubiquitous Ppp1cc1 and the testis-
specific Ppp1cc2. Studies have indicated that PPP1CC2 is the predominant isoform in the mouse testis
although other PP1 isoforms are expressed (Takizawa et al. 1994, Varmuza et al. 1999). A recent
104
transgenic rescue experiment has established that expression of the PPP1CC2 isoform alone is able to
rescue the Ppp1cc mutant infertility phenotype, provided expression levels surpass a threshold amount
(Sinha et al. 2012).
While the requirement of PPP1CC2 for completion of mammalian spermatogenesis is well
established, its exact role(s) has yet to be elucidated. To date, a number of PPP1CC2 interacting proteins
in the testis have been identified (Vijayaraghavan et al. 1996, Huang et al. 2002, Hrabchak & Varmuza
2004, Huang et al. 2004, Hrabchak et al. 2007, Cheng et al. 2009, Fardilha et al. 2011b, Henderson et al.
2011, Ruan et al. 2011, Wang & Sperry 2011), including most recently, DDOST (MacLeod & Varmuza
2012, chapter 2), TSKS and TSSK1 (MacLeod et al., 2013, in preparation, chapter 3); however the
identification of bona fide PPP1CC2 substrates has proven to be challenging, as the interaction between
PP1 isoforms and their substrates is typically weak, and short-lived. Ppp1cc mutant testes are lacking
expression of a protein phosphatase gene, meaning that PPP1CC2 is unavailable for substrate
dephosphorylation. Therefore, by identifying hyperphosphorylated testis expressed proteins in a Ppp1cc
mutant background we can identify candidate substrates of PPP1CC2 that may play a crucial role in
spermatogenesis. Previous research from our laboratory performed 2-dimensional electrophoresis (2DE)
coupled with phosphoprotein staining to identify hyperphosphorylated proteins in the Ppp1cc mutant
testis (Henderson et al. 2011). This approach identified several candidate PPP1CC2 substrates, including
HSPA2 and β-Tubulin. In the present study we have expanded upon this line of inquiry by making
several key changes to our methodology. First, although the use of 2DE is a dependable method of
protein separation, its use in proteomics is compromised by the fact that it requires the excision of
individual spots on a gel. Another limitation of 2DE is that larger changes in phosphorylation can affect
the pI of a protein, and alter its migration on a gel making comparison between phosphorylated and
unphosphorylated proteins difficult. In contrast, LC-MS/MS based methods coupled with
phosphopeptide enrichment can simultaneously identify numerous phosphopeptides from a single
sample, and can also identify the specific site of phosphorylation. Phosphopeptide enrichment strategies
105
such as immobilized metal ion chromatography (IMAC), and TiO2 chromatography have been
demonstrated to be highly effective in identifying phosphorylation sites via LC-MS/MS from rodent
testis samples (Huttlin et al. 2010, Lundby et al. 2012b). Similar approaches have been used successfully
to analyze phosphopeptide changes during rat sperm capacitation, and epididymal maturation, with as
little as 150 µg of starting material (Baker et al. 2010, Baker et al. 2011).
A second major methodological change relates to the tissue samples analyzed. Our previous
testis phosphoproteomics study (Henderson et al. 2011) used testis proteins from adult mice for their
analysis. However, the composition of the wild-type adult testis is very different from the Ppp1cc
mutant, as the latter suffers from a near complete lack of cells from the round spermatid phase onwards
(Varmuza et al. 1999). The proteomes of different spermatogenic cell types are quite different (Huang et
al. 2008, Guo et al. 2011), and by extension their phosphoproteomes. Thus, many observed changes in
protein phosphorylation status are likely due to secondary effects. To ensure that phosphoproteomic
analysis reflects changes due specifically to a loss of PPP1CC activity, and not secondary effects, we
have opted to focus on the time-point that the Ppp1cc gene is first required in the testis. Previous work
from our laboratory has suggested that this time point occurs at approximately 3 weeks of age,
corresponding to the first observed defects in the seminiferous tubules of Ppp1cc knockout mice
(Varmuza & Ling 2003). To verify this observation we first performed an analysis of the expression of all
four PP1 isoforms in the mouse testis to test for the earliest incidence of Ppp1cc2 specific upregulation
and performed a phenotypic comparison of wild-type and Ppp1cc mutant seminiferous tubules at this
time point prior to conducting a comparative phosphoproteomic analysis.
4.2 Materials and Methods
RNA extraction and cDNA synthesis
Testis and brain samples were homogenized in Trizol® Reagent (Invitrogen) and RNA was
extracted using the manufacturer`s suggested protocol. RNA quality was assayed via gel electrophoresis
106
with examination of the 16S and 18S rRNA bands. RNA purity and yield were determined using a
nanodrop spectrophotometer (Fisher Scientific). Following RNA extraction, samples were diluted to 1
µg/µL in ultrapure H2O. For cDNA synthesis 5 µg of RNA was treated with DNAse I in the presence of
RiboLock™ RNAse inhibitor (Thermo Scientific), followed by reverse transcription using 20 units of M-
MuLV (Fermentas) with 100 ng random hexamer primers (Fermentas) for 1 hour at 50°C. Resultant
cDNA was diluted in ultrapure H2O.
Quantitative PCR
Two primer pairs were utilized in qPCR experiments for each transcript tested; an “outside”
primer pair for production of template DNA for standard curve production, and an “inside” primer pair
for the qPCR reaction itself. Primer pairs used in this experiment are listed in Table 4.1. qPCR was
performed using SYBR® Advantage® qPCR Premix (Clontech) according to the provided protocol.
Reactions were carried out in a Rotorgene 3000 Light Cycler (Corbett Research) and analysed using the
accompanying software. Following an initial denaturation period of 30 seconds at 95°C, PCR cycling
conditions were as follows: denaturation for 5 seconds at 95°C; annealing for 20 seconds at 55°C for
actin, 53°C for Ppp1ca and Ppp1cb, 56.1°C for Ppp1cc1, 53.7°C for Ppp1cc2; extension for 30 seconds
at 72°C for a total of 40 cycles. Normalized Ppp1c expression levels were calculated by dividing raw
Ppp1c values by the average of 2 Actb qPCR runs for a given cDNA sample. Analysis was performed on
cDNA samples from 3 different mice at each age, with duplicate qPCR runs performed on each sample.
Exceptions to this sample size include Ppp1cc2 1 week sample, where an outlier (~100X all other
samples at that age point) was discarded and Ppp1cb 5 week sample where only two samples were
available. Relative Ppp1c expression levels from duplicates were averaged prior to statistical analysis.
Statistical analysis of qPCR data
107
Table 4.1: Primers used for qPCR analysis of PP1 isoform expression in the post-natal mouse testis
108
Transcript Outside/Inside Forward Primer Sequence Reverse Primer Sequence
Actb outside ATGAAGATCCTGACCGAGCG TACTTGCGCTCAGGAGGAGC
Actb inside GACGGCCAGGTCATCACTAT GCACTGTGTTGGCATAGAGG
Ppp1ca outside CAGCCATTGTGGATGAGAAG TTTCTTGGCTTTGGCAGAAT
Ppp1ca inside TTGCCAAGAGACAGTTGGTG ACTGCCCATACTTGCCCTTA
Ppp1cc1 outside GTTTTAACTGCTTGCCGATAGC CTGAATGGACGGGTTCAGG
Ppp1cc1 inside CCCATCAGGTGGTTGAAGAT CTGAATGGACGGGTTCAGG
Ppp1cc2 outside GTTTTAACTGCTTGCCGATAGC GCCTGATCCAACCCGTGG
Ppp1cc2 inside CCCATCAGGTGGTTGAAGAT GCCTGATCCAACCCGTGG
Ppp1cb outside TGCTAGCATCAAATCGCATTT TCGGTGGATTAGCTGTTCG
Ppp1cb inside CTAAACGACAGTTGGTAACCTT TCGGTGGATTAGCTGTTCG
109
To test for significant changes in Ppp1c isoform expression levels throughout post-natal
development a one-way analysis of variance (ANOVA) was performed with the aid of Microsoft Excel.
ANOVAs were followed by Tukey’s post-tests, performed manually, to conduct pairwise comparisons of
expression data from different age groups. Newman-Kuels multiple range test, and pairwise t-tests were
also performed on selected samples where indicated.
Histology
Testes from 3 week old wild-type and Ppp1cc mutant mice were dissected and fixed in Bouin’s
solution overnight at 4°C followed by dehydration in a graded series of ethanol solutions and embedding
in TissuePrep® (Fisher Scientific). Seven μm sections were dewaxed, hydrated and stained using the
Periodic Acid-Schiff (PAS) staining system (Sigma-Aldrich) with haematoxylin counterstaining. Slides
were mounted in 50% glycerol for viewing with an Olympus BX60 microscope and images were
captured using Cool Snap software and a CCD camera (RSPhotometrics). Images were adjusted for
brightness and contrast using Photoshop 6.0 (Adobe).
Phosphopeptide Enrichment
Mouse testes were decapsulated, homogenized in 400μL of 7M Urea, 4% CHAPs (w/v), 40mM
Tris and DNAseI and incubated with rocking at 4°C for 30 minutes. Extracted proteins were reduced
with 20mM dithioreitol for 1 hour at room temperature followed by alkylation with 40 mM iodoacetic
acid for 35 minutes at room temperature in darkness. Testis proteins were precipitated with acetone and
dried using a speed vac. Dried acetone pellets were resuspended in 1M urea, 50 mM ammonium
bicarbonate and concentration was determined using the BCA Protein Assay Kit from Bio Basic Inc.
Trypsin digestion of testis protein was carried out overnight with 2% (w/w) of proteomics grade trypsin
(Sigma-Aldrich T6765) at room temperature with end over end rotation. Digestion was subsequently
acidified with 1% (v/v) formic acid and centrifuged to remove insoluble material. 120 μg testis peptides
were then was used for phosphopeptide enrichment via sequential elution from IMAC (SIMAC) using
110
the protocol modified from Thingholm et al. (Thingholm et al. 2009, Thingholm et al. 2008). Briefly,
peptides were resuspended in ~300 μL of IMAC loading buffer (50% acetonitrile, 0.1% TFA) and
incubated with 40 μL of washed PHOS-select™ IMAC resin (Sigma-Aldrich) for 30 minutes with end
over end rotation. IMAC resin was packed into a 200 μL gel loading pipette tip, and washed with 150 μL
of IMAC loading buffer. A first phosphopeptide elution step was conducted with 140 μL of acidic
elution buffer (1% TFA, 20% acetonitrile) followed by a second elution with 160 μL of basic elution
buffer (ammonia water). The basic elution fraction was acidified with 10 μL of formic acid and
lyophilized. IMAC flow through (and wash) and acidic elution fraction were also lyophilized, followed
by resuspension in 250 μL TiO2 loading buffer (80% acetonitrile, 5% TFA, 1M glycolic acid).
Resuspended peptides were incubated with 50 μL of washed TiO2 Mag Sepharose™ (GE Healthcare) for
30 minutes with end over end rotation. TiO2 resin was washed sequentially with 500 μL TiO2 loading
buffer, 80 μL of 80% acetonitrile with 1% TFA and 80 μL of 10% acetonitrile with 0.2% TFA. After 10
minutes of air drying phosphopeptides were eluted from TiO2 resin by incubation with 50 μL ammonia
water for 5 minutes with constant mixing. Eluted phosphopeptide solution was acidified with 2 μL of
10% TFA and 7 μL of formic acid. For each individual mouse the TiO2 enriched IMAC flow through and
acidic elution fractions were then combined and lyophilized.
LC-MS/MS analysis
The digested peptides were loaded onto a 100 μm ID pre-column (Thermo-Fisher Scientific) at 4
μl/min and separated over a 75 μm ID X 15 cm analytical column (EASY-Spray, Thermo-Fisher
Scientific, Odense Denmark). The peptides were eluted over 60 min. at 300 nl/min. using a 0 to 40%
acetonitrile gradient in 0.1% formic acid using an EASY nLC 1000 nano-chromatography pump
(Thermo-Fisher Scientific, Odense Denmark). The peptides were eluted into a LTQ Velos-Orbitrap Elite
hybrid mass spectrometer (Thermo-Fisher, Bremen, Germany) operated in a data dependant mode. MS
was acquired at 240,000 FWHM resolution in the FTMS and MS/MS was carried out in the linear ion
trap. 10 MS/MS scans were obtained per MS cycle. The multistage activation option of the analyzer
111
was selected to reduce the effect of neutral loss fragmentation. The raw data files were searched using
Proteome Discover 1.3 (Thermo-Fisher Scientific) using a parent ion accuracy of 10 ppm and a fragment
accuracy of 0.6 Da. A fixed modification of carbamidomethyl cysteine and variable modifications of
phosphorylated serine, threonine and tyrosine residues, as well as oxidized methionine were considered
in the search
Database searching
All MS/MS samples were analyzed using Sequest (Thermo Fisher Scientific, San Jose, CA,
USA; version 1.3.0.339) and X! Tandem (The GPM, thegpm.org; version CYCLONE (2010.12.01.1)).
Sequest was set up to search MOUSE-Uniprot-Sep-05-12.fasta (unknown version, 55250 entries)
assuming the digestion enzyme trypsin. X! Tandem was set up to search the MOUSE-Uniprot-Sep-05-12
database (unknown version, 55270 entries) also assuming trypsin. Sequest and X! Tandem were searched
with a fragment ion mass tolerance of 0.60 Da and a parent ion tolerance of 10.0 PPM. Carbamidomethyl
of cysteine was specified in Sequest and X! Tandem as a fixed modification. Glu->pyro-Glu of the n-
terminus, ammonia-loss of the n-terminus, gln->pyro-Glu of the n-terminus, oxidation of methionine and
phospho of serine, threonine and tyrosine were specified in X! Tandem as variable modifications.
Oxidation of methionine and phospho of serine, threonine and tyrosine were specified in Sequest as
variable modifications.
Criteria for protein identification
Scaffold (version Scaffold_3.4.3, Proteome Software Inc., Portland, OR) was used to validate
MS/MS based peptide and protein identifications. Peptide identifications were accepted if they exceeded
specific database search engine thresholds. Sequest identifications required at least deltaCn scores of
greater than 0.10 and XCorr scores of greater than 1.8, 2.5, 3.5 and 3.5 for singly, doubly, triply and
quadruply charged peptides. X! Tandem identifications required at least -Log (Expect Scores) scores of
greater than 1.00. Protein identifications were accepted if they contained at least 1 identified peptide.
112
Proteins that contained similar peptides and could not be differentiated based on MS/MS analysis alone
were grouped to satisfy the principles of parsimony.
Bioinformatic and semi-quantitative analysis of testis phosphoproteins
Enrichment analysis was performed on identified testis phosphoproteins using the DAVID
Functional Annotation Chart tool from the DAVID Bioinformatics Resources 6.7 (Huang et al. 2008,
Huang et al. 2009) using the Mus musculus background and queried for GO cellular component,
biological process and molecular function. Known and predicted PP1 interacting proteins were
identified using PSICQUIC (Aranda et al. 2011) and I2D (Brown & Jurisica 2005, Brown & Jurisica
2007) (mouse as target organism) search tools. Annotation of identified phosphopeptides to the GO
biological process reproduction (GO:0000003) was performed using the Scaffold viewer software.
Assignment of phosphorylation to specific sites was performed using Scaffold PTM (version 2.0.0,
Proteome Software) which is based on the Ascore algorithm (Beausoleil et al. 2006). Spectral counting
of individual phosphorylation sites was performed using data from Scaffold PTM assigned sites only,
which were present in at least 2 of 3 replicates of at least one genotype. A cut-off value of 2 was used as
a minimal fold-change required for further analysis.
MS1 filtering and quantitative analysis of testis phosphopeptides
MS1 filtering quantitative analysis of extracted ion chromatograms was performed using Skyline
(Schilling et al. 2012) according to the step by step instructions available on the Skyline website
(http://proteome.gs.washington.edu/software/Skyline/tutorials/ms1filtering.html). A spectral library was
first created using .DAT files from all six replicate MS/MS runs described above using a cut-off score of
0.8. The Skyline peptide tree was populated with candidate hyperphosphorylated peptides identified in
the preliminary analysis described above by either importing specific peptide sequences, or full protein
FASTA sequences retrieved using the Uniprot retrieval tool. Results for MS1 filtering were imported
from raw files for all six samples using an import filter resolution of 100,000. Skyline automated peak
113
selection was manually adjusted when clear outliers in retention time were observed in replicate results.
XIC peak area values were exported from Skyline into Microsoft Excel and were log2 transformed and
subjected to statistical analysis using a student’s t-test (p ≤ 0.05).
4.3 Results
Quantitative analysis of PP1 isoform expression during the first wave of spermatogenesis
Expression of Ppp1ca, Ppp1cb, Ppp1cc1, and Ppp1cc2 was detectable in mouse testis cDNA
ranging from 1 to 5 weeks of age. In addition, Ppp1ca and Ppp1cc1 were detectable in brain cDNA,
whereas little or no Ppp1cc2 expression was evident (level of expression was outside the range of the
standard curve) and Ppp1cb was not assayed. The levels of Ppp1ca, Ppp1cb and Ppp1cc1 transcripts
displayed no significant difference in expression level throughout the first wave of spermatogenesis, or
between brain and testis cDNA samples (Figure 4.1). In contrast, ANOVA analysis of Ppp1cc2 transcript
levels showed a clear and statistically significant increase in expression level throughout the first wave of
spermatogenesis (p=0.001) (Figure 4.1). Ppp1cc2 expression level was low at 1 and 2 weeks of age.
Subsequently, at three weeks of age the level of Ppp1cc2 increased approximately six-fold, which is a
statistically significant increase relative to the 2 week time point (p<0.001). By four weeks of age
Ppp1cc2 transcript levels had again significantly increased (p=0.02) a further 2.5-fold. By the four week
time point Ppp1cc2 expression level had reached its maximum level in the first-wave of
spermatogenesis, as no significant change was evidenced at the 5 week time point. This data shows
conclusively that the Ppp1cc2 transcript specifically is upregulated in the mouse testis by 3 weeks of age.
The seminiferous epithelium of 3 week old Ppp1cc mutant mice displays impaired spermatogenesis
To test if the upregulation of Ppp1cc2 in the mouse testis at 3 weeks of age corresponds to a
requirement of PPP1CC2 for normal spermatogenesis, we examined the seminiferous tubules of wild-
type and Ppp1cc mutant mice. Previous research has observed the first phenotypic effects of the Ppp1cc
mutant to be visible at this stage (Varmuza & Ling 2003), which we sought to confirm before progressing
114
Figure 4.1: Expression of mouse Ppp1c isoforms in the testis during the first wave of spermatogenesis
demonstrates specific upregulation of only Ppp1cc2. Time points listed are weeks post-natal. Expression
levels from brain were from whole adult tissue. Values are relative to β-actin x 1000. * indicates a
statistically significant (α= 0.05) change in expression level from the previous time point. Note that in
the brain, Ppp1cb levels were not tested, and Ppp1cc2 levels were tested but below the level of
quantitation.
115
*
*
116
with further experiments. While the first wave of spermatogenesis is commonly referred to as
synchronous, our observations suggest that this is not entirely true, consistent with previous work from
our lab (Varmuza &Ling. 2003). By three weeks of age, most wild-type mouse seminiferous tubules are
in the final stages of meiosis and the remainder contain the first round spermatids (Figure 4.2A). Wild-
type seminiferous tubules generally display a uniform thickness with very few observed instances of cell
sloughing (Figure 4.2C). Progression of spermatogenesis does not appear to be impaired in Ppp1cc
mutant seminiferous tubules as both tubules containing late spermatocytes and round spermatids were
visible (Figure 4.2B). While a substantial proportion of Ppp1cc mutant seminiferous tubules display
normal morphology, many others are abnormal in appearance including an increase in cell sloughing and
vacuolation (Figure 4.2B). A closer examination of the seminiferous epithelium inside Ppp1cc mutant
seminiferous tubules reveals a number of reoccurring defects including cell sloughing (Figure 4.2D),
joined round spermatid nuclei within a single cytoplasm (Figure 4.2E, arrows), and prominent “blobs” of
cellular material projecting into the tubule lumen (Figure 4.2F, arrowhead). These results indicate that
while there is no block in the progression of spermatogenesis, there is impairment in the process by three
weeks of age in response to the loss of Ppp1cc. Furthermore, while there is evidence of cell loss at this
age, the cellular composition of wild-type and Ppp1cc mutant seminiferous tubules is very similar.
Phosphoproteomic analysis of the 3 week mouse testis.
After determining that Ppp1cc is first required in the testis by 3 weeks of age we sought to
achieve two goals via phosphoproteomic analysis. First, we wanted to identify as many phosphoproteins
in the 3 week testis as possible. These proteins would serve as a resource to others interested in PTMs
during testis development, as well as representing a large pool of potential PPP1CC1/PPP1CC2
substrates for further bioinformatic analysis. Our second and ultimate goal was to identify proteins that
were differentially phosphorylated in wild-type and Ppp1cc mutant 3 week testes. Those proteins that
are hyperphosphorylated on Ser/Thr residues in Ppp1cc mutants would represent strong candidate
PPP1CC2 testis substrates.
117
Figure 4.2: Phenotypic abnormalities are present in the seminiferous tubules of 3 week old Ppp1cc
mutant mice. Heterozygous seminiferous tubules (A and C) retain the vast majority of developing germ
cells and present a consistent and normal morphology. In Ppp1cc mutant testes phenotypically normal
and abnormal seminiferous tubule phenotypes are often evident within the same cross-section (B). A
number of phenotypic abnormalities are visible in Ppp1cc mutant seminiferous tubules including germ
cell sloughing (B, asterisk and D)multiple spermatid nuclei joined closely together (E, arrows) and large
“blobs” of cellular material projecting into the tubule lumen (F, arrowhead).
118
119
Phosphopeptide enrichment of 3 week mouse testis peptide samples was performed using a
modified sequential elution from IMAC (SIMAC) (Thingholm et al. 2009, Thingholm et al. 2008)
strategy. The SIMAC method includes an initial phosphopeptide enrichment using IMAC, in which
bound peptides are sequentially eluted with an acidic and basic solution. Next the IMAC flow-
through and acidic elution are subjected to a second phosphopeptide enrichment step using TiO2
chromatography. Using our conditions, the TiO2 enriched fractions yielded 95% phosphopeptides.
However, the IMAC basic elution fraction contained only 15% phosphopeptides. For this reason, we
proceeded using only the combined TiO2 enriched fractions.
Phosphopeptide enriched samples from three biological replicates each of 3 week old wild-type and
Ppp1cc mutant testis were then analyzed via LC-MS/MS using an LTQ-Orbitrap elite to identify the
phosphopeptides present. This data has been uploaded to the Global Proteome Machine website
(http://review.thegpm.org/review/index.html and can be accessed using the following accession numbers-
Mut1: GPM77700020781, Mut 2: GPM00300024842, Mut 3: GPM77700020782, WT1:
GPM77700020783, WT2: GPM77700020784, WT3: GPM77700020785) and will be made publicly
available following publication. In total 12,651 phosphopeptides were identified, corresponding to 755
different proteins and 1,026 different phosphorylation sites. Searching identified spectra against a decoy
database revealed 0 false identifications. Fifteen percent more phosphopeptides were detected in the
Ppp1cc mutant samples when compared to the wild-type (6741 vs. 5912), however this increase was not
statistically significant (p=0.17). Our phosphopeptide enrichment strategy was highly reproducible as
was evidenced at the protein level with a high degree of overlap between wild-type and Ppp1cc mutant
samples, as well as between biological replicates within the same group. Six hundred and four (604)
different proteins were identified in wild-type samples and 666 were identified in Ppp1cc mutant
samples. Of these proteins, 515 were identified in at least one biological replicate of each genotype, 89
were unique to wild-type and 151 were unique to Ppp1cc mutants (Figure 4.3A). Fifty-five percent of
phosphorylated proteins detected in wild-type samples were detected in all 3 biological replicates and
120
Figure 4.3: Reproducible phosphopeptide enrichment and identification in wild-type and Ppp1cc mutant
testis samples. (A) Venn diagram depicting the number of unique phosphoproteins identified in each
genotype examined. (B) Venn diagram depicting the number of unique phosphopeptides identified in
each genotype examined. (C) Venn diagram depicting the inter-sample reproducibility at the protein
level in wild-type testis samples. Triangle represents proteins found in at least 2 of 3 replicates, which
were subsequently considered for quantitative analysis via spectral counting. (D) A similar Venn diagram
depicting inter-sample reproducibility in Ppp1cc mutant samples.
121
122
72% were found in more than one replicate (Figure 4.3C). In Ppp1cc mutant samples, 47% of
phosphorylated proteins detected were found in all 3 biological replicates, and 70% were found in at least
2 replicates (Figure 4.3D). At the peptide level 1261 unique phosphopeptides (meaning amino acid
sequence, ignoring phosphorylation site assignment) were identified, 786 of which were found in both
wild-type and Ppp1cc mutant testis samples (Figure 4.3B). Amongst the identified testis phosphoproteins
were 40 proteins encoded by genes for which male infertility mouse models exist (Appendix A.4.5). As
well, we have found 21 known PP1 interacting proteins (or approximately 10% of all known interactors)
and 8 predicted PP1 interacting proteins to be phosphorylated in the 3 week mouse testis (Appendix
A.4.5), including at least 3 known PP1 substrates: RB1, SRSF10 and PPP1R2. Eleven different proteins
that were identified in SBP-3XFLAG-PPP1CC2 ES cell tandem affinity purification (Chapter 2), as well
as the OST complex protein STT3B were also identified in our phosphoproteomic dataset (Appendix
A.4.5). None of the proteins identified in GST-PPP1CC2 adult testis pull down assays (Chapter 3) were
present in the phosphoproteomic dataset. The absence of TSSK1 and TSKS from this dataset is not
surprising as they are not expressed in the testis by 3 weeks of age.
To further characterize the overall characteristics of the 3 week testis phosphoproteome, we
performed a bioinformatic analysis using the DAVID Functional Annotation Tool to identify GO Cellular
Compartment, Functional Annotation, and Biological Process terms enriched in our dataset (Full list in
Appendix A.4.6). GO cellular compartment analysis showed enrichment for a number of compartments
including chromosome/chromatin, ribonucleoprotein complexes and the cytoskeleton. DNA, RNA and
chromatin binding proteins, serine/threonine kinases and transcription factor binding proteins were all
highly enriched via GO molecular function analysis. The most highly enriched biological processes in
the 3 week mouse testis phosphoproteome included RNA processing, chromatin organisation and the cell
cycle, with meiosis and spermatogenesis also being significantly enriched. These functional
characteristics are not unexpected given our knowledge of this tissue at this particular point in
development, where intensive reorganization of the nuclear material is underway in the majority of cells,
123
and cytoskeletal reorganization is primed to begin in newly emerging cells. However, the large
proportion of phosphoproteins identified does serve to underscore the importance of protein
phosphorylation in regulating these processes.
Semi-quantitative comparison of wild-type and Ppp1cc mutant testis phosphoproteomes
In order to examine changes in protein phosphorylation status in response to the Ppp1cc deletion
it is necessary to examine our results at the peptide level, as it is the phosphorylation stoichiometry at
specific sites that will yield candidate substrate identification. Label-free quantitative analysis was
performed on the three biological replicates of each genotype and subjected to both spectral counting and
extracted ion chromatogram quantitation. Our quantitative analysis strategy consisted of two stages, a
preliminary stage where candidate peptides were identified for closer inspection, followed by a thorough
quantitative analysis of the candidate peptides using MS1 filtering of extracted ion chromatograms
across all six replicates (Figure 4.4).
Spectral counting is a semi-quantitative measure based on the correlation between the abundance of a
protein and the frequency of sampling of precursor ions in an LC-MS/MS experiment (Liu et al. 2004).
As a first approach in our preliminary quantitative analysis of the 3 week testis phosphoproteome we
used the Scaffold PTM software (version 2.0.0, Proteome Software Inc., Portland, OR) which reanalyzes
MS/MS results using an extension of the Ascore algorithm to produce confident PTM site assignments.
Hence, we were able to confidently assign 1,026 unique phosphorylation sites (923 serine, 97 threonine
and 6 tyrosine) in 572 different proteins throughout our 6 replicates. To identify candidate
hyperphosphorylated proteins in 3 week Ppp1cc mutant testes we identified phosphorylation sites that
were a) present in at least 2 of 3 biological replicates of at least one genotype, and b) exhibited at least a
2-fold increase in spectral count in Ppp1cc mutant replicates (Figure 4.5A). This analysis yielded
phosphorylation sites in 145 different proteins that were more abundant in Ppp1cc mutants (Appendix
A.4.7). Amongst these proteins were at least two known PP1 interacting proteins; MAP1B (Ulloa et al.
