dna structure and protein synthesis (also known as gene expression)
Post on 18-Jan-2016
223 Views
Preview:
TRANSCRIPT
DNA Structure and Protein Synthesis (also known
as Gene Expression)
Protein Synthesis
• The process of making proteins…
• Boring stuff?
• Nope
• This is how the information in your genes is used to build…
you!
DNA
• Deoxyribonucleic Acid (DNA) is found in what part of the cell?
• How is the DNA organized?Chromosomes!
Nucleus
Each strand of DNA is a POLYMER!!
• Individual nucleotides are the monomers!
• Monomers (nucleotides) are linked to form a long polymer of single-stranded DNA
• In our cells, 2 DNA polymers are bonded together to form a LONG double-stranded polymer
The Parts of a Nucleotide• SUGAR – deoxyribose
• Phosphate group (PO4)
• Nitrogen-containing base
A nucleotide
What are the 4 BASES?
ADENINETHYMINE
CYTOSINE
GUANINE
A DNA POLYMER!!
• Strong bonds hold the nucleotides together to form a ‘backbone’.
• They occur between the sugar of one nucleotide and the phosphate of the next nucleotide.
MORE ABOUT THE BASES…
• Adenine always bonds to thymine
• Cytosine always bonds to guanine
• Adenine –Thymine (A-T)
• Cytosine-Guanine (C-G)
How does DNA Replicate?
• DNA replication is making a COPY of ALL the genetic information (ALL the bases of DNA).
• This has to happen BEFORE cell division (either Mitosis or Meiosis) can occur.
• WHY does it have to happen?
The role of DNA• The material that genes are made of…
• Gene - segment of DNA that carries the information necessary to build a protein.
• Information is encoded in the sequence (order) of the four DNA bases (ATGC).
• A gene is a sequence of thousands of these bases that codes for a protein!
• The DNA in a single human cell = 3,000,000,000 bases (3 Billion!)
• However, scientists were surprised that there are only about 30,000 genes!!
DNA is Double Stranded Molecule• The four bases that make up the
genetic code (ATGC) form complimentary pairs.
• A pairs with T… G pairs with C.
• If one strand is ACGCAATTGCATT
• The other is TGCGTTAACGTAA
• This makes it possible for DNA copy it’s self…
Make a complementary strand!
• TTCCGATCGGCGTATCTGAGCGATCAG….
AAGGCTAGCCGCATAGACTCGCTAGTC
What is a gene?
• A Segment of DNA that contains the information that codes for a protein!!!
How do genes result in proteins?
• The DNA is in the NUCLEUS of the cell.
• Proteins are made on the ribosomes- where?
• In the cytoplasm!• So, the information needs to leave the
nucleus…..
• Can the DNA can leave the nucleus?
• NO, it cannot!
• The information for the gene needs to be copied in a way that the information CAN leave the nucleus!
• This process is the 1st step in Protein Synthesis- TRANSCRIPTION
Transcription:• The information in the DNA is
copied into a molecule of RNA (Ribonucleic acid).
• DNA can’t leave the nucleus so …a messenger (copy) is sent.
• mRNA is the messenger.
How is RNA different from DNA?•Monomer is a nucleotide with Ribose sugar, nitrogen base, and phosphate group
•In RNA, nitrogen bases are: Adenine, Guanine, Cytosine, and URACIL
•Complementary base pairs are C-G; A-U)
• RNA is Single Stranded; DNA is double stranded
• DNA: ATGCGTTAC
• mRNA: UACGCAAUG
• http://www.dnalc.org/resources/3d/03-mechanism-of-replication-basic.html
Transcribe this DNA sequence!
• DNA: GCCTTAAGACATTGTATGCCTAGCTAG
• Complementary mRNA:
CGGAAUUCUGUAACAUACGGAUCGAUC
What are differences between mRNA & DNA
• Location?
• Nucleotides?
• Double stranded? Single Stranded?
• How much genetic information is contained?
TRANSLATION• What do you do when you go from
one language to another? You TRANSLATE!
• mRNA carries the instructions for building the protein
• It takes place on the ribosomes (cellular machine that makes the protein by joining amino acids)
Translation
• The Sequence (order) of bases in the DNA/RNA determines the order of amino acids in the protein!
• The information is translated from the language of DNA/RNA (nucleic acids) to the language of proteins (amino acids).
What does the cell need to translate a mRNA?
• mRNA- information for making the protein
• tRNA- type of RNA that actually translates the information from nucleic acid (RNA) to amino acid (protein)
• Ribosome- the “machine” where translation takes place; binds the mRNA, tRNA, and joins the corresponding amino acids (the monomers of proteins!)
How is the mRNA translated to make a protein?
• Correct tRNA with an amino acid attached “reads” 3 nucleotides (a codon) in the mRNA and puts the correct amino acid in the growing polypeptide (unfolded protein!).
• This happens in the ribosome!!
Summary of transcription and translation
• Transcription – A copy of the information in DNA for a gene is encoded into RNA (takes place in nucleus).
• Translation – The RNA (messenger) serves as the plan for building a protein using tRNA as the translator and the ribosome as the “machine” (takes place in cytoplasm)
• http://www.lew-port.com/10712041113402793/lib/10712041113402793/Animations/Protein%20Synthesis%20%20long.swf
top related