design and synthesis of small molecule agonists targeting ... · (ii) the vitamin d receptor (vdr),...
Post on 19-May-2020
1 Views
Preview:
TRANSCRIPT
Design and Synthesis of Small Molecule Agonists Targeting Type I
Interferon and Vitamin D Receptors
by
Joseph M. Keca
A thesis submitted in conformity with the requirements for the degree of Master of Science
Pharmaceutical Sciences University of Toronto
© Copyright by Joseph M. Keca (2014)
ii
DESIGN AND SYNTHESIS OF SMALL MOLECULE
AGONISTS TARGETING TYPE I INTERFERON AND
VITAMIN D RECEPTORS
ABSTRACT
Small molecule agonists were designed and synthesized for two receptor systems: (i) type I
interferon-α/β-receptor (IFNAR), a heterodimeric cell-surface transmembrane receptor; and
(ii) the vitamin D receptor (VDR), a nuclear membrane bound receptor. As part of the first
project, 18 compounds were designed, carrying specific functionalities, and were synthesized
targeting IFNAR. A candidate compound exhibited antiviral activities and induced interferon-
inducible genes, implying their agonist-like interactions at the receptor. As part of the second
project, synthetic strategies were investigated for the synthesis of three hit compounds as
potential agonists of VDR to enable accessibility to target compounds. Three hit molecules
belonging to the class of pyrimidines were synthesized. This thesis outlines the functional
group modifications for exploring agonist activities using rational approaches.
iii
ACKNOWLEDGEMENTS
I would like to take this opportunity to extend my gratitude to the members of the Kotra group,
particularly Dr. Angelica Bello for her perpetual mentorship and guidance. I would also like to
thank my committee members, Dr. Eleanor Fish and Dr. Christine Allen, for the patience and
guidance throughout the completion of my degree. Finally, and most importantly, I want to
extend my most sincere thank you to my supervisor, Dr. Lakshmi Kotra, for giving me the
opportunity many others dream of, and for continually believing in me. The teachings and
preparations you have given me will carry throughout my life, and I am incredibly grateful for
them.
iv
TABLE OF CONTENTS
ABSTRACT ............................................................................................................................... ii
ACKNOWLEDGEMENTS ........................................................................................................ iii
CHAPTER 1: INTRODUCTION……………………………………………………………….x
CHAPTER 2: DESIGN AND SYNTHESIS OF SMALL MOLECULE AGONISTS TO THE
TYPE I INTERFERON RECEPTOR…………………………………………………………...1
ABSTRACT ................................................................................................................................. 1
1. INTRODUCTION ................................................................................................................ 2
1.1 The Interferon Family of Cytokines ........................................................................................ 2
1.2 The Binding Event Between Type I IFN-α and its Heterodimeric Cell Surface Receptor ..... 2
1.3 Clinical Applications and Limitations of Type I IFNs ............................................................ 4
1.4 Protein-Protein Interactions: Intricacies and Difficulties in Mimicry ..................................... 5
1.6 Utilization of In Silico Screening for the Identification of IFN-α Mimetics .......................... 9
1.7 Hypothesis ............................................................................................................................. 10
1.8 Development of IFN-α2a Mimetics ...................................................................................... 11
2. RESULTS AND DISCUSSION ......................................................................................... 12
2.1 Chemistry ............................................................................................................................... 12
2.2 Regiochemistry Determination .............................................................................................. 19
2.3 EMCV Cytopathic Effect (CPE) Reduction .......................................................................... 21
2.4 Cytotoxicity in CHO Cells .................................................................................................... 21
2.5 IFN-Stimulated Genes (ISG) Expression .............................................................................. 23
2.6 Phosphorylation of Tyk2 ....................................................................................................... 23
2.7 Physicochemical Properties Determination ........................................................................... 24
3. CONCLUSION .................................................................................................................. 27
v
4. EXPERIMENTAL SECTION ............................................................................................ 27
5. APPENDIX ........................................................................................................................ 42
CHAPTER 3: DESIGN AND SYNTHESIS OF NON-SECOSTEROIDAL AGONISTS
TARGETING THE NUCLEAR MEMBRANE BOUND VITAMIN D RECEPTOR .............. 50
ABSTRACT ............................................................................................................................... 50
6. INTRODUCTION .............................................................................................................. 51
5.1 Physiological Implications of Vitamin D .............................................................................. 51
5.2 VDR Activation and Modulation of Cholesterol ................................................................... 53
5.3 Limitations of Dietary Vitamin D and 1,25D in Treating Hypercholesterolemia ................. 53
5.4 Rationale ................................................................................................................................ 54
5.5 Hypothesis ............................................................................................................................. 55
7. RESULTS AND DISCUSSION ......................................................................................... 57
6.1 Synthetic Approach of 6-(pyridin-4-yl)pyrimidine Rings Using Substitutions and
Cyclocondensations ..................................................................................................................... 57
6.2 Suzuki Cross-Coupling Approach in the Formation of 2,4-dichloro-6-(pyridin-4-
yl)pyrimidine ............................................................................................................................... 59
6.3 Synthetic Approaches to 2,4-dichloro-6-(pyridin-4-yl)pyrimidine Moiety Utilizing Uracil
as a Building Block ...................................................................................................................... 64
6.4 Construction of 6-(pyridin-4-yl)pyrimidine Moiety with 2-Chloropyrimidine as a Core
Building Block ............................................................................................................................. 66
6.5 Synthetic Strategy Involving the Construction of the Pyrimidine Core via Cyclization of
3-Ketoesters and Amidines to Afford KP-156 and KP-172 ........................................................ 68
6.6 Implementation of Amidine and 3-Ketoester Cyclization to Afford KP-162 ....................... 71
8. CONCLUSION .................................................................................................................. 73
9. EXPERIMENTAL SECTION ............................................................................................ 73
CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS. .................................................. 85
vi
10. REFERENCES ................................................................................................................ 93
11. APPENDIX ..................................................................................................................... 93
vii
List of Figures
Figure 1. Computational model of IFN-α and IFNAR complex. ..................................................... 9
Figure 2. General structural core of homodimeric structure, leading to hit compounds, hit
compound 1 and hit compound 2. ................................................................................................... 10
Figure 3. Cartoon representation of IFN-αCon1. ........................................................................... 11
Figure 4. 2D NOESY NMR spectrum of 4c (Panel A) and 4e (Panel B), confirming the
predicted N1,N1’ regiochemistry. .................................................................................................... 20
Figure 5. Real-time PCR evaluation of Daudi cells treated for 16 hours with 5 ng/mL IFN-
αcon1 and with 500 µM of candidate compound 4e. The IFN-induced genes ISG15 (A), PKR
(B), and OAS1 (C) were evaluated for elevated expression. ........................................................... 24
Figure 6. Biosynthetic, photochemical production of vitamin D3 in the skin. ............................... 51
Figure 7. Metabolism and subsequent activation of vitamin D3 into 1,25D. .................................. 52
Figure 8. Selected hit compounds identified through in silico screening with potential VDR
agonist activity. ................................................................................................................................ 55
viii
List of Schemes
Scheme 1. Synthesis of bis-phenyltetrazole derivatives. ................................................................ 13
Scheme 2. Synthesis of alkyl halide building blocks, reagents and conditions .............................. 14
Scheme 3. Mechanistic hypotheses for the addition of hydrazoic acid/azide ion to a nitrile to
give a tetrazole. ................................................................................................................................ 17
Scheme 4. Two different isomers of tetrazole, the 1,5- and 2,5-disubstituted, can be formed
through the concerted cycloaddition. ............................................................................................... 18
Scheme 5. Retrosynthetic analysis of VDR agonist hit compounds.. ............................................. 56
Scheme 7. Formation of C-6 para-pyridine substituted pyrimidine using Suzuki-Miyaura
transition metal mediated cross-coupling. ....................................................................................... 61
Scheme 8. Synthetic approaches utilizing uracil substitution methodologies. ............................... 65
Scheme 9. Synthesis of pyrimidine core using 2-chloropyrimidine as a central building block. ... 67
Scheme 10. Refined approach at the generation of VDR agonists using amidine intermediates
for cyclizations, affording KP-156 and KP-172. ............................................................................. 70
Scheme 11. Synthesis of KP-162 utilizing 3-ketoester and amidine cyclization protocol. ............ 72
ix
List of Tables
Table 1. Synthesized library of bis-phenyltetrazole derivatives. .................................................... 15
Table 2. Antiviral activities of compound 4 series based upon maximal cytopathic effect
reduction against EMCV. ................................................................................................................ 22
Table 3. Experimentally determined physicochemical properties of biologically active
compounds. ...................................................................................................................................... 26
Table 4. Purity data for synthesized library. ................................................................................... 42
Table 5. HPLC gradient methods using methanol (0.05% TFA) in water (0.05% TFA) for
purity measurements. ....................................................................................................................... 44
Table 6. HPLC gradient methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for
purity measurements. ....................................................................................................................... 45
Table 7. HPLC isocratic methods using methanol (0.05% TFA) in water (0.05% TFA) for
purity measurements. ....................................................................................................................... 45
Table 8. HPLC isocratic methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for
purity measurements. ....................................................................................................................... 45
Table 9. HRMS data for bis-phenyltetrazole derivatize series. ...................................................... 46
Table 10. Suzuki-Miyaura cross-coupling trials incorporating a variety of palladium catalysts,
bases, solvents, and reaction conditions. ......................................................................................... 62
x
CHAPTER 1: INTRODUCTION
Small molecule agonist drug design is a challenging area of drug discovery, which was
attempted an applied for different biological systems. The molecular design approach was used
in small molecule agonist design, for two different receptor systems: (i) type I interferon-α/β-
receptor (IFNAR), a heterodimeric cell-surface transmembrane receptor; and (ii) the vitamin D
receptor (VDR), a nuclear membrane bound receptor. The first project focused on mimicking
the protein-protein interactions between type I interferon (IFN) and IFNAR, using a small
molecule agonist. Using data obtained from previous in silico screenings, hit compounds were
obtained a used as a template to generate compound libraries with potential agonist activity.
The second project investigated non-secosteroidal VDR agonists, with potential applications in
managing patients with hypercholesterolemia. KP-156, KP-162, and KP-172 were lead
compounds obtained through previous in silico screenings by the Kotra group, and were
subsequently resynthesized in house to confirm the observed VDR agonism.
While these two projects differ in receptor systems, the end goal of small molecule agonist
discovery remains synonymous between them. Each project aims to develop a small molecule
agonist, to circumvent the issues associated with the endogenous ligands. For IFNAR, IFN-α2a
is a clinically relevant therapeutic, particularly in HCV treatment. Limitations associated with
this are pharmacokinetic and fiscal barriers. An orally bioavailable small molecule IFNAR
agonist would have important clinical applications for HCV treatment. For VDR and its
endogenous ligand calcitriol (ROCALTROL®), the current clinical indications for
ROCALTROL® include the management of hypocalcemia and its clinical manifestations in
patients with hypoparathyroidism.55 It is also indicated in the management of secondary
hypoparathyroidism and resultant metabolic bone disease in patients with chronic renal failure
(both predialysis and dialysis patients).56 One of the major limitations of calcitriol treatment is
the hypercalcemic effects associated with it.57 For both of these receptor systems, and the
limitations associated with their endogenous ligands, these projects both aim to develop a small
molecule agonist to potentially circumvent these issues.
1
CHAPTER 2: DESIGN AND SYNTHESIS OF SMALL
MOLECULE AGONISTS TO THE TYPE I INTERFERON
RECEPTOR
ABSTRACT
Interferons (IFNs) are cytokines, classified into types I, II, or III. The type I IFNs, IFNs-α/β,
exhibit pleiotropic activities, including antiviral, growth inhibitory, and immunomodulatory
activities. Interferon-α2a, an FDA approved therapeutic, is a type I IFNα, and binds its cognate
cell surface receptor, interferon-αβ receptor (IFNAR).IFNAR is a heterodimer comprised of two
single, transmembrane spanning proteins, IFNAR1 and IFNAR2, with JAK1 and TYK2 in the
cytoplasmic domain. IFN activation of IFNAR requires engagement and binding of both subunits
to elicit a cascade of signaling events in the cell.
In this chapter, the design and synthesis of bis-phenyltetrazole based non-peptidic small molecules
are investigated for IFN-like activity. Utilizing the molecular design approach, a library of 18
compounds were synthesized. These compounds are symmetrically substituted bis-phenyltetrazole
structures with a diethylether linker connecting the functional moieties mimicking IFN surface
residues. All compounds were evaluated for their antiviral activities, which is a functional end
point, followed by testing for IFN-inducible genes. Compound 4e demonstrated antiviral activity
against EMCV with an EC50 of 0.5 ± 0.2 µM. This compound was also shown to activate Tyk2
phosphorylation, as well as induce IFN-inducible genes.
Declaration of work: All synthetic routes, synthesis of library, characterizations, physiochemical
properties, and purity analysis was performed by Joseph M. Keca. In silico screenings were
performed by Dr. William Wei, and biological evaluations were performed by the Fish group.
2
1. INTRODUCTION
1.1 The Interferon Family of Cytokines
A particular family of cytokines that has received considerable attention in recent years, due to
immunomodulating activity, is interferons (IFNs).1 IFNs bind to one large receptor subgroup, the
type I and type II cytokine-receptor superfamily. This receptor is also known to bind a variety of
interleukins and colony-stimulating factors.2 IFNs are categorized into three distinct classes: type
I, type II, and type III IFN. In humans, the type I IFN family is composed of 16 different
members, with the majority being 12 IFNα subtypes, IFNβ, IFNε, IFNκ, and IFNω.3 The type I
IFNs are of prime focus for research, due to their protective role against viral infection. Similarly,
the type II IFN family exhibits antiviral activities, however, is comprised of one cytokine, IFNγ.
Finally, the type III IFN class is comprised of the IFNλ family, specifically being IFNλ1
(interleukin-29, IL-29), IFNλ2 (interleukin-28A, IL-28A), and IFNλ3 (interleukin-28B, IL-28B).4
There are marked differences in protein sequences and structures among type III IFNs and type I
and type II IFNs. Type III IFNs exhibit greater similarity to members of the interleukin-10 (IL-10)
family. Regardless of this structural similarity, type III IFNs still elicit the same antiviral
responses and induce the activation of IFN-stimulated genes (ISGs), making them most similar to
type I IFNs.5 The activation of these genes has recently been implicated in a variety of cellular
processes, which give new roles for the IFN family of cytokines, extending their function beyond
their well-known role in viral interference.6 With type I IFNs having new roles in intestinal
homeostasis, inflammatory and autoimmune diseases such as coeliac disease and psoriasis, as well
as multiple sclerosis and cancer, it is evident that investigations into the potential therapeutic
applications of this cytokine is of prime interest.6
1.2 The Binding Event Between Type I IFN-α and its Heterodimeric Cell Surface Receptor
The type I and type II cytokine-receptor superfamily comprises of receptors that bind IFN, many
interleukins, and colony-stimulating factors.7 There is a common mechanism of signal
transduction for the aforementioned cytokines, the JAK-STAT pathway. The JAK-STAT pathway
is utilized extensively throughout physiological processes, and its importance has been
demonstrated in studying patients with primary immunodeficiencies.8 The pathway consists of
3
four Janus kinases (JAKs) - JAK1, JAK2, JAK3, and tyrosine kinase 2 (TYK2) - which selectively
associate with the intracellular cytoplasmic domains of various cytokine receptors, including, IFN
receptors.9 Activation from a cytokine results in the phosphorylation of cytoplasmic domains on
the receptors by JAKs. This allows for the selective binding of STATs (signal transducers and
activators of transcription).10 Members of the STAT family include: STAT1, STAT2, STAT3,
STAT4, STAT5A, STAT5B, and STAT6.10
The JAK-STAT pathway is activated upon type I IFN binding to the type I IFN receptor
(interferon-αβ receptor). The interferon-α/β receptor (IFNAR) -a heterodimer comprised of two
single transmembrane spanning proteins, IFNAR1 and IFNAR2, with JAK1 and TYK2 associated
factors in the cytoplasmic domain - requires recruitment of both subunits to elicit signal
transduction. Human IFNAR1 is a 63 kDa protein, composed of 530 amino acids. IFNAR2, the
primary binding element, exists as three isoforms: (i) IFNAR2a, 239 amino acids and 24kDa; (ii)
IFNAR2b, 331 amino acids and 34kDa; and (iii) IFNAR2c, 515 amino acids and is 55kDa.11 All
three isoforms have identical extracellular domains, but deviate in their intracellular domain
sequences.
Type I IFNs bind to IFNAR1 and IFNAR2 extracellular domains, which induces intracellular
signal transduction. Specific domains in IFN-α, termed IFN receptor recognition peptides (IRRPs)
have been implicated in contacting IFNAR1 and IFNAR2 to invoke high affinity binding, receptor
activation, and signal transduction.12 Recruitment of the two IFNAR subunits results in receptor
oligomerization, with rapid autophosphorylation and activation of the receptor-associated JAKs,
JAK1 and TYK2.13 This results in the phosphorylation of the cytoplasmic tails of the receptor
complex, providing a docking site for the STATs - STAT1 and STAT2 - which are subsequently
phosphorylated by JAK1 and TYK2. These DNA-binding proteins are tyrosine-phosphorylated,
allowing for dimerization to occur.10 The dimerized STATs translocate to the nucleus, activating
transcription of ISGs. The main critical complex formed is the heterodimeric complex between
STAT1-STAT2, which effectively forms the ISG factor 3 (ISGF3 complex).14 The mature ISGF3
complex is comprised of the activated (phosphorylated) forms of STAT1 and STAT2, with IRF9
(IFN-regulatory factor 9). The STAT1-STAT2-IRF9 then binds to the promoter regions of ISGs,
specifically IFN-stimulated response element (ISRE).14 Moreover, type I IFNs can induce the
4
formation of STAT1-STAT1, STAT1-STAT3 and STAT3-STAT3 homodimers, which translocate
to the nucleus and bind GAS (IFN-γ-activated site) elements, adjacent to the promoter of ISGs.
Type I IFNs are also involved in several other signalling pathways. The CRKL pathway has been
shown to be IFN-inducible, where JAK activation results in CRKL association with TYK2, and
becomes tyrosine phosphorylated.15 Activated CRKL forms a complex with STAT5, which
subsequently undergoes TYK2-dependent tyrosine phosphorylation.15 CRKL-STAT5 complex
translocates to the nucleus and binds GAS elements. PI3K and NF-κB are also IFN-inducible
signalling pathways.15 JAK1 and TYK2 phosphorylation result in activation of PI3K and AKT,
subsequently mediating downstream activation of mTOR, causing inactivation of GSK-3,
CDKN1A, and CDKN1B, and activation of IKKβ, resulting in activation of NF-κB2.15 Type I
IFNs can also activate NF-κB by a secondary pathway involving linkage of TRAFs (TNF
receptor-associated factors). A third pathway activating NF-κB involves an activation loop via
PKCθ.15 Moreover, the MAPK (mitogen activated protein kinase) pathway has been shown to be
IFN-inducible, where JAK activation and subsequent tyrosine phosphorylation of Vav, leads to the
activation of several MAPKs.15
1.3 Clinical Applications and Limitations of Type I IFNs
In addition to possessing broad spectrum antiviral activity, IFN-α also displays stimulatory and
inhibitory effects on T-cells, as well as a stimulatory effect on natural killer (NK) cells and
macrophages.15 The direct anti-proliferative effects, potential antiangiogenic effects, stimulation of
major histocompatibility-1 (MHC1) expression, and NK cell activity, has resulted in IFN-α
becoming a therapeutically relevant and utilized pharmaceutical.13,16
With the various physiologically important processes IFN-α is involved in, it has become a
therapeutically utilized tool in medicine. Of particular interest in this research is IFN-α2a, or
known by the commonly used trade name, Roferon A. Due to the applications of IFN-α2a in
malignant and non-malignant diseases, it has been applied to a variety of medically relevant
conditions. The current FDA-approved indications for IFN-α2a include Hairy cell leukemia, Non-
Hodgkin's lymphoma, chronic myleogenous leukemia, AIDS-related Kaposi sarcoma, and chronic
5
hepatitis C (HCV).13, 16 Currently, IFN-α and ribavirin treatment remains front line standard of
care in the clinic, when treating chronic hepatitis C infections.
Despite IFN-α having a role in the clinic, there are complex pharmacokinetic issues associated
with the delivery and bioavailability of this peptide, due to proteolytic degradation. To overcome
this, IFN-α is administered subcutaneously or intramuscularly, with absorption being reported
greater than 80%.17 Although there are measureable concentrations for 4 to 24 hours after injection
of IFN-α, the short half-life of 4-16 h for this peptide causes it to be rapidly removed from the
body. As a result, maintaining serum plasma concentrations that will induce a therapeutic response
requires multiple injections. Strategies have been developed to overcome this issue and increase
the circulation time of IFN-α, by means of pegylation. This proved to be effective in decreasing
the clearance rate of IFNs, however, peginterferons (α2a and α2b) were shown to exhibit reduced
bioactivity in comparison to consensus IFN and IFN-α2a.18-20 With the complexities associated
with drug-delivery and pharmacokinetics for IFN-α, it is evident that a small molecule mimetic
which elicits the same physiological response as IFN-α, and circumvents the issues associated
with peptide pharmacokinetics and drug delivery, is of significant interest. It is this that has led
my research into the field of developing small molecules which mimic the protein-protein
interactions observed between IFN-α and its cognate cell surface receptor, IFNAR.
1.4 Protein-Protein Interactions: Intricacies and Difficulties in Mimicry
Protein-protein interactions (PPIs) are observed throughout nature, and are vital in a variety of
cellular processes, from intercellular communication to programmed cell death. Accordingly, a
large number of proteins present as target therapeutic candidates. Of these, a significant proportion
rely on the formation of stable or dynamic protein complexes. These include antigen-antibody
interactions, the organization of active sites of oligomeric enzymes or receptors, and regulatory
processes, such as signal transduction and DNA synthesis.21
PPIs have been considered challenging when attempting to design small molecule mimetics, due to
the large interaction surfaces involved.22 However, it may not be entirely necessarily to mimic the
entire protein binding surface. Instead, there are critical portions on proteins which contribute to
6
the interface binding affinity, termed, "hot-spots".23 Consequently, it can be hypothesized that
these binding sites possessed by hot-spots, as well as the electronic characters associated around
the hot-spot binding interface, can be mimicked by low molecular weight molecules.21, 24
Due to overall protein architecture and super-secondary structure playing an integrative part of
protein-protein interactions and function, PPI mimetics are highly dependent on protein secondary
structure.22 There are three predominantly observed secondary structural elements found in
proteins and in protein-protein interfaces.21, 24 These include: (i) α-helices; (ii) β-sheets; and (iii)
reverse turns. Once the secondary structure element has been identified for the protein of interest
involved in the specified protein-protein interaction, hot-spots can be identified to determine key
amino acids involved in the binding interface. From this, the specific electrostatic environment can
be constructed, in order to rationally develop a focused set of mimetics. The primary peptide
structure is typically translated and converted into cyclic analogues.21 It is then important to
gradually decrease the peptidic nature of the mimetics, eventually reaching a small molecular
probe, absent of peptidic elements.21 This process involves the combination of peptidic and non-
peptidic elements, until ultimately a completely non-peptidic small molecule is produced.21
There are limited reports in the literature of type I IFN mimetics. In 2008, Wang and colleagues
reported the discovery of two IFNα-2b mimetic peptides with antiviral activity, which was
obtained from screening a phage-display heptapeptide library using a novel functional biopanning
method.25 While presenting a unique screening methodology, novel compounds were not
constructed or synthesized; rather, screened for.
A second instance, where IFN-β was successfully mimicked, was reported by Saburo Sone and
Atsushi Sato in 2003, where a 15-mer peptide (SYR6), was shown to compete with IFN-β for
binding to the type I IFN receptor in a concentration-depended manner.26 Similarly, as
demonstrated by Wang and colleagues, the isolation of the peptide was achieved by use of phage-
display screening, using a neutralizing anti-IFN-β monoclonal antibody. While it is important to
note that the work presented by both Wang and colleagues and Saburo Sone and Atsushi Sato is
commendable, the peptidic constructs developed are not without fault. The same pharmacokinetic
and drug delivery issues associated with native IFN would be encountered with these compounds.
