genetic diseasescbaghdad.edu.iq/sc/files/lectures/biotechnology/genetic disease... · a genetic...

Post on 10-Jul-2020

6 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

TRANSCRIPT

GENETIC DISEASE

Dr.Aseel shakir lec.1

A genetic disease is any disease that is caused by an abnormality in an individual's genome, the person's entire genetic makeup. The abnormality can range from small to major -- from a mutation in a single base in the DNA of a single gene to a gross chromosome abnormality involving the addition set of chromosomes. Some genetic disorders are inherited from the parents, while other genetic diseases are caused by acquired changes or mutations in a preexisting gene or group of genes. Mutations can occur either randomly or due to some environmental exposure.

The causes of many other disorders, however, are much more complex. Common medical problems such as heart disease, diabetes, and obesity do not have a single genetic cause—they are likely associated with the effects of multiple genes in combination with lifestyle and environmental factors. Conditions caused by many contributing factors are called complex or multifactorial disorders Complex disorders are also difficult to study and treat because the specific factors that cause most of these disorders have not yet been identified. Researchers continue to look for major contributing genes for many common complex disorders

Rheumatoid arthritis Rheumatoid Arthritis (RA) is a common, systemic and chronic inflammatory autoimmune disease of the connective tissues. It is characterized by a synovial inflammation of small joints (hands and feet) and large joints (shoulder and knees). The joint synovitis leads to progressive destructions in bones and cartilages, and causes significant disabilities

Pathologically, RA is mainly three steps process

that begins with autoimmunity development,

followed by local inflammation and in the final

step, bone destruction is induced The development of autoimmunity in

susceptible individuals is influenced by various

genetic and environmental factors, and

presence of autoantibodies

Etiology and Pathogenesis

Rheumatoid arthritis is a multifactorial disease,

in which both genetic and environmental factors

contribute to its etiology Environment-gene interactions in RA are

suggested to promote the immune system of

patient to loss tolerance to self-proteins,

especially those that contain a citrullinated

peptide.

Genetic Factors

genetic factors participate in RA etiology. RA among monozygotic twins has been reported to

be higher than that of dizygotic twins . Family studies confirmed these findings and

heritability of RA and the estimated relative risks for

RA in offspring of affected parents, siblings,

multiplex families, twins . RA susceptibility is associated with certain alleles of

human leukocyte antigen (HLA) system .

Genetic marker-association RA

cytokines play a significant role in

etiopathogenesis of RA. They are probably

responsible for inflammatory reactions and joint destruction that occur during the course of

disease. Cytokines such as Interleukines IL1B, IL4, IL6, IL10, IL17A and TNF-A genes which

have been suggested to have roles in

etiopathogenesis of RA.

Environmental Factors

genetic factors play an important role in

pathogenesis of RA, but environmental factors

have also been suggested to have role in

triggering the development of this disease in

genetically predisposed individuals.

1-cigarette smoking, which has been found to be

associated with an increased risk of RA 2-vitamin D deficiency 3-excessive coffee and alcohol 4-Infectious agents (viruses and bacteria) are

further environmental factors that have been

associated with an increased risk of RA.

Epstein-Barr virus (EBV) has been suggested to

have role in triggering RA bacterial infections like Streptococcus pyogenes , In addition, chronic urinary tract infection

caused by Gram negative bacteria (Escherichia

coli and Proteus spp.)

Symptoms

Signs and symptoms of rheumatoid arthritis may include: Tender, warm, swollen joints Joint stiffness that is usually worse in the mornings and after inactivity ,Fatigue, fever and weight loss. Redness and warmth. The joints may be warmer and show color changes related to the inflammation.

Early rheumatoid arthritis tends to affect your

smaller joints first — particularly the joints that

attach your fingers to your hands and your toes

to your feet. As the disease progresses, symptoms often

spread to the wrists, knees, ankles, elbows, hips

and shoulders. In most cases, symptoms occur in

the same joints on both sides of your body.

Diagnosis 1-Physical Exam 4-Antibodies: -Rheumatoid factor (RF) -anti-cyclic citrullinated peptide (anti-CCP) 3-Genetics Exam to biomarkers genes such(TNF- α gene in chromosome 6 and others Cytokines) Genes that play important role in RA.by -Polymerase chain reaction (PCR) -real-time polymerase chain reaction (Real-Time PCR)

Genetics disease

Breast and overian cancer

Lec.2 Dr.aseel shakir

cancer

● Cancer occurs when cell division gets out of control, and usually, the timing of cell division is under strict control, involving a network of signals that work together when a cell divides.