124
Figure 4.4: Strategy for quantitative analysis of wild-type and Ppp1cc mutant 3 week testis
phosphoproteomes. After phosphopeptide enrichment via IMAC and TiO2 chromatography, peptides
were subjected to LC-MS/MS analysis. MS/MS data was used for preliminary identification of candidate
hyperphosphorylated peptides via spectral counting, MS/MS peak XIC quantitation as well as peptides
from genes essential for male fertility, associated with the GO biological process Reproduction, and
encoding known or predicted PP1 interacting proteins (PIPs). Candidate peptides were then subjected to
MS1 filtering using Skyline to compare XIC quantitative measurements from MS data across all six
replicates.
125
126
Figure 4.5: Distribution of spectral counting and MS/MS peak XIC data for wild-type and Ppp1cc
mutant testis phosphopeptides. A) Spectral counting of individual phosphorylation sites. The solid line
indicates an equal spectral count in each genotype, while dashed lines indicate a 2-fold increase in either
genotype. B) XIC of MS/MS peaks of individual phosphopeptides. X-axis represents a log2
transformation of the Ppp1cc mutant/wild-type ratio of extracted ion chromatogram area under the curve
values. Y-axis is the untransformed sum of the average extracted ion chromatogram area under the curve
values for wild-type and Ppp1cc samples for a given peptide observed in at least 2 of 3 replicates of each
genotype.
127
A
B
128
1993, Hendrickx et al. 2009) and NCL (Nucleolin) (Morimoto et al. 2002) as well as 12 proteins encoded
by genes which when deleted result in infertility in mice (ESPL1, TDRD1, SYCP3, AGFG1, CCNE2,
ADAM2, HMGA1, CLGN, CSDA, SYCP2, RAD18 and HSPA4). As mentioned above, spectral
counting is considered to be a semi-quantitative analytical method is subject to an increased amount of
variation when dealing with low spectral count numbers as is the case for many of the phosphopeptides
observed in this study. Therefore, these peptides require further analysis to determine if they are truly
hyperphosphorylated in Ppp1cc mutants.
To complement our preliminary spectral counting analysis of the 3 week mouse testis
phosphoproteome, we next performed a second preliminary quantitative analysis approach, this time
based on the extracted ion chromatograms (XIC) of phosphopeptides. The signal intensity of a given
peptide in an LC-MS run is directly proportional to its abundance, thus by extracting the area under to
curve of a peptide peak (XIC value) in a number of samples we can compare its abundance (Chelius &
Bondarenko. 2002). For this approach, we compared the average log2 transformed XIC values for all
phosphopeptides detected in the SEQUEST database search between wild-type and Ppp1cc mutant testis
samples (Figure 4.5B). To reduce the effect of outliers and allow for statistical analysis we only
considered peptides that were present in at least 2 of 3 biological replicates for each genotype. Both a
two sample student’s t-test (when 3 replicate values of each genotype were available) and a local-pooled
error test (LPE) (Jain et al. 2003, Colinge et al. 2005) were conducted to detect peptides that differed in
abundance when Ppp1cc was deleted in the 3 week mouse testis. This analysis identified 40 different
phosphopeptides that were more abundant in Ppp1cc mutant samples, corresponding to 36 unique
proteins (Appendix A.4.7), seven of which were also identified via spectral counting (ACIN1, ENTHD1,
ESPL1, HNRNPU, LARP1, RALY, and SYCP2). The preliminary quantitative analysis described above
suffers from one key limitation; the fact that the XIC values for only those peptide ions that were
subsequently selected for MS/MS fragmentation in that sample are considered. Thus, a large amount of
129
information remains unexplored in the LC-MS data, and peptides identified as more abundant in mutant
testes by these means require further analysis as confirmation.
Identification of hyperphosphorylated proteins in the 3 week Ppp1cc mutant testis via label-free
quantitative analysis
Preliminary quantitative analysis of the 3 week Ppp1cc mutant testis phosphoproteome provided
a list of candidate hyperphosphorylated peptides that is suitable for further label-free quantitative
analysis. In addition to the candidate hyperphosphorylated peptides, we also further analyzed all known
or predicted PP1 interacting proteins (29 proteins), proteins encoded by genes essential for male fertility
(40 proteins), and proteins associated with the GO biological process Reproduction (33 proteins) that
were identified in our phosphoproteomic dataset, as well as proteins identified in SBP-3XFLAG-
PPP1CC2 ES cell tandem affinity purification (Chapter 2). In total phosphopeptides from 233 different
proteins were subjected to extracted ion chromatogram quantitative analysis across all six replicates
using the Skyline MS1 filtering tool (Schilling et al. 2012). Skyline was used to select and align MS
peaks with integrated MS/MS and retention time data from which area under the curve (AUC) values
were calculated. Log2 transformed AUC values were then subjected to statistical analysis via a student’s
t-test and peptides displaying a statistically significant (p ≤ 0.05) increase in abundance were identified.
This yielded the identification of 33 different peptides in 32 proteins that were significantly more
abundant in the 3 week Ppp1cc mutant testis (Table 4.2). A representative example of a peptide from
ARHGEF11 is depicted in Figure 4.6. The average fold-change in these peptides is 4.8 with a lowest
significant fold-change of 1.6 and a highest of 26.9. Amongst the identified hyperphosphorylated
proteins, 4 are encoded by genes which are essential for male fertility—HMGA1, HSPA4, SYCP2 and
YBX2 (Figure 4.7). Additionally one known PP1 interacting protein MAP1B, and two predicted PP1
interacting proteins HSPA4 and SIRT2 were hyperphosphorylated (Figure 4.7, full set in Appendix
A.4.8). As all of these proteins have phosphorylation sites that are more abundant upon deletion of the
phosphatase gene Ppp1cc they all represent candidate PPP1CC2 substrates in the testis. Gene ontology
130
Table 4.2: Candidate PPP1CC2 substrates. Shown is a list of identified phosphopeptides significantly
more abundant in 3 week old Ppp1cc knockout testes than in wild-type. Gene names followed by *
indicate an infertility phenotype in knockout mice. pS and pT reflect phosphorylated serine and threonine
residues respectively. Residues surrounded by parentheses represent cases of ambiguous phosphorylation
site assignment. Ascore values are given for only those phosphorylation sites confidently assigned by
Scaffold PTM software.
131
Accession
Gene
Name PeptideSequence
GO Biological Process Localized
Phosphorylation
site Ascore
Mut/
WT
XIC
AUC t-test
F6RJ39 Acin1 HLpSHPEPEQQHVIQR apoptotic process S656 1,000 2.9 0.002
Q68FM7 Arhgef11 NSVLSDPGLDpSPQTpSPVILAR cytokinesis S251, S255 36.46, 28.50 3.7 0.023
Q8K019 Bclaf1 QKFHDpSEGDDTEETEDYR transcription S395 56.76 1.6 0.036
Q9CXS4 Cenpv pSGATGGLSGGESR cell cycle S18 26.79 1.9 0.016
P60904 Dnajc5 p(SLSTSGESLYHVLGLDK) protein folding 2.4 0.040
Q8JZQ9 Eif3b AKPAAQSEEETATpSPAApSPTPQSAER translation S75, S79 51.64, 20.17 2.3 0.039
E9Q0C6 Gm14569 p(SISHDSVFCLDPEPEKGAGK) N/A 2.3 0.001
P17095 Hmga1*
KLEKEEEEGIpSQEpSpSEEEQ transcription S99, S102, S103 1,000, 1,000, 1,000 3.2 0.010
Q3U2G2 Hspa4*
HAEQNGPVDGQGDNPGpSQAAEHGADTAVPSDGDK response to stress S817 23.91 2.0 0.046
Q920Q8 Ivns1abp NpSPQp(SSPTSTPK)
negative regulation of
apoptotic process S282 58.33 6.3 0.034
Q6ZQ58 Larp1 DGAEREpSPRPPAAAEAPAGpSDGEDGGRR macroautophagy S68, S81 1,000, 1,000 2.9 0.036
Q05CL8 Larp7 pp(TASEGSEAETPEAPKQPAK) RNA processing 4.4 0.048
P14873 Map1b VLpSPLRpSPPLLGSESPYEDFLSADSK
cytoskeletal
organization S1391, S1395 81.66, 77.60 8.1 0.009
E9PVG7 Map4k4 RDpSPLQGGGQQNSQAGQR
protein
phosphorylation S587 78.73 2.2 0.027
E9QKD1 Nol8 SSMpSDDDVDpSEDELK DNA replication S318, S324 17.01, 106.20 16.8 0.010
Q9R0L6 Pcm1 pp(NVRSDVSDQEEDEESERCPVSINLSK)
Centrosome
organization 26.9 0.004
Q3UHX2 Pdap1 SLDpSDEpSEDEDDDYQQK N/A S60, S63 20.05, 63.94 5.3 0.034
Q99JF8 Psip1 p(QSNAS)pSDVEVEEK Transcription S106 32.40 3.2 0.023
Q8K094 Pvr ENVQYSpSVNGDCR cell-cell adhesion S393 20.35 3.0 0.042
Q64012 Raly LPAPQEDpTASEAGpTPQGEVQTR mRNA processing T268, T274 55.44, 26.42 2.8 0.018
Q9ERU9 Ranbp2 pQNQPTSCVSAPAp(SSETSRSPK) protein transport 2.2 0.032
Q5U4C3 Scaf1 APpSPAPAVpSPK mRNA processing S676, S682 1,000, 1,000 13.8 0.046
Q8BP27 Sfr1 pp(ENPPSPPTSPAAPQPR) DNA repair 2.5 0.039
132
Q8VDQ8 Sirt2 VQEAQDpSDpSDTEGGATGGEAEMDFLR cell cycle S23, S25 12.57, 12.74 7.7 0.038
Q52KI8 Srrm1 pp(RLSPSASPPR) mRNA processing 6.5 0.042
Q52KI8 Srrm1 KEpTEpSEAEDDNLDDLER mRNA processing T876, S878 1,000, 1,000 4.0 0.037
Q8BTI8 Srrm2 ARpSRpTPPSAPSQSR mRNA processing S2264, T2266 103.22, 126.91 2.0 0.005
Q9CUU3 Sycp2*
p(SLS)PYPKAPpSPEFLNGNNSVVGR meiosis S1124 84.11 3.3 0.012
Q8BYJ6 Tbc1d4 HAp(SAPS)HVQPSDSEK
vesicle-mediated
transport 2.3 0.006
P39447 Tjp1 pSREDLSAQPVQTK
negative regulator of
vascular permeability S617 17.48 1.8 0.049
P83510 Tnik ANpSKp(SEGSPVLPHEPSK)
protein
phosphorylation S735, ?? 21.77 5.0 0.048
G5E870 Trip12 VREDDEDpSDDDGpSDEEIDESLAAQFLNSGNVR DNA repair S1350, S1355 27.86, 43.65 3.9 0.019
B2RUF0 Ybx2*
pTPGNQATAASGpTPAPPAR spermatid development T66, T77 40.19, 40.28 2.9 0.045
133
Figure 4.6: Example of Skyline MS1 filtering output. Skyline MS1 filtering identified a peptide
NSVLSDPGLDpSPQTpSPVILAR (which maps to ARHGEF11) that was more abundant in Ppp1cc
mutant testis samples than in wild-type. A) Histogram showing XIC peak area calculations across all six
replicates reveals that this peptide was more abundant in all Ppp1cc knockout testis samples. B)
Retention times for selected peaks are consistent across all 6 replicates giving confidence in Skyline
MS1 peak selection.
134
135
Figure 4.7: Quantitative comparison of XIC peak areas of hyperphosphorylated phosphopeptides
mapping to genes essential for spermatogenesis and known/predicted PP1 interacting proteins. HMGA1,
YBX2, HSPA4, SYCP2 are essential for mouse spermatogenesis, MAP1B is a known PP1 interacting
protein. HSPA4 and SIRT2 are predicted PP1 interacting proteins. Peptides from table 4.2 mapping to
these proteins were more abundant in Ppp1cc mutant testis samples than in wild-type. Bars represent
average XIC peak areas across 3 biological replicates of each genotype +/- standard error.
136
137
analysis revealed several biological processes and molecular functions to be significantly enriched in this
set of genes, primarily involving RNA processing (Table 4.3).
A large portion (approximately 90%) of all currently known PIPs contain a short degenerate RVxF
docking motif ([KR]-X(0,1)-[VI]-{P}-[FW]) which is the principal site of interaction with
the phosphatase. However, as a caveat, the presence of this motif does not prove interaction with PP1
isoforms, as the motif is frequently observed throughout the proteome (~25% of all proteins). In many
instances, PIPs are thought to act as regulatory subunits and by binding to the RVxF motif target PP1
catalytic subunits to dephosphorylate specific substrates. However, this is not always the case, as many
known PP1 substrates also contain RVxF motifs (Bollen et al. 2010). Seventeen of the 32 (53%)
candidate PPP1CC2 substrate proteins identified in this study contain RVxF motifs (34 instances). PP1
docking motifs often reside in flexible, exposed surface regions of proteins as opposed to inside globular
domains (Egloff et al. 1997, Hendrickx et al. 2009). Ignoring instances of RVxF motifs inside globular
domains, there remain six candidate PPP1CC2 substrate proteins with predicted accessible docking
motifs—PVR, RANBP2, SIRT2, SRRM2, TBC1D4, and the known interactor MAP1B. The presence of
this motif in an accessible region of a substrate protein may be indicative of a stronger association with
the phosphatase catalytic subunit than is typical of PP1 substrates.
4.4 Discussion
In a landmark study, Bellve et al. (1977) isolated and characterized the cell type composition of
the prepubertal mouse testis throughout the first 20 days postnatal. The first wave of mouse
spermatogenesis begins one week post-natal (p.n.). Until that point, the only germ cells present in the
testis are Spermatogonia (Type A at six days p.n. and Types A and B at eight days p.n.). By day 10,
meiosis has begun, with preleptotene and leptotene spermatocytes first being observed. Subsequently,
zygotene and early pachytene spermatocytes are first found at days 12 and 14 respectively. Developing
germ cells reach the late pachytene stage between days 18 and 20. Day 20 marks the completion of the
138
Table 4.3: GO biological processes and molecular functions enriched in the hyperphosphorylated dataset
relative to a full mouse background dataset. Data from DAVID Functional Annotation Tool.
139
Biological Process/Molecular Function Proteins
(no.) P-value
mRNA metabolic process 5 1.10E-03
RNA binding 6 2.70E-03
RNA splicing 4 3.00E-03
RNA processing 5 4.10E-03
mRNA processing 4 7.30E-03
small GTPase regulator activity 3 4.40E-02
140
first wave of meiosis, with secondary spermatocytes and the first round spermatids beginning to appear
at this date. By four weeks of age the mice are sexually mature, and a full complement of germ cell
types are found in the testis. To date, several studies have examined the expression pattern of Ppp1cc1
and Ppp1cc2 in the mouse testis, primarily at the protein level. An early study by Takizawa and co-
workers (Takizawa et al. 1994) performed western blots on various mouse tissues for PP1 isoforms and
found that both PPP1CC isoforms, as well as PPP1CA and PPP1CB were expressed in the mature mouse
testis, with PPP1CC2 being expressed at a very high level. Another study, by Chakrabarti and co-
workers (Chakrabarti et al. 2007b) found that both PPP1CC1 and PPP1CC2 were both detectable in the
mouse testis at eight days p.n. via western blot (the first time point examined) and that the PPP1CC2
protein level increased between the ages of 8 and 30 days p.n. indicating a higher degree of PPP1CC2
expression in later stage germ cells. This is consistent with our qPCR data, which is important
confirmation as the correlation between mRNA and protein levels can often be poor in the testis (Cagney
et al. 2005). Immunohistochemical (IHC) analysis of PPP1CC2 in the mouse testis shows high PPP1CC2
expression in all germ cell stages from primary spermatocytes onwards, with lower expression levels in
spermatogonia as well as in the somatic Sertoli cells (Hrabchak &Varmuza. 2004). PPP1CC1 has been
observed via IHC to be expressed at low levels in all germ cell stages, as well as in at higher levels in
interstitial cells (Chakrabarti et al. 2007b). Analysis of PPP1CA expression in the testis has shown
expression throughout spermatogenesis, including in condensing spermatids (Varmuza et al. 1999). In
the existing body of literature of PP1s in the testis, there have been multiple claims that PPP1CC2 is the
only PP1 isoform present in mammalian spermatozoa; however, several proteomic studies indicate that
this is not actually the case (Baker et al. 2007, Baker et al. 2008b, de Mateo et al. 2011). It is apparent
from these previous works that PP1 isoforms are differentially expressed in the mouse testis (Takizawa et
al. 1994, Varmuza et al., 1999, Chakrabarti et al., 2007b). However, studies such as
immunohistochemistry and western blots are only semi-quantitative at best, and can lead to discrepancies
in descriptions in expression patterns. The results of our study prove definitively that the expression of
the Ppp1cc2 isoform is specifically upregulated beginning at 3 weeks post-natal.
141
Histological examination of the 3 week old Ppp1cc mutant testis has confirmed previous
observations (Varmuza & Ling 2003) that the earliest phenotypic effects of this mutation are visible by 3
weeks of age, corresponding to upregulation of the Ppp1cc2 isoform. At this age, many seminiferous
tubules retain normal architecture, however, others are beginning to prematurely shed germ cells, and
show signs of seminiferous tubule degeneration. To date, a large portion of the research regarding
PPP1CC2’s role in mammalian spermatogenesis has focused on a later established role in motility, but it
is clear that PPP1CC2 is first required much earlier in spermatogenesis. In order to learn more about the
function(s) of PPP1CC2 at this stage in spermatogenesis, this study sought to identify candidate
PPP1CC2 substrates via a comparative phosphoproteomic analysis at a stage when minimal cellular
differences between mutant and wild type would be expected to confound results. For an informative
comparison to be made, this time point was pivotal.
The experiments described in this study represent to our knowledge, the largest comparative
analysis of the mouse testis phosphoproteome to date. Previous large-scale analyses of different mouse
tissues has produced two very large testis phosphoproteome datasets (Huttlin et al. 2010, Lundby et al.
2012b), including one of the three week testis, however, these experiments focused on tissue-tissue
variation as opposed to an examination of the testis under pathological (i.e. mutant) conditions. Despite
the size of these datasets almost ¼ of the phosphoprotein gene symbols (179/755) identified in our
dataset were not listed in the 3 week testis by Huttlin et al. including four proteins which we found to be
more abundant in Ppp1cc mutant testes (SFR1, MAP1B, PVR and GM14569). Differences in the
formatting of results likely accounts for some of the variation, as conversion between different types of
gene/protein identifiers can be problematic. At the peptide level of 1261 unique peptides in our dataset
(ignoring phosphorylation site assignment) 27.6% were not identified by Huttlin et al. including 7 of the
33 hyperphosphorylated testis peptides (mapping to BCLAF1, GM14569, HSPA4, ACIN1, LARP1,
TBC1D4 and PVR). One potential reason for this is differences in the phosphopeptide enrichment
strategy; Huttlin employed only IMAC, while we used both IMAC and TiO2 chromatography. It has been
142
established experimentally that each phosphopeptide enrichment strategy isolates a distinct overlapping
fraction of the total phosphoproteome (Bodenmiller et al., 2007). This illustrates that, while
phosphoproteomic datasets continue to increase in size, covering the entire phosphoproteome by any one
method, is currently not technically feasible. When our dataset is compared to the previous
phosphoproteomic dataset from our lab, only 7 proteins were common to both sets, and none identified
as being more abundant in 3 week Ppp1cc mutant testes (Henderson et al. 2011, Henderson 2007). This
lack of overlap is likely due to several factors. First the previous dataset is small (only 57 proteins) and
many of the proteins were identified from gel spots picked from 2-D gels after phospho-specific staining,
that contained multiple proteins, and thus may not even be phosphorylated. In addition, this experiment
was conducted using adult testes which contain cell types and therefore proteins/phosphorylation events
not present in the 3 week testis.
Our testis phosphoproteome data, the product of efficient phosphopeptide enrichment, displays a
high degree of reproducibility, making it possible to perform an informative comparison of the wild-type
and Ppp1cc mutant phosphoproteomes. To identify phosphopeptides that were more abundant in the
Ppp1cc mutant testis, we utilized a combination of multiple, label-free quantitation methods. While
many quantitative proteomic and phosphoproteomic studies use metabolic labelling strategies such as
SILAC, label-free methods can provide a powerful alternative, that is often more suitable to tissue
samples from mammalian models. Our analysis strategy consisted of two stages (Figure 4.4) in which a
preliminary semi-quantitative analysis was used to develop a list of peptides for further, more rigorous
quantitative analysis. The use of a two-stage analytical strategy was helpful in reducing the amount of
data processing in the MS1 filtering stage. While Skyline automatically assigns and aligns MS peaks,
manual inspection of this data for each peptide was performed to ensure that accurate retention times
were selected for alignment. By only performing a semi-quantitative analysis on a large portion of the
data, it could be argued that a significant amount phosphoproteomic data was not thoroughly analyzed
quantitatively. However, we feel that our two stage analytical strategy allowed us to extract the strongest
143
candidate PPP1CC2 substrates from our dataset whilst reducing the amount of data processing needed to
a manageable amount.
Our quantitative phosphoproteomic analysis of the mouse testis identified 33 different peptides
in 32 proteins that were more abundant in 3 week old Ppp1cc mutants. These mutants lack the
expression of a phosphatase gene and thus, the identified proteins represent candidate PPP1CC2
substrates. As a caveat, our data does not demonstrate direct dephosphorylation of any of these proteins
by PPP1CC2, but instead provides a strong list of candidates for further study. Previous
phosphoproteomic studies have demonstrated that there are thousands of phosphorylated proteins in the
mouse testis, even at 3 weeks of age (Huttlin et al. 2010). Furthermore, interactions between PP1
catalytic subunits and their substrates are often weak and transient, making substrate identification based
on interaction studies challenging. For these reasons, we feel that our study represents an important step
in the substrate identification process by developing a list of candidate PPP1CC2 substrates that is of a
suitable length to test individually over the course of future studies. As is the case for many quantitative
phosphoproteomic studies, it is difficult to discern instances of true hyperphosphorylation from
differences in protein abundance due to the fact that so few unique peptides are isolated for each
individual protein. It is likely that some of these observed changes in phosphopeptide abundance derive
from indirect effects secondary to the loss of Ppp1cc in the testis. However, by performing our
phosphoproteomic analysis at the time point where the earliest phenotypic changes are observed, we
have kept these instances to a minimum. Most of the candidate PPP1CC2 substrates identified (21/32)
were represented by more than one unique phosphopeptide in our dataset. For all but two of these
proteins (TJP1 and LARP7) these additional peptides did not appear to show increased abundance in
Ppp1cc mutants, indicating the likelihood of hyperphosphorylation at the specific site(s) indicated.
Eleven of the candidate PPP1CC2 substrate proteins (ARHGEF11, CENPV, DNAJC5, IVNS1ABP,
LARP1, MAP4K4, PVR, RANBP2, SCAF1, SIRT2, and TBC1D4) were represented by a single unique
peptide and we were therefore unable to rule out changes in protein abundance. Future studies evaluating
144
all of these candidate substrates should first aim to rule out this alternate explanation using techniques
such as western blotting or quantitative mass spectrometry of non-phosphopeptide enriched samples.
Nonetheless, it is worth noting that even indirect misregulation of the phosphorylation status or
abundance of proteins can provide information regarding pathways or processes affected by the loss of
Ppp1cc in the testis.
Amongst the identified candidate testis substrates is one known PP1 interacting protein (PIP),
MAP1B a microtubule binding protein to which PP1 isoforms have been demonstrated to bind and even
dephosphorylate in vitro (Ulloa et al. 1993, Hendrickx et al. 2009). MAP1B has no known role in
spermatogenesis, but an interaction between PPP1CC2 and another microtubule associated protein
PPP1R42 (TLRR) has been established and was shown to be most active at 3 weeks in the testis (Wang
et al. 2010, Wang & Sperry 2011). Furthermore, a previous study from our lab has demonstrated
hyperphosphorylation and disrupted localization of β-tubulin in the Ppp1cc knockout testis as well as an
association with PPP1CC2 (Henderson et al. 2011). Several additional candidate substrates have links to
PP1 via shared interacting proteins including predicted PIP, SIRT2 (HDAC6; Nahhas et al., 2007)),
SRRM1 (TRA2B; Long & Caceres 2009), and TJP1 (OCLN; Li et al., 2004). TJP1, which is important
in the regulation and maintenance of the Sertoli-cell junctions in the testis (Byers et al. 1991) also
associates with two of the other hyperphosphorylated proteins identified in this study—HSPA4 and
ARHGEF11 (data from Uniprot database www.uniprot.org).
Several of the candidate PPP1CC2 substrates identified in this study are known to be essential
for spermatogenesis. Targeted deletion of Hspa4 results in male specific infertility due to a partial arrest
in prophase I of meiosis, resulting in widespread apoptosis in late pachytene spermatocytes (Held et al.
2011). This phenotype has many similarities to the Ppp1cc mutant phenotype with widespread loss of
developing germ cell populations, the presence of immature germ cells in the epididymis and defects in
chromatin condensation, however, the most severe loss of germ cells occurs slightly earlier in Hspa4
knockouts than in Ppp1cc (Varmuza et al. 1999, Held et al. 2011). The Hspa4 mutant phenotype is also
145
highly similar to that of Hspa2 (Dix et al. 1996) which was previously identified as a candidate
PPP1CC2 substrate and interactor and was shown to be abnormally distributed in Ppp1cc mutant
spermatogenic cells (Henderson et al. 2011). Chimeric mice harbouring a deletion of another
hyperphosphorylated testis protein HMGA1 were also observed to have disrupted spermatogenesis, with
widespread loss of germ cells beginning with spermatocytes, resulting in azoospermia (Liu et al. 2003).
SYCP2 is a component of the synaptonemal complex during meiosis, and targeted deletion of this gene
results in a complete meiotic arrest (Yang et al. 2006). Recent research has demonstrated that many
proteins in the meiotic chromosome axis, including SYCP2 become phosphorylated during prophase I of
spermatogenesis and it has been hypothesized that phosphorylation is important in regulating
chromosomal events at this juncture (Fukuda et al. 2012). Deletion of another candidate PPP1CC2
substrate gene, Ybx2 (Msy2) results in the complete absence of mature sperm in male mice due to
abnormalities in both meiotic and post-meiotic cells (Yang et al. 2005). Ybx2 knockout seminiferous
tubules display an increase in apoptosis in spermatocytes, and later a block in spermatid elongation.
Multinucleated spermatids were frequently observed, as were abnormally shaped and variably condensed
spermatid nuclei, features that are also observed in Ppp1cc mutants (Varmuza et al. 1999, Yang et al.
2005). Aside from the above-mentioned proteins that are encoded by genes shown to be essential for
spermatogenesis, several other candidate PPP1CC2 substrates identified in this study have also been
linked to spermatogenesis: LARP7 (Okamura et al. 2012), PSIP1 (Sutherland et al. 2006), PVR
(Wakayama et al. 2007) and RANBP2 (Nagai et al. 2011).
Spermatogenesis is a complex developmental process involving the coordination of hundreds, if
not thousands, of proteins. While the identities of many of these proteins are known, the specific roles
they play, and how they are regulated remains, in most cases, unknown. The results of this study will
help to shed some light on the role of one of these proteins, the testis specific protein phosphatase
PPP1CC2. Our comparative phosphoproteomic analysis of the Ppp1cc mutant testis has produced a list
of candidate substrates of a practical length for future analysis, including a number of proteins with
146
known or potential links to spermatogenesis. Future studies will seek to verify which of these candidates
are direct PPP1CC2 substrates, and determine their roles in the regulation of mammalian
spermatogenesis.
147
Chapter 5: Conclusion
Authors note: Portions of this section are included in a mini-review article currently in review for
publication in FEBS Journal. I was responsible for writing this section, with editing from S. Varmuza.
Full citation: G. MacLeod and S. Varmuza (2013). The application of proteomic approaches to the study
of mammalian spermatogenesis and sperm function. FEBS Journal [In review].
5.1 The Application of Proteomic Approaches to the study of mammalian spermatogenesis
To better understand the process of spermatogenesis, we must uncover which genes are involved,
what roles they play and how they are regulated. Emerging proteomic technologies can provide a number
of useful tools for studying mammalian spermatogenesis. The use of proteomics is particularly important
for spermatogenesis, because the correlation between RNA and protein expression is lower in the testis
than in other tissues (Cagney et al. 2005), indicating that microarray studies are less informative in this
context. Compounding these difficulties further are transcriptional silencing and storage of earlier
produced transcripts in the later stages of spermatogenesis, and well as the abundance of tissue-specific
alternative splicing observed in the testis (Yeo et al. 2004). Despite its importance, we have only recently
begun to scratch the surface of the potential of proteomic research in application to spermatogenesis.
Throughout the course of my thesis research, I have applied several of these proteomic techniques aimed
at studying the role of PPP1CC2 in mouse spermatogenesis.