7
These constructs, however, have provided insights into the complex mechanism of activating
heterodimeric cytokine receptors, knowledge that would be utilized in future research endeavours.
There has been research into the development of IFN-γ mimetics, by Johnson and colleagues in
2005. Here, the group developed peptide mimetics of IFN- γ, that did not act through recognition
by the extracellular domain of the IFN- γ receptor, but instead bound to the cytoplasmic domain of
the receptor chain 1, IFNGR-1.27 While the peptide mimetics played a direct role in the activation
and nuclear translocation of STAT1, they did not interact with the extracellular receptor domain,
which native IFN- γ interacts with. Consequently, these peptide mimetics of IFN-γ are not true
mimetics, since although they may elicit the same physiological JAK-STAT signal transduction
response, they do so in a manner which differs to the mechanism of native IFN- γ, at the upstream
site of protein-protein interaction with the extracellular portion of the receptor.
Limited research has gone into the development of IFN-α receptor agonists or antagonists, despite
their potential as therapeutic agents in the clinic. In order to commence focused and rational
research in this area, it was important to construct a well-developed understating of the binding
interface between IFN-α and IFNAR.11 Fish and colleagues constructed a fundamental model
understanding the relationship between IRRPs and IFNAR1 and IFNAR2.28-30 Their studies
revealed that of the three IRRPs (IRRP1-3), IFNAR2 interacts with IRRP-1 and IRRP-3, whereas
IFNAR1 interacts with IRRP-2.28-30 Using these principles, Fish, Kotra, and colleagues in 2007
developed three-dimensional structural information for the IFNAR-IFN-α binding interface.31 The
obtained data provided insights into the species specificity of IFN-α, as well as defining key hot
spot regions critical for IFN recognition by IFNAR. Increasing the understanding of the critical
regions involved in the IFN-IFNAR binding event, allowed for focused research into identifying
IFN agonists and/or antagonists.
Previous work performed by Kotra and colleagues interrogated the binding sites of IFNAR,32, 33
where the combination of in silico screenings and medicinal chemistry led to identification of
compounds interacting with IFNAR. In 2008, a series of 26 compounds were synthesized to
investigate the interactions present in the IFN-IFNAR complex.33 Of these compounds, two
displayed antagonist activity, effectively disrupting IFN-IFNAR interactions and blocking
8
downstream signalling. This work helped pave the way toward future investigations of IFN
agonists and antagonists.
Kotra and colleagues utilized the knowledge obtained through previous work regarding IRRPs and
IFNAR1 and IFNAR2 to design and synthesize a series of small molecules that mimic IFN-α
epitopes, and interact with IFNAR.33 Key residues of IRRP-1 (Leu30, Arg33, and Asp35) were
used to derive 11 chemical compounds that belong to 5 distinct chemotypes.33 Three compounds
displayed potential mimicry to IRRP-1, and were shown to inhibit IFNAR activation by IFN-α.
Following this, an effort to identify small molecules spanning the surface of IFN-α2a was
undertaken using an in silico approach; compounds were synthesized and these were evaluated for
their potential agonist activities (unpublished data).
9
1.6 Utilization of In Silico Screening for the Identification of IFN-α Mimetics
The fundamental framework developed by Fish and Kotra enabled the utilization of in silico
screening efforts to identify small molecules with potential agonist activity to IFNAR. This
strategy included the utilization of the complete structure of IFN-α2a to identify molecules
spanning the IRRP regions (Figure 1).
Figure 1. Computational model of IFN-α and IFNAR complex. IFN-α2a (green ribbon) complex with its cognate cell surface receptor, IFNAR1 (purple ribbon) and IFNAR2 (orange ribbon). IRRP-1 is presented as cyan, IRRP-2 is shown as green blue, and IRRP-3 is depicted as magenta capped-stick model.11 Over 60 compounds were identified as potential small molecule mimics spanning IRRP-2 and
IRRP-1/-3 regions of the IFN. These compounds were commercially procured and were evaluated
for their potential to exhibit IFN-like protection against the cytopathic effects of viral infection.
This led to the identification of six hits for further investigation, from which a generic
homodimeric structure was derived (Figure 2). Two of these hits, hit compound 1 and hit
compound 2, possessed IFN-like activity, and were considered as candidate compounds to
IRRP-‐3
IRRP-‐2
IRRP-‐1
10
investigate as potential IFNAR agonists. A medicinal chemistry effort was undertaken to explore
the structural features for agonist-like activity.
Figure 2. General structural core of homodimeric structure, leading to hit compounds, hit compound 1 and hit compound 2. Common structural features in both compounds lend to the symmetric homodimeric generic structure. Black boxes represent hidden structural moieties. Red spheres indicate areas in which compounds were derivatized.
1.7 Hypothesis
By recreating hot-spot environments of IRRPs using functional moieties (Figure 3), and placing
them strategically on the diethyl ether linked bis-phenyltetrazole scaffold of hit compound 2, the
new small molecules will possess agonist activity for IFNAR.
11
Figure 3. Panel A: cartoon representation of IFN-αCon1. IRRP-1 (red), IRRP-2 (orange), and IRRP-3 (purple) are shown as capped-stick models. Unity features defined for database searches. Panel B: Hot-spot environments of individual IRRPs. Blue spheres represent positive centers, red spheres indicate negative centers, yellow spheres depict hydrophobic centers, and purple spheres describe hydrogen bond donor atoms. Images provided by Dr. William Wei. IFN-αCon1 is a novel, synthetic consensus IFN-α.11
1.8 Development of IFN-α2a Mimetics
As part of this thesis, I engaged in the rational design and synthesis of IFN-α2a mimetics. To
achieve this, a molecular design approach was implemented using data obtained through in silico
screening (Kotra and co-workers, unpublished results). The Kotra group identified a number of
compounds spanning the surface of IFN, specifically the region of IRRP-2 and the contiguous
surface spanning IRRP-1 and IRRP-3. Two compounds, hit compound 1and hit compound 2, were
identified that fit into the homodimeric chemical ligand structure (Figure 2). As a part of this
IRRP-‐1
IRRP-‐3
A
IRRP-‐2
B
IRRP-‐3
IRRP-‐1
IRRP-‐2
12
thesis, hit compound 2 was considered for structure-activity relationship investigations by
incorporating various functional moieties on the tetrazole moieties. As a first step, a facile,
synthetic route was devised to afford a library of 18 compounds, which were further tested for
potential IFN-like activity.
2. RESULTS AND DISCUSSION
2.1 Chemistry
Small molecules mimicking the protein-protein interactions and binding events between
IFN-α and IFNAR1 and IFNAR2 were investigated, by incorporating a variety of functional
moieties into a central organic scaffold. This array of functional moieties took into account the
addition or absence of hydrophobic (i.e. phenyl) or hydrophilic (i.e. carboxylate) groups, as well as
hydrogen bond donors (i.e. amines, hydroxyl). By utilizing a dynamic array of functionalization,
the exact electrostatic and molecular interactions involved between any lead compound and
IFNAR can be deduced. Understanding the activity profiles of various derivatives will allow for a
greater degree of specific lead compound development. A standardized protocol was developed
and implemented in the synthesis of the bis-phenyltetrazole small molecule library (Scheme 1). .
The bis-phenyltetrazole moiety was used as a core building block, and consequently, synthetic
strategies to afford this architecture were devised. The first process involved 4-cyanophenol 1 as a
central starting material, which was readily reacted with 1-bromo-2-(2-bromoethoxy)ethane in
basic conditions and moderate heating to produce its symmetrical analogue 2 in excellent yields.
Compound 2 possesses two key features which were predicted to be vital for agonist activity.
Firstly, the diethyl ether linker is inert, and possesses little reactivity to both acidic and basic
conditions. Secondly, the linker creates a specific distance between the two bis-phenyltetrazole
moieties, which allow them to potentially span the region between IFNAR1 and IFNAR2. Thus,
the linker enables compound 4 to cover the spatial distance between both subunits, potentially
interacting favourably with key amino acid residues in the receptor.
13
Scheme 1. Synthesis of bis-phenyltetrazole derivatives. a. Reagents and conditions: (a) K2CO3, 1-bromo-2-(2-bromoethoxy)ethane, DMF, 70oC, 4 h; (b) NaN3, ZnBr2, water, MW 180oC, 1 h; (c) NaHCO3, DMF, R-X (alkyl halide), r.t., 24-48 h. Alkyl halides used were either commercially available, or were synthesized in house. Compound 7
was synthesized from 5, using a two-step protocol involving methylation using iodomethane,
followed by subsequent halogenation using elemental bromine and hydrogen bromide. 7 was used
directly on 3 to afford 4a in excellent yields. Compounds 4n-p required alkyl halide building
blocks to be synthesized in house as well. 9 was obtained by alkylation of 8 using 1-bromo-2-
chloroethane, and was directly added to 3 to afford 4p. 11 was obtained using the same procedure,
and was used according to the same protocol to afford 4n-o. Alkyl bromide 13 was synthesized
from 12, using triphenylphosphine and carbon tetrabromide as bromination conditions. 13 was
used according to the same protocol converting 3 to 4 to afford 4h-i.
14
Scheme 2. Synthesis of alkyl halide building blocks, reagents and conditions. A: (a) CH3I, K2CO3, DMF, 60oC, 24 h; (b) Br2, HBr, 0oC, 2 h. B: (c) K2CO3, 1-bromo-2-chloroethane, DMF, r.t., 12 h. C: (d) NaHCO3, 1-bromo-2-chloroethane, DMF, r.t., 12 h. D: (e) CBr4, PPh3, dichloromethane, r.t., 12 h.
The formation of 2 allowed for an ideal compound to convert to its corresponding 5-substituted
2H-tetrazole 3. The tetrazole moiety has received considerable attention, as this functional group
has roles in coordination chemistry as a ligand, in medicinal chemistry as a metabolically stable
surrogate for a carboxylic acid group, and in a variety of materials science applications.34 The
tetrazole moiety was also chosen for its potential towards many useful transformations generating
substituted tetrazoles 4.
A B
C D
15
Table 1. Synthesized library of bis-phenyltetrazole derivatives.
Compound
R - Regiochemistry
4a
N2,N2'
4b
N2,N2'
4c
N1,N1'
4d
N1,N2'
4e
N2,N2'
4f
N2,N2'
4g
N2,N2'
16
4h
N1,N2'
4i
N2,N2'
4j
N2,N2'
4k
N2,N2'
4l
N2,N2'
4m
N2,N2'
4n
N1,N2'
4o
N2,N2'
4p
N2,N2'
4q
N1,N2'
4r
N2,N2'
17
The formation of 3 from 2 was readily achieved using the Sharpless protocol,35 involving the click
synthesis addition of sodium azide to nitrile 2 in water as a solvent and zinc bromide as a catalyst.
There has been debate as to the specific mechanism of the addition of hydrazoic acid/azide ion to a
nitrile to afford a tetrazole, with evidence supporting both a two-step mechanism36, 37 and a
concerted [2 + 3] cycloaddition38 (Scheme 3, mechanism 2). However, more recent studies have
shown that a concerted [2 + 3] cycloaddition is the most likely pathway for the bimolecular
addition of non-ionic azides to nitriles.38 This safe and exceptionally efficient process afforded 3
in excellent yields, without the need for an organic solvent, as well provides for large-scale
applications without the need for organic solvents in the workup or isolation phases. This synthetic
strategy is fiscally advantageous compared with a variety of other tetrazole syntheses involving
organic solvents and costly reagents.39, 40
Scheme 3. Mechanistic hypotheses for the addition of hydrazoic acid/azide ion to a nitrile to give a tetrazole. For the binding interaction between IFN and IFNAR, there are particular sequences on the surface
of IFN, termed IFN receptor recognition peptides (IRRPs), which mediate the binding and signal
transduction when IFN interacts with IFNAR.28 Of the three IRRPs (IRRP1-3), it was predicted
through in silico screening that IFNAR2 interacts with IRRP-1 and IRRP-3, whereas IFNAR1
interacts with IRRP-2.12, 28 The derivatization of 3 into 4 was based upon the principles set by
IRRPs, where specific electronic environments of amino acid residues were represented by
functional groups placed upon 3. The conversion of 3 to 4 was achieved readily through the use of
18
an alkyl halide and base in suitable solvent. A library of 18 compounds were readily generated by
use of this synthetic protocol.
When synthesizing 4, three different regioisomers were observed in certain cases, where alkyl
substituents were placed in a N2,N2', N1,N2', or N1,N1' regiochemistry. The reason for multiple
regioisomers may have two explanations: (i) the specific localization of the tetrazole proton in 3
can be between a 1H- and 2H-position. In the concerted cycloaddition mechanism in the
formation of 3, it is possible to have a 1,5-tetrazole (1H) and 2,5-tetrazole (2H) (Scheme 4).38 The
presence of both regioisomers in the starting material 3 when converted into 4 can lead directly
into both N1,N1' and N2,N2' regioisomers; and (ii) the second rationale behind the observation of
three regioisomers of 4, and the most likely explanation, is the phenomenon of tautomerization. In
the tautomerization of tetrazole, the tetrazole proton can delocalize between N1 and N2.35, 38 As a
result, there becomes a random distribution over time between species of 3 when placed in the
reaction conditions to convert to 4.35, 38 These species include a [1H,1H] , [1H,2H] , and the most
thermodynamically favourable and predominant species, [2H,2H] .35, 38 The presence of these
species in solution can lead directly to its corresponding alkyl substituted analogue 4 when in
presence of the electrophile alkyl halide.
Scheme 4. Two different isomers of tetrazole, the 1,5- and 2,5-disubstituted, can be formed through the concerted cycloaddition.
19
Among the synthesized derivatives, compounds 4c-e led to all three regioisomers, and the single
N1,N1' derivative. It is possible that the alkaline character of 2-chloro-N,N-diethylethan-1-amine
may bias the distribution of tautomer species in solution, since the reagent possesses significant
structural similarity to triethylamine.
2.2 Regiochemistry Determination
An interesting phenomenon occurred when synthesizing 4, as instead of the predicted N2,N2'
regiochemistry, both N1,N1` and N1, N2`were observed in certain cases (derivatives 4c-e, 4h-i,
4n-o, and 4q-r). The variation of regiochemistry has significant implications to the overall
architecture and geometry of the small molecules, which can have significant implications in
receptor binding and recognition. Due to the binding interface of protein-protein interactions
having highly specific orientations and electronic interactions, the geometry of the derivatives can
have significant implications. In the N1,N1` derivative (4c), the tetrazole ring is expected to be
twisted out of the plane of the phenyl ring, causing a 'kink' in the ring system to reduce the steric
and electronic effects of the N1,N1`substituents. This disrupts the interannular conjugation of the
bi-aromatic system, resulting in the observed 'kink'.41
To ascertain the regiochemistry of the synthesized compounds, 2D-NMR methodologies were
applied, specifically 2-D Nuclear Overhauser effect spectroscopy (2D-NOESY). Due to the spatial
disposition of methylene protons in N1 or N2 substitutions, there would be a distinguishable
difference between the spatial correlations of the phenyl-tetrazole protons and respective
methylene protons. I hypothesized that the 13C NMR shift of C-5 in the tetrazole ring would
experience deviations between N1 and N2 regioisomers, due to the direct effect on interannular
conjugation. It has been previously demonstrated that there is a difference between N1 and N2
regioisomers of phenyltetrazoles at C-5, with N2 regioisomers having the larger downfield shift.
This is predicted to due to the increased co-planarity observed between the biaryl system.
2D-NOESY NMR was used on 4c and 4d, due to the possibility of only two regioisomers. 2D-
NOESY of 4c (Figure 4, Panel A) displayed a direct correlation between the methylene protons
substituted onto the tetrazole ring, with that of the phenyl protons adjacent to the tetrazole ring
system. This directly supports the prediction of a N1 substituted system. 4e displayed no
correlation between the respective protons (Figure 4, Panel B), indicating a difference in the
20
spatial correlation, thus eluting to N2 regiochemistry. From this, the correct regiochemistry of 4c-d
was determined, and this knowledge was used to determine the regiochemistry of the complete
compound library.
Figure 4. 2D NOESY NMR spectrum of 4c (Panel A) and 4e (Panel B), confirming the predicted N1,N1’ regiochemistry.
B
A
21
2.3 EMCV Cytopathic Effect (CPE) Reduction
To determine whether the synthesized library of compounds displayed IFN-like antiviral activity,
Daudi cells were infected with encephalomyocarditis virus (EMCV), and treated with each
compound to reveal any reduction in the virus-induced cytopathic effects (Table 2). IFN-α2a was
used as an internal positive control (100% reduction in CPE). Of the 18 bis-phenyltetrazole
compounds screened, 9 displayed CPE reduction with an EC50 in the micromolar range. Of these
compounds, 4e displayed the highest CPE reduction, as well as an EC50 of 0.5 ± 0.2 µM and
maximal CPE reduction of 61%. While three other derivatives displayed a sub-micromolar EC50,
the maximal CPE reduction was below that of 4e, and these were subsequently excluded for
further evaluations due to their low potency. 4e was chosen as a candidate compound for further
evaluation as a potential antiviral agent and activator of IFNAR. These antiviral studies were
conducted by Beata Majchrzak-Kita of the Fish group.
2.4 Cytotoxicity in CHO Cells
Candidate compounds which exhibited good antiviral activity and potential for IFN-like activity
were subjected to cytotoxicity analysis in Chinese hamster ovary (CHO) cells. 4e was evaluated in
CHO cells for any potential cytotoxic effects. Cytotoxicity was minimal, including concentrations
evaluated as high as in the millimolar range. As a result, the low cytotoxicity of 4e made it a more
suitable candidate for later stage evaluations. This experiment was conducted by Ewa Poduch of
the Kotra group.
22
Table 2. Antiviral activities of compound 4 series based upon maximal cytopathic effect reduction against EMCV.
Compound R - Regiochemistry EC50 (µM) Maximal CPE Reduction (%)
4b
N2,N2' 0.1 ± 0.2 15
4c
N1,N1' 100 ± 54.6 8
4d
N1,N2' 25.2 ± 45.9 9
4e
N2,N2' 0.5 ± 0.2 61
4g
N2,N2' 44.8 ± 4.7 60
4o
N2,N2' 14.3 ± 2.2 25
4p
N2,N2' 0.5 ± 0.1 38
4q
N1,N2' 4.8 ± 0.6 41
4r
N2,N2' 0.9 ± 0.3 45
23
2.5 IFN-Stimulated Genes (ISG) Expression
Candidate compounds evaluated and confirmed to be non-cytotoxic were subjected to gene
expression analysis to determine whether any IFN-induced genes are activated by these
compounds. Real-time PCR was used to evaluate Daudi cells treated for 16 hours with 5 ng/mL
IFN-αCon1 and with 500 µM of candidate compounds chosen (4e). ISG15, PKR, and OAS1 were
gene products evaluated for induced expression. 4e displayed the greatest fold induction of gene
expression for all three genes. In IFN-αCon1 treated cells, ISG15 expression was increased 163-
fold, whereas 4e treated cells exhibited a 55-fold increase. For PKR, IFN-αCon1 treated cells
increased expression by 40-fold, and 4e by 5-fold. . For OAS1, IFN-αCon1 increased gene
expression by 8-fold and 4e by 2-fold (Figure 5). This data provides indirect evidence for the
observed antiviral activity of compound 4e, indicating that 4e could potentially be invoking its
activity through IFNAR activation. These studies were conducted by Beata Majchrzak-Kita of the
Fish group.
2.6 Phosphorylation of Tyk2
An early event following the high affinity binding of type I IFNs to IFNAR, is Tyk2
phosphorylation. In a time course study (2, 5, and 15 minutes) the ability of compound 4e to
phosphorylate Tyk2 was examined in cell lysates using Western immunoblot analysis. The data
revealed that treatment with 500 µM of the candidate compound does result in some degree of
phosphorylation of Tyk2, further suggesting its IFN-like activity and potential as an activator of
IFNAR (data not shown). To confidently determine whether 4e binds to IFNAR directly, surface
plasmon resonance studies are currently being investigated.
C
24
Figure 5. Real-time PCR evaluation of Daudi cells treated for 16 hours with 5 ng/mL IFN-αcon1 and with 500 µM of candidate compound 4e. The IFN-induced genes ISG15 (A), PKR (B), and OAS1 (C) were evaluated for elevated expression. KF-112 (hit compound 2) is a vendor purchased compound, with predicted agonist activity to IFNAR. Data obtained and provided by Beata Majchrzak-Kita of the Fish group.
2.7 Physicochemical Properties Determination
The physicochemical properties of biologically active derivatives in series 4 were experimentally
determined and evaluated (Table 3). A wide range of pKa values were obtained for various
analogues in the library of compounds, showing that the library design incorporates both basic,
acidic, and neutral compounds. The distribution-coefficient (logD) was also determined for series
4 at physiological pH, to determine the relative lipophilicity of compounds, and potential
unwanted cytotoxic effects as a result of highly hydrophobic compounds.
0
50
100
150
200
IFN-‐a-‐con1 KF-‐112 4e
Fold
Indu
ctio
n ISG15
0
10
20
30
40
50
IFN-‐a-‐con1 KF-‐112 4e
Fold
Indu
ctio
n
PKR
0 1 2 3 4 5 6 7 8 9
IFN-‐a-‐con1 KF-‐112 4e
Fold
Indu
ctio
n
OAS1
25
The implications of regiochemistry on biological activity and physicochemical properties is
evident in the pKa and logD values obtained. Observing 4c-e, which possess all three regioisomers
(N1,N1`, N1,N2`, and N2,N2`), the experimentally determined physicochemical properties differ
significantly among each derivative. The pKa for 4c (N1,N1’) was determined to be 7.41 ± 0.06,
where 4e (N2,N2`) was 8.33 ± 0.32. Despite both derivatives possessing the same functional
groups, the pKa between both of these compounds differ by almost an order of magnitude. This
can be rationalized due to the steric hindrance of 4c N1,N1’ regiochemistry, which subsequently
disrupts co-planarity between the biaryl system. Protonation of the amino side chain would further
contribute to steric hindrance and electrostatic repulsions, subsequently increasing the acidity of
the functional moiety. 4d (N1,N2`), the asymmetric regioisomer, possessed an intermediate pKa of
7.59 ± 0.11, which roughly lies between the values of 4c and 4e.
Further differences in physicochemical properties among regioisomers 4c-e, the logD (@ pH 7.4)
was calculated for all derivatives in series 4. Although 4c and 4e possess different regiochemistry,
the logD values are similar (4c = 6.801, 4e = 6.669). Interestingly, the asymmetric regioisomers
4d had an experimentally determined logD of 2.831, substantially lower than that of its
corresponding regioisomer partners. This may be due to the asymmetry of the electronic system,
where molecular dipole moments (a vector) do not cancel out, as observed in symmetrical
molecules. The symmetry observed in 4c and 4e presumably reduces the polarity in the overall
dipole moments, where the vector dipoles cancel, subsequently decreasing the overall polarity of
the system.
Due to the complexity of these compounds - their high molecular weights and large polar surface
areas - the use of computational programs to predict physicochemical properties is potentially
unreliable, as observed in the differences in values obtained through predictive software, and that
of the experimentally determined values. An example of this is observed in derivative 4r, where
the reliability of using predictive software for pKa determination was called into question. Using
ChemBioDraw® software, the predicted pKa was 7.93, however, the experimentally determined
value (performed in triplicates) was 7.22 ± 0.19. These values are almost an order of magnitude in
difference, which highlights the caution that should be taken when utilizing predictive software to
determine physicochemical properties. Moreover, the utility and versatility of the Sirius-T3®
system in determining physicochemical properties accurately and quickly is exemplified in these
26
compounds. The molecular size and complexity of these compounds required physicochemical
properties to be experimentally determined, rather than computationally predicted. Experiment
was conducted on a single trial; multiple trials are to be carried out to ensure reproducibility.