● Mutations in one or more of the nodes in this network can trigger cancer, be it through exposure to some environmental factor, or because of a genetic predisposition, or both.

● Usually, several cancer-promoting factors have to be added up before a person will develop a malignant growth: no one risk alone is sufficient.

● The mechanisms for the cancers featured here are (i) weakness of a DNA repair pathway (ii) the transformation of a normal gene into an oncogene and (iii) the malfunction of a tumor supressor gene.

Genetics of cancer

● Cellular proliferation is under genetic control and development of cancer is related to a combination of environmental mutagens, somatic mutation and inherited predisposition.

● Molecular studies have shown that several mutational events, that enhance cell proliferation and increase genome instability, are required for the development of malignancy.

● In familial cancers one of these mutations is inherited and represents a essential change in all cells, increasing the likelihood of further somatic mutations occurring in the cells that lead to tumor formation.

● Chromosomal translocations have been recognized for many years as being markers for, or the cause of, certain tumor, and various oncogenes have been implicated.

Mechanisms of tumorigenesis

The three main classes of genes known to predispose to malignancy are oncogenes, tumour suppressor genes and genes involved in DNA mismatch repair. In addition, specific mutagenic defects from environmental carcinogens and viral infections (notably hepatitis B) have been identified

Oncogenes are genes that can cause malignant transformation of normal cells

Mutation in a proto-oncogene results in altered, enhanced, or unsuitable expression of the gene product leading to tumor

• Tumor suppressor genes normally act to

inhibit cell proliferation by stopping cell

division, initiating apoptosis or being

involved in DNA repair mechanisms.

• Loss of function or inactivation of these

genes is associated with Tumor-genesis

• Another mechanism for tumour development

is the failure to repair damaged DNA

Breast and Ovarian Cancer

these diseases remain important causes of death in women.

Two major genes associated with susceptibility to breast and ovarian cancer — breast cancer susceptibility gene 1 (BRCA1) and breast cancer susceptibility gene 2 (BRCA2) — have been identified to date.

Mutations in either of these genes confer a lifetime risk of breast cancer

susceptibility other genes, such as TP53, PTEN.

BRCA1 and BRCA2 are two tumor suppressor genes. Normally, these genes help prevent cancer by producing proteins that suppress abnormal cell growth. Certain changes (mutations) in these genes affect their normal function, thereby potentially allowing cell growth to occur uncontrolled. This test detects mutations in these genes that are linked mainly with hereditary breast and ovarian cancers.

Chromosomal Location

BRCA1 gene which is the long (q) arm

of chromosome 17

BRCA2 gene is located on the long (q) arm of

chromosome 13

Gene changes related

Inherited genetic mutations

cancers occur in women with inherited mutations linked to an increased risk of ovarian cancer. These include mutations in the BRCA1 and BRCA2 genes, as well as the genes related to other family cancer syndromes linked to an increased risk

Genetic tests can detect mutations associated with these inherited syndromes. If you have a family history of cancers linked to these syndromes, such as breast and ovarian cancers, thyroid and ovarian cancer, and/or colorectal and endometrial (uterine) cancer, you might want to ask your doctor about genetic counseling and testing.

Acquired genetic changes

Most mutations related to ovarian and breast cancer are not inherited but instead occur during a woman's life and are called acquired mutations. In some cancers, these types of mutations leading to the development of cancer may result from radiation or cancer-causing chemicals, but there is no evidence for this in ovarian cancer. So far, studies haven’t been able to specifically link any single chemical in the environment or in our diets to mutations that cause ovarian cancer. The cause of most acquired mutations remains unknown.

Factors that increase your risk of

ovarian cancers

• Getting older

• Being overweight or obese

• Having children later or never having a full-

term pregnancy

• Using fertility treatment

• Taking hormone therapy after menopause:

using estrogens have an increased risk

Diagnosis

• Real-time PCR detecting breast-ovarian

cancer

• PCR

• Ultrasound

• The CA-125 blood test measures the amount

of a protein called CA-125 in the blood. Many

women with ovarian cancer have high levels

of CA-125.