Each spermatogenic cell type represents a step towards the production of spermatozoa, and thus,
by characterizing the proteome of the different cell types we can gain insight into the genes and proteins
involved in each step. Current estimates suggest that the human sperm proteome contains roughly
2500-3000 proteins (Baker and Aitken 2009); however, less differentiated spermatogenic cells may
contain a much higher number. All of the major types of spermatogenic cells—spermatogonia
(Guillaume et al. 2000, Com et al. 2003, Dihazi et al. 2009), spermatocytes (Guo et al. 2011), spermatids
(Guo et al. 2010) and spermatozoa (Baker et al. 2008a) have been isolated and subjected to analysis in
148
order to characterize their proteomes. Some experiments have examined even narrower classes of
spermatogenic cells, such as those described by Delbes et al., (2011) who performed a proteomic
analysis of elongated spermatids. The utility of proteomic analysis of whole testes or isolated germ cell
populations goes beyond simply cataloging the proteome of the cell types. Proteomic approaches have
also been used to ask specific biological questions by an increasing number of groups. For example, the
previously mentioned elongating spermatid proteome investigation by Delbes et al., compared the
proteomic profiles of wild-type and Paip2a/Paip2b double knockouts to identify 29 differentially
expressed proteins (Delbes et al. 2011).
By breaking the cell down into its constituent parts (be they fractions, structural elements or
organelles) we can gain an even better coverage of the proteome and learn about the localization of
proteins within the spermatogenic cell types, which will help us to gain functional insight. In fact, the
spermatozoa are uniquely suited to this form of analysis. Being arguably the most differentiated cell type
in the body, they contain a number of different component parts that can be readily isolated and subjected
to proteomic analysis. To date, subcellular spermatozoa fractions examined in proteomic studies include
the sperm surface (Nixon et al. 2009, Asano et al. 2010, Belleannee et al. 2011, Gu et al. 2011, Nixon et
al. 2011, Byrne et al. 2012), the acrosomal matrix (Guyonnet et al. 2012), the sperm tail (Amaral et al.
2013), the sperm nucleus (de Mateo et al. 2011) and sperm chromatin binding proteins (Govin et al.
2012).
Post-translational modifications in spermatogenic cells
Another area of proteomics that has garnered increased interest over the past several years is the
study of post-translational modifications (PTMs). Once translated in the cell, proteins can be covalently
modified in a number of different ways, which can govern the activity of proteins and signalling
networks. Identifying PTMs of testis proteins gives us a more detailed picture of how those proteins exist
in the tissue, and can offer clues as to their functions. As well, by characterizing changes in PTM status
149
in response to different stimuli or at different time points in spermatogenesis we can gain even further
insight into the regulation of a protein’s activity. The analysis of PTMs is especially relevant in mature
spermatozoa, as they are both transcriptionally and translationally silent, meaning the entirety of cellular
functions must be governed by post-translational activity.
Phosphorylation is by far the most studied PTM in spermatogenesis. Following recent
technological advances in the isolation of phosphorylated peptides such as those by Larsen et al. (2005),
the field of phosphoproteomics has experienced significant growth over the past several years. The study
of spermatogenesis has been no exception to this, as an increasing number of groups have performed
phosphoproteome analysis in sperm and spermatogenic cells. However, the largest existing testis
phosphoproteomic datasets were not produced from labs focusing directly on spermatogenesis, but on
large scale studies aiming to map phosphorylation sites across multiple tissues. One large scale analysis
of nine tissues from 3 week old mice identified over 2,500 phosphoproteins in the testis corresponding to
over 10,000 phosphorylation sites after immobilized metal ion affinity chromatography (IMAC)
phosphopeptide enrichment (Huttlin et al. 2010). Another phosphoproteomic study utilized titanium
dioxide (TiO2) phosphopeptide enrichment on 14 different tissues and organs in the rat, and also
identified over 10,000 phosphorylation sites in the testis, including over 200 testis specific
phosphorylation sites (Lundby et al. 2012b). These studies, while not directly focused on
spermatogenesis, represent a wealth of data to the research community and have provided insight into
post-translational regulation of spermatogenesis. As an example, both studies found that the testis was
second only to the brain in the number of tissue specific phosphorylation sites (17% of all identified sites
in one experiment (Huttlin et al. 2010)), further emphasizing the importance of protein phosphorylation
in spermatogenesis.
Aside from these large scale analyses of the mammalian testis, most groups have chosen to focus
on spermatozoa for phosphoproteomic analyses due to their ease of retrieval and
transcriptional/translational silent status. Baker et al., have published 2 separate examinations of
150
changes in protein phosphorylation during rat epididymal maturation using TiO2 phosphopeptide
enrichment, identifying 53 (Baker et al. 2011) and 22 (Baker et al. 2012) differentially phosphorylated
proteins. Perhaps the most extensively studied aspect of sperm maturation via phosphoproteomic
analysis is capacitation, which has been examined in mouse (Platt et al. 2009), rat (Baker et al. 2010) and
human samples (Ficarro et al. 2003). Another investigation has even performed phosphoproteomic
analysis on clinical samples, comparing sperm from fertile individuals with those suffering from
asthenozoospermia and identified 66 differentially phosphorylated peptides (Parte et al. 2012).
In contrast to those groups examining spermatozoa, our group has focused on the response of
developing spermatogenic cells in the testis to the loss of the protein phosphatase Ppp1cc, and in one
previous study identified 10 proteins hyperphosphorylated in response to this deletion (Henderson et al.
2011). Furthering this line of inquiry, I conducted a phosphoproteomic analysis (Chapter 4) of the 3 week
old mouse testis. To our knowledge, this dataset represents the largest comparative phosphoproteomic
analysis of the mouse testis under pathologic (i.e. mutant) conditions conducted to date. This study
identified 755 different phosphorylated proteins in the 3 week old mouse testis, and confidently assigned
1,026 unique phosphorylation sites. This dataset represents one of the largest collections of mouse testis
phosphoproteomic data available, and could provide a wealth of information to researchers interested in
spermatogenesis. Quantitative analysis of our data identified 33 different phosphorylated peptides in 32
different proteins that were more abundant in Ppp1cc mutant samples than in wild-type. These
hyperphosphorylated proteins represent candidate PPP1CC2 substrates in the testis. This combination of
shotgun phosphoproteomics with a specific biological question has yielded an excellent set of candidate
genes that will form the basis of future studies regarding the role of PPP1CC2 in spermatogenesis. In
addition to this large scale phosphoproteomic study, we used phosphoproteomic analysis in other studies
to look at specific proteins of interest, identifying a novel phosphorylation site important in the
regulation of the interaction between PPP1CC2 and TSKS (Chapter 3), and showing that a protein in
complex with newly identified PIP DDOST is phosphorylated in the testis (Chapter 2).
151
In addition to the growing number of phosphoproteomic studies relating to spermatogenesis and
sperm function, a series of other types of PTMs have also been catalogued including lysine acetylation
(Lundby et al. 2012a), glycosylation (Kaji et al. 2012, Tian et al. 2010), S-nitrosylation (Lefièvre et al.
2007) and most recently SUMOylation (Vigodner et al. 2012). It is clear from these studies that the
nature of a protein does not end when it is translated—PTMs confer an extremely high diversity of
protein forms within a given cell type; a complexity that must be better understood for deciphering a
protein’s function. Fortunately, technological improvements in mass spectrometry instruments, data
analysis tools, and protein enrichment are moving us closer to this goal.
Protein-protein interaction networks (interactomes) in spermatogenesis
Proteins rarely if ever function in isolation—it is the interaction between numerous protein
species that carries out functions. Thus, to fully understand a process as complex as spermatogenesis, we
must not only look to what proteins are present in a given space and how they are modified, but to which
proteins they interact with—the interactome. By characterizing interactomes, that is the full complement
of protein-protein interactions for a given protein, we have a much better chance of understanding a
protein’s function than if we looked at each in isolation. In the past, the most common approach to
interactome studies was the yeast 2-hybrid assay. While this approach has been quite successful in
identifying protein-protein interactions, even with regard to genes important to spermatogenesis (for
example Hrabchak & Varmuza 2004, Hrabchak et al. 2007, Fardilha et al. 2011b) it has several
prominent limitations due to the artificial nature of the system (for instance, the absence of species/tissue
specific PTMs) and the fact that it only looks at binary interactions. Currently, the yeast 2-hybrid system
has been largely replaced by affinity-purification/mass spectrometry (AP-MS) based approaches,
featuring either single, or tandem affinity (TAP) tags. These approaches are typically applied to
mammalian tissue culture systems and can simultaneously identify a large number of protein-protein
interactions including multi-protein complexes. AP-MS when applied with the appropriate controls, also
results in the identification of fewer false positive interactions, and use of a mammalian system is for
152
obvious reasons preferable to a yeast-based system (see Chen &Gingras. 2007) for an overview of such
systems).
As outlined in the preceding sections, the testis is particularly abundant in tissue specific protein
expression as well as PTMs, and the complex architecture of the testis cannot be modelled in culture.
Thus, if looking to define the interactome of a protein involved in spermatogenesis using tissue culture, it
is likely that a large amount of information is being missed. For this reason it is important to conduct
interactome studies directly in the testis when possible. This prospect is significantly more demanding
than tissue culture based approaches due to the need to either have highly specific antibodies, or the
ability to generate a transgenic line with an affinity-tagged version of the gene of interest. Despite its
technological demands, a number of groups have successfully performed interactome studies in the
testis. In 2009 Chen et al., used immunoprecipitation followed by gel-free LC-MS/MS to characterize
the interactomes of germline-specific Argonaute family members MIWI and MILI in the mouse testis
(Chen et al. 2009). The authors then went on to perform a reciprocal experiment using one of their
identified interactions partners, TDRKH, and characterized a multi-protein interaction network in the
testis. Similarly, another experiment used a modified immunoprecipitation and mass spectrometry
approach to identify an additional member of the CATSPER complex in the mouse testis (Chung et al.
2011). The authors of this study had undertaken this approach due to their inability to successfully
express the CATSPER complex in any other system, which underscores the importance of examining
protein interactions in their natural environment. Other groups have generated transgenic mouse lines in
order to perform tandem affinity purification directly in the testis. To identify novel interactors involved
in Bardet-Biedl syndrome, Seo et al. generated a mouse line expressing a green fluorescent protein
(GFP) and S-tag coupled BBS4 construct, and performed tandem affinity purification in transgenic
testes, successfully identifying a novel protein complex member (Seo et al. 2011). Another TAP
experiment in the testis using a mouse expressing TAP-tagged 14-3-3ζ identified a large number of novel
153
protein-protein interactions, although the lack of appropriate control experiments leaves the total number
of true interactors in question (Puri et al. 2011).
To further define the interactome of PPP1CC2 in the testis, we endeavored to produce a TAP-
tagged PPP1CC2 knock-in mouse model (Chapter 2). To do this, we first generated a vector system for
producing SBP-3XFLAG tagged versions of any gene using gene-trap ES cell lines. Our method was
based on the Floxin system (Singla et al. 2010) from which we obtained our plasmid vector backbone.
This system can serve as a useful resource for other groups that wish to conduct interactome studies in
transgenic tissues. Via this method SBP-3XFLAG-PPP1CC1 and PPPCC2 transgenic ES cell lines were
produced. Subsequently, we used these cells in an attempt to create a transgenic mouse line, but chimeric
mice were unable to transmit the transgene through the germline, possibly due to dominant negative
effects. However, TAP studies in the transgenic ES cells successfully identified a novel PIP, DDOST
with a potential role in spermatogenesis. To further study the interactome of PPP1CC2 directly in the
testis, we performed GST pull down assays and identified several novel candidate PPP1CC2 interacting
proteins, two of which, TSSK1 and TSKS, were validated and studied further (Chapter 3). The different
proteins identified in each approach underlines the importance of conducting multiple approaches to
studying the interactome of any protein, as no one approach is likely to identify all interactors.
Furthermore, the fact that testis specific proteins were identified as PPP1CC2 interactors in our pull
down assays highlights why performing interactome studies in a biologically relevant context is the ideal
experiment.
The utilization of proteomics in clinical studies of male infertility
The ultimate aim in furthering our understanding of spermatogenesis is to improve our ability to
diagnose and treat male infertility. In recent years a number of investigators have applied proteomic
analysis to clinical samples in an effort to go beyond basic research. By analyzing the sperm proteomes
of infertile men, we may be able to detect aberrations to explain impairments, and evaluate the feasibility
154
and course of future treatment. While it is difficult to obtain a sufficient amount of starting material from
spermatogenic cells in the testes of infertile men, ejaculated spermatozoa and seminal fluid are much
easier to obtain, and thus have constituted the bulk of the studies to date.
The proteome of sperm from infertile donors has been examined by a number of groups, to date.
Experiments have identified proteins differentially expressed in patients exhibiting generalized infertility
(de Mateo et al. 2011, Xu et al. 2012), low sperm count and motility (Thacker et al. 2011),
asthenozoospermia (Zhao et al. 2007, Martínez-Heredia et al. 2008, Siva et al. 2010), Sertoli Cell Only
Syndrome (Li et al. 2012), in vitro fertilization failure (Pixton et al. 2004), diabetes and obesity (Kriegel
et al. 2009). The seminal plasma provides a protective and facilitative environment for sperm transit that
is critical in a number of ways for proper sperm function. As such, a number of clinical studies have
applied proteomic analysis in the hopes of finding useful biomarkers for defects of the male reproductive
system. (Pilch & Mann 2006, Wang et al. 2009, Batruch et al. 2011, Batruch et al. 2012, Davalieva et al.
2012, Kagedan et al. 2012, Milardi et al. 2012). From these studies a large number of biomarkers have
been identified, including those useful in discrimination between obstructive and nonobstructive
azoospermia which provide a non-invasive diagnostic alternative to the current practices of biopsy and
histology. The routine use of proteomic analysis in a clinical setting may be practical in the near future.
Alternatively, experiments such as those listed above can be used as discovery tools to produce smaller
biomarker panels which are simpler to use and interpret, less expensive, and thus easier to institute in a
clinical setting.
5.2 Significance and future directions
The experiments described in this thesis have greatly increased our knowledge of PPP1CC2
protein-protein interactions in the mouse testis. Three novel PPP1CC2 interactors in the testis have been
validated (DDOST, TSSK1 and TSKS) and four more potential interactors were identified (ATP5C1,
UQCRC2, SCCPDH and FADS2). In another experiment, from thousands of phosphorylated proteins in
155
the mouse testis, we have identified 32 that are hyperphosphorylated in response to deletion of Ppp1cc
making them excellent candidate substrates. In addition to this new information regarding protein-protein
interactions, this thesis contains a number of additional contributions to the body of literature regarding
the role of PPP1CC2 in spermatogenesis, as well as to the research community in general. qPCR
analysis has characterized the expression levels of all four PP1c isoforms in the first wave of
spermatogenesis, and demonstrated specific upregulation of Ppp1cc2 at both the transcriptional and
splicing levels beginning at 3 weeks of age. Histological analysis of the mouse testis has verified that the
first phenotypic effects of Ppp1cc deletion are present by 3 weeks of age in the testis, and further
characterized this phenotype. Apart from the identification of candidate PPP1CC2 substrates, our testis
phosphoproteomic dataset represents one of the largest of its kind, and contains a large amount of data
that will be useful to the scientific community. Finally, the SBP-3XFLAG knock-in vector produced for
TAP experiments represents a useful tool for the research community to explore the interactome of any
gene.
Taking all of this information together, we can draw several important conclusions regarding the
function of PPP1CC2 in spermatogenesis. First, we have proven definitively that PPP1CC2 has a role
early in spermatogenesis, by 3 weeks of age. Isoform specific upregulation of the Ppp1cc2 transcript and
the presence of a knockout phenotype by three weeks of age show conclusively that PPP1CC2 is
required at this stage of spermatogenesis. At this point, the late spermatocyte is the predominant germ
cell type present and only the very first round spermatids have appeared. Second, this early role for
PPP1CC2 in spermatogenesis is unlikely to be its only function. Previous studies have demonstrated a
role for PPP1CC2 in the acquisition of spermatozoan motility, which occurs long after its first
requirement in the testis (reviewed in Fardilha et al. 2011a). Furthermore, our identification of a complex
containing PPP1CC2, TSKS, and TSSK1 suggests an additional role in the mid to late stages of
spermiogenesis, as TSKS and TSSK1are not even expressed in the testis at 3 weeks of age. Further
support for this model is found in transgenic Ppp1cc2 knock-in mice. Transgenic expression of Ppp1cc2
156
in a Ppp1cc knockout background is only able to completely rescue the infertility phenotype if
expression levels reach a certain threshold; ~50% of heterozygous protein levels (Sinha et al., 2012).
Below this expression level only a partial rescue is of the Ppp1cc mutant phenotype is observed (Soler et
al., 2009, Sinha et al., 2012). A low level of PPP1CC2 expression in the testis rescues extensive
depletion of spermatids but mice remain infertile due to abnormal spermatid morphology with defective
nuclear shaping and mitochondrial sheath morphology. This suggests the possibility of different
threshold levels of PPP1CC2 required at different points in spermatogenesis. One can envision a scenario
where a lower level of PPP1CC2 expression is required at 3 weeks of age for a function in early
spermatogenesis, but a higher level is required for an additional function in late spermiogenesis. This is
also consistent with the expression levels observed in our qPCR analysis of Ppp1cc2 in the first wave of
spermatogenesis. A pleiotropic nature of PPP1CC2 in the testis is not surprising, given the fact that PP1s
are involved in numerous and varied biological processes, and our research (and that of others) suggests
that this is the most likely scenario.
The knowledge gained from the research described in this thesis also produces a large number of
new questions regarding PPP1CC2’s role in spermatogenesis. These questions were discussed in detail
in previous chapter, but a few central ideas warrant future mention. Does the PPP1CC2-DDOST complex
play a role in spermatogenesis? The first step in determining this is to perform a targeted knockout or
tissue-specific deletion of Ddost to determine if it is essential for spermatogenesis, and if so characterize
the nature of the infertility phenotype. Another key question posed is what is the biochemical relationship
between members of the PPP1CC2-TSKS-TSSK1 complex, and how do they regulate one another?
Given that this complex contains both a Ser/Thr kinase and phosphatase it is logical to hypothesize that,
aside from the known phosphorylation of TSKS by TSSK1 there may be additional enzyme-substrate
relationships present. This could be tested by examining the phosphorylation status of the three proteins
in Tssk1/2 and Ppp1cc mutant backgrounds as well as using in vitro phosphatase and kinase assays. The
biological role of the PPP1CC2-TSKS-TSSK1 complex also requires further study. It appears that this
157
complex may play a role in organizing the formation of the mitochondrial sheath. One interesting
experiment would be to perform a cross between the Ppp1cc and Tssk1/2 knockout models. If the
phosphatase and kinase play opposing roles in this process perhaps the double-knockout would result in
restoration of spermiogenesis. However, due to the more severe and early acting phenotype of the
Ppp1cc knockout, the use of a line with hypomorphic PPP1CC2 expression, such as those that resulted in
partial rescue of the spermatogenic impairment (Soler et al., 2009, Sinha et al., 2012) may be more
appropriate. Additional experiments should also include a more thorough examination of the
interactomes of all three proteins to determine whether there are additional members of this complex,
which could offer further clues as to its function in spermatogenesis. It remains to be determined, which
of the proteins hyperphosphorylated in the Ppp1cc mutant testis are true substrates of PPP1CC2? This
could be tested via in vitro phosphatase assays and/or interaction studies that show a direct interaction
between the phosphatase and the candidate substrates. And finally, is there an isoform specific role for
PPP1CC2 in spermatogenesis, or is there a threshold total PP1 dosage that is required for completion of
spermatogenesis? These central questions will need to be tested in future studies if we are to truly
understand the function of PPP1CC2. Developing a better understanding of mammalian spermatogenesis
including which genes are involved, and how they are regulated is needed in order to increase the
efficacy of the diagnosis and treatment of male infertility. As infertility affects the quality of life in
approximately 15% of all couples, basic research such as that which is described in this thesis is an
important step towards this goal.
158
References
Amaral A, Castillo J, Estanyol JM, Ballesca JL, Ramalho-Santos J & Oliva R 2013 Human sperm
tail proteome suggests new endogenous metabolic pathways. Molecular & Cellular Proteomics 12 330-
342.
Angers S, Thorpe CJ, Biechele TL, Goldenberg SJ, Zheng N, MacCoss MJ & Moon RT 2006 The
KLHL12-Cullin-3 ubiquitin ligase negatively regulates the Wnt-[beta]-catenin pathway by targeting
Dishevelled for degradation. Nature cell biology 8 348-357.
Aranda B, Blankenburg H, Kerrien S, Brinkman FSL, Ceol A, Chautard E, Dana JM, De LR,
Dumousseau M, Galeota E, Gaulton A, Goll J, Hancock REW, Isserlin R, Jimenez RC,
Kerssemakers J, Khadake J, Lynn DJ, Michaut M, O'Kelly G, Ono K, Orchard S, Prieto C, Razick
S, Rigina O, Salwinski L, Simonovic M, Velankar S, Winter A, Wu G, Bader GD, Cesareni G,
Donaldson IM, Eisenberg D, Kleywegt GJ, Overington J, Ricard-Blum S, Tyers M, Albrecht M &
Hermjakob H 2011 PSICQUIC and PSISCORE: accessing and scoring molecular interactions. Nature
Methods 8 528-529.
Asano A, Nelson JL, Zhang S & Travis AJ 2010 Characterization of the proteomes associating with
three distinct membrane raft sub-types in murine sperm. Proteomics 10 3494-3505.
Baker MA, Hetherington L, Reeves GM & Aitken RJ 2008a The mouse sperm proteome
characterized via IPG strip prefractionation and LC-MS/MS identification. Proteomics 8 1720-1730.
Baker MA, Hetherington L, Reeves G, Müller J & Aitken RJ 2008b The rat sperm proteome
characterized via IPG strip prefractionation and LC-MS/MS identification. Proteomics 8 2312-2321.
Baker MA, Hetherington L, Weinburg A, Naumovski N, Velkov T, Pelzing M, Dolman S, Condina
MR & Aitken RJ 2012 Analysis of Phosphopeptide Changes as Spermatozoa Acquire Functional
Competence in the Epididymis Demonstrates Changes in the Post-Translational Modification of Izumo1.
Journal of Proteome Research 11 5252-5264.
Baker MA, Reeves G, Hetherington L, Müller J, Baur I & Aitken RJ 2007 Identification of gene
products present in Triton X-100 soluble and insoluble fractions of human spermatozoa lysates using LC-
MS/MS analysis. Proteomics - Clinical Applications 1 524-532.
Baker MA, Smith ND, Hetherington L, Pelzing M, Condina MR & Aitken RJ 2011 Use of Titanium
Dioxide To Find Phosphopeptide and Total Protein Changes During Epididymal Sperm Maturation.
Journal of Proteome Research 10 1004-1017.
Baker MA, Smith ND, Hetherington L, Taubman K, Graham ME, Robinson PJ & Aitken RJ 2010
Label-Free Quantitation of Phosphopeptide Changes During Rat Sperm Capacitation. Journal of
Proteome Research 9 718-729.
Batruch I, Lecker I, Kagedan D, Smith CR, Mullen BJ, Grober E, Lo KC, Diamandis EP & Jarvi
KA 2011 Proteomic Analysis of Seminal Plasma from Normal Volunteers and Post-Vasectomy Patients
Identifies over 2000 Proteins and Candidate Biomarkers of the Urogenital System. Journal of Proteome
Research 10 941-953.
159
Batruch I, Smith CR, Mullen BJ, Grober E, Lo KC, Diamandis EP & Jarvi KA 2012 Analysis of
Seminal Plasma from Patients with Non-obstructive Azoospermia and Identification of Candidate
Biomarkers of Male Infertility. Journal of Proteome Research 11 1503-1511.
Beausoleil SA, Villen J, Gerber SA, Rush J & Gygi SP 2006 A probability-based approach for high-
throughput protein phosphorylation analysis and site localization. 24 1285-1292.
Belleannee C, Belghazi M, Labas V, Teixeira-Gomes A, Gatti JL, Dacheux J & Dacheux F 2011
Purification and identification of sperm surface proteins and changes during epididymal maturation.
Proteomics 11 1952-1964.
Bellve A, Cavicchia J, Millette C, O'Brien D, Bhatnagar Y & Dym M 1977 Spermatogenic cells of
the prepuberal mouse: isolation and morphological characterization. The Journal of cell biology 74 68-
85.
Beullens M, Van Eynde A, Vulsteke V, Connor J, Shenolikar S, Stalmans W & Bollen M 1999
Molecular Determinants of Nuclear Protein Phosphatase-1 Regulation by NIPP-1. Journal of Biological
Chemistry 274 14053-14061.
Bianchi M, De Lucchini S, Marin O, Turner DL, Hanks SK & -Villa-Moruzzi E 2005 Regulation of
FAK Ser-722 phosphorylation and kinase activity by GSK3 and PP1 during cell spreading and migration.
Biochemical Journal 391 359-- 370.
Bienvenu F, Jirawatnotai S, Elias JE, Meyer CA, Mizeracka K, Marson A, Frampton GM, Cole
MF, Odom DT, Odajima J, Geng Y, Zagozdzon A, Jecrois M, Young RA, Liu XS, Cepko CL, Gygi
SP & Sicinski P 2010 Transcriptional role of cyclin D1 in development revealed by a genetic-proteomic
screen. Nature 463 374-378.
Blendy JA, Kaestner KH, Weinbauer GF, Nieschlag E & Schutz G 1996 Severe impairment of
spermatogenesis in mice lacking the CREM gene. Nature 380 162-165.
Bodenmiller B, Mueller LN, Mueller M, Domon B & Aebersold R 2007 Reproducible isolation of
distinct, overlapping segments of the phosphoproteome. Nature Methods 4 231-237.
Bolino A, Bolis A, Previtali SC, Dina G, Bussini S, Dati G, Amadio S, Del Carro U, Mruk DD, Feltri
ML, Cheng CY, Quattrini A & Wrabetz L 2004 Disruption of Mtmr2 produces CMT4B1-like
neuropathy with myelin outfolding and impaired spermatogenesis. The Journal of cell biology 167 711-
721.
Bollen M 2001 Combinatorial control of protein phosphatase-1. Trends in biochemical sciences 26 426-
431.
Bollen M, Peti W, Ragusa MJ & Beullens M 2010 The extended PP1 toolkit: designed to create
specificity. Trends in biochemical sciences 35 450-458.
Bonilla E &Xu EY 2008 Identification and characterization of novel mammalian spermatogenic genes
conserved from fly to human. Molecular human reproduction 14 137-142.
Brautigan DL 2012 Protein Ser/Thr phosphatases -the ugly ducklings of cell signalling. FEBS Journal
280 324-325.
Brown KR &Jurisica I 2005 Online Predicted Human Interaction Database. Bioinformatics 21 2076-
2082.
160
Brown K &Jurisica I 2007 Unequal evolutionary conservation of human protein interactions in
interologous networks. Genome biology 8 R95.
Browne GJ, Fardilha M, Oxenham SK, Wu W, Helps NR, da cruz e Silva, Odete A.B., Cohen PTW
& da Cruz e Silva EF 2007 SARP, a new alternatively spliced protein phosphatase 1 and DNA
interacting protein. - Biochemical Journal 402 187-196.
Brush MH, Weiser DC & Shenolikar S 2003 Growth Arrest and DNA Damage-Inducible Protein
GADD34 Targets Protein Phosphatase 1α to the Endoplasmic Reticulum and Promotes
Dephosphorylation of the α Subunit of Eukaryotic Translation Initiation Factor 2. Molecular and cellular
biology 23 1292-1303.
Burckstummer T, Bennett KL, Preradovic A, Schutze G, Hantschel O, Superti-Furga G & Bauch A 2006 An efficient tandem affinity purification procedure for interaction proteomics in mammalian cells. 3
1013-1019.
Bushnik T, Cook JL, Yuzpe AA, Tough S & Collins J 2012 Estimating the prevalence of infertility in
Canada. Human Reproduction 27 738-746.
Byers S, Graham R, Dai HN & Hoxter B 1991 Development of Sertoli cell junctional specializations
and the distribution of the tight-junction-associated protein ZO-1 in the mouse testis. American Journal
of Anatomy 191 35-47.
Byrne K, Leahy T, McCulloch R, Colgrave ML & Holland MK 2012 Comprehensive mapping of the
bull sperm surface proteome. Proteomics 12 3559-3579.
Cagney G, Park S, Chung C, Tong B, O'Dushlaine C, Shields DC & Emili A 2005 Human Tissue
Profiling with Multidimensional Protein Identification Technology. Journal of Proteome Research 4
1757-1767.
Ceulemans H &Bollen M 2004 Functional Diversity of Protein Phosphatase-1, a Cellular Economizer
and Reset Button. Physiological reviews 84 1-39.