Table 3. Experimentally determined physicochemical properties of biologically active compounds. pKa and LogD values were derived from a single experiment. To confirm the accuracy and reproducibility of these results, these experiments must be repeated in separate trials. Compound
Code R - pKa LogD (@ pH 7.4)
4c
7.41 ± 0.06 6.801
4d
7.59 ± 0.11 2.831
4e
8.33 ± 0.32 6.669
4h
5.12 ± 0.11 3.423
4i
5.20 ± 0.14 4.99
4n
6.48 ± 0.47 6.284
4o
7.01 ± 0.20 6.937
4p
pKa1 (NR2H): 2.98 ± 0.42 pKa2 (NR3): 7.31 ± 0.58 0.859
4q
7.17 ± 0.15 5.799
4r
7.22 ± 0.19 6.602
27
3. CONCLUSION
IFN-α2a is as a standard of care in HCV treatments in the clinic, with pharmacokinetic barriers
warranting investigations into small molecule mimetics. The Kotra group has discovered several
small molecule agonists for IFNAR using in silico screening, including a bis-phenyltetrazole core
tethered via ethylene ether linker. As part of this thesis project, a synthetic methodology was
developed for this core, and a library of 18 compounds was synthesized. Among these compounds,
4e demonstrated antiviral activity against EMCV with an EC50 of 0.5 ± 0.2 µM. This compound
was also shown to induce Tyk2 phosphorylation, as well as induce IFN-inducible genes (PKR,
OAS1, and ISG15). This work highlights the effectiveness of using the molecular design approach
to design small molecule agonists for cell surface receptors (IFNAR), potentially mimicking
protein-protein interactions.
4. EXPERIMENTAL SECTION
4.1 General. All reactions were performed under N2 in oven-dried glassware. Flash
chromatography was performed using distilled solvents from Sigma-Aldrich. All solvents and
reagents were obtained from commercial sources; anhydrous solvents were prepared following
standard procedures. Chromatographic purifications were performed using performed using 60 Å
(70–230 mesh) silica gel with the indicated solvents as eluents. TLC analysis was performed using
EMD TLC Silica gel 60 F254 Aluminum sheets and visualized using UV light, iodine, ninhydrin,
vanillin, and phosphomolybdic acid stains. Final products were purified by LC/MS on a Waters
LC/MS system equipped with a photodiode array detector using an XBridge semipreparative C18
column (19.2 mm x 150 mm, 5 µm). Mass spectra were recorded using ESI Waters system (+ve)
mode. All HPLC solvents were filtered through Waters membrane filters (47 mm GHP 0.45 µm,
Pall Corporation). Injection samples were filtered using Waters Acrodisc® Syringe Filters 4 mm
PTFE (0.2 µm). NMR spectra were recorded on a Bruker spectrometer (400 MHz for 1H; 101
MHz for 13C). Chemical shifts are reported in δ ppm using tetramethylsilane or the deuterated
28
solvent as the reference. Compounds listed in procedures that were not otherwise mentioned in the
aforementioned schemes were also obtained from commercially available sources.
4.2 Physiochemical Properties Determination. The dissociation constant (pKa) and lipophilicity
(LogP/D) was determined using a Sirius-T3 automated system (Software Version 1.1.0.10, Sirius
Analytical LTD, UK) for compounds 4a-r. KHP calibration titrations were performed before
physicochemical properties were determined for each series of compounds. Deionized water and
spectrophotometric grade dimethylsulfoxide or methanol were used for the pKa or LogP/D
determination. Assays were performed in triplicate at 25oC using 5 µL of 10 mM solution of each
sample per assay. The dissociation constant was determined by the Fast UV pKa experiment in the
presence of neutral buffer to stabilize the pH electrode across the pH range of 2–12 during the
titration of the analyte. The distribution coefficient (LogD) was determined using the pH-metric
method in which the compound was titrated for pKa in the presence of water and octanol solvent
mixture, and compared to the measured aqueous pKa value.
4,4'-Oxybis(ethane-1,2-diyl)-bis(oxy)dibenzonitrile (2). To a suspension of 4-cyanophenol (6.61
g, 55.48 mmol) in anhydrous DMF (50 mL), potassium carbonate (19.17g, 138.70 mmol) was
added under nitrogen atmosphere. The reaction mixture was then set to stir for 30 minutes, to
ensure phenoxide formation. Once complete, 1-bromo-2-(2-bromoethoxy)ethane (3.48 mL, 6.43 g,
27.74 mmol) was added drop-wise over a period of 30 minutes at 0oC. After complete addition,
the reaction temperature was elevated to 70oC for a period of 4 hours. Once the reaction was
complete by TLC analysis, the reaction vessel was removed from heat, cooled to room
temperature, and solvent removed via rotatory evaporator. Next, cold distilled water (50 mL) was
added, and the resulting suspension was extracted with ethyl acetate (2 x 25 mL). The organic
layers were combined, dried over sodium sulfate, and concentrated under reduced pressure.
Hexanes:ethyl acetate (3:1) was added to the resulting solid, where remaining 4-cyanophenol
dissolved, while desired produced remained insoluble. The remaining solid was filtered, washed
with hexanes:ethyl acetate (3:1), and dried under reduced pressure to afford 2 as a white crystalline
solid: 3.67 g, 63% yield). 1H NMR (CDCl3) δ 3.95 (t, J=3.6 Hz, 4 H), 4.20 (t, J=4.4 Hz, 4 H), 6.95
29
(d, J=8.8 Hz, 4 H), 7.58 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 161.98, 133.96, 119.11, 115.31,
104.22, 69.68, 67.74.
5,5'-Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole) (3). To a suspension of
sodium azide (1.81 g, 27.83 mmol) and zinc bromide (6.27g, 27.83 mmol) in distilled water (10
mL), was added 2 (1.56 g, 5.06 mmol). Once complete dissolution of the salts was observed, the
reaction vessel was placed under microwave radiation for one hour at 180oC. Once the reaction
was confirmed complete by TLC analysis, the pH was brought to 1.0 with 3N HCl (5 mL), and the
reaction mixture was stirred vigorously for 30 minutes. The resulting solid precipitated was
filtered via vacuum filtration, and washed with 3N HCl (3 x 5 mL), as well as hexanes: ethyl
acetate (1:1, 15 mL). The solid was isolated and dried under reduced pressure, affording 3 as a
light brown solid: 847 mg, 57% yield. 1H NMR (DMSO-d6) δ 3.85 (t, J=4.30 Hz, 4 H), 4.21 (t,
J=4.30 Hz, 4 H), 7.16 (d, J=9.03 Hz, 4 H), 7.97 (d, J=9.03 Hz, 4 H); 13C NMR (DMSO-d6) δ
161.1, 131.8, 129.1, 115.8, 69.4, 67.9.
General Procedure for the Nucleophilic Substitution of 5,5'-oxybis(ethane-1,2-diyl)bis(oxy)
bis(1,4-phenylene)bis(2H-tetrazole) (4). To a reaction vessel charged with nitrogen, 3 (1 eq.) and
sodium bicarbonate (2.5 eq.) was added in anhydrous DMF. The suspension was allowed to stir for
several minutes to ensure the formation of a nucleophilic species. The reaction mixture was then
cooled to 0oC, whereby the halo electrophile (2.2 eq.) suspended in anhydrous DMF was added
drop-wise over several minutes by means of a syringe. The reaction vessel was then warmed to
room temperature, and stirred overnight. Once the reaction was confirmed complete by TLC
analysis, water was added to the reaction mixture and was extracted with ethyl acetate. The
organic layers were subsequently washed with water (2x) and saturated sodium bicarbonate
solution (1x). The organic layers were combined, dried over sodium sulfate, and concentrated in
vacuo to afford the crude product. To the crude product, 3 mL of CH2Cl2 and 0.5 g of silica was
added. The volatile compounds were removed in vacuo, and the white silica powder was placed on
a column. The crude product mixture was purified using flash column chromatography on silica
gel (mobile phase conditions: gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes).
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-(4-
(dimethylamino)phenylethanone) (4a) : To a reaction vessel charged with nitrogen, 3 (58 mg,
30
0.147 mmol) and sodium bicarbonate (27.18mg, 0.523 mmol) was added in anhydrous DMF (6
mL). The suspension was allowed to stir for 30 minutes, whereby the reaction mixture was cooled
to 0oC, and to it was added 7 (78.33 mg, 0.323 mmol). After complete addition, the reaction vessel
was warmed to room temperature, and was allowed to stir for 24 hours. Once the reaction was
confirmed complete by TLC analysis, water (10 mL) was added to the reaction mixture and was
extracted with ethyl acetate (2 x 5 mL). The organic layers were combined and washed with water
(2 x 5 mL), and saturated sodium bicarbonate solution (5 mL). The organic layers were combined,
dried over sodium sulphate, and concentrated in vacuo. To the crude product, 3 mL of CH2Cl2 and
0.5 g of silica was added. The volatile compounds were removed in vacuo, and the yellow silica
powder was placed on a column. The crude product mixture was purified using flash column
chromatography on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to
afford 4a as a yellow solid: 28 mg, 38% yield; mp 180-181 oC; 1H NMR (CDCl3) δ 3.10 (s, 12 H),
3.98 (t, J=3.00 Hz, 4 H), 4.23 (t, J=3.00 Hz, 4 H) , 6.01 (s, 4 H), 6.69 (d, J=9.2 Hz, 4 H), 7.01 (d,
J=8.8 Hz, 4 H), 7.90 (d, J=9.2 Hz, 4 H), 8.09 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 186.4,
165.3, 160.3, 154.1, 130.5, 128.5, 121.6, 120.3, 114.9, 110.9, 69.9, 67.5, 40.0; IR (cm-1) ν 2953
(CH), 2921 (CH), 1690 (C=O), 1595 (C=C); λmax (nm) 257.5.
3,3'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)bis(ethane-1,2-diyl)bis(1H-indole) (4b): This compound was synthesized from 3 (117 mg,
0.296 mmol), sodium bicarbonate (55 mg, 0.593 mmol), and 3-(2-bromoethyl)-1H-indole (133
mg, 0.593 mmol) using the procedure described for compound 4a. A modification was
implemented to the procedure described in 4a, as the reaction mixture was warmed to 60oC and set
to stir for 20 hours. To the crude product, 12 mL of CH2Cl2 and 0.5 g of silica was added. The
volatile compounds were removed in vacuo, and the white silica powder was placed on a column.
The crude product mixture was purified using flash column chromatography on silica gel
(gradient, ethyl acetate:hexanes, 25% to 60% over 25 minutes) to afford 4b as a white solid: 80
mg, 60% yield; mp 149-151 oC; 1H NMR (CDCl3) δ 3.53 (t, J=7.53 Hz, 4 H), 3.98 (t, J=5 Hz , 4
H), 4.23 (t, J=5 Hz , 4 H ), 4.91 (t, J=7.53 Hz, 4 H), 6.97 (d, J=2.26 Hz, 2 H), 7.01 (d, J=8.8 Hz, 4
H), 7.15 (t, J=6.8 Hz, 2 H), 7.21 (t, J=8.0 Hz, 2 H), 7.36 (d, J=8.0 Hz, 2 H), 7.63 (d, J=7.6 Hz, 2
H), 8.07 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3/ MeOD-d4) δ 164.7, 160.4, 136.3, 128.2, 126.8,
31
122.6, 121.8, 120.0, 119.2, 118.0, 114.9, 111.4, 109.9, 69.8, 67.5, 53.7, 25.6; IR (cm-1) ν 3407
(NH), 3057 (CH), 2954 (CH), 1581 (C=C); λmax (nm) 257.4.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(N,N-
diethylethanamine) (4c). By a procedure similar to that described for 4a, 3 (50 mg, 0.126 mmol)
and sodium bicarbonate (25 mg, 0.278) was added in anhydrous DMF (5 mL). The reaction
mixture was allowed to stir for 30 minutes, and once complete, was placed on an ice bath. After
the temperature of the reaction suspension was brought down to 0oC, potassium iodide (46.30 mg,
0.278 mmol), and (2-chloroethyl)diethylamine hydrochloride (37.83 mg, 0.278 mmol) were added,
and the reaction vessel temperature was elevated to 60oC. Once the reaction was confirmed
complete by TLC analysis, water (20 mL) was added to the reaction mixture and was extracted
with ethyl acetate (3 x 3 mL). The organic layers were combined, dried over sodium sulfate, and
concentrated by use of a rotatory evaporator. To the remaining residue was added 3 mL CH2Cl2
and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white silica
powder was placed on a column, a purified via flash chromatography on silica gel (gradient, ethyl
acetate:hexanes, 25% to 60% over 23 minutes). Isolation of three regioisomers (4c-e) was
obtained. Compound 4c was isolated as a clear and colourless, sticky oil: 87 mg, 55% yield; 1H
NMR (CDCl3) δ 1.35 (t, J=7.2 Hz, 12 H), 3.23 (q, J=7.2 Hz, 8 H), 3.69 (t, J=7.6 Hz, 4 H), 3.97 (t,
J=4.8 Hz, 4 H), 4.24 (t, J=4.4 Hz, 4 H), 4.94 (t, J=7.2 Hz, 4 H), 7.04 (d, J=8.8 Hz, 4 H), 7.58 –
7.60 (d, J=8.8 Hz, 4 H). 13C NMR (CDCl3) δ 161.5, 154.6, 130.2, 115.7, 69.7, 67.7, 53.4, 47.0,
42.8, 8.2; IR (cm-1) ν 3035 (CH), 2925 (CH), 1579 (C=C); λmax (nm) 254.0.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(1H-tetrazole-1,5-diyl)bis(N,N-
diethylethanamine) (4d). This compound was obtained during the procedure described in 4e, and
was isolated from the regioisomer mixture as a yellow, sticky oil: 87 mg, 55% yield; 1H NMR
(CDCl3) δ 1.34 (t, J=4.8 Hz, 12 H), 3.26 (q, J=7.2 Hz, 8 H), 3.73 (t, J=7.6 Hz, 2 H), 3.83 (t, J=6.4
Hz, 2 H), 3.96 (t, J=4.8 Hz, 4 H), 4.22 (dt, J=5.2 Hz, 4.0 Hz, 4 H), 4.94 (t, J=7.2 Hz, 2 H), 5.13 (t,
J=6.4 Hz, 2 H), 6.99 (d, J=8.8 Hz, 2 H), 7.01 (d, J=8.8 Hz, 2 H), 7.56 (d, J=8.8 Hz, 4 H), 7.94 (d,
J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.6, 161.5, 160.7, 130.2, 128.3, 119.2, 115.7, 115.1, 114.5,
69.8, 69.7, 67.7, 67.6, 49.7, 49.4, 47.3, 47.1, 47.0, 42.7, 8.3, 8.1; IR (cm-1) ν 3021 (CH), 2926
(CH), 1543 (C=O); λmax (nm) 255.0.
32
2,2'-(Oxybis(ethane-2,1-diyl)bis(oxy)bis(4,1-phenylene)bis(2H-tetrazole-5,2-diyl)bis(N,N-
diethylethan-1-amine) (4e). This compound was isolated from the procedure described from 4c,
where 4e was isolated as an orange, sticky oil: 87 mg, 55%; 1H NMR (CDCl3) δ 1.28 (t, J=7.2 Hz,
12 H), 3.22 (q, J=7.2 Hz, 8 H), 3.79 (t, J=6.0, 4 H), 3.94 (d, J=4.0 Hz, 4 H), 4.19 (d, J=4.8 Hz, 4
H), 5.12 (t, J=6.4 Hz, 4 H), 6.96 (d, J=8.4 Hz, 4 H), 7.93 (d, J=8.4 Hz, 4H); 13C NMR (CDCl3)
δ 165.6, 160.7, 128.4, 119.3, 115.1, 69.8, 67.6, 49.4, 47.3, 47.1, 8.2; IR (cm-1) ν 2959 (CH), 2925
(CH), 1582 (C=C); λmax (nm) 256.4.
2,2'-(5,5'-(Oxybis(ethane-1,22,1-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)bis(1-(4-(diethylamino)phenylethanone) (4f). This compound was synthesized from 3 (77
mg, 0.195 mmol), sodium bicarbonate (40 mg, 0.429 mmol), and 2-bromo-1-(4-
(diethylamino)phenyl)ethanone (116 mg, 0.429 mmol) using the procedure described for
compound 4a. To the crude product, 15 mL of CH2Cl2 and 0.5 g of silica was added. The volatile
compounds were removed in vacuo, and the white silica powder was placed on a column. The
crude product mixture was purified using flash column chromatography on silica gel (gradient,
ethyl acetate:hexanes, 25% to 60% over 18 minutes) to afford 4f as a white solid: 58 mg, 38%
yield; mp 168-170oC; 1H NMR (CDCl3) δ 1.23 (t, J=7.2 Hz, 12 H), 3.44 (q, J=7.2 Hz, 8 H), 3.98
(t, J=4.0 Hz, 4 H) 4.23 (t, J=4.0 Hz, 4 H), 5.99 (s, 4 H) 6.66 (d, J=9.2 Hz, 4 H), 7.01 (d, J=8.8 Hz,
4 H), 7.86 (d, J=8.8 Hz, 4 H), 8.09 (d, J=8.4 Hz, 4 H); 13C NMR (CDCl3) δ 186.0, 165.3, 160.3,
152.1, 130.8, 130.4, 128.5, 121.0, 120.4, 114.9, 110.5, 69.9, 67.5, 57.5, 44.6, 12.5; IR (cm-1)
ν 2959 (CH), 2921 (CH), 1672 (C=O), 1594 (C=C); λmax (nm) 256.5.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-
phenylethanone) (4g). This compound was synthesized from 3 (83 mg, 0.210 mmol), sodium
bicarbonate (53 mg, 0.631 mmol), and 2-bromo-1-phenylethanone (93 mg, 0.403 mmol) using the
procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.5 g of silica
was added. The volatile compounds were removed in vacuo, and the white silica powder was
placed on a column. The crude product mixture was purified using flash column chromatography
on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to afford 4g as a light-
yellow solid: 8 mg, 6% yield; mp 124-126 oC; 1H NMR (CDCl3): δ 3.97 – 3.99 (t, J=4.80 Hz, 4
H), 4.24 (t, J=4.0 Hz, 4 H), 6.12 (s, 4 H), 7.02 (d, J=8.8 Hz, 4 H), 7.57 (dd, J=8.0 Hz, 4 H), 7.69 -
33
7.71 (m, 2 H), 8.01 (d, J=7.2 Hz, 4 H), 8.08 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 189.0, 165.5,
160.5, 134.6, 133.9, 129.2, 128.5, 128.2, 127.8, 114.9, 69.9, 67.6, 58.1; IR (cm-1) ν 3068 (CH),
2953 (CH), 1702 (C=O), 1580 (C=C); λmax (nm) 254.0.
4-(2-(5-(4-(2-(2-(4-(1-(2-Morpholinoethyl)-1H-tetrazol-5-yl)phenoxy)ethoxy)ethoxy)phenyl)-
2H-tetrazol-2-yl)ethyl)morpholine (4h). This compound was synthesized from 3 (61 mg, 0.151
mmol), sodium bicarbonate (38 mg, 0.453 mmol), and 13 (73 mg, 0.378 mmol) using the
procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.5 g of silica
was added. The volatile compounds were removed in vacuo, and the white silica powder was
placed on a column. The crude product mixture was purified using flash column chromatography
on silica gel (gradient, methanol:dichloromethane, 3% to 10% over 30 minutes) to afford 4h as a
yellow, sticky oil: 50 mg, 37%; 1H NMR (CDCl3) δ 3.25 (m, 8 H) 3.69 (t, J=7.2 Hz, 4 H) 3.80 (t,
J=6.4 Hz, 4 H) 3.94 – 3.99 (m, 4 H) 4.21 - 4.25 (m, 4 H) 4.91 (t, J=7.2 Hz, 4 H) 5.13 (t, J=6.4 Hz,
4 H) 6.99 (d, J=8.8 Hz, 2 H) 7.02 (d, J=8.8 Hz, 2 H) 7.54 (d, J=8.8 Hz, 2 H) 7.94 (d, J=8.8 Hz, 2
H); 13C NMR (CDCl3) δ 165.3, 161.6, 160.9, 154.7, 130.3, 128.0, 124.7, 119.4, 115.2, 114.9,
114.8, 114.8, 114.1, 69.5, 69.4, 67.6, 67.4, 67.4, 63.9, 63.6, 54.8, 54.7, 52.4, 52.2, 46.7, 42.4, 29.5,
25.1; IR (cm-1) ν 2928 (CH), 2873 (CH), 1581 (C=C); λmax (nm) 253.4.
4,4'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)bis(ethane-1,2-diyl)dimorpholine (4i). This compound was obtained from the procedure
performed in the synthesis of 4h, where the regioisomer 4i was obtained as a light brown, sticky
oil: 50 mg, 37%; 1H NMR (CDCl3) δ 3.24 (br. s., 8 H) 3.81 (t, J=6.0 Hz, 4 H) 3.95 – 3.98 (m, 8
H) 4.21 - 4.23 (m, 12 H) 5.16 (t, J=6.0 Hz, 4H) 6.97 (d, J=8.8 Hz, 4 H) 7.97 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.5, 160.7, 131.8, 128.4, 119.3, 115.1, 69.8, 67.6, 64.0, 63.7, 54.9, 52.2,
47.4; IR (cm-1) ν 2930 (CH), 2874 (CH), 1615 (C=C); λmax (nm) 256.5.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)bis(1-(4-
(trifluoromethyl)phenylethanone) (4j). This compound was synthesized from 3 (91 mg, 0.230
mmol), sodium bicarbonate (60 mg, 0.692 mmol), and
1-(2-bromoethyl)-4-(trifluoromethyl)benzene (128 mg, 0.507 mmol) using the procedure described
34
for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added. The
volatile compounds were removed in vacuo, and the white silica powder was placed on a column.
The crude product mixture was purified using flash column chromatography on silica gel
(gradient, ethyl acetate:hexanes, 25% to 60% over 15 minutes) to afford 4j as a white solid: 42 mg,
38% yield; mp 123-125 oC; 1H NMR (CDCl3) δ 3.44 (t, J=7.6 Hz, 4 H), 3.99 (t, J=4.8 Hz, 4 H),
4.24 (t, J=4.80 Hz, 4 H), 4.88 (t, J=7.6 Hz, 4 H), 7.03 (d, J=8.8 Hz, 4 H), 7.30 (d, J=8.0 Hz, 4 H),
7.56 (d, J=8.0 Hz, 4 H), 8.05 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.0, 160.5, 140.5, 140.5,
129.7, 129.4, 129.0, 128.3, 125.1-125.8 (q, J=7.90 Hz, CF3), 120.1, 115.0, 69.9, 67.6, 53.5,
35.4; IR (cm-1) ν 2918 (CH), 2851 (CH), 1735 (C=O), 1542 (C=C); λmax (nm) 256.4.
Diethyl 2,2'-(5,5'-(oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)diacetate (4k). This compound was synthesized from 3 (50 mg, 0.126 mmol), sodium
bicarbonate (24 mg, 0.278 mmol), and ethyl bromoacetate (47 mg, 0.278 mmol) using the
procedure described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica
was added. The volatile compounds were removed in vacuo, and the white silica powder was
placed on a column. The crude product mixture was purified using flash column chromatography
on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 15 minutes) to afford 4k as a white
solid: 20 mg, 28% yield; mp 139-141oC; 1H NMR (CDCl3) δ 1.29 (t, J=7.2 Hz, 6 H), 3.98 (t, J=4.8
Hz, 4 H), 4.23 (t, J=4.8 Hz, 4 H), 4.29 (q, J=7.2 Hz, 4 H), 5.42 (s, 4 H), 7.03 (d, J=8.8 Hz, 4 H),
8.08 (d, J=8.8 Hz, 4 H); 13C NMR (CDCl3) δ 165.5, 160.5, 128.5, 119.9, 114.9, 69.9, 67.6, 62.7,
53.3, 14.0; IR (cm-1) ν 2955 (CH), 2918 (CH), 1745 (C=O), 1581 (C=C); λmax (nm) 256.0.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-diyl)diacetic
acid (4l). To a mixture of 4k (13 mg, 0.021 mmol) in THF (700 µL) and methanol (210 µL) was
added lithium hydroxide (3.04 mg, 0.127 mmol), and the reaction was set to stir at room
temperature overnight, under nitrogen atmosphere. Once the reaction was confirmed complete by
TLC analysis, the reaction solvent was removed under reduced pressure, and to the resulting
residue water (3 mL) was added. Next, 10% HCl (2 mL) was added drop-wise at 0oC until a
precipitate formed. The water was removed via rotatory evaporator, and to the residue was added
methanol/dichloromethane (1:9, 5 mL). The organic layer was filtered, dried over sodium sulphate,
and condensed in vacuo to afford 4l as a white solid: 11 mg, 98% yield; mp 201-202 oC; 1H NMR
35
(DMSO-d6) δ 3.86 (t, J=4.4 Hz, 4 H), 4.20 - 4.22 (m, J=4.4 Hz, 4 H), 5.68 (s, 4 H), 7.13 (d, J=8.8
Hz, 4 H), 7.98 (d, J=8.8 Hz, 4 H); 13C NMR (DMSO-d6) δ 164.3, 160.6, 128.4, 119.7, 115.7, 69.4,
67.8; IR (cm-1) ν 3512 (OH), 2955 (CH), 2917 (CH), 1725 (C=O), 1551 (C=C); λmax (nm) 255.0.
