genetics biology i. chromosomes chromatid centromere ↓
Post on 03-Jan-2016
244 Views
Preview:
TRANSCRIPT
Genetics
Biology I
Chromosomes
Chromatid
Chromatid
Centromere↓
database of genes that are on each chromosome (hax1, fuca1)
Karyotype – spread of human chromosomes to look for chromosomal abnormalities
OROR
Chromosome Terminology Homologous Chromosomes – paired
chromosomes – same size, same banding pattern, same type of genes but not necessarily the exact same forms of each gene Example – gene on one chromosome for
brown eyes and gene on its homologue for blue eyes
GGGTCAGTCATTTTAAGAGATC
GGGAAAGTCATTTTAAGAGATC
Remember – Sister Chromatids are two halves of the same double chromosome and are exact copies of one another
Real Karyotype
Down’s Syndrome Karyotype
Cell Types and Chromosome Types Diploid – cell with the normal # of
chromosomes (2n) Haploid – cell with ½ the normal number
of chromosomes (n) Somatic cell – normal body cell Sex Cell, gamete – sperm and egg –
haploid cells Germ cell – 2n cell that is the precursor
to the gametes Autosomes – chromosomes 1-22 Sex chromosomes – X and Y, necessary
to determine sex, but code for many proteins not related to sex and found in all cells
Meiosis – cell division process that produces the sperm and egg (n)
Purpose of Meiosis To make haploid sex cells so that
when they come together, the zygote has the normal amount of DNA (2n)
EggEgg
nn
SpermSperm
nn
ZygoteZygote
2n2n
FertilizationFertilization
→→MitosisMitosis
EmbryoEmbryo
Steps of Meiosis
Chromosomes form and homologous pairs come together
Germ Cell (2n) in G1 (46 single chromosomes)
S-Phase – copy all DNA so after have 46 double chromosomes
When Chromosomes form in meiosis I – 46 doubles
Crossing over in Prophase I
Homologous Pairs line up down center
Still 46 doubles or
23 double pairs
Each daughter cell has 23 double chromosomes – no longer have pairs – just one of each pair
Meiosis I is the reduction division because the cell went from 46 chromosomes or 23 pairs to just 23 chromosomes
The daughter cells are now haploid but they don’t yet have ½ of the DNA of the orginial germ cell, they must undergo meiosis II
Chromosomes reform in the two daughter cells
Each individual chromosome lines up down the center and sister chromatids split
Now that sister chromatids split – we have 23 single chromosomes – ½ the DNA of a normal cell – this is the finished sex cell
Summary
Meiosis happens only in ovaries and testes to make sperm and egg
Sperm and egg have only 1 of each pair of chromosomes and are haploid
Sex cells come together to make a zygote that contains a pair of each chromosomes again and is diploid
Meiosis Animation
Mitosis vs. Meiosis
Egg vs. Sperm
Each germ cell forms 4 sperm of equal size
Sperm form everyday throughout life in a male
Each germ cell forms 1 large egg (cytoplasm divides unequally and small cells disintegrate)
Females are born with all of the eggs they will ever have
Sexual Reproduction Brings about Variation by: Crossing Over Independent Assortment
Amount of variation due to IA – 2n
In humans = 2 23 = 8 million Random Fertilization
8 million x 8 million = 64 TRILLION combinations
Crossing Over makes this almost infinite
Chromosomal Abnormalities Trisomy or Monosomy due to
non-disjunction during meiosis Chromosomal deletions (a
piece of a chromosome breaks off)
Chromosomal Translocations (whole or parts of chromosomes)
Chromosomal Inversions
Non-disjunction causes trisomy’s, monosomy’s, and
aneuploidy
Chromosomal Abnormalities
Translocation of chromosome 13 and 14 – normal phenotype
Translocation Abnormality Philadelphia Chromosome
A piece of chromosome 22 is translocated to chromosome 9 causing Chronic Myelogenous Leukemia
Chromosomal Deletions
Each chromosome 22 on the right of each pair is missing a piece
Cri-du-chat – have a deletion from chromosome #5 and the babies sound like a cat crying – mental retardation and heart disease
Mendel
Mendelian Principles Alleles – different forms of the
same gene Dominant – gene that is seen Recessive – only seen if with
another recessive allele Homozygous – having 2 like alleles Heterozygous – having 2 different
alleles Genotypes – actual gene make-up
for a particular locus or trait Phenotypes – visible trait
Mendelian Laws
Law of SegregationLaw of Segregation - When the gametes form – each gamete receives only 1 of each pair of alleles.