Ceulemans H &Bollen M 2006 A Tighter RVxF Motif Makes a Finer Sift. Chemistry & biology 13 6-8.
Chakrabarti R, Cheng L, Puri P, Soler D & Vijayaraghavan S 2007a Protein phosphatase
PP1[gamma]2 in sperm morphogenesis and epididymal initiation of sperm motility. Asian Journal of
Andrology 9 445-452.
Chakrabarti R, Kline D, Lu J, Orth J, Pilder S & Vijayaraghavan S 2007b Analysis of Ppp1cc-Null
Mice Suggests a Role for PP1gamma2 in Sperm Morphogenesis. Biology of reproduction 76 992-1001.
Chelius D &Bondarenko PV 2002 Quantitative Profiling of Proteins in Complex Mixtures Using
Liquid Chromatography and Mass Spectrometry. Journal of Proteome Research 1 317-323.
Chemes H, E., Fawcett D, W. & Dym M 1978 Unusual features of the nuclear envelope in human
spermatogenic cells. 192 493-512.
Chen C, Jin J, James DA, Adams-Cioaba MA, Park JG, Guo Y, Tenaglia E, Xu C, Gish G, Min J &
Pawson T 2009 Mouse Piwi interactome identifies binding mechanism of Tdrkh Tudor domain to
arginine methylated Miwi. Proceedings of the National Academy of Sciences 106 20336-20341.
Chen GI &Gingras A 2007 Affinity-purification mass spectrometry (AP-MS) of serine/threonine
phosphatases. Methods 42 298-305.
161
Cheng L, Pilder S, Nairn AC, Ramdas S & Vijayaraghavan S 2009 PP1Cγ2 and PPP1R11 Are Parts
of a Multimeric Complex in Developing Testicular Germ Cells in which their Steady State Levels Are
Reciprocally Related. PLoS ONE 4 e4861.
Choi J, Nannenga B, Demidov ON, Bulavin DV, Cooney A, Brayton C, Zhang Y, Mbawuike IN,
Bradley A, Appella E & Donehower LA 2002 Mice Deficient for the Wild-Type p53-Induced
Phosphatase Gene (Wip1) Exhibit Defects in Reproductive Organs, Immune Function, and Cell Cycle
Control. Molecular and cellular biology 22 1094-1105.
Chung J, Navarro B, Krapivinsky G, Krapivinsky L & Clapham DE 2011 A novel gene required for
male fertility and functional CATSPER channel formation in spermatozoa. Nature Communications 2
153.
Cohen P 1999 The Croonian Lecture 1998. Identification of a protein kinase cascade of major
importance in insulin signal transduction. Philosophical transactions of the Royal Society of London.
Series B, Biological sciences 354 485-495.
Colinge J, Chiappe D, Lagache S, Moniatte M & Bougueleret L 2005 Differential Proteomics via
Probabilistic Peptide Identification Scores. Analytical Chemistry 77 596-606.
Com E, Evrard B, Roepstorff P, Aubry F & Pineau C 2003 New Insights into the Rat Spermatogonial
Proteome. Molecular & Cellular Proteomics 2 248-261.
Dantzer F, Mark M, Quenet D, Scherthan H, Huber A, Liebe B, Monaco L, Chicheportiche A,
Sassone-Corsi P, de Murcia G & Ménissier-de Murcia J 2006 Poly(ADP-ribose) polymerase-2
contributes to the fidelity of male meiosis I and spermiogenesis. Proceedings of the National Academy of
Sciences 103 14854-14859.
Davalieva K, Kiprijanovska S, Noveski P, Plaseski T, Kocevska B, Broussard C & Plaseska-
Karanfilska D 2012 Proteomic analysis of seminal plasma in men with different spermatogenic
impairment. Andrologia 44 256-264.
Davies MJ, Moore VM, Willson KJ, Van Essen P, Priest K, Scott H, Haan EA & Chan A 2012
Reproductive Technologies and the Risk of Birth Defects. N Engl J Med 366 1803-1813.
Davies T &Varmuza S 2003 Development to Blastocyst Is Impaired When Intracytoplasmic Sperm
Injection Is Performed with Abnormal Sperm from Infertile Mice Harboring a Mutation in the Protein
Phosphatase 1cγ Gene. Biology of reproduction 68 1470-1476.
de Mateo S, Castillo J, Estanyol JM, Ballescà JL & Oliva R 2011 Proteomic characterization of the
human sperm nucleus. Proteomics 11 2714-2726.
De Wever V, Lloyd DC, Nasa I, Nimick M, Trinkle-Mulcahy L, Gourlay R, Morrice N & Moorhead
GBG 2012 Isolation of Human Mitotic Protein Phosphatase Complexes: Identification of a Complex
between Protein Phosphatase 1 and the RNA Helicase Ddx21. PLoS ONE 7 e39510.
Delbes G, Yanagiya A, Sonenberg N & Robaire B 2011 PABP Interacting Protein 2A (PAIP2A)
Regulates Specific Key Proteins During Spermiogenesis in the Mouse. Biology of reproduction.
Dihazi H, Dihazi GH, Nolte J, Meyer S, Jahn O, Müller GA & Engel W 2009 Multipotent Adult
Germline Stem Cells and Embryonic Stem Cells: Comparative Proteomic Approach. Journal of
Proteome Research 8 5497-5510.
162
Dix DJ, Allen JW, Collins BW, Mori C, Nakamura N, Poorman-Allen P, Goulding EH & Eddy EM 1996 Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male
infertility. Proceedings of the National Academy of Sciences 93 3264-3268.
Egloff MP, Johnson DF, Moorhead G, Cohen PT, Cohen P & Barford D 1997 Structural basis for the
recognition of regulatory subunits by the catalytic subunit of protein phosphatase 1.The EMBO Journal
16 1876-1887.
Egloff M, Cohen PTW, Reinemer P & Barford D 1995 Crystal Structure of the Catalytic Subunit of
Human Protein Phosphatase 1 and its Complex with Tungstate. Journal of Molecular Biology 254 942-
959.
Fardilha M, Esteves SLC, Korrodi-Gregório L, Pelech S, da Cruz e Silva,Odete A.B. & da Cruz e
Silva E 2011a Protein phosphatase 1 complexes modulate sperm motility and present novel targets for
male infertility. Molecular human reproduction 17 466-477.
Fardilha M, Esteves SLC, Korrodi-Gregório L, Vintém AP, Domingues SC, Rebelo S, Morrice N,
Cohen PTW, Silva OA & da Cruz e Silva EF 2011b Identification of the human testis protein
phosphatase 1 interactome. Biochemical pharmacology 82 1403-1415.
Fawcett, DW 1975 The mammalian spermatozoa. Developmental Biology 44 394-436.
Ficarro S, Chertihin O, Westbrook VA, White F, Jayes F, Kalab P, Marto JA, Shabanowitz J, Herr
JC, Hunt DF & Visconti PE 2003 Phosphoproteome Analysis of Capacitated Human Sperm. Journal of
Biological Chemistry 278 11579-11589.
Forgione N, Vogl AW & Varmuza S 2010 Loss of protein phosphatase 1c{gamma} (PPP1CC) leads to
impaired spermatogenesis associated with defects in chromatin condensation and acrosome development:
an ultrastructural analysis. Reproduction 139 1021-1029.
Fukuda T, Pratto F, Schimenti JC, Turner JMA, Camerini-Otero R & Höög C 2012
Phosphorylation of Chromosome Core Components May Serve as Axis Marks for the Status of
Chromosomal Events during Mammalian Meiosis. PLoS Genet 8 e1002485.
Ge R, Chen G & Hardy MP 2009 The Role of the Leydig Cell in Spermatogenic Function. In
Molecular Mechanisms in Spermatogenesis, pp 255. Cheng CY (Ed), New York: Springer.
Goldberg J, Huang H, Kwon Y, Greengard P, Nairn AC & Kuriyan J 1995 Three-dimensional
structure of the catalytic subunit of protein serine/threonine phosphatase-1. Nature 376 745-753.
Govin J, Caron C, Escoffier E, Ferro M, Kuhn L, Rousseaux S, Eddy EM, Garin J & Khochbin S 2006 Post-meiotic Shifts in HSPA2/HSP70.2 Chaperone Activity during Mouse Spermatogenesis.
Journal of Biological Chemistry 281 37888-37892.
Govin J, Gaucher J, Ferro M, Debernardi A, Garin J, Khochbin S & Rousseaux S 2012 Proteomic
strategy for the identification of critical actors in reorganization of the post-meiotic male genome.
Molecular human reproduction 18 1-13.
Grallert A, Chan KY, Alonso- Nuñez ML, Madrid M, Biswas A, Alvarez- Tabarés, Connolly Y,
Tanaka K, Robertson A, Ortiz JM, Smith DL & Hagan IM 2013 Removal of Centrosomal PP1 by
NIMA Kinase Unlocks the MPF Feedback Loop to Promote Mitotic Commitment in S. pombe. Current
Biology 23 213-222.Griswold MD &McLean D 2006 The Sertoli Cell. In The Physiology of
Reproduction, edn 3, pp 949-975. Eds E Knobil and JD Neill. St Louis: Academic Press.
163
Gu, Bin AND Zhang, Jiarong AND Wu, Ying AND Zhang, Xinzong AND Tan, Zhou AND Lin,
Yuanji AND Huang, Xiao AND Chen, Liangbiao AND Yao, Kangshou AND Zhang,Ming 2011
Proteomic Analyses Reveal Common Promiscuous Patterns of Cell Surface Proteins on Human
Embryonic Stem Cells and Sperms. PLoS ONE 6 e19386.
Guan K, Nayernia K, Maier LS, Wagner S, Dressel R, Lee JH, Nolte J, Wolf F, Li M, Engel W &
Hasenfuss G 2006 Pluripotency of spermatogonial stem cells from adult mouse testis. Nature 440 1199-
1203.
Guillaume E, Dupaix A, Moertz E, Courtens J, Jégou, B & Pineau C 2000 Proteome analysis of
spermatogonia: identification of a first set of 53 proteins. Proteome 1 1-20.
Guo X, Shen J, Xia Z, Zhang R, Zhang P, Zhao C, Xing J, Chen L, Chen W, Lin M, Huo R, Su B,
Zhou Z & Sha J 2010 Proteomic Analysis of Proteins Involved in Spermiogenesis in Mouse. Journal of
Proteome Research 9 1246-1256.
Guo X, Zhang P, Qi Y, Chen W, Chen X, Zhou Z & Sha J 2011 Proteomic analysis of male 4C germ
cell proteins involved in mouse meiosis. Proteomics 11 298-308.
Guyonnet B, Zabet-Moghaddam M, SanFrancisco S & Cornwall GA 2012 Isolation and proteomic
characterization of the mouse sperm acrosomal matrix. Molecular & Cellular Proteomics 11 758-774.
Hardouin N &Nagy A 2000 Gene-trap-based target site for Cre-mediated transgenic insertion. Genesis
26 245-252.
Held T, Barakat AZ, Mohamed BA, Paprotta I, Meinhardt A, Engel W & Adham IM 2011 Heat-
shock protein HSPA4 is required for progression of spermatogenesis. Reproduction 142 133-144.
Henderson H. 2006 Identifying the targets of Protein Phosphatase PP1cγ2 in the Mouse Testis. Thesis
(M.Sc.), University of Toronto.
Henderson H, MacLeod G, Hrabchak C & Varmuza S 2011 New candidate targets of protein
phosphatase-1c-gamma-2 in mouse testis revealed by a differential phosphoproteome analysis.
International Journal of Andrology 34 339-351.
Hendrickx A, Beullens M, Ceulemans H, Den Abt T, Van Eynde A, Nicolaescu E, Lesage B &
Bollen M 2009 Docking Motif-Guided Mapping of the Interactome of Protein Phosphatase-1. Chemistry
& biology 16 365-371.
Heroes E, Lesage B, Görnemann J, Beullens M, Van Meervelt L & Bollen M 2012 The PP1 binding
code: a molecular-lego strategy that governs specificity. FEBS Journal 280 584-595.
Hess RA &de Franca LR 2009 Spermatogenesis and Cycle of the Seminiferous Epithelium. In
Molecular Mechanisms in Spermatogenesis, pp 1. Ed. CY Cheng, New York: Springer.
Hornbeck PV, Kornhauser JM, Tkachev S, Zhang B, Skrzypek E, Murray B, Latham V & Sullivan
M 2012 PhosphoSitePlus: a comprehensive resource for investigating the structure and function of
experimentally determined post-translational modifications in man and mouse. Nucleic acids research 40
D261-D270.
Hrabchak C &Varmuza S 2004 Identification of the spermatogenic zip protein Spz1 as a putative
protein phosphatase-1 (PP1) regulatory protein that specifically binds the PP1cgamma2 splice variant in
the mouse testis. Journal of Biological Chemistry 279 37079-37086.
164
Hrabchak C, Henderson H & Varmuza S 2007 A Testis Specific Isoform of Endophilin B1,
Endophilin B1t, Interacts Specifically with Protein Phosphatase-1cgamma2 in Mouse Testis and Is
Abnormally Expressed in PP1cgamma Null Mice. Biochemistry 46 4635-4644.
Hsu S, Shyu H, Hsieh-Li H & Li H 2001 Spz1, a novel bHLH-Zip protein, is specifically expressed in
testis. Mechanisms of development 100 177-187.
Hu Z, Xia Y, Guo X, Dai J, Li H, Hu H, Jiang Y, Lu F, Wu Y, Yang X, Li H, Yao B, Lu C, Xiong C,
Li Z, Gui Y, Liu J, Zhou Z, Shen H, Wang X & Sha J 2012 A genome-wide association study in
Chinese men identifies three risk loci for non-obstructive azoospermia. Nature genetics 44 183-186.
Huang DW, Sherman BT & Lempicki RA 2008 Systematic and integrative analysis of large gene lists
using DAVID bioinformatics resources. 4 44-57.
Huang DW, Sherman BT & Lempicki RA 2009 Bioinformatics enrichment tools: paths toward the
comprehensive functional analysis of large gene lists. Nucleic acids research 37 1-13.
Huang H, Lee T, Tzeng S & Horng J 2005 KinasePhos: a web tool for identifying protein kinase-
specific phosphorylation sites. Nucleic acids research 33 W226-W229.
Huang X, Guo X, Shen J, Wang Y, Chen L, Xie J, Wang N, Wang F, Zhao C, Huo R, Lin M, Wang
X, Zhou Z & Sha J 2008 Construction of a Proteome Profile and Functional Analysis of the Proteins
Involved in the Initiation of Mouse Spermatogenesis. Journal of Proteome Research 7 3435-3446.
Huang Z, Khatra B, Bollen M, Carr DW & Vijayaraghavan S 2002 Sperm PP1γ2 Is Regulated by a
Homologue of the Yeast Protein Phosphatase Binding Protein sds221. Biology of reproduction 67 1936-
1942.
Huang Z, Myers K, Khatra B & Vijayaraghavan S 2004 Protein 14-3-3ζ Binds to Protein Phosphatase
PP1γ2 in Bovine Epididymal Spermatozoa. Biology of reproduction 71 177-184.
Huang Z, Somanath PR, Chakrabarti R, Eddy EM & Vijayaraghavan S 2005 Changes in
Intracellular Distribution and Activity of Protein Phosphatase PP1γ2 and Its Regulating Proteins in
Spermatozoa Lacking AKAP4. Biology of reproduction 72 384-392.
Huang Z &Vijayaraghavan S 2004 Increased Phosphorylation of a Distinct Subcellular Pool of Protein
Phosphatase, PP1γ2, During Epididymal Sperm Maturation. Biology of reproduction 70 439-447.
Hubbard MJ &Cohen P 1993 On target with a new mechanism for the regulation of protein
phosphorylation. Trends in biochemical sciences 18 172-177.
Huckins C 1971 The spermatogonial stem cell population in adult rats. I. Their morphology,
proliferation and maturation. The Anatomical Record 169 533-557.
Hurley TD, Yang J, Zhang L, Goodwin KD, Zou Q, Cortese M, Dunker AK & DePaoli-Roach AA 2007 Structural Basis for Regulation of Protein Phosphatase 1 by Inhibitor-2. Journal of Biological
Chemistry 282 28874-28883.
Huttlin EL, Jedrychowski MP, Elias JE, Goswami T, Rad R, Beausoleil SA, Villén J, Haas W, Sowa
ME & Gygi SP 2010 A Tissue-Specific Atlas of Mouse Protein Phosphorylation and Expression. Cell
143 1174-1189.
Ingebritsen TS &Cohen P 1983 The Protein Phosphatases Involved in Cellular Regulation. European
Journal of Biochemistry 132 255-261.
165
Jain N, Thatte J, Braciale T, Ley K, O'Connell M & Lee JK 2003 Local-pooled-error test for
identifying differentially expressed genes with a small number of replicated microarrays. Bioinformatics
19 1945-1951.
Jaleel M, McBride A, Lizcano JM, Deak M, Toth R, Morrice NA & Alessi DR 2005 Identification of
the sucrose non-fermenting related kinase SNRK, as a novel LKB1 substrate. FEBS letters 579 1417-
1423.
Jones M, Ng B, Bhide S, Chin E, Rhodenizer D, He P, Losfeld M, He M, Raymond K, Berry G,
Freeze H & Hegde M 2012 DDOST Mutations Identified by Whole-Exome Sequencing Are Implicated
in Congenital Disorders of Glycosylation. The American Journal of Human Genetics 90 363-368.
Jurisicova A, Lopes S, Meriano J, Oppedisano L, Casper RF & Varmuza S 1999 DNA damage in
round spermatids of mice with a targeted disruption of the Pp1c{gamma} gene and in testicular biopsies
of patients with non-obstructive azoospermia. Molecular human reproduction 5 323-330.
Kagedan D, Lecker I, Batruch I, Smith C, Kaploun I, Lo K, Grober E, Diamandis E & Jarvi K 2012 Characterization of the seminal plasma proteome in men with prostatitis by mass spectrometry.
Clinical Proteomics 9 2.
Kaji H, Shikanai T, Sasaki-Sawa A, Wen H, Fujita M, Suzuki Y, Sugahara D, Sawaki H, Yamauchi
Y, Shinkawa T, Taoka M, Takahashi N, Isobe T & Narimatsu H Large-scale Identification of N-
Glycosylated Proteins of Mouse Tissues and Construction of a Glycoprotein Database, GlycoProtDB.
Journal of Proteome Research 11 4553-4566.
Kawa S, Ito C, Toyama Y, Maekawa M, Tezuka T, Nakamura T, Nakazawa T, Yokoyama K,
Yoshida N, Toshimori K & Yamamoto T 2006 Azoospermia in mice with targeted disruption of the
Brek/Lmtk2 (brain-enriched kinase/lemur tyrosine kinase 2) gene. Proceedings of the National Academy
of Sciences 103 19344-19349.
Keller A, Nesvizhskii AI, Kolker E & Aebersold R 2002 Empirical Statistical Model To Estimate the
Accuracy of Peptide Identifications Made by MS/MS and Database Search. Analytical Chemistry 74
5383-5392.
Kerk D, Templeton G & Moorhead GBG February 2008 Evolutionary Radiation Pattern of Novel
Protein Phosphatases Revealed by Analysis of Protein Data from the Completely Sequenced Genomes of
Humans, Green Algae, and Higher Plants. Plant physiology 146 351-367.
Kierszenbaum AL 2002 Intramanchette transport (IMT): Managing the making of the spermatid head,
centrosome, and tail. Molecular reproduction and development 63 1-4.
Kopera IA, Bilinska B, Cheng CY & Mruk DD 2010 Sertoli–germ cell junctions in the testis: a review
of recent data. Philosophical Transactions of the Royal Society B: Biological Sciences 365 1593-1605.
Kriegel TM, Heidenreich F, Kettner K, Pursche T, Hoflack B, Grunewald S, Poenicke K, Glander
H & Paasch U 2009 Identification of diabetes- and obesity-associated proteomic changes in human
spermatozoa by difference gel electrophoresis. Reproductive BioMedicine Online 19 660-670.
Kueng P, Nikolova Z, Djonov V, Hemphill A, Rohrbach V, Boehlen D, Zuercher G, Andres A &
Ziemiecki A 1997 A Novel Family of Serine/Threonine Kinases Participating in Spermiogenesis. The
Journal of cell biology 139 1851-1859.
166
Kuzmin A, Jarvi K, Lo K, Spencer L, Chow GYC, Macleod G, Wang Q & Varmuza S 2009
Identification of Potentially Damaging Amino Acid Substitutions Leading to Human Male Infertility.
Biology of reproduction 81 319-326.
Larsen MR, Thingholm TE, Jensen ON, Roepstorff P & Jørgensen TJD 2005 Highly Selective
Enrichment of Phosphorylated Peptides from Peptide Mixtures Using Titanium Dioxide Microcolumns.
Molecular & Cellular Proteomics 4 873-886.
Leblond CP &Clermont Y 1952 Spermiogenesis of rat, mouse, hamster and guinea pig as revealed by
the “periodic acid-fuchsin sulfurous acid” technique. American Journal of Anatomy 90 167-215.
Lefièvre L, Chen Y, Conner SJ, Scott JL, Publicover SJ, Ford WCL & Barratt CLR 2007 Human
spermatozoa contain multiple targets for protein S-nitrosylation: An alternative mechanism of the
modulation of sperm function by nitric oxide? Proteomics 7 3066-3084.
Lewis JD, Abbott DW & Ausió J 2003 A haploid affair: core histone transitions during
spermatogenesis. Biochemistry and Cell Biology 81 131-140.
Lexicon Genetics 2005 NIH initiative supporting placement of Lexicon Genetics, Inc. mice into public
repositories. MGI: J:103485.
Li J, Guo W, Li F, He J, Yu Q, Wu X, Li J & Mao X 2012 HnRNPL as a key factor in
spermatogenesis: Lesson from functional proteomic studies of azoospermia patients with sertoli cell only
syndrome. Journal of Proteomics 75 2879-2891.
Li X, Ionescu AV, Lynn BD, Kamasawa N, Morita M, Davidson KG, Yasumura T, Rash JE, Nagy JI
2004 Connexin47, connexin29 and connexin32 co-expression in oligodendrocytes and Cx47 association
with zonula occludens-1 (ZO-1) in mouse brain. Neuroscience 126 611-630.
Li Y, Sosnik J, Brassard L, Reese M, Spiridonov NA, Bates TC, Johnson GR, Anguita J, Visconti
PE & Salicioni AM 2011a Expression and localization of five members of the testis-specific serine
kinase (Tssk) family in mouse and human sperm and testis. Molecular human reproduction 17 42-56.
Li Y, Franklin S, Zhang MJ & Vondriska TM 2011b Highly efficient purification of protein
complexes from mammalian cells using a novel streptavidin-binding peptide and hexahistidine tandem
tag system: Application to Bruton's tyrosine kinase. Protein Science 20 140-149.
Liu H, Sadygov RG & Yates JR 2004 A Model for Random Sampling and Estimation of Relative
Protein Abundance in Shotgun Proteomics. Analytical Chemistry 76 4193-4201.
Liu J &Brautigan DL 2000 Glycogen Synthase Association with the Striated Muscle Glycogen-
targeting Subunit of Protein Phosphatase-1: Synthase activation involves scaffolding regulated by β-
adrenergic signalling. Journal of Biological Chemistry 275 26074-26081.
Liu J, Schiltz JF, Ashar HR & Chada KK 2003 Hmga1 is required for normal sperm development.
Molecular reproduction and development 66 81-89.
Long JC, Caceres JF 2009 The SR protein family of splicing factors: master regulators of gene
expression. Biochemical Journal 417 15-27.
Luk JM, Mok BW, Shum CK, Yeung WS, Tam PC, Tse JY, Chow JF, Woo J, Kam K & Lee KF 2003 Identification of novel genes expressed during spermatogenesis in stage-synchronized rat testes by
differential display. Biochemical and biophysical research communications 307 782-790.
167
Lundby A, Lage K, Weinert B, Bekker-Jensen D, Secher A, Skovgaard T, Kelstrup C, Dmytriyev
A, Choudhary C, Lundby C & Olsen J 2012a Proteomic Analysis of Lysine Acetylation Sites in Rat
Tissues Reveals Organ Specificity and Subcellular Patterns. Cell Reports 2 419-431.
Lundby A, Secher A, Lage K, Nordsborg NB, Dmytriyev A, Lundby C & Olsen JV 2012b
Quantitative maps of protein phosphorylation sites across 14 different rat organs and tissues. Nature
Communications 3 876.
Lynes EM &Simmen T 2011 Urban planning of the endoplasmic reticulum (ER): How diverse
mechanisms segregate the many functions of the ER. Biochimica et Biophysica Acta (BBA) - Molecular
Cell Research 1813 1893-1905.
MacLeod G &Varmuza S 2012 Tandem Affinity Purification in Transgenic Mouse Embryonic Stem
Cells Identifies DDOST as a Novel PPP1CC2 Interacting Protein. Biochemistry 51 9678-9688.
Mann M, Latham K, E. & Varmuza S 1995 Identification of Genes Showing Altered Expression in
Preimplantation and Early Postimplantation Parthenogenetic Embryos. Developmental Genetics 17 223-
232.
Martínez-Heredia J, de Mateo S, Vidal-Taboada JM, Ballescà JL & Oliva R 2008 Identification of
proteomic differences in asthenozoospermic sperm samples. Human Reproduction 23 783-791.
Matzuk MM &Lamb DJ 2008 The biology of infertility: research advances and clinical challenges.
Nature medicine 14 1197-1213.
McAvoy T, Allen PB, Obaishi H, Nakanishi H, Takai Y, Greengard P, Nairn AC & Hemmings HC 1999 Regulation of Neurabin I Interaction with Protein Phosphatase 1 by Phosphorylation. Biochemistry
38 12943-12949.
Meikar O, Da Ros M, Korhonen H & Kotaja N 2011 Chromatoid body and small RNAs in male germ
cells. Reproduction 142 195-209.
Meiselbach H, Sticht H & Enz R 2006 Structural Analysis of the Protein Phosphatase 1 Docking Motif:
Molecular Description of Binding Specificities Identifies Interacting Proteins. Chemistry & biology 13
49-59.
Milardi D, Grande G, Vincenzoni F, Messana I, Pontecorvi A, De Marinis L, Castagnola M &
Marana R 2012 Proteomic approach in the identification of fertility pattern in seminal plasma of fertile
men. Fertility and sterility 97 67-73.e1.
Moorhead GBG, Trinkle-Mulcahy L & Ulke-Lemee A 2007 Emerging roles of nuclear protein
phosphatases. Nature reviews. Molecular cell biology 8 234-244.
Moorhead GBG, De wever V, Templeton G & Kerk D 2009 Evolution of protein phosphatases in
plants and animals. Biochemical Journal 417 401-409.
Morimoto H, Okamura H & Haneji T 2002 Interaction of Protein Phosphatase 1 Delta with Nucleolin
in Human Osteoblastic Cells. Journal of Histochemistry & Cytochemistry 50 1187-1193.
Nagai M, Moriyama T, Mehmood R, Tokuhiro K, Ikawa M, Okabe M, Tanaka H & Yoneda Y 2011
Mice lacking Ran binding protein 1 are viable and show male infertility. FEBS letters 585 791-796.7.
168
Nahhas F, Dryden SC, Abrams J, Tainsky MA 2007 Mutations in SIRT2 deacetylase which regulate
enzymatic activity but not its interaction with DHAC6 and tubulin. Molecular and Cellular Biochemistry
303 221-230.
Nesvizhskii AI, Keller A, Kolker E & Aebersold R 2003 A Statistical Model for Identifying Proteins by
Tandem Mass Spectrometry. Analytical Chemistry 75 4646-4658.
Nieschlag E, Behre HM &Nieschlag S (Eds) 2010 Andrology: Male Reproductive Health and
Dysfunction, edn 3, New York: Springer.
Nixon B, Bielanowicz A, Mclaughlin EA, Tanphaichitr N, Ensslin MA & Aitken RJ 2009
Composition and significance of detergent resistant membranes in mouse spermatozoa. Journal of
cellular physiology 218 122-134.
Nixon B, Mitchell LA, Anderson AL, Mclaughlin EA, O'bryan MK & Aitken RJ 2011a Proteomic
and functional analysis of human sperm detergent resistant membranes. Journal of cellular physiology
226 2651-2665.
Nord AS, Chang PJ, Conklin BR, Cox AV, Harper CA, Hicks GG, Huang CC, Johns SJ, Kawamoto
M, Liu S, Meng EC, Morris JH, Rossant J, Ruiz P, Skarnes WC, Soriano P, Stanford WL, Stryke
D, von Melchner H, Wurst W, Yamamura K, Young SG, Babbitt PC & Ferrin TE 2006 The
International Gene Trap Consortium Website: a portal to all publicly available gene trap cell lines in
mouse. Nucleic acids research 34 D642-D648.
Oakberg EF 1971 Spermatogonial stem-cell renewal in the mouse. The Anatomical Record 169 515-
531.