2,2'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)diethanol (4m). This compound was synthesized from 3 (52 mg, 0.131 mmol), sodium
bicarbonate (24 mg, 0.290 mmol), and 2-bromoethanol (36 mg, 0.290 mmol) using the procedure
described for compound 4a. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added.
The volatile compounds were removed in vacuo, and the white silica powder was placed on a
column. The crude product mixture was purified using flash column chromatography on silica gel
(gradient, methanol:dichloromethane, 2% to 8% over 25 minutes) to afford 4m as a white solid: 27
mg, 43% yield; mp 159-161 oC; 1H NMR (DMSO-d6) δ 3.87 (t, J=4.0 Hz, 4 H), 3.94 (t, J= 4.80
Hz, 4 H), 4.21 (t, J=4.0 Hz, 4 H), 4.73 (t, J=4.8 Hz, 4 H), 5.07 (br. s., 2 H), 7.12 (d, J=8.8 Hz, 4
H), 7.98 (d, J=8.4 Hz, 4 H); 13C NMR (MeOD-d4) δ 164.8, 160.5, 128.1, 119.8, 114.8, 77.8, 77.5,
77.2, 69.7, 67.4, 59.6, 55.4; IR (cm-1) ν 3675 (OH), 2955 (CH), 2915 (CH), 1592 (C=C); λmax
(nm) 254.4.
Methyl-1-(2-(5-(4-(2-(2-(4-(1-(2-(4-(methoxycarbonyl)piperidin-1-yl)ethyl)-1H-tetrazol-5-
yl)phenoxyethoxyphenyl)-2H-tetrazol-2-yl-ethylpiperidine-4-carboxylate (4n). This compound
was synthesized using a modified approached as described in 4a. This compound was synthesized
from 3 (52 mg, 0.131 mmol), potassium carbonate (24 mg, 0.290 mmol), potassium iodide (6.67
mg, 0.042 mmol), and 11 (68 mg, 0.330 mmol). The reaction mixture was placed under
microwave radiation for 120 minutes at 105oC. The solvent was removed under reduced pressure,
and to the residue, EtOAc (15 mL) was added. The organic layer was washed with water (3 x 5
mL) and saturated sodium bicarbonate solution (5 mL). The organic layers were combined, dried
over sodium sulphate, and condensed in vacuo. To the remaining residue was added 3 mL CH2Cl2
and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white silica
powder was placed on a column, a purified via flash chromatography on silica gel (gradient,
methanol:dichloromethane, 3% to 5% over 20 minutes) to afford 4n as a clear oil: 30 mg, 61%; 1H NMR (MeOD-d4) δ 2.23 (br. s., 8 H) 2.77 (br. s., 2 H) 3.24 (br. s., 8 H) 3.73 (s, 6 H) 3.83 (t,
J=6.4 Hz, 2 H) 3.93 (t, J=6.4 Hz, 2 H) 3.96 – 3.99 (m, 4 H) 4.24 - 4.29 (m, 4 H) 4.96 (t, J=6.8 Hz,
2 H) 5.23 (t, J=6.0 Hz, 2 H) 7.10 (d, J=6.8 Hz, 2 H) 7.20 (d, J=6.8 Hz, 2 H) 7.72 (d, J=6.8 Hz, 2
36
H) 8.05 (d, J=6.8 Hz, 2 H); 13C NMR (MeOD-d4) δ 173.3, 165.3, 161.7, 161.0, 154.7, 130.2,
128.0, 119.4, 115.3, 114.8, 69.5, 69.4, 67.6, 67.4, 51.2, 42.6; IR (cm-1) ν 2957 (CH), 2922 (CH),
1729 (C=O), 1541 (C=C); λmax (nm) 254.0.
Dimethyl 1,1'-(5,5'-(oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)bis(ethane-1,2-diyl)bis-piperidine-4-carboxylate (4o). This compound was obtained from
the procedure performed in the synthesis of 4n, where the regioisomer 4o was obtained as a clear
oil: 30 mg, 61%; 1H NMR (MeOD-d4) δ 1.98 (br. s, 4 H) 2.23 (br. s., 4 H) 2.78 (br. s., 2 H), 3.73
(s, 2 H) 3.92 (t, J=6.4 Hz, 4 H) 3.98 (t, J=4.4 Hz, 4 H) 4.25 (t, J=4.4 Hz, 4 H) 5.24 (t, J=6.0 Hz, 4
H) 7.099 (d, J=8.4 Hz, 4 H) 8.05 (d, J=8.4 Hz, 4 H); 13C NMR (MeOD-d4) δ 173.2, 165.4, 161.0,
128.0, 119.4, 114.8, 69.5, 67.4, 51.3; IR (cm-1) ν 2924 (CH), 2855 (CH), 1727 (C=O), 1614
(C=C); λmax (nm) 256.0.
1,1'-(5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2H-tetrazole-2,5-
diyl)bis(ethane-1,2-diyl)dipiperazine (4p). To a suspension of 3 (77.83 mg, 0.197 mmol),
potassium iodide (32.76 mg, 0.197 mmol), potassium carbonate (81.82 mg, 0.591 mmol) in
anhydrous DMF (3 mL) was added 9 (54.00 mg, 0.217 mmol). The reaction mixture was placed
under microwave radiation for 45 minutes at 120oC. Once the reaction was confirmed complete by
TLC analysis, water was added (10 mL), and was extracted with EtOAc (3 x 5 mL). The organic
layers were washed with saturated sodium bicarbonate solution (5 mL) and brine solution (5 mL),
dried over sodium sulphate, and condensed in vacuo. To the remaining residue was added 3 mL
CH2Cl2 and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting white
silica powder was placed on a column, a purified via flash chromatography on silica gel (gradient,
methanol:dichloromethane, 3% to 5% over 25 minutes) to afford Boc-protected 4p as a white
solid: 27 mg, 20% yield. 1H NMR (CDCl3) δ 1.42 - 1.47 (m, 18 H) 2.48 (br s, 4 H) 3.04 (t, J=6.6
Hz, 4 H) 3.36 (t, J=5.2 Hz, 4 H) 3.98 (t, J=4.5 Hz, 4 H) 4.24 (t, J=4.2 Hz, 4 H) 4.64 (t, J=5.0 Hz, 4
H) 4.75 (t, J=6.8 Hz, 4 H) 4.90 (t, J=5.0 Hz, 4 H) 7.03 (d, J=8.8 Hz, 4 H) 8.06 (d, J=8.8 Hz, 4 H).
Finally, Boc-protected 4p was placed in an oven dried RBF, and to it was added trifluoroacetic
acid/dichloromethane (3:7, 4 mL). The reaction mixture was then set to stir at room temperature
for 2 hours. Once the reaction was confirmed complete by TLC analysis, the solvent was removed
under reduced pressure, and to the resulting residue was added saturated sodium bicarbonate
37
solution (5 mL). The aqueous solution was then extracted with EtOAc (3 x 5 mL), organic layers
combined, dried over sodium sulphate, and condensed in vacuo to afford 4p as a clear, yellow,
sticky oil: 11 mg, 99% yield; 1H NMR (CDCl3) δ 2.30 (br. s., 2 H), 2.54 (br. s., 8 H) 2.88 (br. s., 8
H) 3.02 (t, J=6.8 Hz, 2 H) 3.98 (t, J=4.8 Hz, 4 H) 4.23 (t, J=4.8 Hz, 4 H) 4.63 (t, J=5.2 Hz, 2 H)
4.74 (t, J=6.8 Hz, 2 H) 4.89 (t, J=4.8 Hz, 2 H) 7.02 (d, J=7.6 Hz, 4 H) 8.06 (d, J=8.4 Hz, 4 H); 13C
NMR (MeOD-d4) δ 165.4, 160.8, 131.3, 129.1, 127.8, 119.8, 114.7, 114.1, 69.5, 67.4, 55.5, 49.9,
49.0, 43.4, 22.8; IR (cm-1) ν 3354 (NH), 3010 (CH), 2938 (CH),1597 (C=C); λmax (nm) 256.0.
1-(2-(Pyrrolidin-1-yl)ethyl)-5-(4-(2-(2-(4-(2-(2-(pyrrolidin-1-yl-ethyl)-2H-tetrazol-5-
yl)phenoxy)ethoxyphenyl-1H-tetrazole (4q). This compound was synthesized from 3 (158 mg,
0.401 mmol), potassium iodide (66 mg, 0.397 mmol), sodium bicarbonate (101mg, 1.20 mmol),
and 1-(2-chloroethyl)pyrrolidine (134, 1.00 mmol) using the procedure described for compound
4n. To the crude product, 10 mL of CH2Cl2 and 0.4 g of silica was added. The volatile compounds
were removed in vacuo, and the white silica powder was placed on a column. The crude product
mixture was purified using flash column chromatography on silica gel (gradient,
methanol:dichloromethane, 2% to 8% over 30 minutes) to afford 4q as a clear, yellow, sticky oil:
14 mg, 59%; 1H NMR (MeOD-d4) δ 2.04 (br. s., 8 H) 3.64 - 3.81 (m, 8 H) 3.82 - 3.87 (m, 2 H)
3.92 - 4.01 (m, 4 H) 4.04 (t, J=6.0 Hz, 2 H) 4.25 - 4.32 (m, 4 H) 4.97 (t, J=6.0 Hz, 2 H) 5.22 (t,
J=6.0 Hz, 2 H) 7.10 (d, J=8.8, 2.26 Hz, 2 H) 7.20 (d, J=8.8, 2 H) 7.76 (d, J=8.8 Hz, 2 H) 8.60 (d,
J=8.8 Hz, 2 H); 13C NMR (MeOD-d4) δ 165.4, 161.7, 160.9, 154.7, 130.3, 128.0, 119.4, 115.3,
114.8, 114.8, 69.5, 69.4, 67.6, 67.4, 54.4, 54.3, 52.6, 52.5, 43.9, 22.5; IR (cm-1) ν 2980 (CH), 2929
(CH), 1613 (C=C); λmax (nm) 254.0.
5,5'-(Oxybis(ethane-1,2-diyl)bis(oxy)bis(1,4-phenylene)bis(2-(2-(pyrrolidin-1-yl)ethyl)-2H-
tetrazole (4r). This compound was obtained from the procedure performed in 4q, where the
regioisomer 4r was isolated as a clear, white, sticky oil: 35 mg, 59%; 1H NMR (MeOD-d4) δ 2.11
(br. s., 8 H) 3.87 - 4.05 (m, 16 H) 4.25 (t, J=4.8 Hz, 4 H) 5.20 (t, J=6.0 Hz, 4 H) 7.10 (d, J=9.0 Hz,
4 H) 8.06 (d, J=9.0 Hz, 4 H); 13C NMR (MeOD-d4) δ 165.5, 161.0, 128.0, 119.4, 114.8, 69.5,
67.4, 54.3, 52.7, 22.5; IR (cm-1) ν 2998 (CH), 2926 (CH), 1613 (C=C); λmax (nm) 254.0.
1-(4-(Dimethylamino)phenyl)ethanone (6): To a solution of 4-aminoacetophenone (1.01 g, 7.47
mmol) in anhydrous DMF (10 mL) was added iodomethane (2.33 g, 16.415 mmol) and potassium
38
carbonate (2.83 g, 20.47 mmol). The reaction mixture was heated to 60 oC and stirred under
nitrogen atmosphere for 12 hours. Once the reaction was confirmed complete by TLC analysis, the
reaction mixture was quenched with water (25 mL), and extracted with the EtOAc (2 x 15 mL).
The organic layers were washed with water (2 x 10mL) and saturated sodium bicarbonate solution
(10 mL). The organic layers were combined, dried over sodium sulphate, and condensed in vacuo
to afford 6 as a light yellow solid: 1.16 g, 84% yield. 1H NMR (CDCl3) δ 2.48 - 2.52 (s, 3 H), 3.06
(s, 6 H), 6.65 (d, J=7.2 Hz, 2 H), 7.87 (d, J=7.2 Hz, 2 H).
2-Bromo-1-(4-Dimethylamino)phenylethanone (7): To a round-bottomed flask obtained from an
oven was added 6 (256 mg, 0.0512 mmol). The reaction vessel was placed into an ice bath, and to
it was added HBr (5 mL) at 0oC. Next, once complete dissolution was achieved, bromine (249 mg,
0.0512 mmol) was added drop-wise over a period of 30 minutes, ensuring a controlled amount was
added over the allocated time period. After complete addition, the reaction mixture was left to stir
for one hour in the ice bath. Once the reaction was confirmed complete by TLC analysis, water (10
mL) was added, as well as saturated sodium bicarbonate solution until neutralization was achieved,
and confirmed by pH analysis. The resulting mixture was extracted with dichloromethane (3 x 10
mL), and the organic layers were combined and washed with saturated sodium bicarbonate
solution (2 x 10 mL). The organic layers were dried over sodium sulphate, and condensed via
rotatory evaporator to afford 7 as an orange solid: 322 mg, 85% yield. 1H NMR (CDCl3) δ 3.03 (s,
6 H), 4.32 (s, 2 H), 6.61 (d, J=8.8 Hz, 2 H), 7.84 (d, J=8.8 Hz, 2 H).
tert-Butyl-4-(2-chloroethyl)piperazine-1-carboxylate (9). To a solution of 1-boc-piperazine (315
mg, 1.69 mmol) in anhydrous DMF (10 mL) was added potassium carbonate (701 mg, 5.07
mmol), and the reaction mixture was set to stir at room temperature for 30 minutes. Once
complete, 1-bromo-2-chloroethane (242 mg, 1.69 mmol) was added drip-wise over a period of five
minutes, and the suspension was allowed to stir overnight at room temperature. Once the reaction
was confirmed complete by TLC analysis, water (20 mL) was added, and was extracted with ethyl
acetate (3 x 10 mL). The organic layers were combined, dried over sodium sulphate, and
condensed in vacuo. To the remaining residue was added 3 mL CH2Cl2 and 0.5 g silica, and the
volatile compounds were removed in vacuo. The resulting white silica powder was placed on a
column, a purified via flash chromatography on silica gel (gradient, methanol:dichloromethane,
39
1% to 5% over 20 minutes), to afford 9 as a white powder: 202 mg, 52% yield. 1H NMR (CDCl3)
δ 1.46 (s, 9 H) 3.44 (dt, J=5.6 Hz, 2 H) 3.69 (t, J=5.6 Hz, 2 H) 4.34 (t, J=5.2 Hz, 2 H).
Methyl-1-(2-chloroethyl)piperidine-4-carboxylate (11): This compound was synthesized from
methyl piperidine-4-carboxylate (300 mg, 2.10 mmol), potassium carbonate (890 mg, 6.29 mmol),
and 1-bromo-2-chloroethane (300 mg, 2.10 mmol) using the procedure described for 9. To the
remaining residue was added 3 mL CH2Cl2 and 0.5 g silica, and the volatile compounds were
removed in vacuo. The resulting white silica powder was placed on a column, a purified via flash
chromatography on silica gel (gradient, methanol:dichloromethane, 1% to 5% over 20 minutes), to
afford 11 as an off-white powder: 79 mg, 20% yield. 1H NMR (CDCl3) δ 2.23 - 2.37 (m, 1 H)
2.71 (t, J=4.8 Hz, 2 H) 2.90 (s, 2 H) 3.58 (t, J=4.8 Hz, 2 H) 3.68 (t, 2 H) 3.69 - 3.71 (m, 2 H) 4.05
(br s, 2 H) 4.27 - 4.39 (m, 2 H).
4-(2-Bromoethyl)morpholine (13): To a reaction vessel charged with 12 (541 mg, 4.13 mmol) in
dichloromethane (20 mL) was added carbon tetrabromide (2.05 g, 6.19 mmol) and
triphenylphosphine (1.30 g, 4.95 mmol) in sequential order at 0oC. The resulting reaction mixture
was then slowly warmed to room temperature, and allowed to stir overnight. Once the reaction was
confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to the
resulting residue was added hexanes (80 mL). The solid precipitate was filtered, and the filtrate
was concentrated via rotatory evaporator to afford 13 as a white solid: 448 mg, 56% yield. 1H
NMR (CDCl3) δ 2.50 (t, J=4.2 Hz, 4 H), 2.78 (t, J=7.8 Hz, 2 H), 3.42 (t, J=7.8 Hz, 2 H), 3.72 (t, J-
=4.2 Hz, 4 H).
4.3 Cell Viability. 2tfgh cells were seeded at a density of 1.5 x 105/mL in 100 mL of DMEM
supplemented with 2% FCS in individual wells of 96-well tissue culture plates. After 24 hours
they were treated with the indicated concentrations of the appropriate compounds for 16h, after
which the medium was replaced DMEM supplemented with 2%FCS for an additional 24h. The
cells were then fixedin ethanol (95%)-fixed, stained with crystal violet (0.1% in 2% ethanol) and
destained (0.5 M NaCl in 50% ethanol).The absorbance of destained cells at 570nm was assessed
using a Microplate reader (Molecular Devices) and Softmax 2.32 software. Viability of the cells
was then determined relative to untreated cells.
40
4.4 Antiviral Assay. 2tfgh cells were seeded at a density of 1.5 x 105/mL in 100 mL of DMEM
supplemented with 2% FCS in individual wells of 96-well tissue culture plates. After 24 hours the
cells were treated with the indicated compounds for 16 h. At the time of virus inoculation, the
medium was aspirated and EMCV was added to individual wells in 100 mL of DMEM, 2% FCS.
After an additional 24 h, cells were ethanol (95%)-fixed and the extent of EMCV infection was
determined by spectrophotometric estimation of viral CPE. Fixed cells were crystal violet (0.1% in
2% ethanol) stained and destained (0.5 M NaCl in 50% ethanol), and the inhibition of virus
infection was estimated from absorbance measurements at 570 nm using a Microplate Reader
(Molecular Divices) and SOFTmax2.32 software relative to untreated and uninfected cells.
4.5 IFN-Stimulated Genes (ISG) Expression. Real-time PCR were perform using a
LightCycler® instrument (Roche) in conjunction with LightCycler® FastStart DNA Master SYBR
GreenPLUS I Kit (Roche). Reactions were performed in a final volume of 20 µl containing 1x
Master SYBR GreenPLUS I buffer, 1µl of each primer (concentration 20µM) and 5 µl template
cDNA ( concentration 100 ng/µl).
The following reaction conditions were used: pre-incubation at 95°C for ten minutes, followed by
45 amplification cycles of denaturation at 95°C for ten seconds, annealing at 60°C for 5 seconds,
extension at 72°C for ten seconds, melting curve analysis at 65°C for 15 seconds and a continuous
acquisition mode of 95°C with a temperature transition rate of 0.1°C/s.
PCRs were performed using the following primers:
ISG15 sequence:
(forward) 5’ GCGGCTGAGAGGCAGCGAAC
(reverse) 5’ TGCCCGCCAGCATCTTCACC
OAS1 sequence:
(forward) 5’ GAGCTCCAGGGCATACTGAG
(reverse) 5’ CCAAGCTCAAGAGCCTCATC
41
PKR sequence:
(forward) 5’ GGCTCCTGTGTGGGAAGTCA
(reverse) 5’ TATGCCAAAAGCCAGAGTCCTT
HPRT sequence:
(forward) 5’ TCCTCCTCTGCTCCGCCACC
(reverse) 5’ TCACTAATCACGACGCCAGGGCT
Reactions were performed in accordance with conditions required for use of LightCycler®
Relative Quantification Software. Standard curves were established for each primer set and both
reference (HPRT) and target (ISG15, OAS1 and PKR) reactions were performed for each sample.
4.6 Phosphorylation of Tyk2. Cells were treated with the indicated doses of the candidate
compounds for 2, 5, and 15 mins. Cells were lysed in a phosphorylation lysis buffer supplemented
with protease and phosphatase inhibitors. Equal protein aliquots were resolved by SDS–PAGE,
and transferred to membranes for immunoblotting with an antibody against tyrosine
phosphorylated Tyk2.
42
5. APPENDIX
The purity for compounds 4a-r were determined by LC/MS analysis using a Waters™ Liquid
Chromatography/Mass Spectrometry system equipped with a PDA (200-500 nm) and a mass
spectrometer (60-2000 Da) detectors. The HPLC methods for purity measurements were
developed using a Waters™ X-Bridge analytical column (4.6 mm x 150 mm, 5 µm), 1 mL/min
flow rate and using gradient or isocratic methods as listed below. High Resolution Mass
Spectrometry was recorded using ESI +ve mode for all the compounds.
Table 4. Purity data for synthesized library.
Compound R - Regiochemistry Method Purity (%) Retention
Time (min)
4a
N2,N2' C 95.07 7.20
L 95.77 2.79
4b
N2,N2'
C 95.32 7.88
L 96.36 4.71
4c
N1,N1' Q 97.80 3.68
A 97.18 5.83
4d
N1,N2' P 99.31 2.43
B 97.58 5.23
4e
N2,N2' P 98.94 4.38
B 97.06 5.58
4f
N2,N2'
H 95.02 9.20
S 95.32 7.05
4g N2,N2' M 96.21 2.25
43
D 96.27 7.36
4h
N1,N2' J 95.24 7.19
K 95.07 5.35
4i
N2,N2'
C 97.89 4.81
P 97.88 3.83
4j
N2,N2' E >99.99 9.17
M >99.99 4.02
4k
N2,N2': N1,N2' (75:25)
N 96.08
N2,N2': 2.83
N1,N2': 3.05
H 96.20
N2,N2': 8.09
N1,N2': 8.20
4l
N2,N2'
D
Total: 97.80
N2,N2': 91.23
N1,N2': 8.77
N2,N2': 5.25
N1,N2': 6.43
F
Total: 97.39
N2,N2': 91.61
N1,N2': 8.39
N2,N2': 2.98
N1,N2': 3.79
4m
N2,N2'
G
Total: 97.53
N2,N2': 90.80
N1,N2': 9.20
N2,N2': 7.47
N1,N2': 7.03
H
Total: 97.20
N2,N2': 89.56
N1,N2':
N2,N2': 6.19
N1,N2': 5.89
44
10.44
4n
N1,N2'
A 99.44 6.00
B 98.55 4.16
4o
N2,N2'
A 99.07 6.37
B 95.41 4.49
4p
N2,N2'
A 99.36 5.39
O 99.06 2.35
4q
N1,N2' I 97.94 3.41
B 98.63 4.26
4r
N2,N2' I 97.58 3.58
B 98.64 4.60
Table 5. HPLC gradient methods using methanol (0.05% TFA) in water (0.05% TFA) for purity measurements.