Genetics disease Lec.3

Dr.Aseel shakir

Burkitt lymphoma

Burkitt lymphoma is a cancer of the lymphatic

system, particularly B lymphocytes. Burkitt lymphoma is associated with impaired

immunity and is rapidly fatal if left untreated. Burkitt lymphoma is named after British surgeon

Denis Burkitt, who first identified this unusual

disease in 1956

Burkitt lymphoma is common in young children

who also have malaria and Epstein-Barr, the

virus that causes infectious mononucleosis. One

mechanism may be that malaria weakens the

immune system's response to Epstein-Barr,

allowing it to change infected B-cells into

cancerous cells. About 98% of African cases are

associated with Epstein-Barr infection.

Types of Burkitt Lymphoma

-Endemic (African). Endemic Burkitt lymphoma

primarily affects African children ages 4 to 7. -Sporadic Burkitt lymphoma occurs worldwide.

Globally. -Immunodeficiency-associated. This variant of

Burkitt lymphoma is most common in people

with HIV/AIDS.

Genetics All types of Burkitt lymphoma are characterized by dysregulation of the c-myc gene by one of three chromosomal translocations. This gene is found at chromosom 8 q. genetic changes involving the MYC gene these genetic changes are acquired (not inherited). MicroRNA expression: microRNAs (miRNAs) have important functions in lymphoma biology. In malignant B cells, miRNAs participate in pathways fundamental to B cell development, B cell migration/adhesion, cell-cell interactions in immune niches

diagnosis

Specific PCR primers sequences for IgH gene

each isolated B cell possesses a unique IgH

immunoglobulin heavy chain gene

rearrangement all tumor cells from one patient are supposed to

possess identical IgH genes.

MEN1 mutations in multiple endocrine

neoplasia patients MEN1 gene must be altered

to trigger tumor formation in multiple endocrine

neoplasia.

Diagnosis

Before MEN-1 can be diagnosed it must be

suspected. Suspicion should be raised in any

patient with a family history of endocrine

tumors of the pancreas, family members with

pituitary or parathyroid disease or a family

history of endocrinopathy. -PCR

Cenetics disease

Lec.4 Dr.Aseel shakir

Celiac Disease Celiac disease is a serious autoimmune disorder that can occur in genetically predisposed people where the ingestion of gluten leads to damage in the small intestine. It is estimated to affect 1 in 100 people worldwide. Celiac disease is hereditary, meaning that it runs in families. People with a first-degree relative with celiac disease (parent, child, sibling) have a risk of developing celiac disease.

When people with celiac disease eat gluten (a

protein found in wheat, rye and barley), their

body mounts an immune response that attacks

the small intestine. These attacks lead to

damage on the villi, small fingerlike projections

that line the small intestine, that promote

nutrient absorption. When the villi get

damaged, nutrients cannot be absorbed

properly into the body.

-

Inheritance Pattern

Celiac disease tends to cluster in families. Parents, siblings, or children (first-degree relatives) of people with celiac disease have between a 4 and 15 percent chance of developing the disorder. However, the inheritance pattern is unknown. Celiac disease is a multifactorial disorder, which means that multiple genes interact with environmental factors to cause CD. The condition is due to the

-HLA and 1DQA-HLA interaction of the genes(known to be associated with CD 1DQB

-that are less well HLA genes-susceptibility); nonunderstood.

known to increase HLA genes The-HLA susceptibility to celiac disease are called

. These genes provide 1DQB-HLA and 1DQAdirections for making proteins used by the immune system The proteins made by these 2 genes attach to each other to form bigger proteins called heterodimers. With celiac disease, aberrations in the HLA coding can cause the immune system to go haywire in the presence of gluten and attack cells of the small intestine.

Symptoms of Celiac Disease 1. Diarrhea 2. Bloating 3. Gas 4. Fatigue 5. Weight Loss 6. Iron-Deficiency Anemia 7. Constipation 8. Depression 9. Itchy Rash

Celiac Disease Genetic Testing

The genes that predispose you to celiac disease

are located on the HLA-class II complex of our

DNA, and they're known as the DQ genes. PCR testing

Secreening Test

Anti-Tissue Transglutaminase (tTg) Assays This test is used to see if you have celiac disease Tissue transglutaminase is an enzyme that fixes

damage in your body. People with celiac disease

often make antibodies that attack this enzyme.

These are called anti-tissue transglutaminase

antibodies. A blood test that shows higher levels

of anti-tissue transglutaminase antibodies .