Oakberg EF 1956 A description of spermiogenesis in the mouse and its use in analysis of the cycle of
the seminiferous epithelium and germ cell renewal. American Journal of Anatomy 99 391-413.
Obenauer JC, Cantley LC & Yaffe MB 2003 Scansite 2.0: proteome-wide prediction of cell signaling
interactions using short sequence motifs. Nucleic acids research 31 3635-3641.
Okamura D, Maeda I, Taniguchi H, Tokitake Y, Ikeda M, Ozato K, Mise N, Abe K, Noce T, Izpisua
Belmonte JC & Matsui Y 2012 Cell cycle gene-specific control of transcription has a critical role in
proliferation of primordial germ cells. Genes & development 26 2477-2482.
Okano K, Heng H, Trevisanato S, Tyers M & Varmuza S 1997 - Genomic Organization and
Functional Analysis of the Murine Protein Phosphatase 1c γ (Ppp1cc) Gene. 45 215.
Olsen JV, Blagoev B, Gnad F, Macek B, Kumar C, Mortensen P, Mann M 2006 Global, in vivo, and
site-specific phosphorylation dynamics in signalling networks. Cell 127 635-648.
Olsen JV, Vermeulen M, Santamaria A, Kumar C, Miller ML, Jensen LJ, Gnad F, Cox J, Jensen
TS, Nigg EA, Brunak S & Mann M 2010 Quantitative Phosphoproteomics Reveals Widespread Full
Phosphorylation Site Occupancy During Mitosis. Science Signaling 3 ra3.
Oppedisano-Wells L &Varmuza S 2003 Protein phosphatase 1cgamma is required in germ cells in
murine testis. Molecular reproduction and development 65 157-166.
Parte PP, Rao P, Redij S, Lobo V, D'Souza SJ, Gajbhiye R & Kulkarni V 2012 Sperm
phosphoproteome profiling by ultra performance liquid chromatography followed by data independent
analysis (LC–MSE) reveals altered proteomic signatures in asthenozoospermia. Journal of Proteomics 75
5861-5871.
169
Philipps DL, Wigglesworth K, Hartford SA, Sun F, Pattabiraman S, Schimenti K, Handel M,
Eppig JJ & Schimenti JC 2008 The dual bromodomain and WD repeat-containing mouse protein
BRWD1 is required for normal spermiogenesis and the oocyte–embryo transition. Developmental
biology 317 72-82.
Phillips BT, Gassei K & Orwig KE 2010 Spermatogonial stem cell regulation and spermatogenesis.
Philosophical Transactions of the Royal Society B: Biological Sciences 365 1663-1678.
Pilch B &Mann M 2006 Large-scale and high-confidence proteomic analysis of human seminal plasma.
Genome biology 7 R40.
Pixton KL, Deeks ED, Flesch FM, Moseley FLC, Björndahl L, Ashton PR, Barratt CLR & Brewis
IA 2004 Sperm proteome mapping of a patient who experienced failed fertilization at IVF reveals altered
expression of at least 20 proteins compared with fertile donors: Case report. Human Reproduction 19
1438-1447.
Platt MD, Salicioni AM, Hunt DF & Visconti PE 2009 Use of Differential Isotopic Labeling and Mass
Spectrometry To Analyze Capacitation-Associated Changes in the Phosphorylation Status of Mouse
Sperm Proteins. Journal of Proteome Research 8 1431-1440.
Puri P, Acker-Palmer A, Stahler R, Chen Y, Kline D & Vijayaraghavan S 2011 Identification of testis
14-3-3 binding proteins by tandem affinity purification. Spermatogenesis 1 354-365.
Puri P, Myers K, Kline D & Vijayaraghavan S 2008 Proteomic Analysis of Bovine Sperm YWHA
Binding Partners Identify Proteins Involved in Signaling and Metabolism. Biology of reproduction 79
1183-1191.
Ragusa MJ, Dancheck B, Critton DA, Nairn AC, Page R & Peti W 2010 Spinophilin directs protein
phosphatase 1 specificity by blocking substrate binding sites. Nature structural & molecular biology 17
459-464.
Reinton N, Collas P, Haugen TB, Skålhegg BS, Hansson V, Jahnsen T & Taskén K 2000
Localization of a Novel Human A-Kinase-Anchoring Protein, hAKAP220, during Spermatogenesis.
Developmental biology 223 194-204.
Rigaut G, Shevchenko A, Rutz B, Wilm M, Mann M & Seraphin B 1999 A generic protein
purification method for protein complex characterization and proteome exploration. Nature
Biotechnology 17 1030-1032.
Roboti P &High S 2012 The oligosaccharyltransferase subunits OST48, DAD1 and KCP2 function as
ubiquitous and selective modulators of mammalian N-glycosylation. Journal of cell science 125 3474-
3484.
Ruan Y, Cheng M, Ou Y, Oko R & van der Hoorn FA 2011 Ornithine Decarboxylase Antizyme Oaz3
Modulates Protein Phosphatase Activity. Journal of Biological Chemistry 286 29417-29427.
Russell LD, Ettlin RA, Sinha Hikim AP & Clegg EG 1990 Histological and Histopathological
Evaluation of the Testis. Clearwater, Fl: Cache River Press.
Schilling B, Rardin MJ, MacLean BX, Zawadzka AM, Frewen BE, Cusack MP, Sorensen DJ,
Bereman MS, Jing E, Wu CC, Verdin E, Kahn CR, MacCoss MJ & Gibson BW 2012 Platform-
independent and Label-free Quantitation of Proteomic Data Using MS1 Extracted Ion Chromatograms in
170
Skyline: APPLICATION TO PROTEIN ACETYLATION AND PHOSPHORYLATION. Molecular &
Cellular Proteomics 11 202-214.
Seo, Seongjin AND Zhang, Qihong AND Bugge, Kevin AND Breslow, David K. AND Searby,
Charles C. AND Nachury, Maxence V. AND Sheffield,Val C. 2011 A Novel Protein LZTFL1
Regulates Ciliary Trafficking of the BBSome and Smoothened. PLoS Genet 7 e1002358.
Shang P, Hoogerbrugge J, Baarends WM & Grootegoed JA 2013 Evolution of testis-specific kinases
TSSK1B and TSSK2 in primates. Andrology 1 160-168.
Shang P, Baarends WM, Hoogerbrugge J, Ooms MP, van Cappellen WA, de Jong AAW, Dohle GR,
van Eenennaam H, Gossen JA & Grootegoed JA 2010 Functional transformation of the chromatoid
body in mouse spermatids requires testis-specific serine/threonine kinases. Journal of cell science 123
331-339.
Shi Y &Manley JL 2007 A Complex Signaling Pathway Regulates SRp38 Phosphorylation and Pre-
mRNA Splicing in Response to Heat Shock. Molecular cell 28 79-90.
Shima H, Haneji T, Hatano Y, Kasugai I, Sugimura T & Nagao M 1993 Protein Phosphatase 1γ2 Is
Associated with Nuclei of Meiotic Cells in Rat Testis. Biochemical and biophysical research
communications 194 930-937.
Singla V, Hunkapiller J, Santos N, Seol AD, Norman AR, Wakenight P, Skarnes WC & Reiter JF 2010 Floxin, a resource for genetically engineering mouse ESCs. Nature Methods 7 50-52.
Sinha N, Pilder S & Vijayaraghavan S 2012 Significant Expression Levels of Transgenic PPP1CC2 in
Testis and Sperm Are Required to Overcome the Male Infertility Phenotype of Ppp1cc Null Mice. PLoS
ONE 7 e47623.
Siva AB, Kameshwari DB, Singh V, Pavani K, Sundaram CS, Rangaraj N, Deenadayal M &
Shivaji S 2010 Proteomics-based study on asthenozoospermia: differential expression of proteasome
alpha complex. Molecular human reproduction 16 452-462.
Smith GD, Wolf DP, Trautman KC, da Cruz e Silva,E F., Greengard P & Vijayaraghavan S 1996
Primate sperm contain protein phosphatase 1, a biochemical mediator of motility. Biology of
reproduction 54 719-727.
Soler DC, Kadunganattil S, Ramdas S, Myers K, Roca J, Slaughter T, Pilder SH, Vijayaraghavan S
2009 Expression of Transgenic PPP1CC2 in the Testis of Ppp1cc-Null Mice Rescues Spermatid Viability
and Spermiation but does not Restore Normal Sperm Tail Ultrastructure, Sperm Motility or Fertility.
Biology of Reproduction 81 343-352.
Spiridonov NA, Wong L, Zerfas PM, Starost MF, Pack SD, Paweletz CP & Johnson GR 2005
Identification and Characterization of SSTK, a Serine/Threonine Protein Kinase Essential for Male
Fertility. Molecular and cellular biology 25 4250-4261.
Stoffel W, Holz B, Jenke B, Binczek E, Gunter RH, Kiss C, Karakesisoglou I, Thevis M, Weber A,
Arnhold S & Addicks K 2008 [Delta]6-Desaturase (FADS2) deficiency unveils the role of [omega]3-
and [omega]6-polyunsaturated fatty acids. The EMBO journal 27 2281-2292.
Sutherland HG, Newton K, Brownstein DG, Holmes MC, Kress C, Semple CA & Bickmore WA 2006 Disruption of Ledgf/Psip1 Results in Perinatal Mortality and Homeotic Skeletal Transformations.
Molecular and cellular biology 26 7201-7210.
171
Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y, Liang C, Jung JU, Cheng JQ,
Mul JJ, Pledger WJ & Wang H 2007 Bif-1 interacts with Beclin 1 through UVRAG and regulates
autophagy and tumorigenesis. Nature cell biology 9 1142-1151.
Takizawa N, Mizuno Y, Ito Y & Kikuchi K 1994 Tissue Distribution of Isoforms of Type-1 Protein
Phosphatase PP1 in Mouse Tissues and Its Diabetic Alterations. Journal of Biochemistry 116 411-415.
Tegelenbosch RA &de Rooij DG 1993 A quantitative study of spermatogonial multiplication and stem
cell renewal in the C3H/101 F1 hybrid mouse. 290 193-200.
Terrak M, Kerff F, Langsetmo K, Tao T & Dominguez R 2004 Structural basis of protein phosphatase
1 regulation. Nature 429 780-784.
Terry-Lorenzo R, Carmody LC, Voltz JW, Connor JH, Li S, Smith FD, Milgram SL, Colbran RJ
& Shenolikar S 2002 The Neuronal Actin-binding Proteins, Neurabin I and Neurabin II, Recruit Specific
Isoforms of Protein Phosphatase-1 Catalytic Subunits. Journal of Biological Chemistry 277 27716-
27724.
Thacker S, Yadav SP, Sharma RK, Kashou A, Willard B, Zhang D & Agarwal A 2011 Evaluation of
Sperm Proteins in Infertile Men: A Proteomic Approach. Fertility and sterility 95 2745-2748.
Thingholm TE, Jensen ON & Larsen MR 2009 Enrichment and Separation of Mono- and Multiply
Phosphorylated Peptides Using Sequential Elution from IMAC Prior to Mass Spectrometric Analysis. In
Phospho-Proteomics, Methods and Protocols, pp 67-78. Ed. M de Graauw, New York: Humana Press.
Thingholm TE, Jensen ON, Robinson PJ & Larsen MR April 2008 SIMAC (Sequential Elution from
IMAC), a Phosphoproteomics Strategy for the Rapid Separation of Monophosphorylated from Multiply
Phosphorylated Peptides. Molecular & Cellular Proteomics 7 661-671.
Tian Y, Kelly-Spratt KS, Kemp CJ & Zhang H 2010 Mapping Tissue-Specific Expression of
Extracellular Proteins Using Systematic Glycoproteomic Analysis of Different Mouse Tissues. Journal of
Proteome Research 9 5837-5847.
Tokuhiro K, Isotani A, Yokota S, Yano Y, Oshio S, Hirose M, Wada M, Fujita K, Ogawa Y, Okabe
M, Nishimune Y & Tanaka H 2009 OAZ-t/OAZ3 Is Essential for Rigid Connection of Sperm Tails to
Heads in Mouse. PLoS Genet 5 e1000712.
Tournaye H 2012 Male factor infertility and ART. Asian Journal of Andrology 14 103-108.
Trinkle-Mulcahy L, Andersen J, Lam YW, Moorhead G, Mann M & Lamond AI 2006 Repo-Man
recruits PP1γ to chromatin and is essential for cell viability. The Journal of cell biology 172 679-692.
Ulloa L, Dombrádi V, Díaz-Nido J, Szücs K, Gergely P, Friedrich P & Avila J 1993
Dephosphorylation of distinct sites on microtubule-associated protein MAP1B by protein phosphatases
1, 2A and 2B. FEBS letters 330 85-89.
Varmuza S, Jurisicova A, Okano K, Hudson J, Boekelheide K & Shipp EB 1999 Spermiogenesis Is
Impaired in Mice Bearing a Targeted Mutation in the Protein Phosphatase 1cγ Gene. Developmental
biology 205 98-110.
Varmuza S &Ling L 2003 Increased recombination frequency showing evidence of loss of interference
is associated with abnormal testicular histopathology. Molecular reproduction and development 64 499-
506.
172
Vigodner M, Shrivastava V, Gutstein LE, Schneider J, Nieves E, Goldstein M, Feliciano M &
Callaway M 2012 Localization and identification of sumoylated proteins in human sperm: excessive
sumoylation is a marker of defective spermatozoa. Human Reproduction 28 210-223.
Vijayaraghavan S, Stephens DT, Trautman K, Smith GD, Khatra B, da Cruz e Silva,E F. &
Greengard P 1996 Sperm motility development in the epididymis is associated with decreased glycogen
synthase kinase-3 and protein phosphatase 1 activity. Biology of reproduction 54 709-718.
Wakayama T, Sai Y, Ito A, Kato Y, Kurobo M, Murakami Y, Nakashima E, Tsuji A, Kitamura Y &
Iseki S 2007 Heterophilic Binding of the Adhesion Molecules Poliovirus Receptor and Immunoglobulin
Superfamily 4A in the Interaction Between Mouse Spermatogenic and Sertoli Cells. Biology of
reproduction 76 1081-1090.
Wakula P, Beullens M, Ceulemans H, Stalmans W & Bollen M 2003 Degeneracy and Function of the
Ubiquitous RVXF Motif That Mediates Binding to Protein Phosphatase-1. Journal of Biological
Chemistry 278 18817-18823.
Walker A, Taylor J, Rowe D & Summers D 2008 A method for generating sticky-end PCR products
which facilitates unidirectional cloning and the one-step assembly of complex DNA constructs. Plasmid
59 155-162.
Wang J, Wang J, Zhang H, Shi H, Ma D, Zhao H, Lin B & Li R 2009 Proteomic analysis of seminal
plasma from asthenozoospermia patients reveals proteins that affect oxidative stress responses and semen
quality. Asian Journal of Andrology 11 484-491.
Wang R, Kaul A & Sperry AO 2010 TLRR (lrrc67) interacts with PP1 and is associated with a
cytoskeletal complex in the testis. Biology of the Cell 102 173-189.
Wang R &Sperry AO 2011 PP1 Forms an Active Complex with TLRR (lrrc67), a Putative PP1
Regulatory Subunit, during the Early Stages of Spermiogenesis in Mice. PLoS ONE 6 e21767.
Xu B, Hao Z, Jha KN, Zhang Z, Urekar C, Digilio L, Pulido S, Strauss III JF, Flickinger CJ &
Herr JC 2008 Targeted deletion of Tssk1 and 2 causes male infertility due to haploinsufficiency.
Developmental biology 319 211-222.
Xu W, Hu H, Wang Z, Chen X, Yang F, Zhu Z, Fang P, Dai J, Wang L, Shi H, Li Z & Qiao Z 2012
Proteomic characteristics of spermatozoa in normozoospermic patients with infertility. Journal of
Proteomics 75 5426-5436.
Yamagata T, Tsuru T, Momoi MY, Suwa K, Nozaki Y, Mukasa T, Ohashi H, Fukushima Y &
Momoi T 1997 Genome Organization of Human 48-kDa Oligosaccharyltransferase (DDOST). Genomics
45 535-540.
Yan W 2009 Male infertility caused by spermiogenic defects: Lessons from gene knockouts. Molecular
and cellular endocrinology 306 24-32.
Yang F, De La Fuente R, Leu NA, Baumann C, McLaughlin KJ & Wang PJ 2006 Mouse SYCP2 is
required for synaptonemal complex assembly and chromosomal synapsis during male meiosis. 173 497-
507.
Yang J, Medvedev S, Yu J, Tang LC, Agno JE, Matzuk MM, Schultz RM & Hecht NB 2005
Absence of the DNA-/RNA-binding protein MSY2 results in male and female infertility. Proceedings of
the National Academy of Sciences of the United States of America 102 5755-5760.
173
Yeo G, Holste D, Kreiman G & Burge C 2004 Variation in alternative splicing across human tissues.
Genome biology 5 R74.
Zhang Z &Lutz B 2002 Cre recombinase mediated inversion using lox66 and lox71: method to
introduce conditional point mutations into the CREB binding protein. Nucleic acids research 30 e90.
Zhao C, Huo R, Wang F, Lin M, Zhou Z & Sha J 2007 Identification of several proteins involved in
regulation of sperm motility by proteomic analysis. Fertility and sterility 87 436-438.
174
Appendix A.1 Mouse Mutations Causing Male Infertility
Author’s Note: This table contains data compiled from Matzuk & Lamb 2008, Kuzmin et al., 2009 in
addition to data that I personally compiled.
Gene Testis Cells Affected Sex Affected Testis/Sperm Phenotype Male Fertility Status
Ace Spermatozoa Male Impaired fertility Subfertile
Acr Spermatozoa Male Impaired fertility Fertile
Acvr2a Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Oligozoospermia Subfertile
Adad1 Spermatozoa Male Oligoteratozoospermia Infertile
Adam2 Spermatozoa Male Impaired fertility Infertile
Adam24 Spermatozoa Male Polyspermy Subfertile
Adam3 Spermatozoa Male Impaired fertility Infertile
Adamts2 Spermatogonia; Spermatids;
Spermatozoa
Male Oligozoospermia infertile
Adcy10 Spermatozoa Male Asthenozoospermia Infertile
Adcy3 Spermatids; Spermatozoa Male Impaired fertility;
Asthenozoospermia
Subfertile
Adora1 Spermatozoa Male Impaired Fertility Subfertile
Adra1b Sertoli,
peritubular, Leydig
and/or interstitial
cells;
Spermatocytes
Male hypospermatogenesis- Sertoli cell
only
Variable infertility
Aff4 Spermatids Male Azoospermia Infertile
Agfg1 Spermatocytes; Spermatids Male ÒAT/Globozoospermia Infertile
Agps Spermatocytes; Spermatids Male Azoospermia Infertile
Agtpbp1 Spermatozoa Male OAT Infertile
Ahr Spermatozoa Both Oligozoospermia Subfertile
Aire Both Gonadal Atrophy Variable infertility
Akap4 Spermatozoa Male Asthenozoospermia Infertile
Akt1 Spermatozoa Male Oligoasthenozoospermia Subfertile
Akt2 Spermatozoa Male Oligoasthenozoospremia Fertile
Amh Both Obstructive Azoospermia Infertile
Amhr2 Male Obstructive Azoospermia Secondary Infertility
Apaf1 Spermatogonia Male Azoospermia Variable lethality;
infertile
175
Apob Spermatozoa Male Oligoasthenozoospermia Infertile
Aqp3 Spermatozoa Male Impaired Fertility Subfertile
Ar Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Morphological Infertile
Arl4 Spermatozoa Male Oligozoospermia Fertile
Arntl Leydig cells; Spermatozoa Both Oligozoospermia; Impaired
Fertility
Infertile
Aspm PGC Both Oligoasthenozoospermia Subfertile
Asz1 Spermatocytes Male Meiotic Arrest Infertile
Atf4 Male Obstructive Subfertile
Atm Spermatocytes Both Meiotic Arrest Infertile
Atn1 ? Male Oligozoospermia Progressive Infertility
Atp2b4 Spermatozoa Male Asthenozoospermia Infertile
Aurkb Spermatocytes Male Hypospermatogenesis Subfertile
Aurkc Spermatids, Spermatozoa Male Teratozoospermia Subfertile
B4galnt1 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatozoa
Male Azoospermia Infertile
Bat3 Spermatocytes Male Azoospermia Infertile
Bax Spermatogonia Both Azoospermia Infertile
Bbs1 Spermatids Male Asthenozoospermia Infertile
Bbs2 Spermatids Male Asthenozoospermia Infertile
Bbs3 Spermatids Male Asthenozoospermia Infertile
Bbs4 Spermatozoa Male Asthenozoospermia Infertile
Bcl2l1 Spermatocytes Both Sertoli-cell only Infertile
Bcl2l2 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatocytes;
Spermatids
Both Azoospermia Infertile
Bcl6 Spermatocytes Male Oligozoospermia Subfertile
Blimp1 PGC Both PGC depletion Infertile
176
Bmp4 PGC Both PGC depletion Lethal
Bmp8a Spermatocytes Male Progressive germ cell depletion Progressive infertility
Bmp8b Spermatogonia Both Hypospermatogenesis
Variable infertility;
subfertile
Brca2 Spermatocytes Both Meiotic Arrest Infertile
Brdt Spermatids Male OAT Infertile
Brwd1 Spermatids; Spermatozoa Both OAT Infertile
Bsg Spermatocytes Both Meiotic Arrest Infertile
Btrc Spermatocytes Male Oligozoospermia Subfertile
Bub1 Spermatogonia Male Sertoli-cell only Infertile
Bub1b Spermatocytes Both Oligozoospermia, Impaired fertility Infertile
Cadm1 Spermatids; Spermatozoa Male OAT Infertile
Calr3 Spermatozoa Male Impaired Fertility Infertile
Camk4 Spermatids Male Oligoteratozoospermia Infertile
Capza3 Spermatids Male OAT Infertile
Catsper1 Spermatozoa Male Asthenozoospermia Infertile
Catsper2 Spermatozoa Male Asthenozoospermia Infertile
Catsper3 Spermatozoa Male Asthenozoospermia Infertile
Catsper4 Spermatozoa Male Asthenozoospermia Infertile
Ccna1 Spermatocytes Male Meiotic Arrest Infertile
Ccnb1ip1 Spermatocytes Both Meiotic Arrest Infertile
Ccnd2 Both Gonadal hypoplasia Fertile
Ccne2 Spermatocytes Male Oligozoospermia Subfertile
Cd59b Spermatozoa Male OAT Progressive infertility
Cdk16 Spermatids; Spermatozoa Male Asthenoteratozoospermia Infertile
Cdk2 Spermatocytes Both Meiotic Arrest Infertile
Cdk4 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatocytes
Both Age dependent decline in
spermatogenesis
Infertile
Cdkn1b Both Testicular hyperplasia Fertile
Cdkn1c Both Gonadal hypoplasia Infertile
Cdkn2c Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male OAT Fertile
177
Cdkn2d Spermatogonia Male Testicular atrophy Fertile
Cecr2 Spermatozoa Male Impaired Fertility Subfertile
Cenpb Spermatozoa Both Oligozoospermia Fertile
Cftr Sertoli cells; Spermatocytes;
Spermatids; Spermatozoa
Male Azoospermia Infertile
Cga Spermatozoa Both Hypogonadism Infertile
Cib1 Spermatozoa Male Azoospermia Infertile
Cks2 Spermatocytes Both Meiotic Arrest Infertile
Cldn11 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Azoospermia Infertile
Clgn Spermatozoa Male Impaired fertility Infertile
Clock
Cnot7 Spermatocytes; Spermatids Male OAT Infertile
Cpe Both Hypospermatogenesis Subfertile
Cpeb1 Spermatocytes Both Azoospermia Infertile
Cplx1 Spermatozoa Male Impaired Fertility Subfertile
Crem Spermatids; Spermatozoa Male Azoospermia Infertile
Crisp1 Spermatozoa Male Impaired Fertility Fertile
Crtc1 Both ? Infertile
Crybb2 Both Oligozoospermia Subfertile
Csda Spermatocytes Male Oligozoospermia Variable Infertility
Csf1 Spermatogonia Both Oligozoospermia Subfertile
Csf2 Both None Subfertile
Csnk2a2 Spermatids Male Globozoospermia Infertile
Cstf2t Spermatocytes; Spermatozoa Male OAT Infertile
Ctnnb1 Sertoli Cells; Spermatogonia ? Sertoli-cell Only Infertile
Cugbp1 Spermatids Male Azoospermia (variable) Variable Infertility
Cux1 Male None Subfertile
CylD Spermatids Male Azoospermia Infertile
Cyp11a1 Both Gonadal degeneration Not reported
Cyp17a1 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Asthenoteratozoospermia Infertile
178
Cyp19a1 Sertoli,
peritubular, Leydig
and/or interstitial
cells, Spermatogonia
Both Oligozoospermia Progressive Infertility
D6mm5e Spermatocytes Male Oligozoospermia Infertile
Dazap1 Spermatocytes Both Meiotic Arrest Variable lethality;
infertile
Dazl Spermatogonia Both Sertoli-cell only Infertile
Ddr2 Sertoli cells; Leydig cells;
Spermatogonia
Both Testicular atrophy Infertile
Ddx25 Spermatids Male Azoospermia Infertile
Ddx4 Spermatogonia Male Meiotic Arrest Infertile
Dhcr24 Sertoli cells; Spermatocytes;
Spermatids;
Both Seminiferous tubule degeneration;
OAT
Infertile
Dhh Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Azoospermia Infertile
Dicer1 Spermatocytes Both Oligoteratozoospermia Infertile
Dmc1 Spermatocytes Both Meiotic Arrest Infertile
Dmrt1 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatocytes
Male Azoospermia Infertile
Dmrtc2 Spermatocytes Male Meiotic Arrest Infertile
Dnahc1 Spermatozoa Male Asthenozoospermia Infertile
Dnaja1 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Oligoasthenozoospermia Variable
infertility/subfertility
Dnmt3l Spermatogonia Both Azoospermia Infertile
Drosha Spermatocytes; Spermatids ? Azoospermia/Oligoteratozoospermi
a
Infertile
Dyp19l2 Spermatids; Spermatocytes Male Globozoospermia Infertile
Egr1 Both Hypogonadism Infertile
Egr4 Spermatocytes; Spermatozoa Male Hypospermatogenesis Infertile
Ehd1 Spermatids Male Azoospermia Infertile
Ehmt2 Spermatocytes;
Spermatogonia
Both Sertoli-cell only; Meiotic arrest Infertile
Eif4g3 Spermatocytes Male Meiotic Arrest Infertile
Elavl1 Spermatocytes; Spermatids Male Meiotic Arrest Infertile
Elovl2 Spermatocytes Male Azoospermia Infertile
179
Emx2 Both Gonadal hypoplasia Not assessed
Epas1 Sertoli Cells ? Azoospermia Infertile
Epb4.1l2 Sertoli cells; Spermatids Male Azoospermia Infertile
Ercc1 Spermatocytes Both Sertoli-cell only Infertile
Espl1 Spermatogonia Male Sertoli-cell only Fertile
Esr1 Sertoli cells; spermatogonia;
spermatocytes; spermatids;
spermatozoa
Both Hypospermataogenesis;
Asthenozoospermia.