Method
Gradient System,
Methanol:Water (0.05% TFA)
Total Time
A 0-98% in 10 mins 10 mins
B 30-98% in 10 mins 10 mins
C 30-98% in 10 mins, 98% for 5 mins
15 mins
D 50-98% in 10 mins 10 mins
E 50-98% in 15 mins 15 mins
65-98% in 10 mins 10 mins
45
Table 6. HPLC gradient methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Gradient System,
Acetonitrile:Water (0.05% TFA)
Total Time
G 0-98% in 10 mins 10 mins H 0-98% in 7 mins,
98% for 3 mins 10 mins
I 40-98% in 10 mins 10 mins J 0-65% in 10 mins 10 mins K 0-85% in 7 mins,
85-98% in 3 mins 10 mins
Table 7. HPLC isocratic methods using methanol (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Isocratic System
Methanol:Water (0.05% TFA)
Total Time
L 80% 15 mins M 85% 10 mins N 75% 10 mins O 50% 10 mins P 40% 10 mins Q 35% 10 mins R 35% 15 mins
Table 8. HPLC isocratic methods using acetonitrile (0.05% TFA) in water (0.05% TFA) for purity measurements. Method Isocratic System,
Acetonitrile:Water (0.05% TFA)
Total Time
S 70% 10 mins
46
Table 9. HRMS data for bis-phenyltetrazole derivatize series.
Compound Structure Formula for [M+H]+
Calculated for [M+H]
Found for [M+H]
4a
C38H41N10O5 717.3261 717.3165
4b
C38H37N10O3 681.3050 681.2854
4c
C30H45N10O3 593.3676 593.3929
4d
C30H45N10O3 593.3676 593.3929
4e
C30H45N10O3 593.3676 593.3929
47
4f
C42H49N10O5 773.3887 773.4268
4g
C34H31N8O5 631.2418 631.2192
4i
C30H41N10O5 621.3261 621.1801
4j
C36H33F6N8O3 739.2580 739.2278
4k
C26H31N8O7 567.2316 567.2146
48
4l
C22H23N8O7 511.1690 511.2071
4m
C22H27N8O5 483.2104 483.2341
4n
C36H49N10O7 733.3785 733.4281
4o
C36H49N10O7 733.3785 733.4281
49
4p
C30H43N12O3 619.3581 619.3787
4q
C30H41N10O3 589.3363 589.3606
4q
C30H41N10O3 589.3363 589.2333
4h
C30H41N10O5 621.3261 621.3627
50
CHAPTER 3: DESIGN AND SYNTHESIS OF NON-
SECOSTEROIDAL AGONISTS TARGETING THE NUCLEAR
MEMBRANE BOUND VITAMIN D RECEPTOR
ABSTRACT
Vitamin D has received increased attention over the past several years, attributable to a variety of
potential therapeutic applications, which include nutritional rickets and regulation of calcium
homeostasis. More recently, vitamin D has been linked to the reduction of cholesterol in humans,
providing a novel way of managing cholesterol in patients. Administration of the hepatic activated
vitamin D active metabolite, 1,25-dihydroxyvitamin D3 (1,25D), has potential therapeutic
limitations, largely attributed to its induction of elevated high circulating calcium concentrations
(hypercalcemia).42 In this work, we aim to circumvent these associated limitations of 1,25D by the
design and synthesis of non-secosteroidal 1,25D mimetics which exhibit agonism to the vitamin D
receptor (VDR). To date, the vast majority of VDR ligands are secosteroids, which cause
hypercalcemia. Our aim is to prevent this observed issue of hypercalcemia by designing non-
secosteroidal VDR agonists.
Through previous in silico screening efforts performed by the Kotra group, a series of small
molecules were selected and evaluated for activity towards VDR. Three candidate compounds
were selected (KP-156, 162, and 172), and were re-synthesized to reproduce observed activities.
These compounds possess a central, tri-substituted pyrimidine scaffold, representing a complete
non-secosteroidal structure. An elaborate and efficient synthetic route has been devised which
affords key intermediates readily. An cyclocondensation reaction between substituted 3-ketoesters
and amidines affords a key tri-substituted pyrimidine intermediate, which can be functionalized
rapidly, permitting the generation of compound libraries. To our knowledge, this is the first
reported evidence of this class of compounds to exhibit VDR agonism, as well as the first reported
synthesis in generating the key functionalized pyrimidine moiety. This work highlights significant
efforts into developing a novel synthetic route to afford this organic scaffold.43, 44
Declaration of work: All synthetic schemes, synthesis of compounds, and characterizations were
performed by Joseph M. Keca. In silico screenings were performed by Dr. William Wei.
51
6. INTRODUCTION
5.1 Physiological Implications of Vitamin D
Vitamin D has received growing attention over recent years, due to various reports describing its
pleiotropic activities. In addition to being a key dietary supplement, vitamin D has shown a role in
cancer as a chemopreventive agent, as well an immunomodulator.42, 45, 46 More recently, vitamin D
has displayed a role in lowering cholesterol, highlighting another therapeutic potential.
Conventionally, vitamin D is an essential nutrient in maintaining calcium homeostasis and bone
integrity. Consequences of vitamin D deficiency include nutritional rickets in children, as well as
osteomalacia in adults.47 In humans, endogenous production of vitamin D3 occurs via sunlight,
where the synthesis of provitamin D3 (7-dehydrocholesterol, Figure 4) occurs from acetyl-
coenzyme A.47 7-dehydrocholesterol undergoes a photochemical electrocyclic reaction upon
sunlight irradiation to form previtamin D3 (Figure 6), whereby a subsequent thermal 1,7-
sigmatropic reaction yields vitamin D3.48 Interestingly, these two key reactions which form
vitamin D3 occur in the absence of an enzyme, elucidating the importance of sunlight in these
reactions as an essential component for product conversion.
Figure 6. Biosynthetic, photochemical production of vitamin D3 in the skin. Before having the ability to perform biological functions, vitamin D3 must be metabolized into its
active form. Vitamin D3 is first hydroxylated at C-25 by hepatic CYP27A1 to form
25-hydroxyvitamin D3 (25D, Figure 6), one of the major circulating forms of vitamin D3.49 Next, a
tightly regulated 1α−hydroxylation occurs in the kidney, catalyzed by CYP27B1, to afford the
active metabolite, 1,25-dihydroxyvitamin D3 (1,25D, Figure 7). Hydroxylation at the 24R-position
52
can occur under adequate vitamin D supply and normal plasma Ca2+ concentration (9-10 mg/dl)
for both 25D and 1,25D,47 affording 1,24R,25D and 24R,25D (Figure 7). The 24-hydroxylation is
mediated by CYP24, whose expression is regulated by 1,25D binding to VDR, acting as a negative
feedback mechanism to modulate and decrease high levels of active 1,25D.50, 51 Active 1,25D
exhibits its biological activities through binding to VDR, which acts as a ligand-regulated
transcription factor.
Figure 7. Metabolism and subsequent activation of vitamin D3 into 1,25D.
53
5.2 VDR Activation and Modulation of Cholesterol
As previously noted, VDR activation plays a critical role in calcium homeostasis and phosphorus
metabolism, as well as regulation of proliferation and differentiation of cells, and
immunomodulation. More recently, and the specific purpose for our investigations into VDR
agonists, is the newly characterized role of VDR and cholesterol modulation.52 While cholesterol
is an essential component of cell membranes and steroidogenesis, elevated levels can lead to
atherosclerosis and coronary heart disease.52 Cholesterol is converted into bile acids by the 7α-
hydroxylase, CYP7A1,53 a rate-limiting enzyme in classical bile acid biosynthesis. One of the
primary negative feedback regulation mechanisms of CYP7A1 is the human farnesoid X receptor
(FXR) and human small heterodimer partner (SHP) regulatory cascade.54 FXR and SHP act to
down-regulate CYP7A1 activity, thereby preventing the conversion of cholesterol to bile acids and
subsequent modulation of cholesterol levels.52 It has been found that VDR activation acts to inhibit
SHP activity through an FXR independent mechanism, subsequently preventing the ability of SHP
to down-regulate CYP7A1.52 This up-regulation of CYP7A1 results in the direct conversion of
cholesterol into bile acids, effectively lowering cholesterol levels. The VDR-mediated cholesterol
lowering mechanism has been demonstrated in both in vitro and in vivo models, illustrating a
novel therapeutic target for cholesterol modulation.
5.3 Limitations of Dietary Vitamin D and 1,25D in Treating Hypercholesterolemia
While the novel mechanism of up-regulation of CYP7A1 through VDR induction provides a novel
therapeutic target for cholesterol lowering, the use of dietary vitamin D and its active metabolite,
1,25D, to lower cholesterol, possesses several barriers. The use of dietary vitamin D for
cholesterol is a topic of considerable debate, as the levels of 1,25D that are synthesized following
vitamin D3 ingestion are significantly low, under a therapeutically relevant level.52 Due to the
uncertainty that surrounds the use of dietary vitamin D in treating hypercholesterolemia, further
investigations are required in order to determine whether there is any therapeutic potential.
Another alternative would be the use of the active hormone, 1,25D (calcitriol, commercially
available under the brand name ROCALTROL®). The current clinical indications for
ROCALTROL® include the management of hypocalcemia and its clinical manifestations in
patients with hypoparathyroidism.55 It is also indicated in the management of secondary
hypoparathyroidism and resultant metabolic bone disease in patients with chronic renal failure
54
(both predialysis and dialysis patients).56 One of the major limitations of calcitriol treatment is the
hypercalcemic effects associated with it.57 The dose-limiting hypercalcemia of ROCALTROL®
and other 1,25D marketed drugs, prevents their use in chronic and/or acute treatment of
hypercholesterolemia. This highlights the limitation of the therapeutic potential of 1,25D, due to
induction of elevated high circulating calcium concentrations.
While analogues of calcitriol have been developed with reduced hypercalcemic effects –
paricalcitol (ZEMPLAR®) and doxercalciferol (HECTOROL®) – subsequent dose-limiting
hypercalcemia still remains.58, 59 The hypercalcemic effects of 1,25D have been proposed to be
associated with the secosteroidal nature of vitamin D and its active metabolites.60, 61 As a result,
efforts have been made to consider non-secosteroidal VDR agonists to circumvent the
hypercalcemia limitations of 1,25D treatment. A variety of 1,25D analogues have been developed
with no associated hypercalcemic effects, while maintaining the ability to induce VDR.62
However, poor efficacy and potency of these compounds have resulted in clinical trial failures.42
Currently, there are new non-secosteroidal VDR agonists emerging that demonstrate VDR
agonism in vitro.60 Further studies are required to investigate the therapeutic potential of these
compounds in animal models, and ultimately humans. Accordingly, a major focus of these studies
was the identification and synthesis of a non-secosteroidal VDR agonist, with potential to be used
in treating hypercholesterolemia, without the observed hypercalcemic effects of secosteroidal
VDR ligands.
5.4 Rationale
In silico screening efforts were applied to identify non-secosteroidal small molecules with
potential agonist activity to VDR. Previous work from the Kotra group analyzed the 34 available
VDR crystal structures in the protein databank to understand the three-dimensional features of the
ligand binding site. Using the X-ray crystal structures of VDR bound by 1,25D in the binding
pocket, key binding interactions were defined. After carefully screening a library of molecules in
the VDR, 128 hit compounds were identified. From these 128 hit compounds, 67 compounds were
purchased from vendors, and were screened through biological evaluations performed by the
groups of Drs. Sandy Pang and Carolyn Cummins. Of these compounds, three compounds were
the most active (KP-156, KP-162, and KP-172, Figure 8).
55
Figure 8. Selected hit compounds identified through in silico screening with potential VDR agonist activity.
The biological evaluation of the three compounds indicated a potential role as VDR agonists. The
focus of this project was to confirm these observations, which required the compounds to be
synthesized in house, requiring an effort to design a synthetic process for these compounds. A
retrosynthetic analysis was implemented to design a feasible, efficient route to target compounds
(Scheme 5). To our knowledge, there is no reported synthesis of the 2-(piperidin-3-yl)-6-(pyridin-
4-yl)pyrimidin-4-ol scaffold (KP-156 and KP-172), as well as the 6-(piperidin-3-yl)-2-(pyridin-4-
yl)pyrimidin-4-ol scaffold (KP-162), which required significant effort to develop a feasible and
effective synthesis for these compounds. After exploring a variety of synthetic pathways, a
feasible and effective synthetic strategy was developed to generate the 2-(piperidin-3-yl)-6-
(pyridin-4-yl)pyrimidin-4-ol scaffold in high yields. This synthetic approach can be manipulated to
produce KP-162, which possesses inverted regiochemistry in the pyrimidine scaffold.
5.5 Hypothesis
Develop a synthetic pathway to access and re-synthesize KP-156, KP-162, and KP-172, such that
these compounds can be analyzed for their VDR agonist activities.
56
Scheme 5. Retrosynthetic analysis of VDR agonist hit compounds. Panel A: Retrosynthetic route of KP-156 and KP-172, sharing identical regiochemistry on pyrimidine core. Panel B: Retrosynthetic route of KP-162, possessing inverse regiochemistry to KP-156/KP-172 on pyrimidine core.
A
B
57
7. RESULTS AND DISCUSSION
6.1 Synthetic Approach of 6-(pyridin-4-yl)pyrimidine Rings Using Substitutions and
Cyclocondensations
The initial synthetic approach for the target compounds (KP-156,162, and 172) utilized 2,4,6-
trichloropyrimidine as a core building block. Due to the tri-halide functionality, it would be
possible to implement the desired three substitutions observed in the target compounds. The first
step involved introducing 4-pyridyl at C-6 in the pyrimidine ring. Generating this functionality
posed numerous synthetic challenges. Refer to Scheme 6. This was observed in 1, as generating
the free base of 4-bromopyridine hydrochloride resulted in immediate polymerization within
minutes. Consequently, approaches were taken to circumvent these initial issues. Liberation of free
base 1 in a suitable base and organic solvent was achieved in minutes, which was directly
converted to the corresponding pyridine-N-oxide (PNO) 2. This compound displayed improved
stability, including absent polymerization and stability under atmospheric conditions.
Additionally, pyridine-N-oxides possess favourable characteristics not observed in pyridine alone,
such as increased nucleophilicity and electrophilicity, higher dipole-moment [4.37 D (PNO) versus
2.03 D (pyridine)], and decreased basicity [pKa = 0.79 (PNO) versus pKa = 5.2 (pyridine)].63 The
modulated nucleophilic and electrophilic properties of 2 led to various synthetic strategies to
introduce 4-pyridyl at C-6 on 2,4,6-trichloropyrimidine.
Previous synthetic approaches have utilized direct nucleophilic substitutions using
4-lithiopyridyl species, generated from the corresponding 4-halopyridine.64 Moreover, the
corresponding Grignard derivative of 2 could be implemented as another nucleophile (3). Both
approaches were attempted, and the formation of the lithium salt of 2 and the Grignard 3 were
readily produced. However, complications arose when attempting to directly add 2 or 3 onto 2,4,6-
trichloropyrimidine. In both cases, rapid polymerization and degradation of the pyridine-N-oxide
derivative was observed. Attempts were made using the N-oxide free corresponding 4-
bromopyridine, but to no avail. Efforts using lithium-mediated or magnesium mediated
nucleophilic addition resulted in no product formation.
To circumvent these issues, attempts were considered to directly build the pyrimidine ring, with
the desired 6-(pyridin-4-yl)pyrimidine functionality. To achieve this, a cyclocondensation
58
approach was formulated which involves a 3-ketoester (5) and urea or thiourea (6). This approach
was first reported in 1972,65 which has been refined further in a number of publications to reduce
reaction times and improve product yields.66, 67 Firstly, the corresponding 3-ketoester derivative of
pyridine was synthesized using classical Claisen condensation conditions, to afford 5 in excellent
yields. Next, a variety of synthetic approaches were used to generate 7 via cyclocondensation
between 5 and 6 (or thiourea). Solvent-free, Bronsted-acid, and Lewis-acid mediated approaches
were attempted, however, no product conversion was observed. Using sodium methoxide and
elevated temperatures produced 7 in low-to-moderate yields, which was further optimized to
reduce reaction durations to 15 minutes by use of microwave irradiation. Subsequent aromatization
of the pyrimidine ring and chlorination was attempted using phosphorus (V) oxychloride, thionyl
chloride, and oxalyl chloride. However, in all three cases, implementing a variety of reaction
conditions, no conversion to 8 was observed. As a result of this, the synthetic approach required
modifications to alleviate these issues, as without 8, the formation of target 17 is unattainable.
Scheme 6. Initial synthetic approach for the generation of the pyrimidine ring.
59
6.2 Suzuki Cross-Coupling Approach in the Formation of 2,4-dichloro-6-(pyridin-4-
yl)pyrimidine
With the observed barriers of the previous synthetic approach, attempts were made to circumvent
these by the use of Suzuki cross coupling. This well-known methodology involves the palladium-
catalyzed cross coupling between organoboronic acid/boronic esters, and halides. Specifically, the
organoboronic acid/boronic ester is an sp2 carbon centre, with the halide having sp2 or sp3
hybridization. With significant developments over the past few decades, the versatility of Suzuki
coupling has broadened enormously, such that the scope of reaction partners is not restricted to
aryls, but includes alkyls, alkenyls, and alkynyls. Previously, Suzuki reactions were performed in
our group using methoxyphenyl boronic acid and nitrophenyl boronic acid derivatives with 2,4,6-
trichloropyrimidine as a coupling partner with considerable success in each case. As a result of the
successes observed in phenylboronic acids couplings to 2,4,6-trichloropyrimidine, this
methodology was directly implemented for the formation of the 2,4-dichloro-6-(pyridin-4-
yl)pyrimidine core structure.
Initial attempts were made using 9 and pyridin-4-ylboronic acid 10. Pd(PPh3)4 was used as an
initial palladium catalyst, with Na2CO3 as a base, and 1,2-dimethoxyethane (DME) as a solvent.
Preliminary reactions proved unsuccessful, with visible polymerization occurring rapidly upon
complete reagent addition. Catalyst loading with Pd(PPh3)4 was modulated between 0.5 mol%, to a
maximum of 10 mol%. Additionally, the base and solvent were modified. However, in all trials
performed, no evidence of the formation of 8 was observed. This resulted in re-evaluation of the
catalyst choice, as well as the incorporation of ligands to promote product conversion. It is well
known that the oxidative addition step in the Suzuki mechanism is the most energetically
unfavourable event. As such, electron rich palladium catalysts, due to strongly electron rich
ligands, circumvent these issues. This led to the application of a variety of combinations between
palladium catalysts and ligands (Table 10).
Pd2dba3 was applied, with the bulky, electron-rich ligands, XPhos and RuPhos. Additionally, a
variety of bases were employed, due to the importance of boronic acid activation. Activation of the
boron atom enhances the polarization of the organic ligand, subsequently facilitating
transmetallation. After numerous trials between 9 and 10, which included a variety of
60
combinations among Pd2dba3, Pd(OAc)2, XPhos and RuPhos, bases, and solvents, as well as
modulation of catalyst percent loading to ligand percent loading, no product conversion to 8 was
observed. Potassium pyridine-4-trifluoroborate was also implemented as an organotrifluoroborate
reagent, as organotrifluoroborates have been shown to couple well with unactivated aryl and alkyl
halides.68 After attempts using Pd2dba3 and Pd(OAc)2 as catalysts, XPhos, RuPhos, and PPh3 as
ligands, in a variety of combinations and loading percentages, no formation of 8 was observed.
Additionally, 2,4-dichloro-6-methoxypyrimidine was synthesized as a slightly activated aryl halide
coupling partner. It was predicted that methoxy substitution on the pyrimidine ring would
contribute electron density to the system, facilitating the oxidative addition to palladium. Since the
tri-chloro substituted 9 is electron deficient and deactivated, introduction of methoxy would
significantly alter the electronics of the pyrimidine ring, thereby potentially affording 8. After a
variety of trials between 2,4-dichloro-6-methoxypyrimidine and 10 or pyridine-4-trifluoroborate,
no formation of 11 was observed.
After unsuccessful trials, another highly bulky, electron rich palladium catalyst was employed,
(t-Bu)2P(OH)]2PdCl2 (abbreviated as POPd). This air-stable palladium-phosphinous acid based
catalyst has been shown to successfully couple a variety of unactivated aryl and vinyl halides with
numerous arylboronic acids and organozinc reagents.69, 70 An extensive investigation into the
application of the POPd catalyst took place, which utilized the organoboronic reagent 10, as well
as a synthesized 4-pyridineboronic acid pinacol ester, with a variety of aryl halide coupling
partners. Trials were attempted with 9 and 10, utilizing a variety of catalyst loadings, bases, and
solvents. In all trials, no observable formation of 8 was observed. Attempts with 6-chlorouracil as
a halide coupling partner with 10 was also unsuccessful. Moreover, use of 4-pyridineboronic acid
pinacol ester and 9 led to no observable formation of 8, regardless of catalyst loadings, bases, or
solvents used. As a result of this, we concluded that palladium-mediated cross-couplings between
halogenated pyrimidines and 4-halopyridines is an unsuccessful synthetic strategy, warranting
alternative approaches in the formation of 6-(pyridin-4-yl)pyrimidine functionality.
61
Scheme 7. Formation of C-6 para-pyridine substituted pyrimidine using Suzuki-Miyaura transition metal mediated cross-coupling.
62
Table 10. Suzuki-Miyaura cross-coupling trials incorporating a variety of palladium catalysts, bases, solvents, and reaction conditions. Trial Organic boronic
acid Derivative Halide Palladium
Catalyst Ligand Base Solvent Temperature
(oC) Time
(h)
1
Pd(PPh3)4 None Na2CO3 DME 80 4
2
Pd(PPh3)4 None K2CO3 DME 90 24
3
Pd(PPh3)4 None K2CO3 1,4-dioxane 110 24
4
Pd(PPh3)4 None K2CO3 n-butanol 100 24
5
Pd2dba3 XPhos K3PO4 n-butanol 100 24
6
Pd2dba3 XPhos K2CO3 1,4-dioxane 105 24
7
Pd2dba3 XPhos K3PO4 1,4-dioxane 100 24
8
Pd2dba3 XPhos K3PO4 n-butanol 100 24
9
Pd(OAc)2 RuPhos K2CO3 Ethanol 85 24
10
Pd(OAc)2 RuPhos K3PO4 Ethanol 85 24
63
11
Pd(OAc)2 RuPhos K2CO3 1,4,-dioxane 105 24
12
Pd2dba3 XPhos K2CO3 1,4-dioxane r.t. 24
13
Pd(OAc)2 RuPhos Na2CO3 Ethanol 85 18
14
Pd2dba3 RuPhos K2CO3 1,4-dioxane 100 24
15
Pd(OAc)2 PPh3 Na2CO3 THF/H2O 90 24
16
POPd None K2CO3 1,4-dioxane 100 24
17
POPd None K2CO3 1,4-dioxane/H2O
100 24
18
POPd None K2CO3 THF 85 24
19
POPd None K2CO3 1,4-dioxane 110 24
20
POPd None NEt3 DMF 120 24
21
POPd None K2CO3 DMF 120 24
64
22
POPd None NEt3 DMF 120 24
23
POPd None K2CO3 1,4-dioxane/H2O
90 18
24
Pd(PPh3)4 None Na2CO3 DME/H2O (6:1)
80 24
6.3 Synthetic Approaches to 2,4-dichloro-6-(pyridin-4-yl)pyrimidine Moiety Utilizing Uracil as a
Building Block
With previous efforts failing to afford the core 2,4-dichloro-6-(pyridin-4-yl)pyrimidine moiety,
synthetic strategies involving uracil as a central building block were devised. In this approach
(Scheme 8), the substitution on C-6 in uracil is implemented, by modulation of kinetic and
thermodynamic properties of uracil through temperature and base modulations. The first approach
involved the generation of the anion at uracil C-6 by treatment with LDA at -78oC. It is well
known that C-6 anion formation is selective over C-5 when treated with LDA at this temperature.
Formation of this anion has been extensively used as a nucleophile on a variety of aryl and alkyl
electrophiles. With this knowledge, the C-6 uracil anion was treated with 1, however, no evidence
of 7 was observed. Instead, 1 was completely consumed in undesired, polymerization side
reactions. The reciprocal was also attempted, where 4-lithiopyridine was generated in situ (not
shown), and was added over 18. As observed previously, product conversion to 7 did not occur.