BRCA1 and BRCA2

These are two “breast cancer genes” are known as BRCA1 and BRCA2. These

genes are usually pronounced BRCA, and their names are simply abbreviations of

the longer terms given by the researchers who discovered them: BReast CAncer

susceptibility gene 1 and BReast CAncer susceptibility gene 2.

BRCA1 and BRCA2 are major cancer genes, responsible for a large percentage of

hereditary breast and ovarian cancer (HBOC) families

BRCA1, identified in 1990, is on chromosome 17(17q21) exon 24 , while BRCA2,

identified in 1994, is on chromosome 13(13q12.3) .

BRCA1 and BRCA2 are human genes that produce tumor suppressor proteins.

These proteins help repair damaged DNA and, therefore, play a role in ensuring the

stability of each cell’s genetic material. When either of these genes is mutated, or

altered, such that its protein product is not made or does not function correctly,

DNA damage may not be repaired properly. As a result, cells are more likely to

develop additional genetic alterations that can lead to cancer.

Cancer risks associated with BRCA1 and BRCA2

1- Breast and ovarian cancer

2- Prostate cancer

3- Male breast cancer

4- Pancreatic cancer

5- Colorectal cancer

6- Stomach cancer

BRCA1 and BRCA2 Mutations

• BRCA1: 1873 mutations – Point mutations: 1574 (84%) – Large

deletions/duplications: 299 (16%)

• BRCA2: 1597 mutations – Point mutations: 1523 (95%) – Large

deletions/duplications: 74 (5%)

Detection of mutation by

1- RFLP 2-Nested 3- Sequencing

4- Q RT-PCR (Quantitative Real-time PCR)

RFLP

Restriction Fragment Length Polymorphism (RFLP) is a molecular method of

genetic analysis .RFLP analysis technique involves cutting a particular region of

DNA with known variability, with restriction enzymes, then separating the DNA

fragments by agarose gel electrophoresis and determining the number of fragments

and relative sizes. A restriction enzyme is an enzyme, a protein molecule, that cuts

DNA at restriction sites. In essence, the DNA sample is broken up and digested by

the restriction enzymes. The resulting fragments are separated according to their

lengths, and the pattern of fragment sizes will differ for each individual tested.

1- Extraction of DNA from blood

2- Amplification DNA with specific primers(total volume 20 µl).

items volume

DNA 5µl

Primer F 1µl

Primer R 1 µl

Master mix 10µl

Free nuclease

D.W

3µl

PCR program

step temperature time cycles

Initial

denaturation

940C 5 min

Denaturation 94 20 s 30cycles

annealing 540 C 20 sec

extension 720 C 30 sec,

Final

extension

720 C 7 min

3- Electrophoresis to detect from amplification.

4- Digestion the PCR product with restriction enzyme.(HhaI and AciI for

BRCA1 and by BstUI and AciI for BRCA2).

10µl PCR amplified products were digested with 2µl restriction enzyme at

370C for 10 h .

5- 5µl of the digested products were detected by electrophoresis for 1 h within

100 vol in 2.5% agarose gel stained with ethidium bromide in 1 9 TAE

buffer.

6- The genotype results of allelic variation were based on the electrophoretic

pattern of the restriction enzyme-treated PCR products

Other application of RFLP with southern plot

Lec 6

Rheumatoid Arthritis (RA) is a common, systemic and chronic inflammatory

autoimmune disease ,swelling, and pain in and around the joints and other body

organs.

Rheumatoid arthritis is a multifactorial disease, in which both genetic and

environmental factors contribute to its etiology.

Risk factors

The CDC note that people with a higher risk of developing RA may include those

who:

are aged 60 years or above

are female

have specific genetic traits

have never given birth

have obesity

smoke tobacco or whose parents smoked when they were children

Diagnosis

1- Blood tests

Erythrocyte sedimentation rate (ESR).

C-reactive protein (CRP)A test may be used to find or monitor

conditions that cause inflammation. These include:

a. Bacterial infections, fungal infection,

b. Inflammatory bowel disease, a disorder that causes swelling and

bleeding in the intestines

c. An autoimmune disorder such as lupus or rheumatoid arthritis

d. An infection of the bone called osteomyelitis.

Anemia.

Rheumatoid factore :if an antibody known as rheumatoid factor is

present in the blood, it can indicate that RA is present. However, not

everyone with RA tests positive for this factor.