Infertile
Esr2 Both None Fertile
Etv4 Male None Infertile
Etv5 Spermatogonia, Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Sertoli cell only Progressive Infertility
Exo1 Spermatocytes Both Meiotic Arrest Infertile
Faah Spermatozoa Both Impaired Fertility Subfertile
Fabp9 Spermatozoa ?? Teratozoospermia Fertile
Fads2 Spermatids Male Azoospermia Infertile
Fanca Spermatocytes Both Reduced Fertility Subfertile
Fancc PGC Both Hypogonadism Infertile
Fancg Sertoli cells; spermatids Both Hypogonadism Subfertile
Fancl PGC Both Sertoli cell only in younger mice Delayed fertility
Fgf9 Male Sex-reversal; testicular hypoplasia Not assessed
Fhl5 Spermatozoa Male Oligoteratozoospermia Fertile
Fkbp4 Both None Infertile
Fkbp6 Spermatocytes Male Meiotic Arrest Infertile
Fmr1 Male Macroorchidism Fertile
Fndc3a Spermatids; Spermatozoa Male Azoospermia Infertile
Fos Male None Fertile
Foxa3 Leydig cells; Spermatogonia Male Progressive to Sertoli-cell only Progressive subfertility
Foxp3 Male Hypogonadism Infertile
Fshb Both Decreased testis size Fertile
Fshr Sertoli cells; Spermatozoa Both OAT Fertile
Fus Spermatocytes Male Azoospermia Infertile
180
Gal3st1 Spermatocytes Male Meiotic Arrest Infertile
Gamt Spermatids; Sertoli Cells Male Oligozoospermia Subfertile
Gapdhs Spermatozoa Male Asthenozoospermia Infertile
Gata4 Sertoli Cells ? Oligoasthenozoospermia Age dependant
infertility
Gba2 Sertoli Cells; Spermatozoa Male Globozoospermia Subfertile
Gdf7 Male Infertile
Gdi1 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatozoa
Both Azoospermia Infertile
Gdnf Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Hypospermatogenesis Fertile
Ggt1 Both Hypogonadism Infertile
Gja1 Sertoli,
peritubular, Leydig
and/or interstitial
cells, Spermatogonia
Both Azoospermia Postnatal Lethal
Glp1 Spermatocytes Both Azoospermia Infertile
Gm101 Spermatids; Spermatozoa Male Asthenozoospermia Infertile
Gmcl1 Spermatocytes; Spermatids;
Spermatozoa
Male OAT Variable
infertility/subfertility
Gnpat Spermatocytes Male Azoospermia Infertile
Gnrh1 Both Hypogonadism Infertile
Gnrhr Both Hypogonadism Infertile
Gopc Spermatids Male Globozoospermia Infertile
Gpr64 Male Subfertile
Gpx4 Spermatocytes; Spermatids Both OAT Infertile
Gtsf1 Spermatocytes Male Meiotic Arrest Infertile
H1fnt Spermatids Male OAT Subfertile
H2afx Spermatocytes Male Meiotic Arrest Infertile
H3f3a Spermatocytes Male Reduced fertility and copulatory
behavior
Subfertile
HexB Spermatozoa Both Impaired Fertility Progressive infertility
Hip1 Spermatids Male Azoospermia (Incomplete
penetrance)
Variable infertiltiy
Hmga1 Sertoli, Male Azoospermia Infertile
181
peritubular, Leydig
and/or interstitial
cells
Hmgb2 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Azoospermia Subfertile
Hnf1a Both Hypogonadism Infertile
Hook1 Spermatid Male Teratozoospermia Subfertile
Hormad2 Spermatocytes Male Meiotic Arrest Infertile
Hoxa10 Both Cryptorchidism Progressive infertility
Hoxa11 Both Cryptorchidism Infertile
Hsf1 Spermatocytes Both Meiotic Arrest Infertile
Hsf2 Spermatocytes, Spermatids Both Oligozoospermia Subfertile
Hsp90aa1 Spermatocytes Male Meiotic Arrest Infertile
Hsp90b1 Spermatozoa Male Asthenoteratozoospermia Infertile
Hspa2 Spermatocytes Male Meiotic Arrest Infertile
Hspa4 Spermatocytes Male Oligoasthenozoospermia Infertile
Hspa4l Spermatids; Spermatocytes;
Spermatozoa
Male Oligoasthenozoospermia Variable infertility
Ifnb1 Sertoli cells; Spermatogonia Male Progressive Azoospermia Progressive Infertility
Igf1 Both Hypogonadism Infertile
Il17rb Spermatocytes; Spermatids Both OAT Infertile
Il2rn Spermatozoa Male Teratozoospermia Subfertile
Immp2l Both Subfertile
Ing2 Spermatocytes Male Meiotic Arrest Infertile
Inha Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Gonadal tumours Secondary Infertility
Inpp5b Spermatozoa Male Asthenozoospermia Infertile
Insl3 Both Cryptorchidism Subfertile
Insl5 Spermatozoa Both Asthenozoospermia Subfertile
Insl6 Spermatocytes Male Oligoasthenozoospermia Variable Infertility
182
Ip6k1 Spermatocytes; Spermatids Male Azoospermia Infertile
Jam3 Spermatids Male OAT Infertile
Jund Spermatozoa Male Asthenozoospermia; OAT Variable
Katnal1 Sertoli cells; Spermatids Male Oligozoospermia Infertile
Katnb1 Spermatocytes; Spermatids Male OAT Infertile
Kdm3a Spermatocytes/Spermatids Male Oligozoospermia Infertile
Kiss1 Both Hypogonadism Infertile
Kiss1r Both Hypogonadism Infertile
Kit Spermatogonia Both Sertoli-cell only Infertile
Kitl Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Sertoli cell only Infertile
Klc3 Spermatid ? Oligoasthenozoospermia Reduced Fertility
Klhl10 Spermatid Male OAT Infertile
Knuc1 Spermatozoa Male Asthenozoospermia Infertile
Krt9 Spermatids Male Teratozoospermia Fertile
Ldhc Spermatozoa Male Asthenozoospermia Variable infertility;
subfertility
Lep Both Hypogonadism Infertile
Lepr Both Hypogonadism Infertile
Lfng Both None Subfertile
Lgr4 Male Seminiferous epithelium rupture Infertile
Lhb Leydig cells; Spermatids Both Azoospermia Infertile
Lhcgr Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Azoospermia Infertile
Limk2 Spermatogonia,
Spermatocytes
Male Azoospermia Fertile
Lipe Spermatids Male Oligozoospermia Infertile
Lmna Spermatocytes Male Azoospermia Infertile
Lmtk2 Spermatids Male Azoospermia Infertile
Lrp8 Spermatozoa Male Asthenoteratozoospermia Infertile
Man2a2 Sertoli,
peritubular, Leydig
and/or interstitial
Male Azoospermia Mostly Infertile
183
cells
Mark2 Both Gonadal hypotrophy Variable infertility
Mas1 Sertoli,peritubular, Leydig
and/or interstitial
cells; Spermatocytes
Male Hypospermatogenesis Fertile
Mc4r Male None Fertile
Mcph1 Spermatocytes Both Meiotic Arrest Infertile
Mei1 Spermatocytes Both Meiotic Arrest Infertile
Meig1 Spermatocytes, Spermatids Males Azoospermia Infertile
Mfge8 Spermatozoa Male Impaired Fertility Subfertile
Mlh1 Spermatocytes Both Meiotic Arrest Infertile
Mlh3 Spermatocytes Both Meiotic Arrest Infertile
Mll5 Spermatids Male Azoospermia Infertile
Mmel1 Spermatozoa Male Impaired Fertility Subfertile
Morc1 Spermatocytes Male Meiotic Arrest Infertile
Mov10l1 Spermatocytes Male Meiotic Arrest Infertile
Msh4 Spermatocytes Both Meiotic Arrest Infertile
Msh5 Spermatocytes Both Meiotic Arrest Infertile
Mtap7 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatids
Male Azoospermia Infertile
Mthfr Spermatogonia Male Sertoli cell only Infertile
Mtmr2 Spermatocytes; Spermatids Male Azoospermia Infertile
Mybl1 Spermatocytes Male Meiotic Arrest Infertile
Myh10 Spermatocytes Male Azoospermia Infertile
Nanos2 Spermatogonia Male Azoospermia Infertile
Nanos3 PGC Both Sertoli cell only Infertile
Ncoa1 Both Decreased testis size Fertile
Ncoa6 Both Not examined Subfertile
Nek1 Spermatogonia;
Spermatocytes
Both Testicular hypoplasia; Azoospermia Infertile
Nfe2l2 Spermatogonia,
Spermatocytes, Spermatids,
Spermatozoa
? Progressive to Sertoli Cell Only Progressive Infertility
Nhlh2 Both Hypogonadism Infertile
184
Nkd1 Spermatids Male Oligozoospermia Subfertile
Nmp4 Spermatogonia Male Sertoli-cell only/Focal
spermatogenesis
Variable infertility
Nos1 Both Hypogonadism Infertile
Npc1 Spermatocytes; Spermatozoa Both OAT Infertile
Nphp1 Spermatids Male OAT Infertile
Nphp4 Spermatids; Spermatozoa Male Oligoasthenozoospermia Infertile
Nr0b1 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Abnormal Spermatogenesis Infertile
Nr2c2 Spermatocytes Both Oligozoospermia Subfertile
Nr2f2 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Azoospermia Variable fertility
Nr5a1 PGC Both Gonadal hypoplasia Infertile
Nsun7 Spermatozoa Male Asthenozoospermia Infertile
Nxf2 Spermatogonia;
Spermatocytes; Spermatozoa
Male Variable by strain Variable infertility
Oaz3 Spermatozoa Male Teratozoospermia Infertile
Odf1 Spermatozoa Male Teratozoospermia Infertile
Odf2 Spermatids, Spermatozoa Male Asthenozoospermia Variable fertility
Otx1 Both Hypogonadism Delayed fertility
Otx2 Both Hypogonadism Infertile
Ovol1 Spermatocytes Both Meiotic Arrest Subfertile
P2rx6 Spermatogonia; Spermatozoa Male Oligozoospermia Infertile
Pacrg Spermatids Male Oligozoospermia Infertile
Pafah1b1 Spermatids Male Azoospermia Infertile
Pank2 Spermatids Both Azoospermia Infertile
Parp2 Spermatids Male Azoospermia Subfertile
Pax8 Both Secondary seminiferous epithelium
degeneration
Infertile
Paxip1 Spermatocytes ? Meiotic Arrest Infertile
Pcsk4 Spermatozoa Male Impaired fertility Infertile
Pcyt1b Both Seminiferous tubule degeneration
(progressive)
Subfertile
185
Pdilt Spermatozoa Male Impaired Fertility Infertile
Pdrm9 Spermatocytes Both Meiotic Arrest Infertile
Pebp1 Spermatozoa Male Impaired fertility Subfertile
Pfdn5 Spermatocytes; Spermatids Both Oligozoospermia Infertile
Pgap1 Spermatozoa Male Impaired Fertility Postnatal lethal;
infertile
Pgs1 Spermatozoa; Spermatids Male Asthenozoospermia Infertile
Pick1 Spermatids; Spermatocytes Male Globozoospermia Infertile
Piga Both Oligozoospermia Infertile
Pin1 Spermatogonia Male Progressive to Sertoli Cell Only Progressive infertility
Piwil1 Spermatids; Spermatozoa Male Azoospermia Infertile
Piwil2 Spermatocytes Male Meiotic Arrest Infertile
Piwil4 Spermatocytes Male Meiotic Arrest Infertile
Pla2g4c Spermatozoa Male Asthenozoospermia Subfertile
Plcb1 Spermatozoa Both Impaired Fertility Variable lethality;
infertile
Plcd4 Spermatozoa Male Impaired Fertility Variable Infertility/
Subfertile
Plk4 Spermatogonia Male Patchy germ cell loss Fertile
Pltp Spermatozoa Male Asthenozoospermia Subfertile
Pmis2 Spermatozoa Male Impaired fertility Infertile
Pms2 Spermatocytes Both Teratozoospermia Infertile
Pold4 Spermatozoa Male Asthenozoospermia Infertile
Polg Spermatozoa Both Azoospermia Reduced feriltiy
Pou1f1 Both Hypogonadism Infertile
Ppm1d Spermatids Male Testicular atrophy Subfertile
PPP1cc Spermatids; Spermatocytes;
Sertoli Cells
Male Azoospermia Infertile
Prkaa1 Spermatozoa Both Asthenoteratozoospermia Subfertile
Prkaca Spermatozoa Male Asthenozoospermia Infertile
Prkar1a Spermatids; Spermatozoa Male OAT Subfertile
Prlr Spermatozoa Both Impaired Fertility Variable infertility
Prm1 Spermatids; Spermatozoa Male Asthenoteratozoospermia Infertile
Prm2 Spermatids; Spermatozoa Male Asthenoteratozoospermia Infertile
186
Prnd Spermatids; Spermatozoa Male OAT Infertile
Prop1 Both Hypogonadism Infertile
Psmc3ip Spermatocytes Both Meiotic Arrest Infertile
Psme4 Spermatocytes; Spermatids Male OAT Infertile
Pum1 Spermatocytes ? ` Subfertile
Pvrl2 Spermatids Male Teratozoospermia Infertile
Pxt1 Spermatocytes Male Azoospermia Infertile
Pygo2 Spermatids Male Azoospermia Infertile
Rabl2 Spermatozoa Male Oligoasthenozoospermia Infertile
Rad18 Spermatogonia Male Reduced fertility Progressive subfertility
Rad21l Spermatocytes Both Meiotic Arrest Infertile
Rad23b PGC; spermatogonia Male Sertoli-cell only Infertile
Rad51c Spermatocytes Both Meiotic Arrest Variable infertility
Ranbp1 Spermatids Male Azoospermia Infertile
Rara Spermatocytes Male Azoospermia Infertile
Rarg Male None Infertile
Rasip1 Spermatozoa Male Impaired Fertility Infertile
Rbmxl2 Spermatozoa Male Azoospermia Infertile
Rbp4 Sertoli,
peritubular, Leydig
and/or interstitial
cells, Spermatogonia;
Spermatids
Male Variable Infertile
Rec8 Spermatocytes Both Meiotic Arrest Infertile
Rhox5 Spermatozoa Male OAT Subfertile
Rimbp3 Spermatids Male Teratozoospermia Infertile
Rnf17 Spermatids Male Azoospermia Infertile
Rnf8 Spermatids Male OAT Infertile
Ros1 Spermatozoa Male Asthenozoospermia Infertile
Rxfp1 Spermatocytes Male Azoospermia (variable) Variable infertility
Rxfp2 Male Cryptorchidism Infertile
Rxrb Spermatids; Sertoli Cells Male OAT Infertile
Safb Sertoli,
peritubular, Leydig
and/or interstitial
cells, Spermatogonia;
Spermatids
Both Azoospermia Subfertile
187
Sbf1 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Azoospermia Infertile
Sepp1 Spermatozoa Male Asthenoteratozoospermia Infertile
Sept12 Spermatids; Spermatocytes Male Hypospermatogenesis;
Azoospermia; OAT
Variable infertility
Sept4 Spermatids; Spermatocytes Male Asthenozoospermia Infertile
Serpina5 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Asthenoteratozoospermia Infertile
Serpine2 Male None Subfertile
Sgol2 Spermatocytes Both Meiotic Arrest Infertile
Sh2b1 Spermatozoa;
Sertoli,
peritubular, Leydig
and/or interstitial
cells
Both Oligozoospermia Subfertile
Siah1a Spermatocytes Both Meiotic Arrest Infertile
Sin3a Spermatogonia ? Sertoli-cell only Infertile
Sirt1 Spermatocytes; Spermatids;
Spermatozoa
Male OAT Infertile
Six5 Spermatids Male Azoospermia/oligozoospermia Infertile
Slc12a2 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatids;
Spermatozoa
Male Azoospermia Infertile
Slc19a2 Spermatogonia Male Meiotic block Infertile
Slc25a4 Spermatocytes Male Meiotic Arrest Infertile
Slc4a2 Spermatids Male Azoospermia Infertile
Slc9a10 Spermatozoa Male Asthenozoospermia Infertile
Sly1 Spermatids; Spermatozoa Male Teratozoospermia Subfertile
Smad1 PGC Both Gonadal Hypoplasia Not assessed
Smad5 PGC Both Gonadal Hypoplasia Not assessed
Smc1b Spermatocytes Both Meiotic Arrest Infertile
Smcp Spermatozoa Male Athenozoospermia, Impaired
fertility
Infertile
Smpd1 Sertoli cells; Spermatozoa Male Asthenoteratozoospermia Subfertile
188
Sod1 Spermatozoa Both Impaired Fertility Subfertile
Sohlh1 Spermatogonia Both Azoospermia Infertile
Sohlh2 Spermatogonia Both Sertoli-cell only Infertile
Sox3 Sertoli cells Both Hypogonadism; Variable
Oligozoospermia to Sertoli-cell
only
Subfertile
Sox8 Sertoli,
peritubular, Leydig
and/or interstitial
cells
Male Abnormal Spermatogenesis Variable Subfertility
Spaca1 Spermatids; Spermatozoa Male Globozoospermia Infertile
Spag16 Spermatid Male OAT Infertile
Spag6 Spermatozoa Male Asthenoteratozoospermia Infertile
Spag9 Spermatozoa Male Oligoasthenozoospermia Subfertile
Spam1 Spermatozoa Male Impaired Fertility Subfertile
Spata16
Spata22 Spermatocytes Both Meiotic Arrest Infertile
Spef2 Spermatids Male OAT Infertile
Spem1 Spermatids; Spermatozoa Male Teratozoospermia Infertile
Spo11 Spermatocytes Both Meiotic Arrest Infertile
Sprm1 Spermatozoa Male Impaired Fertility Subfertile
Spz1 Spermatogonia;
Spermatocytes; Spermatids
Male Oligoteratozoospermia Progressive infertility
Star Leydig
and/or interstitial
cells
Both Lipid deposits in interstitial regions Not assessed
Stat3 Both Hypogonadism Infertile
Stk11 Spermatids; Spermatozoa Male OAT Infertile
Stra8 Spermatogonia Both Progressive germ cell depletion Infertile
Strbp Spermatids Male OAT Subfertile
Stx2 Spermatocytes Male Meiotic Arrest Infertile
Styx Spermatids Male OAT Infertile
Sult1e1 Sertoli,
peritubular, Leydig
and/or interstitial
cells; Spermatozoa
Both Oligoasthenozoospermia Progressive Infertility
Sun1 Spermatocytes Both Meiotic Arrest Infertile
Syce3 Spermatocytes Both Meiotic Arrest Infertile
189
Sycp1 Spermatocytes Both Meiotic Arrest Infertile
Sycp2 Spermatogonia,
spermatocytes
Both Meiotic Arrest Infertile
Sycp3 Spermatocytes Both Meiotic Arrest Infertile
Taf4b Spermatogonia Both Sertoli-cell only Progressive infertility
Taf7l Spermatozoa Male OAT Infertile
Taldo1 Spermatozoa Male Asthenozoospermia Infertile
Tas2r105 Spermatids Male Azoospermia Infertile
Tbpl1 Spermatids Male Azoospermia Infertile
Tcf21 (Developmental) Both Gonadal Hypoplasia Infertile
Tcte3 Spermatozoa Male Asthenozoospermia Infertile
Tdrd1 Spermatids Male Azoospermia Infertile
Tdrd6 Spermatids Male Azoospermia Infertile
Tdrd7 Spermatids Male Azoospermia Infertile
Tdrd9 Spermatocytes Male Meiotic Arrest Infertile
Tekt2 Spermatozoa Male Asthenoteratozoospermia Infertile
Tekt3 Spermatozoa Male Asthenozoospermia fertile
Tekt4 Spermatozoa Male Asthenozoospermia Subfertile
Tert Spermatocytes Both Progressive germ cell loss Progressive infertility
Tex11 Spermatocytes Male Azoospermia Infertile
Tex14 Spermatocytes Male Meiotic Arrest Infertile
Tex15 Spermatocytes Male Meiotic Arrest Infertile
Tgfb1 Both Infertile
Theg Spermatids Male Asthenozoospermia Infertile
Thoc1 Spermatocytes Both Oligoasthenozoospermia Infertile
Tial1 PGC Both Sertoli-cell only Infertile
Tmf1 Spermatids; Spermatozoa Male OAT Infertile
Tnp1 Spermatids; Spermatozoa Male Asthenozoospermia Subfertile
Tnp2 Spermatids; Spermatozoa Male Asthenozoospermia Subfertile
Top3b Spermatocytes Both Sperm aneuploidy Progressive infertility
Tpst2 Spermatozoa Male Asthenozoospermia; Impaired
fertility
Infertile
Trip13 Spermatocytes Both Meiotic Arrest Infertile
Trpv6 Male Impaired Fertility Infertile
190
Tsc22d3 Spermatogonia; Sertoli cells Male Sertoli-cell only Infertile
Tsn Spermatozoa Male Progressive Oligozoospermia Fertile
Tssk1/2 Spermatids Male OAT Infertile
Tssk6 Spermatids; Spermatozoa Male Asthenoteratozoospermia Infertile
Ttll1 Spermatids; Spermatozoa Male Asthenoteratozoospermai Infertile
Tyst2 Spermatozoa Male Impaired Fertility Infertile
Ubb Spermatocytes Both Meiotic Arrest Infertile
Ube2b Spermatocytes; Spermatids Male Azoospermia Infertile
Ube3a Spermatozoa Both Hypospermatogenesis; Impaired
Fertility
Subfertile
Ubr2 Spermatocytes Male Meiosis Variable lethality;
infertile
Uchl1 Spermatocytes Both Meiotic Arrest Infertile
Usp2 Spermatids; Spermatozoa Male Impaired Fertility Subfertile
Utp14b Spermatogonia Male Progressive germ cell depletion Progressive infertility
Vdac3 Spermatozoa Male Asthenozoospermia Infertile
Vdr Both Oligoasthenozoospermia Infertile
Vhl Sertoli cells; Spermatogonia;
Spermatocytes; Spermatids
? Oligozoospermia Infertile
Vipr2 Spermatids Male Oligozoospermia Progressive Infertility
Vps54 Sertoli cells; Spermatids;
Spermatozoa
Male Globozoospermia Infertile
Vrk1 Spermatogonia Both Sertoli-Cell only Infertile
Wipf3 Spermatozoa Male Impaired Fertility Infertile
Wnt7a Both Obstructive Azoospermia Infertile
Wt1 Spermatogonia Both Sertoli cell only Infertile
Ybx2 Spermatids Both Azoospermia Infertile
Zbtb16 Spermatogonia Male Progressive germ cell depletion Subfertile
Zfx PGC Both Oligozoospermia Fertile
Zmynd15 Spermatids Male Azoospermia Infertile
Zpbp1 Spermatids; Spermatozoa Male Globozoospermia Infertile
Zpbp2 Spermatids; Spermatozoa Male Globozoospermia Subfertile
191
Appendix A.2: Yeast 3-hybrid screen for substrates of the SH3GLB1T-PPP1CC2 holoenzyme
Introduction
The Yeast 2-hybrid (Y2H) is a commonly applied technique for identifying binary protein
interactions on a large scale(Fields &Song. 1989). Due to its ease of use, and ability to screen large
libraries in a relatively short amount of time the Y2H system has been utilized extensively by many
research groups and has allowed for the identification of thousands of protein interaction pairs. In the
Y2H system, the protein of interest or “bait” is expressed in the yeast S. cerevisiae as a fusion protein
with the GAL4 DNA binding domain (GAL4-BD). Yeast cultures expressing this bait-GAL4-BD fusion
protein are transformed with DNA libraries encoding protein coding sequences fused to the GAL4
trascriptional activation domain (GAL4-AD), otherwise known as “prey”. When the bait protein
interacts with a prey protein from the library, the two GAL4 domains are brought into close contact, and
subsequently are able to stimulate the transcription of a reporter gene. Thus positive interaction clones
can be identified via a selectable marker and the sequence of the prey protein can be determined,
identifying the protein that forms a binary interaction with the bait protein.
Previous studies from the Varmuza lab have utilized the Y2H system to identify two putative
isoform-specific regulatory subunits of PPP1CC2: Spz1 (Hrabchak & Varmuza 2004) and SH3GLB1T
(Endophilin B1t) (Hrabchak et al. 2007). Both of these proteins bind only to the PPP1CC2 isoform, and
the interaction is abolished when the unique 18 amino acid C-terminus of PPP1CC2 is deleted. Spz1 and
SH3GLB1T both contain the “RVxF” motif that is commonly found in PP1 regulatory subunits, and
decrease the activity of PPP1CC2 towards the substrate phosphorylase a in vitro.
SH3GLB1T is a testis specific splice isoform of the Sh3glb1 gene, encoding a protein that lacks
the 10 most C-terminal amino acids of the full-length SH3GLB1 protein (Hrabchak et al. 2007).
SH3GLB1 has been shown to play a role in multiple cellular processes including autophagy, endocytosis,
and apoptosis (reviewed in Takahashi et al., 2009 (Hrabchak et al. 2007, Takahashi et al. 2009)). It has
previously been proposed that premature release of the germ cells from the seminiferous tubules may be
192
a cause of the infertility phenotype observed in Ppp1cc mutant mice (Varmuza &Ling. 2003). Premature
germ cell release could arise from improper recycling of cell-cell junctional complexes via endocytosis
in the seminiferous tubules. Thus it has been hypothesized that disregulation of SH3GLB1T in the
Ppp1cc mutant testis could play a role in this process (Hrabchak et al. 2007)
After identifying PPP1CC2 specific regulatory subunits, the focus shifted to identifying
substrates of PPP1CC2 holoenzymes. In an attempt to identify substrates of the SH3GLB1T-PPP1CC2
holoenzyme, I conducted a yeast 3-hybrid (Y3H) screen of a mouse testis cDNA library. As the Y2H is
only capable of recognizing binary interactions, attempts to identify ternary interactions (regulatory
subunit, catalytic subunit, substrate) necessitated a more advanced technique. The Y3H system is based
on the Y2H system, but includes the addition of an inducible third protein(Fields & Song 1989, Tirode et
al. 1997). This inducible third protein functions to “bridge” interactions between the bait and prey fusion
proteins. To conduct a Y3H screen, a library is first screened with the inducible protein expressed. After
selecting positive colonies the inducible bridge protein is switched off. Colonies that are no longer
positive without the bridge protein are dependent upon all 3 proteins being present, and thus represent a
ternary protein complex. My Y3H screen featured the regulatory subunit SH3GLB1T-GAL4BD, with an
inducible PPP1CC2, and a mouse testis cDNA library was screened for third-party interactors which we
hypothesized would be putative substrates of the SH3GLB1T-PPP1CC2 holoenzyme.
Materials and Methods
Cloning of Yeast 3-hybrid Plasmid
The pBridge™ plasmid (Clontech) was obtained as a gift from Prof. Darrell Desveuax
(University of Toronto, Department of Cell and Systems Biology). pBridge features two multiple
cloning sites (MCS): MCSI, which is immediately downstream of a GAL4-BD sequence, and MCSII
which is downstream of a methionine responsive promoter. First, SH3GLB1T was cloned into MCSI.
The full-length SH3GLB1T CDS obtained via a SmaI and XhoI digestion of the SH3GLB1T-pGADT7
193
plasmid (Hrabchak et al. 2007), followed by gel purification. The SH3GLB1T sequence was then ligated
into the pBridge plasmid that had been digested with SmaI and SalI. Next, PPP1CC2 was cloned into
MCSII of pBridge. The PPP1CC2 CDS was amplified from the pGEM7Zf plasmid carrying the full
length cDNA sequence (Mann et al. 1995, Hrabchak et al. 2007) using the following primers: forward –
TCGGCGGCGCGGCCGCGATG; reverse – GTCACCGCAGGATCCAGAATGTAGCCAAAG. The
resultant PCR product was digested with NotI and BglII and ligated into the SH3GLB1T containing
pBridge plasmid that dad been digested with Eco52I and BamHI. The presence and integrity of the
cloned DNA sequences, as well as the frame of insertion was verified by DNA sequencing.
Yeast 3-Hybrid Screening
The Y3H bait vector containing the SH3GLB1T-GAL4BD and inducible PP1cγ2 were
transformed into the S. cerevisiae strain AH109 via the LiAc protocol described in the Clontech Yeast
Protocols Handbook (2001) and maintained on synthetic dropout media lacking tryptophan (SD-W
). Y3H
screening was conducted using the Mouse Testis Matchmaker cDNA Library (clontech), that had been
previously amplified ((Hrabchak et al. 2007)). Library plasmid DNA was purified using Purelink™
HIPure Plasmid Maxiprep Kit (Invitrogen) and transformed into the bait expressing strain according the
protocol outlined the the Clontech Yeast Protocols Handbook. Transformed yeast were plated on
synthetic dropout media lacking tryptophan, leucine, histidine, and adenine (SD-W-L-H-Ade
) supplemented
with 25 µM 3-Amino-1,2,4-triazole (3-AT). Transformation plates were incubated at 30° C for 5 days,
whereupon positive colonies were replicaplated onto both SD-W-L-H-Ade
supplemented with 2mM 3-AT and
SD-W-L-H-Ade
supplemented with 2mM 3-AT and 2mM Methione (SD-W-L-H-Ade+M
). Replicaplates were then
grown at 30°C for a further 3-5 days.
Western blotting
194
Protein extraction, and SDS-PAGE were conducted using standard protocols. Western blotting
was performed with primary antibodies for SH3GLB1 (anti-Bif-1 Imgenex) and PPP1CC (anti-PPP1CC2
N-19, Santa Cruz Biotechnology) at dilution of 1:1000, and HRP coupled secondary antibodies.
Results and discussion
In an attempt to identify proteins that interact with the SH3GLB1T-PPP1CC2 holoenzyme in the
mouse testis, a Y3H screen was conducted using a mouse testis cDNA library. The bait construct for this
Y3H strain utilized the pBridge backbone and contained both a SH3GLB1T-GAL4BD fusion protein as
mouse PPP1CC2 under the control of the S. cerevisiae MET25 promoter, which is active at a low
methionine concentration and inactive at elevated methionine concentrations. After LiAc mediated
transformation of the bait plasmid into the S. cerevisiae strain AH109, western blotting was used to
verify the expression of both the SH3GLB1T-GAL4BD fusion protein and PPP1CC2 (Figure A.2.1). In
order to optimize the methionine concentration needed to abolish PPP1CC2 expression bait expressing
yeast strains were grown in SD-W
supplemented with methionine concentrations ranging from 0.134 – 1
mM methionine. Western blots for PPP1CC2 from these yeast cultures demonstrated prominent
PPP1CC2 expression until 1 mM methionine where PPP1CC2 expression was not evident (Figure A.2.2).