A second approach was implemented, involving the copper(I) iodide and cesium carbonate
mediated coupling of aryl halides to C-6 of uracil. In this synthetic strategy, uracil was protected
with benzyl bromide, to reduce the possibility of side reactions, including the generation of
multiple anions on free uracil. Subsequent deprotection and aromatization/chlorination of benzyl-
protected uracil 20 would then afford the desired product 8, allowing for a variety of
functionalization to the pyrimidine core. While copper(I) iodide is not required for substitution on
65
uracil, it has been shown to selectively increase the ratio between C-6 and C-5 substitution
products.71 First, 18 was protected with benzyl bromide, generating 20. Coupling between 20 and
1 was attempted using copper(I) iodide and cesium carbonate in N,N-dimethylformamide at
elevated temperatures. No evidence of 21 was observed, regardless of temperature and reaction
duration. Trials were attempted with the addition of Pd(OAc)2 and PPh3. However, all trials were
unsuccessful in generating the desired product 21. With these unsuccessful strategies using uracil
as a core building block, it was decided to abandon further investigations into these
methodologies, and explore other synthetically feasible intervention strategies.
Scheme 8. Synthetic approaches utilizing uracil substitution methodologies.
66
6.4 Construction of 6-(pyridin-4-yl)pyrimidine Moiety with 2-Chloropyrimidine as a Core
Building Block
The previous synthetic strategies utilizing 2,4,6-trichloropyrimidine 9 resulted in unsuccessful
outcomes in the generation of key intermediates. The significant electron deficient properties, as
well as a strong propensity to undergo competing polymerizations, led to the investigation into
alternative core building blocks that possess the pyrimidine functionality. A strategy was devised
(Scheme 9) which applies 2-chloropyrimidine 24 as a core building block. The electronics of the
pyrimidine ring in 24 is significantly different to its di- and tri-chloro substituted counterparts. As
a result, the electron density in 24 allows for greater versatility in synthetic approaches.
Additionally, functionalization at C-4 and C-6 on 24 is well characterized, constituting
investigating synthetic approaches with it as a core building block.
The synthetic approach involves the generation of 4-lithiopyridine 23 from the corresponding 4-
bromopyrimidine hydrochloride 1. Subsequent addition to 24 selectively adds at C-6, generating
compound 25 in low to moderate yields. The regeneration of aromaticity was readily achieved in
quantitative yields using the oxidizing agent DDQ, affording 26. The next approach was to
functionalize selectively at C-2 on 26 with 13, using an n-Bu3Sn-adduct intermediate through
treatment with n-Bu3SnLi (formed in situ from LDA and n-Bu3SnH).72 Formation of the n-Bu3Sn-
adduct 27 was not achieved after several attempted trails. In all cases, formation of the adduct was
not observed, consequently halting the addition of 13 at C-2.
To circumvent these issues, the formation of the n-Bu3Sn-adduct was directly attempted on 24,
which has been previously reported.72 The n-Bu3Sn-adduct 28 was obtained in moderate yields,
with subsequent treatment of 13 affording the desired C-2 functionality. Dehydration of 29 using
phosphorus (V) oxychloride and pyridine afforded the unsaturated product 30 in good yields.
Catalytic hydrogenation was employed on 30 to afford 31 in quantitative yields. Next, introduction
of 4-pyridyl at C-6 on 31 was attempted using the same successful protocol in the formation of 25.
After several attempts, no evidence of product 32 was observed, with considerable polymerization
occurring. Subsequent hydroxylation and reductive aminations would afford target 17. However,
without key intermediate 33, this synthetic approach was rendered ineffective.
67
This synthetic strategy highlights the errors attempting to derivatize core pyrimidine building
blocks with the 4-pyridyl functionality. Due to the well-known instability and poor reactivity of 4-
pyridyl in coupling and substitution reactions, investigating alternative synthetic approaches
circumventing these continuously observed issues became the focus of subsequent synthetic
strategies.
Scheme 9. Synthesis of pyrimidine core using 2-chloropyrimidine as a central building block.
68
6.5 Synthetic Strategy Involving the Construction of the Pyrimidine Core via Cyclization of
3-Ketoesters and Amidines to Afford KP-156 and KP-172
Previous synthetic strategies were based upon the utilization of a core pyrimidine or uracil
backbone, with subsequent derivatizations involving 4-pyridyl at C-6. The introduction of
4-pyridyl at C-6 on pyrimidine proved to be challenging when using 2,4,6-trichloropyrimidine 9,
as well as 2-chloropyrimidine 24. These barriers throughout the synthetic strategies based upon
this paradigm caused renewed interest into the construction of the pyrimidine ring. Initial attempts
utilized a cyclocondensation reaction between ethyl-3-oxo-3-(pyridin-4-yl)propanoate 5 and
urea/thiourea. However, regeneration of aromaticity and subsequent chlorination proved difficult.
It has been shown that the construction of pyrimidine rings can be achieved through a cyclization
mechanism between 3-ketoesters and amidines.70, 73 As a result of this, and following careful
examination of the cyclization mechanism, I devised the constructs of amidine 38 and 3-ketoester
5. These critical intermediates were predicted to undergo a cyclization to afford 39, which
possesses all three desired substitutions and functionalities on the core pyrimidine backbone in
target 17.
This new synthetic scheme eliminates several steps to the target 17, as well generating a core
intermediate 33, which can be readily functionalized with a variety of alkyl bromides 41, rapidly
generating a large library of compounds. Due to the limited commercial availability of 38,
including fiscal issues, a facile synthetic scheme was devised which utilized low cost materials.
DL-Nipecotic acid 34 is commercially available and inexpensive, and was readily converted into
N-boc-protected 35 in excellent yields. Conversion of 35 carboxylic acid into amide was achieved
through a rapid, two-step protocol involving activation with isobutyl chloroformate, and
subsequent treatment with ammonium hydroxide, generating 36. Next, the methyl imidolate 37
was quickly formed in excellent yields by treatment of 36 with trimethyloxonium
tetrafluoroborate. The activated compound 37 was then converted to its corresponding amidine
hydrochloride salt 38, by use of ammonium chloride in methanol, under refluxing conditions.
As previously mentioned, the corresponding 3-ketoester derivative of pyridine was synthesized
using classical Claisen condensation conditions, to afford 5. The synthesis of the crucial
69
intermediates 5 and 38 allowed for the attempt at the cyclization protocol. Treatment of these
compounds with a suitable base (K2CO3), and in an appropriate solvent (ethanol), resulted in the
key intermediate 39 in good yields. Deprotection of 39 by treatment with TFA eluted 33, allowing
for substitutions to occur at N-1 of piperidine. Attempts were made to derivatize 33 by means of
reductive amination by suitable substituted benzaldehydes 16. However, after utilizing a variety of
borohydride reagents and reaction conditions, the methodology proved ineffective. This led to the
reduction of substituted benzaldehydes (16) using NaBH4, to afford free, primary hydroxyl
derivatives 40.
Activation of hydroxyl derivatives 40 by mesylation was attempted to improve the electrophilicity
of compounds, aiding in addition to the piperidine nitrogen of 33. A variety of reaction conditions
were employed, but to no avail, as 17 was not observed. A successful approach was devised, in
synthesizing the corresponding alkyl bromide from 40, mediated by CBr4 and PPh3, to afford 41.
Treatment of 33 with 41 led to the formation of 17 in good yields. An alkyl iodide derivative of 41
was synthesized and subjected to the same reaction conditions with 33. Formation of target 17 was
obtained, yielding both KP-156 and KP-172. To our knowledge, this is the first disclosed synthesis
of a 2-(piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol functionality using this approach. With
pyrimidine scaffolds playing a prominent role in drug discovery and design, this novel synthetic
design allows for access to these moieties, with the ability to derivatize rapidly for library
generation.
70
Scheme 10. Refined approach at the generation of VDR agonists using amidine intermediates for cyclizations, affording KP-156 and KP-172.
71
6.6 Implementation of Amidine and 3-Ketoester Cyclization to Afford KP-162
With the success of the cyclization protocol between 3-ketoesters and amidines to afford KP-156
and KP-172, the methodology was directly applied into the synthesis of KP-162. KP-162 differs
from KP-156 and KP-172 by the reversal of regiochemistry in the pyrimidine ring, where C-2
contains a 4-pyridyl functionality, and C-6 possesses a 1,3-piperidinyl moiety. To obtain the key
intermediate 48, it was necessary to reverse the 3-ketoester and amidine building blocks used in
the synthesis of KP-156 and KP-172. Instead, in this synthesis, the 3-ketoester 46 and amidine 47
was required in order to afford 48 (Scheme 11). Due to the limited commercial availability of 46,
in house synthesis was necessary. An efficient and facile protocol was devised, which includes
boc-protection of piperidin-3-ylmethanol 42 to afford 43, with subsequent PCC mediated
oxidation to obtain 44. Due to the instability of 44, it was necessary to immediately convert it to
46, by a two-step procedure involving coupling of 44 and 45 by Wilkinson’s catalyst and
diethylzinc, with subsequent oxidation by Dess-Martin periodinane to afford 46.
Obtaining the key intermediate 46 allowed for the cyclization protocol to be implemented with
amidine 47. Utilizing the same conditions outlined for 33, compound 48 was obtained in excellent
yields. The building block 52 was synthesized from vanillin 49, beginning with benzyl protection
of phenolic hydroxyl affording 50. Subsequent reduction to 51 allowed for facile conversion into
52, by use of CBr4 and PPh3 mediated bromination. Coupling of 48 and 52 afforded 53 in excellent
yields. Deprotection of 53 by use of hydrogenolysis conditions resulted in KP-162 in quantitative
yields. The synthesis of KP-162 highlighted the versatility of the cyclization protocol between 3-
ketoesters and amidines, whereby these substituents can be modulated to afford a diverse library of
substituted pyrimidine scaffolds.
72
Scheme 11. Synthesis of KP-162 utilizing 3-ketoester and amidine cyclization protocol.
73
8. CONCLUSION
The novel mechanism of up-regulation of CYP7A1 through VDR induction suggests a therapeutic
target for cholesterol management. The dose-limiting hypercalcemia of 1,25D (commercially
available as ROCALTROL®), and uncertainty in using dietary vitamin D for cholesterol lowering,
led to investigations into non-secosteroidal VDR agonists. KP-156, KP-162, and KP-172 were
lead compounds obtained through previous in silico screenings by the Kotra group, and were
subsequently resynthesized in house to confirm the observed VDR agonism. An extensive
investigation into the synthesis of these compounds led to the formation of a novel synthetic route,
utilizing a key cyclization between 3-ketoesters and amidines to afford tri-substituted pyrimidine
scaffolds readily. KP-156, KP-162, and KP-172 were synthesized according to this protocol.
9. EXPERIMENTAL SECTION
General. All reactions were performed under N2 in oven-dried glassware. Flash chromatography
was performed using distilled solvents from Sigma-Aldrich. All solvents and reagents were
obtained from commercial sources; anhydrous solvents were prepared following standard
procedures. Chromatographic purifications were performed using performed using 60 Å (70–230
mesh) silica gel with the indicated solvents as eluents. TLC analysis was performed using EMD
TLC Silica gel 60 F254 Aluminum sheets and visualized using UV light, ninhydrin, iodine, vanillin,
and phosphomolybdic acid stains. Final products were purified by LC/MS on a Waters LC/MS
system equipped with a photodiode array detector using an XBridge semipreparative C18 column
(19.2 mm x 150 mm, 5 µm). Mass spectra were recorded using ESI Waters system (+ve) mode.
All HPLC solvents were filtered through Waters membrane filters (47 mm GHP 0.45 µm, Pall
Corporation). Injection samples were filtered using Waters Acrodisc® Syringe Filters 4 mm PTFE
(0.2 µm). NMR spectra were recorded on a Bruker spectrometer (400 MHz for 1H; 101 MHz for 13C). Chemical shifts are reported in δ ppm using tetramethylsilane or the deuterated solvent as the
reference. Compounds listed in procedures that were not otherwise mentioned in the
aforementioned schemes were also obtained from commercially available sources.
1-(tert-Butoxycarbonyl)piperidine-3-carboxylic acid (35): To a reaction vessel charged with
nitrogen was added 34 (179 mg, 1.39 mmol) and sodium carbonate (551 mg, 5.20 mmol), in 10
74
mL of a 1:1 THF/H2O mixture at 0oC. Next, Di-tert-butyl dicarbonate (333 mg, 1.53 mmol) was
added in several portions over 10 minutes, and the reaction mixture was set to stir for 2 hours after
complete addition. Once the reaction was confirmed complete by TLC analysis, THF was removed
under reduced pressure, and the reaction vessel was place on an ice bath. The reaction mixture was
then acidified to pH 3 by 1M HCl at 0oC, causing a precipitate to form, and the aqueous mixture
was extracted with ethyl acetate (3 x 10 mL). The organic layers were combined and washed with
water (2 x 5 mL), and saturated brine solution (10 mL). ). The organic layers were combined, dried
over magnesium sulfate, and concentrated in vacuo. To the crude product, 3 mL of CH2Cl2 and
0.5 g of silica was added. The volatile compounds were removed in vacuo, and the white silica
powder was placed on a column. The crude product mixture was purified using flash column
chromatography on silica gel (gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to
afford 35 as a white solid: 290 mg, 91% yield; 1H NMR (CDCl3) δ 1.46 (s, 9 H), 1.54 - 1.76 (m, 1
H), 1.99 - 2.17 (m, 2 H), 2.43 - 2.62 (m, 2 H), 2.86 (t, J=1.0 Hz, 2 H), 3.89 (d, J=13.3 Hz, 2 H),
10.68 (br. s., 1 H); 13C NMR (CDCl3) δ 179.0, 154.7, 79.9, 41.1, 28.4, 27.2, 24.1, 10.3.
tert-Butyl 3-carbamoylpiperidine-1-carboxylate (36): To a reaction vessel charged with
nitrogen was added 35 (50 mg, 218 µmol) in 3 mL of anhydrous THF. The reaction vessel was
then placed on a 1,4-dioxane/water bath, and to it was added triethylamine (36 µL, 257 µmol), and
set to stir for 5 minutes at this temperature. Next, isobutyl chloroformate (33 µL, 251 µmol) was
added, and the resulting solution was stirred for 15 minutes. After this duration in time,
ammonium hydroxide (1 mL) was added, and the reaction mixture was allowed to stir for 10
minutes. Once the reaction was confirmed complete by TLC analysis, THF was removed under
reduced pressure, and water (3 mL) was added to the mixture. The aqueous solution was extracted
with ethyl acetate (2 x 5 mL), combined, washed with saturated sodium bicarbonate (10 mL),
saturated brine solution (5 mL), dried over magnesium sulfate, and concentrated in vacuo. No
additional purification was required, and 36 was obtained as a white solid: 41 mg, 82% yield; 1H NMR (CDCl3) δ 1.44 (s, 9 H) 1.59 - 1.77 (m, 2 H) 1.76 - 1.96 (m, 2 H) 2.31 - 2.42 (m, 2 H)
3.83 (s, 1 H) 3.93 (br. d, J=1.0 Hz, 2 H).
tert-Butyl 3-(imino(methoxy)methyl)piperidine-1-carboxylate (37): To a reaction vessel
charged with nitrogen, was added 36 (282 mg, 1.24 mmol) in 10 mL of anhydrous CH2Cl2, and
placed on an ice bath. To this mixture was added trimethyloxonium tetrafluoroborate (238 mg,
75
1.61 mmol) in several portions of 5 minutes, where after complete addition the reaction vessel was
allowed to warm to room temperature, and stir for 2 hours. Once the reaction was confirmed
complete by TLC analysis, the reaction vessel was placed on an ice bath, and to it was added
saturated sodium bicarbonate solution (15 mL). The aqueous mixture was then extracted with
CH2Cl2 (2 x 15 mL). The organic layers with combined, washed with saturated brine solution (15
mL), dried over magnesium sulfate, and concentrated in vacuo to afford 37 as a clear, colourless
oil. Further purification was not required: 280 mg, 94% yield; 1H NMR (CDCl3) δ 1.32 (s, 9 H),
1.80 - 2.12 (m, 1 H), 2.29 (d, J=6.0 Hz, 1 H), 3.49 (m, J=6.9 Hz, 1 H), 3.70 (m, J=7.3 Hz, 1 H),
3.76 (s, 3 H), 3.81 (m, J=7.3 Hz, 1 H), 3.84 - 3.87 (m, 2 H), 3.95 (m, J=6.5 Hz, 1 H).
tert-Butyl 3-carbamimidoylpiperidine-1-carboxylate hydrochloride (38): To a flame-dried
RBF charged several times with nitrogen, was added 37 (2.74 g, 11.30 mmol) and 6 mL of
anhydrous CH3OH. Powdered ammonium chloride (616 mg, 11.53 mmol) was then added, and the
mixture was set to reflux for 2.5 hours. Once the reaction was confirmed complete by TLC
analysis, solvent was removed under reduced pressure. The resulting solid was then washed with
CH2Cl2 (30 mL) and filtered. The solid was further washed with CH2Cl2 (2 x 15 mL), whereby the
solid was collected, and dried under reduced pressure overnight to afford 38 as a white solid: 2.20
g, 89% yield; 1H NMR (MeOD-d4) δ 1.48 (s, 9 H), 1.78 - 1.84 (m, 1 H), 1.86 (m, J=3.5 Hz, 1 H),
2.05 - 2.12 (m, 1 H), 2.66 - 2.68 (m, 1 H), 2.83 - 2.93 (m, 1 H), 3.02 - 3.17 (m, 1 H), 3.52 (m,
J=7.00 Hz, 1 H), 4.03 (m, J=13.1 Hz, 1 H), 4.17 (m, J=12.5 Hz, 1 H); 13C NMR (D2O) δ 173.4,
82.2, 73.2, 72.2, 50.1, 49.5, 49.1, 42.1, 28.9, 25.3, 19.6.
Ethyl-3-oxo-3-(pyridin-4-yl)propanoate (5): To a flame-dried RBF, charged several times with
nitrogen, was added anhydrous ethyl acetate (19.72 mL, 201 mmol), and was placed on an ice
bath. To this mixture at 0oC was added sodium hydride (1.05 g, 26.3 mmol) in several portions
over 5 minutes, and the mixture was allowed to stir for an additional 5 minutes. Next, ethyl
isonicotinate (5.93 mL, 39.6 mmol) was added drip-wise over 10 minutes, whereby after complete
addition, the reaction mixture was then heated to reflux for 3 hours. Once the reaction was
confirmed complete by TLC analysis, the reaction vessel was cooled on an ice bath, and to it was
added ice water (20 mL). The aqueous mixture was then acidified to pH 6 with 5% citric acid
solution, and the resulting mixture was extracted with ethyl acetate (2 x 30 mL). The organic
layers were combined, washed with water (20 mL), saturated sodium bicarbonate (20 mL),
76
saturated brine solution (25 mL), dried over magnesium sulfate, and concentrated in vauco. The
crude product mixture was directly purified using flash column chromatography on silica gel
(gradient, ethyl acetate:hexanes, 25% to 60% over 20 minutes) to afford 5 as an off-white solid:
5.85 g, 83% yield; 1H NMR (CDCl3) δ 1.29 (t, J=7.2 Hz, 3 H), 3.95 (s, 2 H), 4.23 (q, J=1.0 Hz, 2
H), 7.55 (d, J=1.0 Hz, 2 H), 8.65 (d, J=1.0 Hz, 2 H).
tert-Butyl-3-(4-hydroxy-6-(pyridin-4-yl)pyrimidin-2-yl)piperidine-1-carboxylate (39): To a
flame-dried RBF, charged several times with nitrogen, was added 38 (2.17 g, 9.55 mmol), and
powdered potassium carbonate (2.46 g, 17.8 mmol) in 10 mL of anhydrous ethanol, and set to stir
for 30 minutes at room temperature. To the reaction mixture was added 5 (1.28 g, 6.63 mmol) in 5
mL of anhydrous ethanol. After complete addition, the reaction mixture was then heated to 75oC
for 24 hours. Once the reaction was confirmed complete by TLC analysis, solvent was then
removed under reduced pressure. Water (25 mL) was then added to the resulting residue, and was
subsequently extracted with ethyl acetate (3 x 20 mL). The organic layers were combined, washed
with saturated sodium bicarbonate (25 mL), saturated brine solution (25 mL), dried over
magnesium sulfate, and condensed under reduced pressure. To the remaining residue was added 20
mL CH2Cl2 and 3.0 g silica, and the volatile compounds were removed in vacuo. The resulting
white silica powder was placed on a column, and purified via flash chromatography on silica gel
(gradient, methanol:dichloromethane, 1% to 5% over 20 minutes), to afford 39 as a white solid:
1.21 g, 54% yield; 1H NMR (CDCl3) δ 1.47 (s, 9 H), 1.81 - 2.01 (m, 1 H), 2.15 (m, J=13.6 Hz, 1
H), 2.31 - 2.39 (m, 1 H), 2.69 - 2.78 (m, 1 H), 2.82 - 2.94 (m, 1 H), 3.01 (t, J=13.1 Hz, 1 H), 3.82 -
3.91 (m, 1 H), 4.01 (m, J=13.8 Hz, 1 H), 4.20 - 4.31 (m, 1 H), 6.85 (s, 1 H), 7.90 (d, J=1.0 Hz, 2
H), 8.69 (d, J=4.8 Hz, 3 H), 8.68 (d, J=1.0 Hz, 2 H); 13C NMR ((MeOD-d4) δ 208.5, 149.5, 144.7,
121.4, 109.2, 79.9, 47.4, 47.2, 42.4, 27.7, 27.2
2-(Piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (33): To a flame-dried RBF, charged several
times with nitrogen, was added 39 (35 mg, 98.2 µmol) in 2 mL of trifluoroacetic
acid/dichloromethane (1:9) at 0oC. The reaction mixture was then allowed to warm to room
77
temperature, and stir for 1 hour. Once the reaction was confirmed complete by TLC analysis,
solvent was then removed under reduced pressure, to afford 33 as a clear, colourless oil:
quantitative yields; 1H NMR (MeOD-d4) δ 1.66 - 1.76 (m, 1 H), 1.77 - 1.89 (m, 1 H), 1.89 - 2.02
(m, 1 H), 2.13 - 2.22 (m, 1 H), 2.69 (m, J=8.30 Hz, 1 H), 2.94 - 3.06 (m, 1 H), 3.07 - 3.19 (m, 1
H), 3.23 - 3.35 (m, 1 H), 3.47 - 3.58 (m, 1 H), 7.16 (s, 1 H), 8.58 (d, J=6.8 Hz, 2 H), 8.87 (d, J=6.8
Hz, 2 H); 13C NMR (MeOD-d4) δ 176.1, 163.8, 162.4, 160.1, 159.7, 159.3, 158.9, 155.6, 153.1,
142.0, 124.6, 119.7, 116.9, 114.0, 113.1, 111.2, 53.6, 45.0, 44.8, 43.7, 43.7, 38.1, 38.0, 27.4, 25.8,
21.1, 20.5.
2-(1-(3,5-Dimethoxybenzyl)piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (17a, KP-156): To a
flame-dried RBF, charged several times with nitrogen, was added 33 (68 mg, 0.27 mmol), and
sodium bicarbonate (67 mg, 0.80 mmol) in 8 mL of anhydrous N,N-dimethylformamide, and
allowed to stir for 30 minutes. Once complete, the reaction vessel was placed on an ice bath, and to
it was added 41 (68 mg, 0.29 mmol) in 3 mL of anhydrous N,N-dimethylformamide drip-wise over
5 minutes. Upon complete addition, the reaction mixture was allowed to warm to room
temperature, and set to stir for 24 hours. Once the reaction was confirmed complete by TLC
analysis, the mixture was quenched with water (15 mL), and the aqueous mixture was extracted
with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with water (10 mL),
saturated sodium bicarbonate (10 mL), saturated brine solution (15 mL), dried over magnesium
sulfate, and concentrated in vacuo. To the remaining residue was added 10 mL CH2Cl2 and 0.1 g
silica, and the volatile compounds were removed in vacuo. The resulting white silica powder was
placed on a column, and purified via flash chromatography on silica gel (gradient,
methanol:dichloromethane, 1% to 5% over 30 minutes), to afford 17a as a white solid: 55 mg,
75% yield; 1H NMR (CDCl3) δ 1.54 - 1.63 (m, 1 H), 1.65 - 1.92 (m, 1 H), 2.04 (d, J=12.3 Hz, 1
H), 2.12 - 2.29 (m, 1 H), 2.39 (m, J=11.5 Hz, 1 H), 2.48 - 2.55 (m, 1 H), 3.05 - 3.20 (m, 1 H), 3.35
- 3.48 (m, 1 H), 3.65 (m, J=12.3 Hz, 1 H), 3.79 (s, 2 H), 3.85 (s, 6 H), 6.42 (s, 1 H), 6.57 (s, 2 H),
6.74 (s, 1 H), 7.76 (d, J=5.8 Hz, 2 H), 8.71 (d, J=5.5 Hz, 4 H), 13.12 (br. s., 1 H); 13C NMR
(CDCl3) δ 26.9, 28.5, 53.9, 54.0, 54.3, 55.3, 55.5, 63.6, 63.7, 98.9, 100.3, 107.0, 109.8, 121.0,
128.6, 132.1, 150.5, 161.1; λmax (nm) 202.4, 229.4, 277.4, 312.4.