Lec 6

2- Imaging scans and X-rays.

3- HLA tissue typing

What it tests: This test detects the presence of a genetic marker called HLA-

DRB1 in the blood.

The most significant genetic risk factors for rheumatoid arthritis are variations

in human leukocyte antigen (HLA) genes, especially the HLA-DRB1 gene.

The proteins produced from HLA genes help the immune system distinguish

the body's own proteins from proteins made by foreign invaders (such as

viruses and bacteria).

The largest genetic risk factor for RA lies within the human leucocyte

antigen (HLA) class II region and encodes the HLA-DRB1 molecule. The

specific alleles of HLA-DRB1 that have been associated with RA encode a

conserved amino acid sequence that lies in the antigen binding groove of

the antigen presenting molecule. This conserved sequence is referred to as

the shared epitope (SE)

7 : Nested PCR

Nested genes : Genes whose entire sequences are contained within other

genes.

Types of nested genes:

(i) genes nested within an intron of the external gene (Fig. A) This type of nested

gene is fairly common, particularly in the introns of higher eukaryotes.

(ii) genes nested (non intronic) entirely opposite an exon or protein-coding

sequence of the external gene (Fig. B)this type ,of nested gene is quite rare, with

very few observed examples of nested genes opposite protein-coding DNA in

eukaryotic genomes.

Nested polymerase chain reaction involves two sets of primers, used in two

successive runs of polymerase chain reaction, the second set intended to amplify

or a low a secondary target within the first run product. This allows amplification f

specific products. The second -number of runs in the first round, limiting non

nested primer set should only amplify the intended product from the first round

specific product. This allows running more total -of amplification and not non

specific products. This is useful for rare templates -e minimizing noncycles whil

or PCR with high background.

Multiple endocrine neoplasia (MEN1)tumors of endocrine glands, The major

forms of multiple endocrine neoplasia are called type 1, type 2, and type 4 .

Type 1 frequently involves tumors of the parathyroid glands, the pituitary gland,

and the pancreas. Tumors in these glands can lead to the overproduction of

hormones. These disease detected by Nested PCR.

Materials

1- Genomic DNA was extracted from peripheral blood samples using

standards methods and a PCR template for the amplificationMEN 1.

2- following forward and reverse primers were used for

Long-PCR: F, 5` -CTCATAACTTGCCGACCGACCCGT GACAG-3`

R, 5` -GAGGTGAGGCCTGTCCCCTTTGGGCT GGGG-3`.

First round: outer primer

• Shorter primer

• Possible non-specific product

Programmed

cycle time Tep. steps

1

5 min 94 0C Initial denaturation

35

1 min 94 0C Denaturation

30 s 600C annealing

1 min 72 C Extension

1 5 min 72 Final extension

Second round: inner primer

• Longer primer within the outer primer

• The template is the product of first round

• Very improbably non-specific product

The PCR product was used in nested PCRs on Exone1 to detect from specificity of

target gene

F: GTGGAACCTTAGCGGACCCT

R: GCAAGGAAAGGAGCACCAGGTC.

cycle time Tep. steps

1

3 min 950C Initial denaturation

35

1 min 94 0C Denaturation

30 s 550C annealing

1 min 72 0C Extension

1 5 min 720C Final extension

Multiple endocrine neoplasia

The term multiple endocrine neoplasia (MEN) include several distinct syndromes featuring tumors of endocrine glands, each with its own characteristic pattern. In some cases, the tumors are malignant, in others, benign.

The major forms of multiple endocrine neoplasia are called type 1, type 2, and type 4. These types are distinguished by the genes involved, the types of hormones made, and the characteristic signs and

symptoms.

Type 1 frequently involves tumors of the parathyroid glands, the pituitary gland, and the pancreas. Tumors in these glands can lead to the overproduction of hormones.

multiple endocrine neoplasia type 2 is a form of thyroid cancer .

Multiple endocrine neoplasia type 4 appears to have signs and symptoms similar to those of type 1, although it is caused by mutations in a different

gene.

MEN1 mutations in multiple endocrine

neoplasia patients MEN1 gene must be altered

to trigger tumor formation in multiple endocrine

neoplasia.

MEN1 mutations in multiple endocrine

neoplasia patients MEN1 gene must be altered

to trigger tumor formation in multiple endocrine

neoplasia.

top related