Law of Independent AssortmentLaw of Independent Assortment – If genes aren’t on the same chromosome (linked) they will not have to remain together in the gamete
Independent Assortment
Pairs:Red and GreenYellow and BlackBrown and WhiteBrown String and White String
Line up you pairs as in Metaphase IPick a side to be the gamete
Independent Assortment Red = red hair, thin eyebrows, long fingers, and genetic
disease for cystic fibrosis, light skin Green = brown hair, bushy eyebrows, short fingers, normal,
dark skin Yellow = big nose, hairy fingers, can’t taste sour things, tall Black = small nose, no hair on fingers, can taste sour things,
short Brown = slow metabolism, blue eyes, great cholesterol
receptors, 5 fingers on each hand, dark skin White = fast metabolism, brown eyes, slightly misshapen
cholesterol receptrs. 6 fingers on each hand, light skin White String = light skin, unibrow, mishappen clotting
enzyme Brown String = dark skin, separated brows, normal clotting
enzyme
Punett Squares – Mono and Di-Hybrid Crosses
Used to calculate the probability of Used to calculate the probability of having certain traits in offspringhaving certain traits in offspring
Figure out all possible gametes for male and females
Place them on the outside of the square
Cross the gametes to come up with the possible genotypes and phenotypes of the offspring
Story of Mendel and Punnett Squares
Beyond Mendel Incomplete Dominance – the phenotype
in the heterozygous condition is a mix of the two (white and red snapdragons make pink)
Co-dominance – both alleles are expressed in heterozygous condition (A,B blood types, Roan cattle)
This can become a “gray” area in diseases – Tay Sachs – make ½ normal protein and ½ misshapen – do not exhibit disease so recessive but moleculary have both expressed so is it co-dominance or even incomplete if has a slight effect ????
Multiple Alleles
More than two allele choices although always only have 2 alleles at each gene locus
Example: Human Blood TypesAlleles = A, B, & O (also an example of co-dominance)
Paternity Testing?
Blood TypesBlooBloo
d d TypeType
AntigenAntigens on s on
blood blood cellscells
GenotypeGenotype Body will Body will make Ab make Ab againstagainst
Person Person can can
Donate to:Donate to:
Person Person can can
Receive Receive From:From:
AA
BB
ABAB
OO
Sex-Linked
Located on a sex chromosome Usually is X-linked (few known
genes on the Y) X-linked usually show more in
males since only have 1 allele – only need 1 recessive allele to show
Pedigrees Used to figure out genotypes of
family members to see if someone is carrying a disease gene
Used to determine the mode of inheritance
Practice
Higher Genetics Pleiotropy – one gene effects
many traits
Polygenic – one trait determined by many genes – continuous pattern
Multifactorial – may be multiple genes and the environment
Chromosomal Inheritance Aneuploidy – abnormal
chromosome # (ex. Trisomy) Polyploidy – 3n, 4n (non-
disjunction of all chromosomes) More normal than aneuploid –
some plants live fine but can only reproduce with other polyploid plants
2n egg and 1n sperm = 3n
Or Zygote replicates DNA but doesn’t
divide = 4n
Sex Chromosomes and Chromosomal Inheritance
Non-disjuction of sex chromosomes
XXY – Klinefelter’s (small testes, sterile, breasts)
XYY – taller, more aggressive?? Males
XXX – normal female
XO – Turner’s Syndrome (no secondary sex characteristics, sterile, short)
top related