1-(Bromomethyl)-3,5-dimethoxybenzene (41): To a reaction vessel charged with 40 (330 mg,
1.97 mmol) in 10 mL of anhydrous CH2Cl2 was added carbon tetrabromide (982 mg, 2.98 mmol)
78
and triphenylphosphine (622 mg, 2.37 mmol) in sequential order at 0oC. The resulting reaction
mixture was then slowly warmed to room temperature, and allowed to stir overnight. Once the
reaction was confirmed complete by TLC analysis, the solvent was removed under reduced
pressure, and to the resulting residue was added hexanes (80 mL). The solid precipitate was
filtered, and the filtrate was concentrated via rotatory evaporator to afford 41 as a white solid: 389
mg, 86% yield; 1H NMR (CDCl3) δ 3.70 (s, 6 H), 4.33 (s, 2 H), 6.31 (s, 1 H), 6.45 (s, 2 H); 13C
NMR (CDCl3) δ 33.66, 55.40, 100.59, 106.96, 139.73, 160.89.
4-(2-Methoxyethoxy)benzaldehyde (55): To a flamed dried RBF was added
4-hydroxybenzaldehyde (1.97 g, 16.10 mmol) and powdered cesium carbonate (5.51 g, 16.90
mmol) in 20 mL of anhydrous N,N-dimethylformamide, and was allowed to stir for 30 mins.
Next, 2-bromoethyl methyl ether (1.59 mL, 16.90 mmol) was added drip-wise at 0oC. Upon
complete addition, the reaction vessel was warmed to room temperature, and was allowed to stir
overnight. Once the reaction was confirmed complete by TLC analysis, the solvent was removed
under reduced pressure, and to the resulting residue was added water (30 mL), and was extracted
with ethyl acetate (3 x 20 mL). The organic layers were combined, washed with water (25 mL),
saturated sodium bicarbonate (25 mL), saturated brine solution (35 mL), dried over magnesium
sulfate, and concentrated in vacuo to afford 55 as a white solid: 2.65 g, 84% yield; 1H NMR
(CDCl3) δ 3.41 (s, 3 H), 3.74 (t, J=1.0 Hz, 2 H), 4.16 (t, J=1.0 Hz, 2 H), 7.00 (d, J=8.5 Hz, 2 H),
7.79 (d, J=8.8 Hz, 2 H), 9.84 (s, 1 H); 13C NMR (CDCl3) δ 190.6, 163.7, 131.7, 129.9, 114.7, 70.5,
67.5, 58.9.
(4-(2-Methoxyethoxy)phenyl)methanol (56): To a reaction vessel charged with 55 (1.64 g, 9.10
mmol) in 15 mL of anhydrous methanol, was added sodium borohydride (860 mg, 22.75 mmol) at
0oC in several portions, and was allowed to stir at this temperature for one hour. Once the reaction
was confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to
the resulting residue was added water (40 mL), and was extracted with ethyl acetate (3 x 30 mL).
The organic layers were combined, washed with saturated brine solution (35 mL), dried over
magnesium sulfate, and concentrated in vacuo to afford 56 as a white solid: 1.35 g, 81% yield; 1H
NMR (CDCl3) δ 3.38 (s, 3 H), 3.49 (br. s., 1 H), 3.67 (t, J=1.0 Hz, 2 H), 4.02 (t, J=1.0 Hz, 2 H),
4.46 (s, 2 H), 6.83 (d, J=8.5 Hz, 2 H), 7.18 (d, J=8.5 Hz, 2 H); 13C NMR (CDCl3) δ 158.1, 133.6,
128.5, 114.5, 71.0, 67.1, 64.3, 59.1.
79
1-(Bromomethyl)-4-(2-methoxyethoxy)benzene (57): This compound was synthesized from 56
(745 mg, 4.09 mmol), carbon tetrabromide (2.03 g, 6.13 mmol), and triphenylphosphine (1.29 g,
4.91 mmol) in 15 mL of anhydrous dichloromethane, using the same procedure outlined for
compound 41. To the crude product, 40 mL of CH2Cl2 and 4.2 g of silica was added. The volatile
compounds were removed in vacuo, and the white silica powder was placed on a column. The
crude product mixture was purified using flash column chromatography on silica gel (gradient,
ethyl acetate:hexanes, 10% to 20% over 20 minutes) to afford 57 as a white solid: 710 mg, 71%
yield; 1H NMR (CDCl3) δ 3.44 (s, 3 H), 3.74 (t, J=1.0 Hz, 2 H), 4.11 (t, J=1.0 Hz, 2 H), 4.49 (s, 2
H), 6.89 (d, J=8.5 Hz, 2 H), 7.31 (d, J=8.5 Hz, 2 H); 13C NMR (CDCl3) δ 158.9, 130.4, 130.2,
114.9, 70.9, 67.3, 59.2, 33.9.
2-(1-(4-(2-Methoxyethoxy)benzyl)piperidin-3-yl)-6-(pyridin-4-yl)pyrimidin-4-ol (17b, KP-
172): This compound was synthesized from 33 (74 mg, 0.29 mmol) and 57 (78 mg, 0.32 mmol),
using the same procedure outlined for 17a (KP-156). To the crude product, 10 mL of CH2Cl2 and
0.4 g of silica was added. The volatile compounds were removed in vacuo, and the white silica
powder was placed on a column. The crude product mixture was purified using flash column
chromatography on silica gel (gradient, methanol:dichloromethane, 2% to 8% over 30 minutes) to
afford 17b (KP-172) as a white solid: 15 mg, 15% yield; 1H NMR (CDCl3) δ 1.63 - 1.86 (m, 2 H),
2.03 (m, J=12.8 Hz, 1 H), 2.12 - 2.27 (m, 1 H), 2.34 (m, J=10.0 Hz, 1 H), 2.42 - 2.55 (m, 1 H),
3.03 - 3.26 (m, 3 H), 3.44 (s, 3 H), 3.45 (s, 2 H), 3.73 (t, J=1.0 Hz, 2 H), 4.10 (t, J=1.0 Hz, 2 H),
6.74 (s, 1 H), 6.94 (d, J=8.5 Hz, 2 H), 7.33 (d, J=8.3 Hz, 2 H), 7.76 (d, J=6.0 Hz, 2 H), 8.71 (d,
J=6.0 Hz, 2 H), 13.13 (br. s., 1 H); 13C NMR (DMSO-d6) δ 163.1, 158.3, 150.8, 144.0, 132.3,
130.6, 128.4, 121.3, 115.4, 114.6, 109.8, 70.9, 67.3, 58.6, 53.2, 28.8.; λmax (nm) 198.4, 230.4,
271.4, 277.4, 310.4.
tert-Butyl 3-(hydroxymethyl)piperidine-1-carboxylate (43): To a reaction vessel was added 42
(1.59 g, 13.8 mmol) and triethylamine (2.10 mL, 15.1 mmol) in 20 mL of tetrahydrofuran/water
(1:1) at 0oC. At this temperature was added di-tert-butyl dicarbonate (3.62 g, 16.6 mmol), and after
complete addition, was allowed to warm to room temperature and stir overnight. Once the reaction
was confirmed complete by TLC analysis, the solvent was removed under reduced pressure, and to
the resulting residue was added water (40 mL), and was extracted with ethyl acetate (3 x 30 mL).
The organic layers were combined, washed with saturated sodium bicarbonate solution (15 mL),
80
0.5M HCl (15 mL), saturated brine solution (35 mL), dried over magnesium sulfate, and
concentrated in vacuo to afford 51 as a white solid: 2.15 g, 75% yield; 1H NMR (CDCl3) δ 1.24 -
1.28 (m, 1 H), 1.46 (s, 9 H), 1.61 - 1.71 (m, 2 H), 1.82 (m, J=4.0 Hz, 2 H), 1.79 (m, J=3.8 Hz, 2
H), 2.74 (br. s., 2 H), 3.47 (t, J=5.3 Hz, 2 H), 3.90 (br. s., 2 H); 13C NMR (CDCl3) δ 171.0, 155.0,
146.6, 84.9, 79.2, 64.3, 60.2, 38.2, 28.3, 27.2, 26.9, 24.1, 20.8, 14.0.
tert-Butyl 3-formylpiperidine-1-carboxylate (44): To a stirred suspension of pyridinium
chlorochromate (3.34 g, 15.5 mmol) and celite (2.38 g) in 50 mL of anhydrous dichloromethane
was added 43 (2.22 g, 10.3 mmol) suspended in 10 mL of anhydrous dichloromethane, drip-wise
at 0oC. The mixture was then set to stir overnight at room temperature. Once the reaction was
confirmed complete by TLC analysis, the mixture was passed through a filter with 5 g of celite.
The filtrate was collected and concentrated under reduced pressure. To the crude product, 35 mL
of CH2Cl2 and 3.0 g of silica was added. The volatile compounds were removed in vacuo, and the
silica powder was placed on a column. The crude product mixture was purified using flash column
chromatography on silica gel (isocratic, ethyl acetate:hexanes, 10%, 20 minutes) to afford 44 as a
white solid: 621 mg, 28% yield; 1H NMR (CDCl3) δ 1.46 (s, 9 H), 1.68 (m, J=3.4 Hz, 2 H), 1.88 -
2.00 (m, 1 H), 2.40 - 2.47 (m, 1 H), 3.06 - 3.13 (m, 1 H), 3.30 - 3.41 (m, 1 H), 3.64 (m, J=12.8 Hz,
1 H), 3.85 - 4.01 (m, 2 H), 9.70 (s, 1 H); 13C NMR (CDCl3) δ 202.5, 79.8, 54.9, 50.5, 47.9, 42.3,
28.4, 24.2, 23.7.
tert-Butyl 3-(3-ethoxy-3-oxopropanoyl)piperidine-1-carboxylate (46): To a flame dried RBF
containing 44 (196 mg, 0.919 mmol) in 5 mL anhydrous tetrahydrofuran, was added Wilkinson’s
catalyst (43 mg, 46 µmol), and ethyl bromoacetate 45 (0.101 mL, 0.919 mmol). The reaction
mixture was then cooled to 0oC, and diethyl zinc (2.02 mL, 2.02 mmol, 1 M in hexanes) was
added drip-wise, and the mixture was allowed to stir for an additional 10 minutes at 0oC. Once the
reaction was confirmed complete by TLC analysis, the reaction is quenched by the addition of
saturated sodium bicarbonate solution (10 mL), and was subsequently extracted with ethyl acetate
(2 x 10 mL). The organic layers were combined, washed with saturated brine solution (15 mL),
dried over magnesium sulfate, and concentrated in vacuo. To the remaining residue was added 10
mL CH2Cl2 and 0.5 g silica, and the volatile compounds were removed in vacuo. The resulting
white silica powder was placed on a column, and purified via flash chromatography on silica gel
(isocratic, ethyl acetate:hexanes, 20% over 20 minutes) to afford intermediate tert-butyl 3-(3-
81
ethoxy-1-hydroxy-3-oxopropyl)piperidine-1-carboxylate as a white solid: 203 mg, 73% yield; 1H NMR (CDCl3) δ 1.19 (t, J=1.0 Hz, 3 H), 1.38 (s, 9 H), 1.41 - 1.50 (m, 1 H), 1.53 - 1.69 (m, 1
H), 2.34 - 2.47 (m, 2 H), 2.50 (m, J=3.0 Hz, 1 H), 2.64 - 2.86 (m, 2 H), 3.18 (m, J=4.0 Hz, 1 H),
3.78 - 3.81 (m, 1 H), 4.10 (q, J=7.3 Hz, 2 H); 13C NMR (CDCl3) δ 172.8, 79.4, 60.7, 40.9, 39.0,
28.4, 27.0, 25.2, 24.3, 14.1.
This compound was immediately converted to 46 following characterizations. To a solution of
tert-butyl 3-(3-ethoxy-1-hydroxy-3-oxopropyl)piperidine-1-carboxylate (109 mg, 0.361 mmol) in
5 mL anhydrous CH2Cl2, is added Dess-Martin periodinane (169 mg, 0.397 mmol) at 0oC. The
mixture was then allowed to stir at room temperature for 30 minutes. The reaction is then
quenched by the addition of sodium thiosulfate (400 mg) in 15 mL of saturated sodium
bicarbonate solution, and was allowed to stir for an additional 10 minutes. The mixture was then
extracted with dichloromethane (2 x 10 mL), dried over magnesium sulfate, and concentrated in
vacuo. To the remaining residue was added 15 mL CH2Cl2 and 0.35 g silica, and the volatile
compounds were removed in vacuo. The resulting white silica powder was placed on a column,
and purified via flash chromatography on silica gel (isocratic, ethyl acetate:hexanes, 10% over 20
minutes) to afford 46 as a white solid: 100 mg, 96% yield; 1H NMR (CDCl3) δ 0.78 – 0.81 (m, 1
H), 1.21 (t, J=7.2 Hz, 3 H), 1.39 (s, 9 H), 1.53 (m, J=10.0 Hz, 1 H), 1.59 - 1.75 (m, 1 H), 1.77 -
2.00 (m, 1 H), 2.41 - 2.66 (m, 1 H), 2.67 - 2.86 (m, 1 H), 2.87 - 3.03 (m, 1 H), 3.45 (s, 2 H), 3.80
(br. s., 1 H), 4.00 (br. s., 1 H), 4.13 (q, J=7.0 Hz, 2 H); 13C NMR (CDCl3) δ 203.6, 167.0, 88.6,
79.8, 61.4, 60.1, 48.5, 47.8, 41.6, 28.4, 24.1, 14.2.
6-(Piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (48): This compound was synthesized from 46
(821 mg, 2.74 mmol) and 4-amidinopyridine hydrochloride 47 (540 mg, 3.43 mmol) using the
same procedure outlined for compound 39. To the remaining residue was added 20 mL CH2Cl2
and 2.0 g silica, and the volatile compounds were removed in vacuo. The resulting yellow silica
powder was placed on a column, and purified via flash chromatography on silica gel (gradient,
methanol:dichloromethane, 0% to 20% over 30 minutes), to afford boc-protected intermediate tert-
butyl 3-(6-hydroxy-2-(pyridin-4-yl)pyrimidin-4-yl)piperidine-1-carboxylate as light yellow
crystals: 421 mg, 46% yield; 1H NMR (CDCl3) δ 1.22 - 1.36 (m, 1 H), 1.48 (s, 9 H), 1.56 - 1.68
(m, 1 H), 1.79 (m, J=12.8 Hz, 1 H), 2.04 - 2.13 (m, 1 H), 2.68 - 2.81 (m, 1 H), 2.83 - 2.99 (m, 1
H), 2.99 - 3.20 (m, 1 H), 4.05 - 4.09 (m, 1 H), 4.17 - 4.50 (m, 1 H), 6.47 (s, 1 H), 8.21 (d, J=5.5
82
Hz, 2 H), 8.85 (d, J=5.3 Hz, 2 H), 13.71 (br. s., 1 H); 13C NMR (CDCl3) δ 170.2, 165.6, 154.5,
150.6, 139.5, 121.4, 111.2, 79.7, 43.3, 29.3, 28.4. Next, tert-butyl 3-(6-hydroxy-2-(pyridin-4-
yl)pyrimidin-4-yl)piperidine-1-carboxylate (122 mg, 0.342 mmol) was suspended in 3 mL of
trifluoroacetic acid/dichloromethane (1:4), and allowed to stir at room temperature for 1 hour.
Once complete, the solvent was removed in vacuo to afford 48 as a light yellow solid: 87 mg,
quantitative yields; 1H NMR (MeOD-d4) δ 1.24 (m, J=17.1 Hz, 1 H), 1.81 - 2.03 (m, 1 H), 2.03 -
2.12 (m, 1 H), 2.19 (m, J=8.5 Hz, 1 H), 2.90 - 3.16 (m, 1 H), 3.21 - 3.36 (m, 2 H), 3.38 - 3.50 (m,
1 H), 3.66 (m, J=12.3 Hz, 1 H), 6.80 (s, 1 H), 8.94 (d, J=1.0 Hz, 2 H), 9.00 (d, J=1.0 Hz, 2 H); 13C
NMR (MeOD-d4) δ 170.1, 159.8, 157.9, 152.9, 142.1, 125.2, 117.0, 114.2, 107.0, 46.4, 43.7, 40.1,
27.7, 26.3, 21.6.
4-(Benzyloxy)-3-methoxybenzaldehyde (50): To a suspension of vanillin 49 (2.57 g, 16.92
mmol), in 25 mL of anhydrous N,N-dimethylformamide, was added benzyl bromide (2.07 mL,
17.43 mmol) slowly, followed by potassium carbonate (5.61 g, 40.60 mmol), and was rapidly
stirred for 2 hours. Once the reaction was confirmed complete by TLC analysis, the mixture was
partitioned into diethyl ether/water (1:1, 100 mL), and stirred for 5 minutes. The organic and
aqueous layers were separated, and the aqueous layer was extracted with diethyl ether (3 x 35 mL).
The combined organic layers were washed with water (50 mL), saturated brine solution (50 mL),
dried over magnesium sulfate, and concentrated, after washing with hexanes (40 mL), and
refiltering the filtrate, to afford 50 as a white solid: 3.90 g, 95% yield; 1H NMR (CDCl3) δ 3.90
(s, 3 H), 5.20 (s, 2 H), 6.96 (d, J=8.3 Hz, 1 H), 7.26 - 7.33 (m, 1 H), 7.33 - 7.39 (m, 3 H), 7.39 -
7.46 (m, 3 H), 9.81 (s, 1 H); 13C NMR (CDCl3) δ 190.9, 153.6, 150.1, 136.0, 130.3, 128.7, 128.2,
127.2, 126.5, 112.4, 109.4, 70.8, 56.0.
(4-(Benzyloxy)-3-methoxyphenyl)methanol (51): This compound was synthesized from 50 (3.50
g, 14.45 mmol), and sodium borohydride (1.37 g, 36.12 mmol) in 25 mL of anhydrous methanol
using the same procedure outlined for compound 56, to afford 51 as a white crystalline solid:
3.49g, 97% yield; 1H NMR (CDCl3) δ 3.88 (s, 3 H), 4.58 (d, J=5.3 Hz, 2 H), 5.14 (s, 2 H), 6.76 -
6.87 (m, 2 H), 6.93 (s, 1 H), 7.24 - 7.32 (m, 1 H), 7.35 (t, J=7.5 Hz, 2 H), 7.40 - 7.45 (m, 2 H); 13C
NMR (CDCl3) δ 149.8, 147.7, 137.1, 134.2, 128.5, 127.8, 127.3, 119.3, 114.0, 111.0, 71.1, 65.3,
56.0.
83
1-(Benzyloxy)-4-(bromomethyl)-2-methoxybenzene (52): This compound was synthesized from
51 (2.88 g, 11.81 mmol), carbon tetrabromide (5.87 g, 17.71 mmol), and triphenylphosphine (3.72
g, 14.71 mmol) in 20 mL of anhydrous CH2Cl2, following the same protocol outlined for
compound 41, to afford 52 as a white solid: 1.80 g, 49% yield; 1H NMR (CDCl3) δ 3.87 (s, 3 H),
4.45 (s, 2 H), 5.12 (s, 2 H), 6.79 (d, J=8.0 Hz, 1 H), 6.83 - 6.87 (m, 1 H), 6.90 - 6.92 (m, 1 H), 7.25
- 7.31 (m, 1 H), 7.34 (t, J=7.5 Hz, 2 H), 7.38 - 7.43 (m, 2 H); 13C NMR (CDCl3) δ 149.7, 148.4,
136.9, 130.7, 128.6, 127.9, 127.3, 121.5, 113.7, 112.7, 71.0, 56.0, 34.4.
6-(1-(4-(Benzyloxy)-3-methoxybenzyl)piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (53):
This compound was synthesized from 48 (87 mg, 0.34 mmol) and 52 (120 mg, 0.390 mmol) using
the same procedure outlined for compounds KP-156 (17a) and KP-172 (17b). To the remaining
residue was added 0.8 mL CH2Cl2 and was directly placed into a column, and purified via flash
chromatography on silica gel (gradient, methanol:dichloromethane, 0% to 20% over 30 minutes),
to afford 53 as a white solid: 45 mg, 27% yield; 1H NMR (CDCl3) δ 1.11 - 1.38 (m, 1 H), 1.61
(br. s., 1 H), 1.80 (br. s., 2 H), 2.00 (m, J=11.3 Hz, 1 H), 2.17 (br. s., 1 H), 2.36 (br. s., 1 H), 3.17
(br. s., 1 H), 3.47 (s, 2 H), 3.54 - 3.72 (m, 1 H), 3.87 (s, 3 H), 5.13 (s, 2 H), 6.40 (br. s., 1 H), 6.79
(m, J=8.1, 8.1, 8.1 Hz, 2 H), 6.98 (s, 1 H), 7.25 - 7.31 (m, 1 H), 7.35 (t, J=7.4 Hz, 2 H), 7.42 (d,
J=1.0 Hz, 2 H), 8.11 (d, J=4.5 Hz, 2 H), 8.81 (d, J=1.0 Hz, 2 H); 13C NMR (CDCl3) δ 150.7,
149.7, 137.1, 128.5, 127.8, 127.2, 121.4, 113.6, 113.0, 71.1, 56.0.
6-(1-(4-Hydroxy-3-methoxybenzyl)piperidin-3-yl)-2-(pyridin-4-yl)pyrimidin-4-ol (KP-162):
To a flamed dried RBF was added 53 (15 mg, 31.1 µmol) and palladium on carbon (3.31 mg, 3.11
µmol) in 2 mL of anhydrous methanol. The reaction vessel was sealed, and flushed several times
with hydrogen, before being subjected to hydrogen atmosphere for 48 h. Once the reaction was
confirmed complete by TLC analysis, the reaction mixture was filtered, and washed with methanol
(15 mL). The filtrate was collected and concentrated to afford an off-white solid. To the crude
mixture was added 0.7 mL CH2Cl2, and was added directly subjected to flash column
chromatography (gradient, methanol:dichloromethane, 5% to 20% over 35 minutes), to afford KP-
162 as a white solid: 12 mg, 98% yield; 1H NMR (MeOD-d4) δ 1.75 - 1.94 (m, 2 H), 1.94 - 2.04
(m, 1 H), 2.08 (d, J=13.3 Hz, 1 H), 2.81 (br. s., 1 H), 2.99 - 3.10 (m, 2 H), 3.29 (d, J=12.5 Hz, 1
H), 3.46 (d, J=7.8 Hz, 1 H), 3.77 - 3.84 (m, 3 H), 4.03 (s, 2 H), 6.32 (s, 1 H), 6.82 (d, J=8.0 Hz, 1
H), 6.89 (dd, J=8.2, 1.4 Hz, 1 H), 7.05 (s, 1 H), 8.05 (d, J=5.5 Hz, 2 H), 8.65 (d, J=5.5 Hz, 2 H);
84
13C NMR (DMSO-d6,) δ 150.7, 147.8, 145.9, 129.5, 122.0, 119.5, 115.5, 113.4, 111.5, 63.4, 62.8,
57.8, 56.0, 53.5, 49.1, 43.4, 29.2, 24.9; λmax (nm) 201.4, 224.4, 279.4.