Three rounds of Y3H screening were conducted, using the SH3GLB1T-GAL4BD + PPP1CC2
bait construct, amounting to an estimated 7 x 106 clones, or 2-fold coverage of the cDNA library. A total
of 71 positive colonies were observed. Upon replicaplating on medium supplemented with 2 mM
methionine to completely abolish PPP1CC2 expression from the bait construct, all 71 colonies survived.
This indicates that none of the interactions were dependent upon the presence of PPP1CC2.
The Y3H method allows for the rapid screening of millions of clones for ternary protein
interactions. We sought to use this approach to identify substrates of the SH3GLB1T-PPP1CC2
holoenzyme. Although 71 positive clones were initially identified, not one was dependent upon the
presence of PPP1CC2. This indicates that the 71 positive clones were likely direct interactors with the
195
Figure A.2.1: Expression of Yeast 3-hybrid bait proteins in yeast. Western blots depicting expression
of SH3GLB1T-GAL4BD (A) and PPP1CC2 (B).
196
197
Figure A.2.2: Methionine regulation of PPP1CC2 expression from pBridge vector in yeast. Western
blot depicting expression of PPP1CC2 in yeast grown in differing methionine concentration. Numerical
values indicated are concentrations in mM.
198
199
SH3GLB1T protein, as well as false positives. Therefore, the Y3H approach described in this chapter
was ineffective in identifying any PPP1CC2 substrates.
There are a number of possible explanations for the failure of this approach. First, yeast based
screening methods are a highly artificial system, despite being regarded as an in vivo approach.
Although we screened a mouse testis cDNA library, and thus were looking at testis proteins, there is no
guarantee that testis proteins expressed in yeast behave the same as testis proteins in their native context.
Post-translational modifications, such as phosphorylation, that occur in the testis may not be present
when a testis protein is expressed in yeast. Thus if a potential PPP1CC2 substrate, was never
phosphorylated to begin with, it is unlikely to interact with a protein phosphatase such as PPP1CC2.
Likewise, PPP1CC2 has been demonstrated to be subject to phosphorylation, which affects its activity
and possibly its binding to other proteins (Huang & Vijayaraghavan 2004). Another limitation of the
Y3H approach at identifying PP1 substrates is due to the transient nature of many PP1-substrate
interactions. While some substrates have been shown to form stable complexes with PP1 catalytic
subunits, others form only weak interactions (Bollen et al. 2010). Finally, while the Y3H system allows
for the expression of one additional protein than the traditional Y2H system, it still falls short of
reproducing larger multi-protein complexes that exist in vivo. It remains a possibility that a PPP1CC2-
SH3GLB1T holoenzyme is a part of a larger complex, and additional proteins are required for substrate
binding. Situations such as this would be missed in our Y3H screen.
In order to address the short comings of the Y3H system in identifying PPP1CC2 substrates, a
more powerful approach is needed. As a result we chose to perform the tandem affinity purification
experiments detailed in chapter 2. Utilizing a TAP-tagged PPP1CC2 to purify interacting proteins direct
from the mouse testis would not suffer from the same shortcomings as Y3H. Because prey proteins
would be expressed in their native tissue, at endogenous levels, they would have the appropriate
expression pattern and post-translational modifications necessary to interact with PPP1CC2. In addition
TAP is not limited to binary, or ternary protein complexes like the Y2H and Y3H systesms. During the
200
course of this research, Takahasi et al., produced a SH3GLB1 knockout mouse (Takahashi et al. 2007).
Loss of SH3GLB1 was found to suppress autophagosome formation, and prolong cell survival under
nutrient starvation conditions, but no impact on male fertility was reported although the testes were not
specifically examined. This likely indicates that a SH3GLB1T-PPP1CC2 holoenzyme does not play a
role in regulation of spermatogenesis. Conversely there remains a possibility that SH3GLB1T-PPP1CC2
plays a minor but not essential role in spermatogenesis, or that functionally redundant proteins exist.
Regardless, future experiments will shift away from examining only SH3GLB1T-PPP1CC2 interacting
proteins, to a more global approach that will seek to identify all PPP1CC2 interacting proteins.
201
Appendix A.3: The effect of Ppp1cc deletion on the localization of candidate substrates HSPA2 and
β-tubulin in mouse spermatogenic cell nuclei.
Author’s Note: A modified version of the experiments described in this section was published as a part
of the following paper: H. Henderson, G. MacLeod, C. Hrabchak and S. Varmuza (2011). New candidate
targets of protein phosphatase-1c-gamma-2 in mouse testis revealed by a differential phosphoproteome
analysis. Int J Androl. 34(4):339-51.
Included in this section are only those experiments that I personally performed. Text for this section was
written by myself, with editing by H. Henderson and S. Varmuza
Introduction
In an attempt to identify candidate substrates of PPP1CC2 in the testis a comparative
phosphoproteome analysis was conducted according to the rationale that substrates will be
hyperphosphorylated in Ppp1cc knockout testes. Ten hyperphosphorylated proteins were identified via
2-dimensional electrophoresis followed by ProQ phosphoprotein staining. Two of these proteins, have
previously been shown to play a role in spermatogenesis: HSPA2 and β-tubulin. HSPA2 is a testis-
specific 70kDa related heat-shock protein, whose deletion leads to spermatogenic arrest at the pachytene
spermatocyte stage, followed by spermatocyte apoptosis (Dix et al. 1996). β-tubulin is the primary
component of the manchette a structure which envelopes the spermatid nucleus and is thought to aid in
nuclear shaping and condensation (Kierszenbaum. 2002). Upon further investigation, both HSPA2 and
β-tubulin were found to co-immunoprecipitate with PPP1CC2 in mouse testis protein lysate.
To further examine the interaction between PPP1CC2 and HSPA2 in the mouse testis I have
examined the effect of deletion of Ppp1cc on HSPA2 and β-tubulin localization in spermatogenic cell
nuclear suspensions.
Materials and Methods
Preparation of Surface-spread nuclear suspensions and Immunohistochemistry
202
Dissected testes were placed in MEM after removal of the tunica albuginea and homogenized
using a razor blade to release germ cells from the seminiferous tubules. The resultant homogenate was
mixed and allowed to settle for several minutes. The developing germ cells were then pelleted by
centrifugation at 2,000 rpm for 2 minutes. Following removal of the supernatant the germ cells were re-
suspended in 25 μL of MEM. 4 μL of germ cell suspension was then surface spread and prepared for
immunohistochemistry as previously (Moens et al. 1987, Moens & Earnshaw 1989, Dobson et al. 1994).
The cell suspension was dropped onto a 0.5% NaCl solution and cells were picked up on glass slides.
Cells were fixed for 3 minutes in a 2% paraformaldehyde solution containing 0.36% SDS followed by 3
additional minutes in 2% paraformaldehyde and 3 one minutes washes in 0.4% Photoflo solution. Slides
were then air-dried. Prior to application of primary antibodies, the slides were incubated for 10 minutes
in PBS + 0.4% Photoflo solution followed by 10 minutes in the same solution with 0.05% Triton-X-100
and 10 minutes in 10% antibody dilution buffer. Incubation with anti-β-Tubulin (1:500) or anti-HSPA2
(1:1000) was carried out overnight at room temperature. Select slides were also incubated with CREST
anti-serum (1:500) to visualize kinetchores and/or anti-COR (1:500) to visualize synaptonemal
complexes. Slides were then washed using the same solutions as prior to primary incubation. Secondary
antibody incubations were all carried out at 1:500 using appropriate combinations of goat and rabbit Cy3
(Jackson), goat anti mouse Cy2, goat anti mouse Cy3, goat anti-human Alexa 488, and goat anti-human
rhodamine at 37 °C for 1 hour. Following secondary antibody incubation slides were washed for 10
minutes each in 0.4% Photoflo in PBS, 0.4% Photoflo plus 0.05% Triton-X-100 in PBS and again in
0.4% Photoflo, followed by 2 one minute washes in 0.4% Photoflo in water. Slides were then
counterstained with DAPI (300nM) for 10 minutes, followed by 4 one minute washes in PBS and
mounted as before. Images were captured and processed as previously described using the appropriate
filters at 100X magnification.
Quantification of β-tubulin abnormalities was performed by scoring 50 randomly chosen
manchettes on slides made from wild-type and Ppp1cc mutant mice as abnormal or normal, based on
203
existing literature on manchette structure (Cherry & Hsu 1984, Russell et al. 1990). Assessment of
abnormalities was done conservatively with any ambiguities being scored as normal, to allow for any
disruptions in manchette structure brought about in slide preparation. Assessment of statistical
significance was performed by a Chi-squared test using a 2x2 contingency table.
Results and discussion
Abnormalities in HSPA2 distribution are present in Ppp1cc mutant germ cell nuclei
To determine if the loss of PPP1CC2 in the testis impaired HSPA2 localization during
spermatogenesis, we performed Immunolocalization studies on surface spread mouse germ cell nuclei.
CREST antibody was included in some experiments as it localizes to the kinetochores, which aids in
staging developing spermatocytes. In wild-type pachytene and diplotene spermatocytes, anti-HSPA2
signal localizes predominantly to the synaptonemal complex, but is also visible in a diffuse cloud
throughout the nucleus (Figure A.3.1A). This localization pattern has been observed previously by
others (Dix et al. 1996). In Ppp1cc mutants, the same cell types display a typically weak HSPA2 signal.
This observation is demonstrated in Figure A.3.1A in which the light intensity in the Ppp1cc mutant
specimen was enhanced to produce a visible signal (note the relative intensities of the CREST signal). In
Ppp1cc mutant spermatocytes HSPA2 was still able to localize to the synaptonemal complex, but
generally lacked or displayed a reduction of the punctate cloud throughout the nucleus (Figure A.3.1A,
arrows). As mentioned previously, deletion of HSPA2 results in a complete meiotic arrest in the
pachytene spermatocyte stage(Dix et al. 1996). Conversely, when Ppp1cc is deleted, germ cells can pass
this stage of development but do display phenotypic effects consistent with defects in meiosis(Varmuza
et al. 1999).
In wild-type elongating spermatid nuclei, HSPA2 displayed a cap-like distribution in the
subacrosomal region that has been previously described (Govin et al. 2006) (Figure A.3.1Bi). This
HSPA2 localization pattern was conserved in some Ppp1cc mutant elongating spermatid nuclei (Figure
A.3.1Bii), while others displayed abnormal localization patterns such as HSPA2 distributed throughout
204
Figure A.3.1: The localization of HSPA2 in developing germ cells. (A) Surface-spread wild-type and
Ppp1cc null spermatocyte nuclei stained for CREST (green) and HSPA2 (red). Arrows indicate the
presence or absence of punctateHSPA2 staining. (B) Surface-spread wild type(i) and Ppp1cc null (ii, iii)
spermatid nuclei stained for DAPI (blue) and HSPA2 (red).
205
206
the nucleus (Figure A.3.1Biii). Generally morphologically normal Ppp1cc mutant elongating spermatid
nuclei displayed wild-type HSPA2 localization, while morphologically abnormal nuclei showed aberrant
localization. As was seen in spermatocytes, HSPA2 localization does not appear to be dependent on the
Ppp1cc gene. However both genes due appear to play a role in re-organization of chromatin in
elongating spermatids(Varmuza et al. 1999, Govin et al. 2006, Forgione et al. 2010)
While HSPA2 localization is impaired in Ppp1cc mutant spermatocytes and spermatids, it’s
localization does not appear to be totally dependent on this gene. This could potentially be due to the
presence of other PP1 isoforms PPP1CA and PPP1CB in the testis. Conversely the localization of
HSPA2 may not be dependent upon its phosphorylation status. While we have demonstrated that HSPA2
is hyperphosphorylated in Ppp1cc mutant testes, direct dephosphorylation of HSPA2 by PPP1CC2 has
not been demonstrated so hyperphosphorylation due to a third-party interaction also remains a
possibility.
The β-tubulin manchette structures are abnormal in Ppp1cc mutant spermatids
To determine if the loss of PPP1CC2 in the testis disrupted β-Tubulin localization in developing
spermatids, surface-spread spermatid nuclei were incubated with anti-β-Tubulin along with DAPI
counterstaining. Analysis of the β-Tubulin containing manchettes from Ppp1cc mutant spermatids
revealed prominent abnormalities when compared to wild-type spermatids and examples from the
existing literature (Table A.3.1). A conservative assessment of manchette abnormalities revealed that
54% of the manchettes examined from Ppp1cc mutant spermatids were abnormal, which is significantly
higher (p < 0.001) than 10% in wild-type spermatids (Figure A.3.2). The β-Tubulin staining pattern in
Ppp1cc mutant spermatid manchettes generally showed an abnormal morphology, and no examples of a
completely developed manchette were observed whereas they were common in wild-type spermatids
(Figure A.3.2iii). Typical abnormalities in Ppp1cc mutant manchettes included incomplete envelopment
of the spermatid nucleus in early elongating spermatids (Figure A.3.2iv), a reduced amount of β-Tubulin
staining (Figure A.3.2v), and mislocalization of the manchette around the spermatid nucleus (Figure
207
A.3.2vi). Abnormalities in Ppp1cc mutant manchettes were accompanied by defects in nuclear
condensation in the developing spermatids (Figure A.3.2iv-vi).
The results of this experiment demonstrate prominent abnormalities in manchette morphogenesis
in Ppp1cc mutant spermatids. This suggests the possibility that misregulation of β-tubulin due to
hyperphosphorylation may be at least partly responsible for the nuclear shaping/condensation defects
found upon deletion of Ppp1cc. However to date, direct dephosphorylation of β-tubulin by PPP1CC2
has yet to be demonstrated, and will need to be confirmed in future experiments. Interestingly, PPP1CC2
has been shown to interact with another protein PPP1R42 that is associated with the manchette in
developing spermatids (Wang & Sperry 2011). The biological role of this interaction remains unknown,
but its existence provides further evidence towards a role of PPP1CC2 in manchette formation.
208
Figure A.3.2: The loss of PPP1CC disrupts manchette formation in the mutant testis.
Immunohistochemistry performed on wild-type (i–iii) and Ppp1cc null (iv–vi) testis cell suspensions
using a b-tubulin antibody (red) and DAPI (blue). Wild-type manchettes initially envelop the nuclei of
elongating spermatids (i,ii) and later form normally developed manchette (iii). Ppp1cc null manchettes
do not properly envelop the nucleus (iv, v) and are poorly formed (vi).
209
210
Appendix A.4 Supplemental Material
Supplemental File A.4.1 Proteins identified via tandem affinity purification
Gene
symbol
Acession
Number
Unique/non
overlap
Spectra
above
threshold
matched
spectra
matched
peptides
#
matched
spectra
>95
Best
MASCOT
protein
score
%
Coverage
PPP1R7 Q3UM45 17 126 37 104 681 61.5
PPP1R8 Q8R3G1 8 20 11 10 110 37.9
PPP1R2 Q9DCL8 5 35 10 21 151 24.3
Wdr82 Q8BFQ4 4 8 5 4 68 16.3
DDOSt O54734 3 3 3 3 56 6.3
PPP1R10 Q80W00 3 5 3 3 43 6.1
PPP1R11 Q8K1L5 2 11 3 6 75 39.7
RRP1B Q91YK2 3 8 4 4 29 6.9
Atp2a2 O55143 2 3 3 2 85 3.8
AtP5C1 Q91VR2 2 2 2 2 41 7.4
LMtK2 Q3TYD6 2 13 5 6 48 4.6
ADAMtS12 Q811B3 1 1 1 1 28 0.6
APOPt1 Q9CQW7 1 1 1 1 17 5.8
ARID5A Q3U108 1 2 2 1 25 3.6
AtRX Q61687 1 1 1 1 23 0.5
BCL11B Q99PV8 1 3 2 2 23 3.6
BRWD1 Q8BPZ1 1 1 1 1 22 0.5
CCDC25 Q78PG9 1 42 2 8 34 10.6
CgN P59242 1 6 3 2 24 2.5
CLCF1 Q9QZM3 1 2 1 2 26 3.6
211
CLIP1 Q922J3 1 1 1 1 21 0.6
CYC1 Q9D0M3 1 1 1 1 24 4.9
DENND5A Q6PAL8 1 2 2 1 20 1.8
SKIDA1 Q80YR3 1 1 1 1 23 1.3
DOCK7 Q7TPP0 1 2 1 2 24 5.1
EgLN1 Q91YE3 1 1 1 1 18 2.5
ELK4 P41158 1 1 1 1 20 2.1
FAM91A1 Q3UVG3 1 8 2 1 20 2.7
FANCL Q9CR14 1 1 1 1 25 2.7
FCHSD2 Q3USJ8 1 1 1 1 24 1.5
FtSJD1 Q8BWQ4 1 3 2 2 19 3.5
gAPDHS Q64467 1 3 2 1 77 5.2
gNB5 P62881 1 1 1 1 20 2.8
HADHA Q8BMS1 1 7 2 1 27 2.8
HES3 Q61657 1 1 1 1 23 5.1
HISt1H1A P43275 1 1 1 1 20 3.3
HISt1H2AF Q8CGP5 1 1 1 1 34 6.9
HKDC1 Q91W97 1 1 1 1 22 0.9
HMBS P22907 1 19 1 4 19 1.9
HOXD1 Q01822 1 2 1 1 25 4.9
HSD3B3 P26150 1 2 2 1 23 4.0
HSPB1 P14602 1 3 3 1 28 20.1
INtS7 Q7TQK1 1 1 1 1 17 1.5
KALRN A2CG49 1 2 2 1 19 0.7
KCNB2 A6H8H5 1 1 1 1 30 1.3
LBR Q3U9G9 1 1 1 1 30 1.8
212
LCP2 Q60787 1 1 1 1 20 1.7
LRP1B Q9JI18 1 3 1 2 30 0.2
MAB21L1 O70299 1 2 2 1 22 7.2
MAgt1 Q9CQY5 1 1 1 1 26 2.4
MOSC2 Q922Q1 1 1 1 1 21 7.1
NDUFA4 Q62425 1 1 1 1 48 12.2
NEFH P19246 1 6 3 2 34 1.6
NES Q6P5H2 1 1 1 1 17 0.6
NOtCH2 O35516 1 1 1 1 17 0.7
PIK3CA P42337 1 4 2 3 45 1.9
PLOD3 Q9R0E1 1 1 1 1 20 0.9
PPP1r42 Q8R1Z4 1 1 1 1 25 2.0
PRR11 Q8BHE0 1 1 1 1 21 3.5
RAB10 P61027 1 3 3 2 53 16.5
RAB12 P35283 1 2 2 1 51 7.8
RAB14 Q91V41 1 2 2 1 51 8.8
RAB35 Q6PHN9 1 6 2 5 80 10.9
RAB8B P61028 1 2 2 1 49 12.1
RAD54B Q6PFE3 1 2 1 1 30 0.9
RPH3AL Q768S4 1 12 1 1 25 2.3
RPS29 P62274 1 1 1 1 23 14.3
SEMA3B Q62177 1 6 2 1 24 2.9
SLC29A1 Q9JIM1 1 1 1 1 43 2.6
Slit3 Q9WVB4 1 2 1 2 24 0.6
Sltm Q8CH25 1 5 1 1 20 1.1
Thsd7a Q69ZU6 1 1 1 1 21 0.4
213
Tial1 P70318 1 2 2 1 21 5.4
Tnn Q80Z71 1 5 2 1 23 2.0
ttC39B Q8BYY4 1 1 1 1 26 1.9
WDR76 A6PWY4 1 3 2 2 17 3.1
214
Supplemental file A.4.2 Peptides identified in LC-MS/MS of ~45KDa gel slice
Gene
Symbol Acession Bait Peptide Sequence
MASCOT
Ion
SCORE
Uqcrc2 Q9DB77
GST-
PPP1CC2 (K)AVAFQNSQTR(I) 43.51
(K)AVAQGNLSSADVQAAK(N) 80.66
(R)GIEAVGGK(L) 33.67
(R)GNNTTSLLSQSVAK(G) 74.08
(R)IIENLHDVAYK(N) 88.11
(K)ITSEELHYFVqNHFTSAR(M) 52.71
(R)LASSLTTK(G) 20
(K)NALANPLYcPDYR(M) 53.5
(R)RWEVAALR(S) 38.63
(K)TSAAPGGVPLQPQDLEFTK(L) 52.79
GST-
PPP1CC1 (K)AVAFQNSQTR(I) 37.96
(K)AVAFQNSQTR(I) 52.51
(K)AVAFQNSqTR(I) 28.87
(K)AVAQGNLSSADVQAAK(N) 80.03
(R)ENMAYTVEGIR(S) 62.92
(R)GNNTTSLLSQSVAK(G) 51.68
(R)IIENLHDVAYK(N) 35.2
(K)ITSEELHYFVqNHFTSAR(M) 51.33
(R)LASSLTTK(G) 35
(K)NALANPLYcPDYR(M) 51.7
(K)QVAEQFLNmR(G) 46.76
215
(R)RWEVAALR(S) 29.13
(K)TSAAPGGVPLQPQDLEFTK(L) 64.68
(R)YEDSNNLGTSHLLR(L) 55.68
Sccpdh Q8R127
GST-
PPP1CC2 (R)EQIASEQSSR(L) 51.72
(K)GGGVFTPGAAFSR(T) 14.62
(K)GGGVFTPGAAFSR(T) 23.36
(K)LQQVLEK(A) 35.34
(K)LVLNcVGPYR(F) 61.15
(R)SVScLKPVPIVGTK(L) 15.51
(R)SVScLKPVPIVGTK(L) 64.18
GST-
PPP1CC1 (R)EQIASEQSSR(L) 28.82
(K)GGGVFTPGAAFSR(T) 23.23
(R)LPWAVAGR(S) 19.68
(K)LQQVLEK(A) 35.04
(K)LVLNcVGPYR(F) 51.33
(R)SVScLKPVPIVGTK(L) 57.47
(R)WPVSYcR(E) 14.71
Tssk1 Q61241
GST-
PPP1CC2 (K)HLTGEcK(D) 17.72
(K)HLTGEcK(D) 31.54
(K)HLTGEcK(D) 26.19
(R)SKHLTGEcK(D) 24.89
GST-
PPP1CC1 (K)APSDFLEK(F) 39.59
(R)DTEEGHPQQPSETHT(-) 53.41
(R)GLSSGAINK(E) 37.62
216
(K)HLTGEcK(D) 46.45
(K)KAPSDFLEK(F) 45.33
(R)QSENVGLSSELNR(D) 71.08
(R)SESKPQEDTLQVVR(Q) 40.16
(R)SKHLTGEcK(D) 28.63
(K)TYEIFETSDGK(V) 40.56
(K)YcHDLDVVHR(D) 35.38
Fads2 Q9Z0R9
GST-
PPP1CC2 (K)HGIEYQEKPLLR(A) 22.43
GST-
PPP1CC2 (K)SIWNHVVHK(F) 33.45
217
Supplemental file A.4.3 TSKS testis phosphopeptide site assignment data
TSKS testis phosphopeptides. ScaffoldPTM Protein Report
#20111006_Graham.sptm, Protein Report created on 12/06/2012
Peptide Sequence Variable Modifications
Localization
Probability Ascore Peptide Score Xtandem:Expect
Mascot:Identity
Threshold
AVsFHGVEPR S3 Phosphorylation 100% 1,000.00 61.98 2.523 38.22
HGLSPATPIQGcSGPPGsPEEPPR S18 Phosphorylation 100% 94.9 141.73 10.08 43.28
HGLSPATPIQGcSGPPGsPEEPPR S18 Phosphorylation 90% 18.8 78.41 2.921 43.22
218
Supplemental file A.4.4 TSKS testis phosphopeptide site assignment charge tables/annotated
spectra
TSKS pS281 Peptide 1
219
TSKS pS281 Peptide 2
220
TSKS pS54
221
Supplemental File A.4.5 3 week testis phosphoproteins of interest
Known and predicted PP1
interacting proteins
Proteins encoded by
genes essential for
male fertility
Proteins with GO Biological Process
"Reproduction" annotation
Proteins identified
in SBP-3XFLAG-
PPP1CC2 tandem
affinity purification
TNS1 ESPL1 AGFG1 DENND5A
MAP1B ACE UBAP2L PPP1R7
HDAC6 DDX25 NIPBL SLTM
SIRT2 RBMXL2 SYCP2 LBR
RB1 SIN3A MAP3K4 PPP1R10
PPP1R7 PRKAR1A AHSG HSPB1
GSK3A SH2B1 EIF2S2 CGN
MKI67 DDX4 MAPK8IP2 DOCK7
MAX CLGN ACSBG1 CCDC25
DDX10 SIRT1 CTNNA1 PPP1R2
PPP1R10 CSTF2T EIF2B5 HIST1H1A
SRSF10 EIF4G3
AMHR
STT3B (VIA
ASSOCIATION
WITH DDOST)
RBM26 SYCP3 SPAG1
WNK1 MYBL1 DDX25
EIF2S2 DMRT1 CLGN
TPRN HMGA1 CSDA
POLR2A CLDN11 H2AFX
PPP1R2 YBX2 XRN2
GNL3 TMF1 DDX4
TRA2B CSDA TDRD1
CD2BP2 RAD18 HORMAD1
222
SLC9A1 HSPA4 HIST1H1T
PHACTR4 AMHR2 BAG6
MRE11A MTMR2 DNMT3A
POLE PANK2 ACE
PHRF1 MYH10 CLDN11
PPP1R3D ADAM2 HIST1H1A
TRIM28 HSP90AA1 SPE39
HSPA4 H2AFX BOLL
MARK2 DMRT1
TDRD1 TYRO3
NEK1 MTL5
AGFG1 NEDD4
CCNE2
ATP2B4
GJA1
TEX14
HSPA4L
UBE3A
SYCP2
223
Supplemental File A.4.6 DAVID GO enrichment analysis of 3 week testis Phosphoproteins
Term Count PValue
Fold
Enrichment
GO:0003723~RNA binding 99 1.4E-29 3.6
GO:0006397~mRNA processing 60 1.9E-27 5.5
GO:0016071~mRNA metabolic process 64 2.8E-27 5.1
GO:0043228~non-membrane-bounded organelle 153 6.3E-24 2.2
GO:0043232~intracellular non-membrane-bounded organelle 153 6.3E-24 2.2
GO:0006396~RNA processing 71 4.5E-23 3.9
GO:0031981~nuclear lumen 95 7.4E-23 3.0
GO:0005694~chromosome 60 1.9E-22 4.5
GO:0008380~RNA splicing 46 4.8E-21 5.5
GO:0030529~ribonucleoprotein complex 62 2.0E-19 3.8
GO:0044427~chromosomal part 51 2.8E-19 4.5
GO:0000166~nucleotide binding 172 3.4E-19 1.9
GO:0043233~organelle lumen 99 2.5E-17 2.4
GO:0031974~membrane-enclosed lumen 101 2.6E-17 2.4
GO:0070013~intracellular organelle lumen 98 6.2E-17 2.4
GO:0005681~spliceosome 29 2.6E-15 6.6
GO:0051276~chromosome organization 56 5.0E-15 3.3
GO:0000785~chromatin 32 1.8E-14 5.4
GO:0006325~chromatin organization 47 7.4E-14 3.6
GO:0005654~nucleoplasm 61 2.3E-13 2.9
GO:0016607~nuclear speck 23 4.6E-13 7.2
GO:0003677~DNA binding 132 3.9E-12 1.8
GO:0016604~nuclear body 27 4.5E-12 5.3
224
GO:0007049~cell cycle 63 5.3E-11 2.5
GO:0000792~heterochromatin 16 1.4E-10 8.8
GO:0032559~adenyl ribonucleotide binding 110 1.8E-10 1.8
GO:0005730~nucleolus 37 3.6E-10 3.3
GO:0005524~ATP binding 107 8.7E-10 1.8
GO:0030554~adenyl nucleotide binding 111 1.6E-09 1.8
GO:0022402~cell cycle process 45 2.0E-09 2.7