85
CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS
The molecular design approach was applied in small molecule agonist design, for two different
receptor systems: (i) type I interferon-α/β-receptor (IFNAR), a heterodimeric cell-surface
transmembrane receptor; and (ii) the vitamin D receptor (VDR), a nuclear membrane bound
receptor. The first project focused on mimicking the protein-protein interactions between type I
IFN and IFNAR, using a small molecule agonist. By using the core bis-phenyltetrazole scaffold of
hit compound 2, a library of 18 compounds were synthesized, and evaluated for potential IFN-like
activity. All compounds were evaluated for their antiviral activities, which is a functional end
point, followed by testing for Tyk2 phosphorylation and induction of IFN-inducible genes.
Compound 4e demonstrated antiviral activity against EMCV with an EC50 of 0.5 ± 0.2 µM. This
compound was also shown to induce Tyk2 phosphorylation, as well as induce IFN-inducible genes
(PKR, OAS1, and ISG15). Results from surface plasmon resonance (SPR) studies indicate 4e
directly binds to IFNAR2, confirming binding interaction between 4e and IFNAR. Future studies
will be focused on structure-activity relationships to better understand how 4e interacts with
IFNAR, allowing for rational structural modifications to improve the binding affinity to IFNAR.
The second project investigated non-secosteroidal VDR agonists, with potential applications in
managing patients with hypercholesterolemia. KP-156, KP-162, and KP-172 were lead
compounds obtained through previous in silico screenings by the Kotra group, and were
subsequently resynthesized in house to confirm the observed VDR agonism. Each lead compound
possessed a core tri-substituted pyrimidine scaffold, of which the synthetic route has not been
reported. As such, an extensive investigation into the synthesis of these compounds led to the
formation of a novel synthetic route, involving a key cyclization between 3-ketoesters and
amidines. KP-156, KP-162, and KP-172 were synthesized according to this protocol. These
compounds were subsequently sent to collaborators to confirm VDR agonism, and the results are
to be obtained in the near future.
While these two projects differ in receptor systems, the end goal of small molecule agonist
discovery remains synonymous between them. Each project aims to develop a small molecule
agonist, to circumvent the issues associated with the endogenous ligands. For IFNAR, IFN-α2a is
a clinically relevant therapeutic, particularly in HCV treatment. Limitations associated with this
86
are pharmacokinetic and fiscal barriers. For VDR and its endogenous ligand calcitriol
(ROCALTROL®), the current clinical indications for ROCALTROL® include the management of
hypocalcemia and its clinical manifestations in patients with hypoparathyroidism.55 It is also
indicated in the management of secondary hypoparathyroidism and resultant metabolic bone
disease in patients with chronic renal failure (both predialysis and dialysis patients).56 One of the
major limitations of calcitriol treatment is the hypercalcemic effects associated with it.57 For both
of these receptor systems, and the limitations associated with their endogenous ligands, these
projects both aim to develop a small molecule agonist to potentially circumvent these issues.
To date, only a limited number of IFNAR small molecule agonists have been reported. In 2012,
Sudoh and colleagues reported an orally available, small molecule IFN agonist that was shown to
inhibit viral replication, and bind to IFNAR2.74 More recently, Kotra, Fish, and colleagues used
key residues of IRRP-1 (Leu30, Arg33, and Asp35) to derive 11 chemical compounds that belong
to 5 distinct chemotypes.33 Three compounds displayed potential mimicry to IRRP-1, and were
shown to inhibit IFNAR activation by IFN-α. In the current work, compound 4e demonstrated
IFN-like activity through antiviral protection, Tyk2 phosphorylation, induction of IFN-inducible
genes (PKR, OAS1, and ISG15), and SPR confirmation of IFNAR2 binding, highlighting the
importance of these findings.
While analogues of calcitriol have been developed with reduced hypercalcemic effects –
paricalcitol (ZEMPLAR®) and doxercalciferol (HECTOROL®) – subsequent dose-limiting
hypercalcemia still remains.58, 59 A variety of non-secosteroidal 1,25D analogues have been
developed with no associated hypercalcemic effects, while maintaining the ability to induce
VDR.62 However, poor efficacy and potency of these compounds have resulted in clinical trial
failures.42 Currently, there are new non-secosteroidal VDR agonists emerging that demonstrate
VDR agonism in vitro.60 Further studies are required to investigate the therapeutic potential of
these compounds in animal models, and ultimately humans. The lead compounds KP-156, KP-
162, and KP-172 highlight non-secosteroidal VDR agonists with potential future applications in
hypercholesterolemia treatment. While these compounds are to be evaluated for biological
activities, one of the most significant achievements in this project was the development of a novel
synthetic route for two specific tri-substituted pyrimidine scaffolds, of which, have not been
87
reported to date. This synthetic route offers the ability for the re-synthesis of vendor purchased
compounds, but also allows access to develop large compound libraries.
The results obtained demonstrated the effectiveness of the molecular design approach in
developing small molecule agonists for two different receptor systems, IFNAR and VDR. For the
IFNAR project, future research should be aimed at understanding which residues 4e is interacting
with, which will allow for focused structural modifications to improve its binding affinity to
IFNAR. Computational modellings can investigate these SAR studies, to better our understanding
where 4e is interacting between IFNAR1 and IFNAR2. This same approach should be utilized in
future work in VDR agonists. It is known that 4-pyridyl in KP-156, KP-162, and KP-172 is critical
for VDR agonism (whereas 3-,and 2-pyridyl eliminate agonist activity). Thus, future investigations
should focus on which elements in the pyrimidine scaffold are also critical for activity. Modulating
substituted phenyls is an initial approach, as well as changing the 1,3-piperdinyl moiety to
potentially a 1,4-piperidinyl or 1,4-piperazine, to determine which geometry is critical for agonist
activity. However, as an initial starting point, computation modellings should be utilized to
determine preliminary critical elements, facilitating rational structural modifications in the future.
In summary, the molecular design approach for small molecular agonist design was applied to two
different receptor systems: (i) IFNAR; and (ii) VDR. The effectiveness of this approach is
exemplified by the successful lead candidates coming from each project (4e for IFNAR; KP-156,
KP-162, and KP-172 for VDR). As a result, it is evident that this approach can be applied to a
variety of receptor systems, with different cellular localizations and ligands (proteinaceous or
small molecule) for future small molecule agonist drug discovery efforts.
88
10. REFERENCES
1. de Weerd, N. A.; Nguyen, T. The interferons and their receptors—distribution and regulation. Immunology and Cell Biology 2012, 90, 483-491. 2. Stark, G. R.; Kerr, I. M.; Williams, B. R.; Silverman, R. H.; Schreiber, R. D. How cells respond to interferons. Annual Review of Biochemistry 1998, 67, 227-264. 3. Gad, H. H.; Dellgren, C.; Hamming, O. J.; Vends, S.; Paludan, S. R.; Hartmann, R. Interferon-λ is functionally an interferon but structurally related to the interleukin-10 family. Journal of Biological Chemistry 2009, 284, 20869-20875. 4. Pestka, S.; Krause, C. D.; Walter, M. R. Interferons, interferon-‐like cytokines, and their receptors. Immunological Reviews 2004, 202, 8-32. 5. González-Navajas, J. M.; Lee, J.; David, M.; Raz, E. Immunomodulatory functions of type I interferons. Nature Reviews Immunology 2012, 12, 125-135. 6. Iwasaki, A.; Medzhitov, R. Toll-like receptor control of the adaptive immune responses. Nature Immunology 2004, 5, 987-995. 7. Leonard, W. J.; O'Shea, J. J. JAKs and STATs: biological implications. Annual Review of Immunology 1998, 16, 293-322. 8. Casanova, J.-L.; Holland, S. M.; Notarangelo, L. D. Inborn errors of human JAKs and STATs. Immunity 2012, 36, 515-528. 9. O'Shea, J. J.; Holland, S. M.; Staudt, L. M. JAKs and STATs in immunity, immunodeficiency, and cancer. New England Journal of Medicine 2013, 368, 161-170. 10. Minegishi, Y.; Saito, M.; Morio, T.; Watanabe, K.; Agematsu, K.; Tsuchiya, S.; Takada, H.; Hara, T.; Kawamura, N.; Ariga, T. Human tyrosine kinase 2 deficiency reveals its requisite roles in multiple cytokine signals involved in innate and acquired immunity. Immunity 2006, 25, 745-755. 11. Kumaran, J.; Wei, L.; Kotra, L. P.; Fish, E. N. A structural basis for interferon-alpha-receptor interactions. FASEB J 2007, 21, 3288-96. 12. Bello, A. M.; Bende, T.; Wei, L.; Wang, X.; Majchrzak-Kita, B.; Fish, E. N.; Kotra, L. P. De novo design of nonpeptidic compounds targeting the interactions between interferon-α and its cognate cell surface receptor. Journal of Medicinal Chemistry 2008, 51, 2734-2743. 13. Jonasch, E.; Haluska, F. G. Interferon in oncological practice: review of interferon biology, clinical applications, and toxicities. The Oncologist 2001, 6, 34-55. 14. Platanias, L. C. Mechanisms of type-I-and type-II-interferon-mediated signalling. Nature Reviews Immunology 2005, 5, 375-386. 15. Hervas-Stubbs, S.; Perez-Gracia, J. L.; Rouzaut, A.; Sanmamed, M. F.; Le Bon, A.; Melero, I. Direct effects of type I interferons on cells of the immune system. Clinical Cancer Research 2011, 17, 2619-2627. 16. Wang, B. X.; Platanias, L. C.; Fish, E. N. STAT activation in malignancies: roles in tumor progression and in the generation of antineoplastic effects of IFNs. Journal of Interferon & Cytokine Research 2013, 33, 181-188. 17. Weiss, K. Safety profile of interferon-alpha therapy. Seminars in Oncology 1998, 8, 9-13. 18. Fried, M. W.; Shiffman, M. L.; Reddy, K. R.; Smith, C.; Marinos, G.; Gonçales Jr, F. L.; Häussinger, D.; Diago, M.; Carosi, G.; Dhumeaux, D. Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. New England Journal of Medicine 2002, 347, 975-982. 19. Glue, P.; Fang, J. W.; Rouzier-Panis, R.; Raffanel, C.; Sabo, R.; Gupta, S. K.; Salfi, M.; Jacobs, S. Pegylated interferon-α2b: Pharmacokinetics, pharmacodynamics, safety, and preliminary efficacy data. Clinical Pharmacology & Therapeutics 2000, 68, 556-567.
89
20. Erickson, A. K.; Seiwert, S.; Gale Jr, M. Antiviral potency analysis and functional comparison of consensus interferon, interferon-alpha2a and pegylated interferon-alpha2b against hepatitis C virus infection. Antiviral Therapy 2008, 13, 851. 21. Jesus Perez de Vega, M.; Martín-Martínez, M.; González-Muñiz, R. Modulation of protein-protein interactions by stabilizing/mimicking protein secondary structure elements. Current Topics in Medicinal Chemistry 2007, 7, 33-62. 22. Archakov, A. I.; Govorun, V. M.; Dubanov, A. V.; Ivanov, Y. D.; Veselovsky, A. V.; Lewi, P.; Janssen, P. Protein-‐protein interactions as a target for drugs in proteomics. Proteomics 2003, 3, 380-391. 23. Veselovsky, A.; Ivanov, Y. D.; Ivanov, A.; Archakov, A.; Lewi, P.; Janssen, P. Protein–protein interactions: mechanisms and modification by drugs. Journal of Molecular Recognition 2002, 15, 405-422. 24. Wills, R. J. Clinical pharmacokinetics of interferons. Clinical Pharmacokinetics 1990, 19, 390-399. 25. Zhang, Q.; Bai, G.; Tian, W.; Cao, Y.; Wang, C. Identification of antiviral mimetic peptides with interferon α-‐2b-‐like activity from a random peptide library using a novel functional biopanning method1. Acta Pharmacologica Sinica 2008, 29, 634-640. 26. Sato, A.; Sone, S. A peptide mimetic of human interferon (IFN)-beta. Journal of Biochemistry 3, 371, 603-608. 27. Ahmed, C. M.; Burkhart, M. A.; Subramaniam, P. S.; Mujtaba, M. G.; Johnson, H. M. Peptide mimetics of gamma interferon possess antiviral properties against vaccinia virus and other viruses in the presence of poxvirus B8R protein. Journal of Virology 2005, 79, 5632-5639. 28. Fish, E. N. Definition of receptor binding domains in interferon-α. Journal of Interferon Research 1992, 12, 257-266. 29. Korn, A. P.; Rose, D. R.; Fish, E. N. Three-dimensional model of a human interferon-α consensus sequence. Journal of Interferon Research 1994, 14, 1-9. 30. Fish, E. Interferon receptor recognition peptides enhance the biological potency of interferon alphas. FEBS Letters 1995, 365, 87-91. 31. Kumaran, J.; Wei, L.; Kotra, L. P.; Fish, E. N. A structural basis for interferon-α-receptor interactions. The FASEB Journal 2007, 21, 3288-3296. 32. Bello, A. M.; Bende, T.; Wei, L.; Wang, X.; Majchrzak-Kita, B.; Fish, E. N.; Kotra, L. P. De novo design of nonpeptidic compounds targeting the interactions between interferon-alpha and its cognate cell surface receptor. Journal of Medicinal Chemistry 2008, 51, 2734-43. 33. Angelica M. Bello, L. W., Beata Majchrzak-Kita, Noruê Salum, Meena K. Purohit,; Eleanor N. Fish, L. P. K. Small molecule mimetics of an interferon-α receptor interacting domain. Bioorganic & Medicinal Chemistry 2014, 22, 8. 34. Singh, H.; Chawla, A. S.; Kapoor, V. K.; Paul, D.; Malhotra, R. K. 4 Medicinal chemistry of tetrazoles. Progress in Medicinal Chemistry 1980, 17, 151-183. 35. Demko, Z. P.; Sharpless, K. B. Preparation of 5-substituted 1 H-tetrazoles from nitriles in water. The Journal of Organic Chemistry 2001, 66, 7945-7950. 36. Finnegan, W. G.; Henry, R. A.; Lofquist, R. An improved synthesis of 5-substituted tetrazoles. Journal of the American Chemical Society 1958, 80, 3908-3911. 37. Jursic, B. S.; Zdravkovski, Z. Semiempirical and ab initio study of 1, 3-dipolar addition of azide anion to organic cyanides. Journal of Molecular Structure: THEOCHEM 1994, 312, 11-22.
90
38. Himo, F.; Demko, Z. P.; Noodleman, L.; Sharpless, K. B. Mechanisms of tetrazole formation by addition of azide to nitriles. Journal of the American Chemical Society 2002, 124, 12210-12216. 39. Cantillo, D.; Gutmann, B.; Kappe, C. O. Mechanistic Insights on Azide− Nitrile Cycloadditions: On the Dialkyltin Oxide− Trimethylsilyl Azide Route and a New Vilsmeier− Haack-Type Organocatalyst. Journal of the American Chemical Society 2011, 133, 4465-4475. 40. Heravi, M. M.; Fazeli, A.; Oskooie, H. A.; Beheshtiha, Y. S.; Valizadeh, H. Click Synthesis of 5-Substituted 1H-Tetrazoles from Aldehydes, Hydroxylamine, and [bmim] N3 via One-Pot, Three-Component Reaction. Synlett 2012, 23, 2927-2930. 41. Butler, R. N.; Garvin, V. C. A study of annular tautomerism, interannular conjugation, and methylation reactions of ortho-substituted-5-aryltetrazoles using carbon-13 and hydrogen-1 nmr Spectroscopy. Journal of Chemical Society Perkin Trans. 1981, 1, 390-393. 42. Deeb, K. K.; Trump, D. L.; Johnson, C. S. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nature Reviews Cancer 2007, 7, 684-700. 43. Mangelsdorf, D. J.; Thummel, C.; Beato, M.; Herrlich, P.; Schütz, G.; Umesono, K.; Blumberg, B.; Kastner, P.; Mark, M.; Chambon, P. The nuclear receptor superfamily: the second decade. Cell 1995, 83, 835-839. 44. Haussler, M. R.; Whitfield, G. K.; Haussler, C. A.; Hsieh, J. C.; Thompson, P. D.; Selznick, S. H.; Dominguez, C. E.; Jurutka, P. W. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. Journal of Bone and Mineral Research 1998, 13, 325-349. 45. White, J. H. Vitamin D signaling, infectious diseases, and regulation of innate immunity. Infection and Immunity 2008, 76, 3837-3843. 46. Lin, R.; Nagai, Y.; Sladek, R.; Bastien, Y.; Ho, J.; Petrecca, K.; Sotiropoulou, G.; Diamandis, E. P.; Hudson, T. J.; White, J. H. Expression profiling in squamous carcinoma cells reveals pleiotropic effects of vitamin D3 analog EB1089 signaling on cell proliferation, differentiation, and immune system regulation. Molecular Endocrinology 2002, 16, 1243-1256. 47. Yamada, S.; Shimizu, M.; Yamamoto, K. Structure–function relationships of vitamin D including ligand recognition by the vitamin D receptor. Medicinal Research Reviews 2003, 23, 89-115. 48. Havinga, E. Vitamin D, example and challenge. Experientia 1973, 29, 1181-1193. 49. Blunt, J.; DeLuca, H. F.; Schnoes, H. 25-hydroxycholecalciferol. A biologically active metabolite of vitamin D3. Biochemistry 1968, 7, 3317-3322. 50. Ohyama, Y.; Hayashi, S.-i.; Okuda, K. Purification of 25-hydroxyvitamin D3 24-hydroxylase from rat kidney mitochondria. FEBS Letters 1989, 255, 405-408. 51. Chen, K.-S.; Prahl, J. M.; DeLuca, H. F. Isolation and expression of human 1, 25-dihydroxyvitamin D3 24-hydroxylase cDNA. Proceedings of the National Academy of Sciences 1993, 90, 4543-4547. 52. Chow, E. C.; Magomedova, L.; Quach, H. P.; Patel, R.; Durk, M. R.; Fan, J.; Maeng, H.-J.; Irondi, K.; Anakk, S.; Moore, D. D. Vitamin D receptor activation down-regulates the small heterodimer partner and increases CYP7A1 to lower cholesterol. Gastroenterology 2014, 146, 1048-1059. 53. Chiang, J. Y. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. Journal of hepatology 2004, 40, 539-551. 54. Lu, T. T.; Makishima, M.; Repa, J. J.; Schoonjans, K.; Kerr, T. A.; Auwerx, J.; Mangelsdorf, D. J. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Molecular Cell 2000, 6, 507-515.
91
55. Malek, M.; Fakharian, M. Treatment result with rocaltrol pulse among patient with secondary hyperparathyroidism in hemodialysis ward. Journal of Babol University of Medical Sciences 2004, 6, 24-30. 56. Winer, K. K.; Ko, C. W.; Reynolds, J. C.; Dowdy, K.; Keil, M.; Peterson, D.; Gerber, L. H.; McGarvey, C.; Cutler Jr, G. B. Long-term treatment of hypoparathyroidism: a randomized controlled study comparing parathyroid hormone-(1–34) versus calcitriol and calcium. The Journal of Clinical Endocrinology & Metabolism 2003, 88, 4214-4220. 57. Sprague, S. M.; Llach, F.; Amdahl, M.; Taccetta, C.; Batlle, D. Paricalcitol versus calcitriol in the treatment of secondary hyperparathyroidism. Kidney International 2003, 63, 1483-1490. 58. Lindberg, J. S. New Vitamin D analogs. Seminars in Dialysis 2001, 1, 229-230. 59. St-Arnaud, R.; Arabian, A.; Akhouayri, O.; Knutson, J. C.; Strugnell, S. A. Differential effects of oral doxercalciferol (Hectorol®) or paricalcitol (Zemplar®) in the Cyp27b1-null mouse model of uremia. Nephron Experimental Nephrology 2011, 119, 67-74. 60. Fischer, J.; Wang, T.-T.; Kaldre, D.; Rochel, N.; Moras, D.; White, J. H.; Gleason, J. L. Synthetically accessible non-secosteroidal hybrid molecules combining vitamin D receptor agonism and histone deacetylase inhibition. Chemistry & Biology 2012, 19, 963-971. 61. Asano, L.; Ito, I.; Kuwabara, N.; Waku, T.; Yanagisawa, J.; Miyachi, H.; Shimizu, T. Structural basis for vitamin D receptor agonism by novel non-secosteroidal ligands. FEBS Letters 2013, 587, 957-963. 62. Eelen, G.; Gysemans, C.; Verlinden, L.; Vanoirbeek, E.; De Clercq, P.; Van Haver, D.; Mathieu, C.; Bouillon, R.; Verstuyf, A. Mechanism and potential of the growth-inhibitory actions of vitamin D and analogs. Current Medicinal Chemistry 2007, 14, 1893-1910. 63. Zhan, C.; Léger, J. M.; Huc, I. Cross-‐Hybridization of Pyridinedicarboxamide Helical Strands and Their N-‐Oxides. Angewandte Chemie International Edition 2006, 45, 4625-4628. 64. Kelly, T. R.; Wei, X.; Sundaresan, J. Maxonine: structure correction and synthesis. Tetrahedron Letters 1993, 34, 6173-6176. 65. Neidlein, R.; Menche, G. Synthese von 3.4-‐sowie 4-‐Substituierten Uracilen und Thiouracilen. Archive der Pharmazie 1972, 305, 596-601. 66. Mojtahedi, M. M.; Saidi, M. R.; Shirzi, J. S.; Bolourtchian, M. Microwave promoted efficient synthesis of substituted uracils and thiouracils under solvent-free conditions. Synthetic Communications 2002, 32, 851-855. 67. Burgula, L. N.; Radhakrishnan, K.; Kundu, L. M. Synthesis of modified uracil and cytosine nucleobases using a microwave-assisted method. Tetrahedron Letters 2012, 53, 2639-2642. 68. Molander, G. A.; Argintaru, O. A.; Aron, I.; Dreher, S. D. Nickel-Catalyzed Cross-Coupling of Potassium Aryl-and Heteroaryltrifluoroborates with Unactivated Alkyl Halides. Organic Letters 2010, 12, 5783-5785. 69. Li, G. Y. Highly Active, Air-Stable Palladium Catalysts for the CC and CS Bond-Forming Reactions of Vinyl and Aryl Chlorides: Use of Commercially Available [(t-Bu)2P(OH)]2PdCl2,[(t-Bu)2P(OH)PdCl2]2, and [[(t-Bu)2PO·H·OP(t-Bu)2]PdCl]2 as Catalysts. The Journal of Organic Chemistry 2002, 67, 3643-3650. 70. Khanapure, S. P.; Garvey, D. S. Use of highly reactive, versatile and air-stable Palladium-phosphinous acid complex [(t-Bu)2P(OH)]2PdCl2(POPd) as a catalyst for the optimized Suzuki-Miyaura cross-coupling of less reactive heteroaryl chlorides and arylboronic acids. Tetrahedron Letters 2004, 45, 567-577.
92
71. Cheng, C.; Shih, Y.-C.; Chen, H.-T.; Chien, T.-C. Regioselective arylation of uracil and 4-pyridone derivatives via copper(I) bromide mediated C–H bond activation. Tetrahedron 2013, 69, 1387-1396. 72. Kamei, K.; Maeda, N.; Katsuragi-Ogino, R.; Koyama, M.; Nakajima, M.; Tatsuoka, T.; Ohno, T.; Inoue, T. New piperidinyl-and 1, 2, 3, 6-tetrahydropyridinyl-pyrimidine derivatives as selective 5-HT receptor agonists with highly potent anti-ischemic effects. Bioorganic & Medicinal Chemistry Letters 2005, 15, 2990-2993. 73. Kataoka, K.; Kosugi, T.; Ishii, T.; Takeuchi, T.; Tsutsumi, T.; Nakano, A.; Unoki, G.; Yamamoto, M.; Sakai, Y. Pyrrolopyrimidine derivatives. US Patent 20,050,277,773: 2005. 74. Konishi, H.; Okamoto, K.; Ohmori, Y.; Yoshino, H.; Ohmori, H.; Ashihara, M.; Hirata, Y.; Ohta, A.; Sakamoto, H.; Hada, N. An orally available, small-molecule interferon inhibits viral replication. Scientific Reports 2012, 2, 1-9.
93
11. APPENDIX
Scheme 11. Precursor synthesis for KP-172.
top related