GO:0001883~purine nucleoside binding 111 2.6E-09 1.8
GO:0016568~chromatin modification 33 3.4E-09 3.4
GO:0001882~nucleoside binding 111 3.8E-09 1.7
GO:0044451~nucleoplasm part 47 6.6E-09 2.6
GO:0000279~M phase 36 7.3E-09 3.1
GO:0000228~nuclear chromosome 21 8.9E-09 4.9
GO:0006350~transcription 122 1.2E-08 1.7
GO:0000398~nuclear mRNA splicing, via spliceosome 13 1.7E-08 8.4
GO:0000375~RNA splicing, via transesterification reactions 13 1.7E-08 8.4
GO:0000377~RNA splicing, via transesterification reactions with
bulged adenosine as nucleophile 13 1.7E-08 8.4
GO:0003682~chromatin binding 25 1.7E-08 3.9
GO:0032553~ribonucleotide binding 120 3.1E-08 1.6
GO:0032555~purine ribonucleotide binding 120 3.1E-08 1.6
GO:0022403~cell cycle phase 38 3.3E-08 2.8
GO:0045449~regulation of transcription 142 6.7E-08 1.5
GO:0006333~chromatin assembly or disassembly 20 1.0E-07 4.4
GO:0044454~nuclear chromosome part 18 1.2E-07 4.9
GO:0017076~purine nucleotide binding 121 1.6E-07 1.6
225
GO:0000793~condensed chromosome 18 2.1E-07 4.7
GO:0051301~cell division 33 2.3E-07 2.8
GO:0008134~transcription factor binding 33 2.7E-07 2.8
GO:0016569~covalent chromatin modification 17 2.0E-06 4.3
GO:0006259~DNA metabolic process 40 2.4E-06 2.3
GO:0051321~meiotic cell cycle 16 4.1E-06 4.3
GO:0004386~helicase activity 19 4.9E-06 3.6
GO:0004674~protein serine/threonine kinase activity 38 9.8E-06 2.2
GO:0051327~M phase of meiotic cell cycle 15 1.5E-05 4.1
GO:0007126~meiosis 15 1.5E-05 4.1
GO:0016567~protein ubiquitination 13 1.5E-05 4.7
GO:0006323~DNA packaging 16 1.7E-05 3.8
GO:0000790~nuclear chromatin 11 2.0E-05 5.6
GO:0032446~protein modification by small protein conjugation 14 2.0E-05 4.3
GO:0006511~ubiquitin-dependent protein catabolic process 19 2.2E-05 3.2
GO:0005720~nuclear heterochromatin 9 2.4E-05 7.2
GO:0016570~histone modification 15 2.5E-05 3.9
GO:0006468~protein amino acid phosphorylation 50 2.6E-05 1.9
GO:0040029~regulation of gene expression, epigenetic 13 2.8E-05 4.5
GO:0000278~mitotic cell cycle 26 3.0E-05 2.6
GO:0034621~cellular macromolecular complex subunit
organization 26 3.2E-05 2.5
GO:0000280~nuclear division 22 4.3E-05 2.8
GO:0007067~mitosis 22 4.3E-05 2.8
GO:0016585~chromatin remodeling complex 10 5.8E-05 5.6
GO:0000087~M phase of mitotic cell cycle 22 5.8E-05 2.7
226
GO:0001739~sex chromatin 7 6.8E-05 9.3
GO:0048285~organelle fission 22 7.3E-05 2.7
GO:0010605~negative regulation of macromolecule metabolic
process 41 7.3E-05 1.9
GO:0006476~protein amino acid deacetylation 7 8.6E-05 8.8
GO:0008092~cytoskeletal protein binding 35 8.7E-05 2.1
GO:0000803~sex chromosome 7 9.0E-05 8.9
GO:0005856~cytoskeleton 65 9.7E-05 1.6
GO:0070647~protein modification by small protein conjugation or
removal 15 9.9E-05 3.5
GO:0016458~gene silencing 11 1.1E-04 4.6
GO:0051603~proteolysis involved in cellular protein catabolic
process 42 1.1E-04 1.9
GO:0004672~protein kinase activity 44 1.3E-04 1.8
GO:0044257~cellular protein catabolic process 42 1.3E-04 1.9
GO:0044265~cellular macromolecule catabolic process 46 1.3E-04 1.8
GO:0003779~actin binding 27 1.3E-04 2.3
GO:0010608~posttranscriptional regulation of gene expression 18 1.4E-04 2.9
GO:0019941~modification-dependent protein catabolic process 40 1.7E-04 1.9
GO:0043632~modification-dependent macromolecule catabolic
process 40 1.7E-04 1.9
GO:0033554~cellular response to stress 34 1.7E-04 2.0
GO:0008135~translation factor activity, nucleic acid binding 14 1.7E-04 3.5
GO:0030695~GTPase regulator activity 31 1.8E-04 2.1
GO:0016310~phosphorylation 51 2.3E-04 1.7
GO:0060589~nucleoside-triphosphatase regulator activity 31 2.4E-04 2.1
GO:0006417~regulation of translation 14 2.5E-04 3.4
227
GO:0031497~chromatin assembly 12 2.5E-04 3.8
GO:0030163~protein catabolic process 42 2.6E-04 1.8
GO:0034622~cellular macromolecular complex assembly 22 2.8E-04 2.4
GO:0034728~nucleosome organization 12 2.9E-04 3.8
GO:0065004~protein-DNA complex assembly 12 2.9E-04 3.8
GO:0034399~nuclear periphery 9 3.0E-04 5.1
GO:0003729~mRNA binding 10 3.1E-04 4.5
GO:0005096~GTPase activator activity 20 3.3E-04 2.5
GO:0006974~response to DNA damage stimulus 26 4.0E-04 2.2
GO:0003712~transcription cofactor activity 19 4.2E-04 2.6
GO:0001741~XY body 5 4.3E-04 12.7
GO:0006270~DNA replication initiation 5 5.1E-04 12.0
GO:0016887~ATPase activity 25 5.3E-04 2.2
GO:0000775~chromosome, centromeric region 13 5.8E-04 3.3
GO:0004221~ubiquitin thiolesterase activity 11 5.8E-04 3.8
GO:0009057~macromolecule catabolic process 46 6.1E-04 1.7
GO:0031252~cell leading edge 13 6.3E-04 3.3
GO:0000794~condensed nuclear chromosome 8 6.3E-04 5.3
GO:0016363~nuclear matrix 8 6.3E-04 5.3
GO:0043933~macromolecular complex subunit organization 30 7.1E-04 2.0
GO:0042162~telomeric DNA binding 5 7.2E-04 11.1
GO:0015630~microtubule cytoskeleton 31 7.2E-04 1.9
GO:0070035~purine NTP-dependent helicase activity 12 7.3E-04 3.4
GO:0008026~ATP-dependent helicase activity 12 7.3E-04 3.4
GO:0051015~actin filament binding 9 7.6E-04 4.5
228
GO:0016575~histone deacetylation 5 7.7E-04 10.9
GO:0051493~regulation of cytoskeleton organization 13 8.1E-04 3.2
GO:0006334~nucleosome assembly 11 8.4E-04 3.6
GO:0003743~translation initiation factor activity 10 8.7E-04 3.9
GO:0006281~DNA repair 21 9.7E-04 2.3
GO:0048232~male gamete generation 23 9.9E-04 2.2
GO:0007283~spermatogenesis 23 9.9E-04 2.2
GO:0006793~phosphorus metabolic process 56 1.1E-03 1.6
GO:0006796~phosphate metabolic process 56 1.1E-03 1.6
GO:0006342~chromatin silencing 6 1.1E-03 7.2
GO:0048471~perinuclear region of cytoplasm 17 1.2E-03 2.5
GO:0045934~negative regulation of nucleobase, nucleoside,
nucleotide and nucleic acid metabolic process 31 1.2E-03 1.9
GO:0000151~ubiquitin ligase complex 9 1.2E-03 4.2
GO:0031202~RNA splicing factor activity, transesterification
mechanism 4 1.2E-03 16.3
GO:0005911~cell-cell junction 16 1.3E-03 2.6
GO:0010558~negative regulation of macromolecule biosynthetic
process 32 1.3E-03 1.8
GO:0008047~enzyme activator activity 22 1.4E-03 2.2
GO:0051172~negative regulation of nitrogen compound metabolic
process 31 1.4E-03 1.9
GO:0032259~methylation 11 1.6E-03 3.3
GO:0030027~lamellipodium 9 1.7E-03 4.0
GO:0022613~ribonucleoprotein complex biogenesis 15 1.7E-03 2.6
GO:0005938~cell cortex 13 1.8E-03 2.9
GO:0045814~negative regulation of gene expression, epigenetic 6 1.8E-03 6.5
229
GO:0043244~regulation of protein complex disassembly 8 1.8E-03 4.5
GO:0065003~macromolecular complex assembly 27 1.9E-03 1.9
GO:0010629~negative regulation of gene expression 31 1.9E-03 1.8
GO:0031327~negative regulation of cellular biosynthetic process 32 2.1E-03 1.8
GO:0003730~mRNA 3'-UTR binding 4 2.1E-03 14.0
GO:0046907~intracellular transport 32 2.1E-03 1.8
GO:0006306~DNA methylation 6 2.2E-03 6.3
GO:0006305~DNA alkylation 6 2.2E-03 6.3
GO:0019904~protein domain specific binding 18 2.3E-03 2.3
GO:0043021~ribonucleoprotein binding 7 2.3E-03 5.0
GO:0009890~negative regulation of biosynthetic process 32 2.4E-03 1.8
GO:0005516~calmodulin binding 13 2.4E-03 2.8
GO:0007010~cytoskeleton organization 26 2.4E-03 1.9
GO:0022618~ribonucleoprotein complex assembly 7 2.5E-03 4.9
GO:0003713~transcription coactivator activity 12 2.5E-03 2.9
GO:0016564~transcription repressor activity 19 2.6E-03 2.2
GO:0043414~biopolymer methylation 10 2.6E-03 3.4
GO:0019887~protein kinase regulator activity 9 2.6E-03 3.7
GO:0006304~DNA modification 6 2.7E-03 6.0
GO:0019899~enzyme binding 20 2.7E-03 2.1
GO:0030029~actin filament-based process 17 2.8E-03 2.3
GO:0000245~spliceosome assembly 5 2.8E-03 8.0
GO:0033558~protein deacetylase activity 5 3.4E-03 7.6
GO:0004407~histone deacetylase activity 5 3.4E-03 7.6
GO:0051494~negative regulation of cytoskeleton organization 8 3.5E-03 4.0
230
GO:0031111~negative regulation of microtubule polymerization or
depolymerization 5 3.6E-03 7.5
GO:0030036~actin cytoskeleton organization 16 3.7E-03 2.3
GO:0001701~in utero embryonic development 22 3.9E-03 2.0
GO:0009628~response to abiotic stimulus 21 4.1E-03 2.0
GO:0070161~anchoring junction 12 4.4E-03 2.7
GO:0005913~cell-cell adherens junction 6 4.4E-03 5.4
GO:0005912~adherens junction 11 4.5E-03 2.9
GO:0007059~chromosome segregation 9 4.8E-03 3.4
GO:0030911~TPR domain binding 3 4.9E-03 24.4
GO:0000795~synaptonemal complex 5 4.9E-03 7.0
GO:0033043~regulation of organelle organization 15 4.9E-03 2.3
GO:0016574~histone ubiquitination 4 5.0E-03 10.7
GO:0050684~regulation of mRNA processing 4 5.0E-03 10.7
GO:0016584~nucleosome positioning 3 5.0E-03 24.0
GO:0019787~small conjugating protein ligase activity 13 5.1E-03 2.5
GO:0051253~negative regulation of RNA metabolic process 24 5.4E-03 1.9
GO:0030054~cell junction 29 5.4E-03 1.7
GO:0032318~regulation of Ras GTPase activity 10 5.8E-03 3.0
GO:0000776~kinetochore 8 6.3E-03 3.6
GO:0000786~nucleosome 8 6.3E-03 3.6
GO:0006913~nucleocytoplasmic transport 11 6.5E-03 2.8
GO:0019213~deacetylase activity 5 6.6E-03 6.4
GO:0016481~negative regulation of transcription 27 6.9E-03 1.7
GO:0043484~regulation of RNA splicing 4 6.9E-03 9.6
GO:0043073~germ cell nucleus 5 7.0E-03 6.4
231
GO:0009898~internal side of plasma membrane 20 7.0E-03 2.0
GO:0051169~nuclear transport 11 7.5E-03 2.7
GO:0051082~unfolded protein binding 9 7.5E-03 3.1
GO:0005852~eukaryotic translation initiation factor 3 complex 4 7.7E-03 9.3
GO:0016881~acid-amino acid ligase activity 15 8.2E-03 2.2
GO:0005768~endosome 18 8.8E-03 2.0
GO:0006730~one-carbon metabolic process 12 9.4E-03 2.5
GO:0019207~kinase regulator activity 9 9.6E-03 3.0
GO:0043009~chordate embryonic development 29 9.8E-03 1.7
GO:0004842~ubiquitin-protein ligase activity 11 1.0E-02 2.6
GO:0003697~single-stranded DNA binding 6 1.0E-02 4.4
GO:0006260~DNA replication 14 1.1E-02 2.2
GO:0009792~embryonic development ending in birth or egg
hatching 29 1.1E-02 1.6
GO:0003774~motor activity 13 1.1E-02 2.3
GO:0044430~cytoskeletal part 41 1.1E-02 1.5
GO:0003725~double-stranded RNA binding 6 1.2E-02 4.3
GO:0000791~euchromatin 3 1.2E-02 16.8
GO:0031532~actin cytoskeleton reorganization 4 1.2E-02 8.0
GO:0017148~negative regulation of translation 5 1.2E-02 5.5
GO:0016323~basolateral plasma membrane 12 1.2E-02 2.4
GO:0005874~microtubule 17 1.2E-02 2.0
GO:0043566~structure-specific DNA binding 9 1.2E-02 2.9
GO:0051656~establishment of organelle localization 6 1.3E-02 4.2
GO:0016790~thiolester hydrolase activity 11 1.3E-02 2.5
GO:0016879~ligase activity, forming carbon-nitrogen bonds 16 1.3E-02 2.0
232
GO:0032268~regulation of cellular protein metabolic process 21 1.3E-02 1.8
GO:0010639~negative regulation of organelle organization 8 1.4E-02 3.1
GO:0043242~negative regulation of protein complex disassembly 6 1.4E-02 4.1
GO:0015629~actin cytoskeleton 15 1.5E-02 2.1
GO:0043087~regulation of GTPase activity 10 1.5E-02 2.6
GO:0051129~negative regulation of cellular component
organization 10 1.5E-02 2.6
GO:0042393~histone binding 5 1.5E-02 5.1
GO:0070507~regulation of microtubule cytoskeleton organization 6 1.6E-02 4.0
GO:0005099~Ras GTPase activator activity 8 1.6E-02 3.0
GO:0032993~protein-DNA complex 8 1.7E-02 3.0
GO:0001939~female pronucleus 3 1.7E-02 14.0
GO:0030528~transcription regulator activity 65 1.8E-02 1.3
GO:0019898~extrinsic to membrane 27 1.8E-02 1.6
GO:0045892~negative regulation of transcription, DNA-
dependent 22 1.8E-02 1.7
GO:0031114~regulation of microtubule depolymerization 4 1.8E-02 6.9
GO:0007026~negative regulation of microtubule depolymerization 4 1.8E-02 6.9
GO:0019953~sexual reproduction 26 1.9E-02 1.6
GO:0050657~nucleic acid transport 8 1.9E-02 2.9
GO:0051236~establishment of RNA localization 8 1.9E-02 2.9
GO:0050658~RNA transport 8 1.9E-02 2.9
GO:0007548~sex differentiation 12 2.0E-02 2.2
GO:0016563~transcription activator activity 19 2.0E-02 1.8
GO:0007276~gamete generation 23 2.1E-02 1.7
GO:0042623~ATPase activity, coupled 17 2.1E-02 1.9
233
GO:0005083~small GTPase regulator activity 17 2.1E-02 1.9
GO:0006403~RNA localization 8 2.1E-02 2.9
GO:0030898~actin-dependent ATPase activity 3 2.2E-02 12.2
GO:0070567~cytidylyltransferase activity 3 2.2E-02 12.2
GO:0003724~RNA helicase activity 3 2.2E-02 12.2
GO:0048024~regulation of nuclear mRNA splicing, via
spliceosome 3 2.3E-02 12.0
GO:0005721~centromeric heterochromatin 3 2.4E-02 12.0
GO:0000800~lateral element 3 2.4E-02 12.0
GO:0051640~organelle localization 7 2.4E-02 3.1
GO:0051168~nuclear export 5 2.4E-02 4.4
GO:0045120~pronucleus 4 2.5E-02 6.2
GO:0001673~male germ cell nucleus 4 2.5E-02 6.2
GO:0050839~cell adhesion molecule binding 4 2.6E-02 6.1
GO:0000118~histone deacetylase complex 5 2.6E-02 4.4
GO:0003006~reproductive developmental process 19 2.7E-02 1.7
GO:0031110~regulation of microtubule polymerization or
depolymerization 5 2.7E-02 4.3
GO:0007017~microtubule-based process 16 3.0E-02 1.8
GO:0005952~cAMP-dependent protein kinase complex 3 3.1E-02 10.5
GO:0043624~cellular protein complex disassembly 4 3.1E-02 5.6
GO:0043241~protein complex disassembly 4 3.1E-02 5.6
GO:0000209~protein polyubiquitination 4 3.1E-02 5.6
GO:0016079~synaptic vesicle exocytosis 4 3.1E-02 5.6
GO:0045947~negative regulation of translational initiation 3 3.2E-02 10.3
GO:0015931~nucleobase, nucleoside, nucleotide and nucleic acid
transport 8 3.4E-02 2.6
234
GO:0048609~reproductive process in a multicellular organism 26 3.6E-02 1.5
GO:0032504~multicellular organism reproduction 26 3.6E-02 1.5
GO:0009314~response to radiation 12 3.6E-02 2.0
GO:0005829~cytosol 29 3.6E-02 1.5
GO:0042995~cell projection 30 3.7E-02 1.5
GO:0032886~regulation of microtubule-based process 6 3.8E-02 3.2
GO:0007163~establishment or maintenance of cell polarity 5 3.8E-02 3.9
GO:0000777~condensed chromosome kinetochore 6 4.0E-02 3.2
GO:0031369~translation initiation factor binding 3 4.0E-02 9.2
GO:0001839~neural plate morphogenesis 3 4.1E-02 9.0
GO:0008360~regulation of cell shape 6 4.5E-02 3.1
GO:0031988~membrane-bounded vesicle 23 4.6E-02 1.5
GO:0016208~AMP binding 4 4.6E-02 4.9
GO:0001725~stress fiber 4 4.7E-02 4.9
GO:0016581~NuRD complex 3 4.7E-02 8.4
GO:0031982~vesicle 27 4.9E-02 1.5
235
Supplemental File A.4.7 Peptides identified via preliminary semi-quantitative analysis as more
abundant in Ppp1cc knockout testes.
Gene Name Method Gene Name Method
Abcf1 Spectral Counting Fip1l1 Spectral Counting
Acin1 MS/MS XIC, Spectral Counting Fn1 Spectral Counting
Acss2 Spectral Counting Fxr2 Spectral Counting
Adam2 Spectral Counting Fyttd1 Spectral Counting
Add1 MS/MS XIC Gapvd1 MS/MS XIC
Aebp2 Spectral Counting Gatad2a Spectral Counting
Agfg1 Spectral Counting Gbf1 Spectral Counting
Ahsg Spectral Counting Gm14569 MS/MS XIC
Akap12 MS/MS XIC Gtpbp1 Spectral Counting
Api5 Spectral Counting Hdac1 Spectral Counting
Arhgap12 Spectral Counting Hdac2 Spectral Counting
Arhgef11 Spectral Counting Hdgf MS/MS XIC
Basp1 MS/MS XIC Hectd1 MS/MS XIC
Baz1b Spectral Counting Hist1h1b Spectral Counting
Bclaf1 Spectral Counting Hmga1 Spectral Counting
Bysl Spectral Counting Hmgn1 MS/MS XIC
Canx Spectral Counting Hnrnpu MS/MS XIC, Spectral Counting
Ccdc6 Spectral Counting Hsf5 Spectral Counting
Ccne2 Spectral Counting Hspa4 Spectral Counting
Ccnk Spectral Counting Htatsf1 Spectral Counting
Cdk12 Spectral Counting Igfn1 Spectral Counting
Cenpv Spectral Counting Ivns1abp Spectral Counting
Clgn Spectral Counting Jcad Spectral Counting
Cnot2 Spectral Counting Kat7 Spectral Counting
Csda Spectral Counting Kdm1a Spectral Counting
Cttn Spectral Counting Kri1 Spectral Counting
D11Wsu99e Spectral Counting Larp1 MS/MS XIC, Spectral Counting
Dcaf6 Spectral Counting Larp7 Spectral Counting
Dgkq Spectral Counting Lsm14a MS/MS XIC
Dhx9 Spectral Counting Luc7l3 Spectral Counting
Dido1 Spectral Counting Mageb10-ps Spectral Counting
Dstn Spectral Counting Mageb4 Spectral Counting
Eif3b Spectral Counting Map1b Spectral Counting
Eif4b Spectral Counting Map4k4 Spectral Counting
Eif4ebp2 Spectral Counting Max Spectral Counting
Eif4g3 MS/MS XIC Mdc1 Spectral Counting
Ensa Spectral Counting Mdn1 Spectral Counting
Enthd1 MS/MS XIC, Spectral Counting Mettl16 Spectral Counting
Esf1 Spectral Counting Mfap1 Spectral Counting
Espl1 MS/MS XIC, Spectral Counting Myh11 Spectral Counting
Espn Spectral Counting Naa30 Spectral Counting
Evl MS/MS XIC Ncl Spectral Counting
Fam122a Spectral Counting Nfatc2ip Spectral Counting
Fam134a Spectral Counting Nipbl Spectral Counting
236
Fam54b Spectral Counting Nkapl Spectral Counting
Fcho2 MS/MS XIC Nmd3 Spectral Counting
237
Gene Name Method Gene Name Method
Nol8 Spectral Counting Srsf11 Spectral Counting
Nop56 MS/MS XIC Ssr1 Spectral Counting
Nop58 Spectral Counting Supt6h Spectral Counting
Npm1 MS/MS XIC Sycp2 MS/MS XIC, Spectral Counting
Nvl Spectral Counting Sycp3 Spectral Counting
Pcm1 Spectral Counting Taok3 Spectral Counting
Pcyt1a Spectral Counting Tbc1d4 MS/MS XIC
Pdap1 Spectral Counting Tcp11l2 Spectral Counting
Phf8 MS/MS XIC Tdrd1 Spectral Counting
Ppil4 MS/MS XIC Thrap3 Spectral Counting
Prpf31 Spectral Counting Thumpd1 Spectral Counting
Prpf38a MS/MS XIC Tjp1 Spectral Counting
Psip1 Spectral Counting Tnik Spectral Counting
Ptges3 Spectral Counting Top2b Spectral Counting
Ptpdc1 MS/MS XIC Tp53bp1 Spectral Counting
Pvr Spectral Counting Trappc12 Spectral Counting
Rab11fip1 Spectral Counting Trip12 Spectral Counting
Rad18 Spectral Counting Trmt10a MS/MS XIC
Ralgps2 Spectral Counting Trp53bp1 Spectral Counting
Raly MS/MS XIC, Spectral Counting Ttc15 Spectral Counting
Ranbp2 Spectral Counting Uba2 MS/MS XIC
Ranbp3 MS/MS XIC Ubap2l Spectral Counting
Rbm14 MS/MS XIC Unc119 Spectral Counting
Rcor3 Spectral Counting Usp9x Spectral Counting
Rhox8 Spectral Counting Vcp MS/MS XIC
Rnf20 MS/MS XIC Xrn2 Spectral Counting
Saal1 Spectral Counting Zc3h13 Spectral Counting
Scaf1 Spectral Counting Zc3hc1 Spectral Counting
Scaf8 Spectral Counting Zfp91 Spectral Counting
Scrib Spectral Counting Znf830 Spectral Counting
Sec31a Spectral Counting Setx Spectral Counting Sf1 Spectral Counting Sf3b1 Spectral Counting Sfr1 Spectral Counting Sgk3 Spectral Counting Sltm Spectral Counting Slx4 MS/MS XIC Smarca5 Spectral Counting Smarcc1 Spectral Counting Smarcc2 Spectral Counting Spice1 Spectral Counting Srp72 MS/MS XIC
238
Supplemental File A.4.8- Quantitative comparison of XIC peak areas of Ppp1cc
hyperphosphorylated peptides assigned to indicated proteins
239
Appendix Reference List
Bollen M, Peti W, Ragusa MJ & Beullens M 2010 The extended PP1 toolkit: designed to create
specificity. Trends in biochemical sciences 35 450-458.
Cherry L &Hsu TC 1984 Antitubulin immunofluorescence studies of spermatogenesis in the mouse.
Chromosoma 90 265-274.
Dix DJ, Allen JW, Collins BW, Mori C, Nakamura N, Poorman-Allen P, Goulding EH & Eddy EM
1996 Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male
infertility. Proceedings of the National Academy of Sciences 93 3264-3268.
Dobson MJ, Pearlman RE, Karaiskakis A, Spyropoulos B & Moens PB 1994 Synaptonemal complex
proteins: occurrence, epitope mapping and chromosome disjunction. Journal of cell science 107 2749-
2760.
Fields S &Song O 1989 A novel genetic system to detect protein–protein interactions. Nature 340 245-
246.
Forgione N, Vogl AW & Varmuza S 2010 Loss of protein phosphatase 1c{gamma} (PPP1CC) leads to
impaired spermatogenesis associated with defects in chromatin condensation and acrosome development:
an ultrastructural analysis. Reproduction 139 1021-1029.
Govin J, Caron C, Escoffier E, Ferro M, Kuhn L, Rousseaux S, Eddy EM, Garin J & Khochbin S
2006 Post-meiotic Shifts in HSPA2/HSP70.2 Chaperone Activity during Mouse Spermatogenesis.
Journal of Biological Chemistry 281 37888-37892.
Hrabchak C &Varmuza S 2004 Identification of the spermatogenic zip protein Spz1 as a putative
protein phosphatase-1 (PP1) regulatory protein that specifically binds the PP1cgamma2 splice variant in
the mouse testis. Journal of Biological Chemistry 279 37079-37086.
Hrabchak C, Henderson H & Varmuza S 2007 A Testis Specific Isoform of Endophilin B1,
Endophilin B1t, Interacts Specifically with Protein Phosphatase-1cgamma2 in Mouse Testis and Is
Abnormally Expressed in PP1cgamma Null Mice. Biochemistry 46 4635-4644.
Huang Z &Vijayaraghavan S 2004 Increased Phosphorylation of a Distinct Subcellular Pool of Protein
Phosphatase, PP1γ2, During Epididymal Sperm Maturation. Biology of reproduction 70 439-447.
Kierszenbaum AL 2002 Intramanchette transport (IMT): Managing the making of the spermatid head,
centrosome, and tail. Molecular reproduction and development 63 1-4.
Kuzmin A, Jarvi K, Lo K, Spencer L, Chow GYC, Macleod G, Wang Q & Varmuza S 2009
Identification of Potentially Damaging Amino Acid Substitutions Leading to Human Male Infertility.
Biology of reproduction 81 319-326.
240
Mann M, Latham K, E. & Varmuza S 1995 Identification of Genes Showing Altered Expression in
Preimplantation and Early Postimplantation Parthenogenetic Embryos. Developmental Genetics 17 223-
232.
Matzuk MM &Lamb DJ 2008 The biology of infertility: research advances and clinical challenges.
Nature medicine 14 1197-1213.
Moens PB, Heyting C, Dietrich AJ, van Raamsdonk W & Chen Q 1987 Synaptonemal complex
antigen location and conservation. The Journal of cell biology 105 93-103.
Moens P &Earnshaw W 1989 Anti-topoisomerase II recognizes meiotic chromosome cores.
Chromosoma 98 317-322.
Russell LD, Ettlin RA, Sinha Hikim AP & Clegg EG 1990 Histological and Histopathological
Evaluation of the Testis. 286.
Takahashi Y, Meyerkord CL & Wang H 2009 Bif-1/Endophilin B1: a candidate for crescent driving
force in autophagy. Cell death and differentiation 16 947-955.
Takahashi Y, Coppola D, Matsushita N, Cualing HD, Sun M, Sato Y, Liang C, Jung JU, Cheng JQ,
Mul JJ, Pledger WJ & Wang H 2007 Bif-1 interacts with Beclin 1 through UVRAG and regulates
autophagy and tumorigenesis. Nature cell biology 9 1142-1151.
Tirode F, Malaguti C, Romero F, Attar R, Camonis J & Egly JM 1997 A Conditionally Expressed
Third Partner Stabilizes or Prevents the Formation of a Transcriptional Activator in a Three-hybrid
System. Journal of Biological Chemistry 272 22995-22999.
Varmuza S, Jurisicova A, Okano K, Hudson J, Boekelheide K & Shipp EB 1999 Spermiogenesis Is
Impaired in Mice Bearing a Targeted Mutation in the Protein Phosphatase 1cγ Gene. Developmental
biology 205 98-110.
Varmuza S &Ling L 2003 Increased recombination frequency showing evidence of loss of interference
is associated with abnormal testicular histopathology. Molecular reproduction and development 64 499-
506.
Wang R &Sperry AO 2011 PP1 Forms an Active Complex with TLRR (lrrc67), a Putative PP1
Regulatory Subunit, during the Early Stages of Spermiogenesis in Mice. PLoS ONE 6 e21767.
top related